WO2011092362A1

WO2011092362A1 - Method for the genome amplification of the west nile virus

Info

Publication number: WO2011092362A1
Application number: PCT/ES2011/070047
Authority: WO
Inventors: Ana VÁZQUEZ GONZÁLEZ; Antonio Tenorio Matanzo; Ana Isabel NEGREDO ANTÓN
Original assignee: Instituto De Salud Carlos Iii
Priority date: 2010-01-29
Filing date: 2011-01-25
Publication date: 2011-08-04
Also published as: ES2364833A1; ES2364833B1

Abstract

Method for the genome amplification of the West Nile virus. The method is based on the amplification of a zone of the non-encoding region 3' of the virus, preferably by means of Real Time PCR, comprising the use of a pair of minimally degenerate primers, thereby allowing the amplification of the West Nile virus present in a sample from any known lineage. The amplified fragment is preferably detected using a probe specific to the zone, which is also minimally degenerate. The pair of selected degenerate primers, together with the preferred probe, provide high sensitivity in the detection of all lineages, as well as high specificity for the West Nile virus.

Description

VIRUS WEST NILE GENOMIC AMPLIFICATION METHOD

TECHNICAL FIELD

The invention relates to the field of Biotechnology. More specifically, the invention relates to a method that allows real-time genomic amplification of any of the West Nile virus lineages present in a sample and, therefore, facilitates the detection of the presence of the virus in a sample.

BACKGROUND OF THE INVENTION

West Nile virus (WNV) is a positive polarity RNA virus belonging to the Flavivirus genus. This genus includes numerous human-pathogenic and even life-threatening viruses, such as Dengue virus, yellow fever virus or viruses belonging to the Japanese encephalitis virus serogroup, a serogroup to which both West Nile virus belongs. like other closely related viruses such as the Japanese encephalitis virus (JEV) itself, the St. Louis encephalitis virus (SLEV), the Murray Valley encephalitis virus (MVEV) or the Usutu virus (USUV).

Within this subgroup, a complex comprising different evolutionary lineages is known as "West Nile virus" (WNV). A review of the literature leads to the conclusion that there are at least five different lineages, several of them with unknown virulence, and with a difference in nucleotides of 20% between each of them (Bondre et al., J Gen Virol 88: 875-884 (2007)). Recent findings also suggest the existence of more evolutionary lineages: the sequence analysis of a virus grown from a mosquito captured in Malaysia, assigned by the Pasteur Institute to the group of inventors, who carried out the complete sequencing of the genome of said virus in 2006, allowed the identification of a sixth evolutionary lineage; more recently, in Europe itself, specifically in Spain, a strain of West Nile virus could be detected that, although it could not be cultivated, has been partially sequenced, giving results that lead to the conclusion that it is a seventh evolutionary lineage of the virus (data disclosed in the doctoral thesis of Dr. Ana Vázquez González, entitled "Search for flavivirus in Spanish wetland mosquitoes. Molecular analysis of West Nile virus and other flaviviruses", read in December 2008). The West Nile virus is kept in nature in a natural cycle that mainly involves birds and mosquitoes, although humans and horses can also be infected, and can lead to deadly neurological disease. The origin of the virus is African, and has a worldwide distribution (Africa, Asia, Europe, the Middle East, India, Australia and America). Since it was isolated for the first time, outbreaks in humans have been rare, but in recent decades it has gained great importance due to its emergence to new areas, such as its entry and expansion into the Americas and recent epidemics. which has produced in Europe, associated with high levels of neuroinvasive disease and mortality. Until 1999, WNV was distributed exclusively in the Old World, but in that year it was first detected on the American continent in New York City, and from there the virus has been able to spread throughout North America, south from Canada, Central America, Caribbean islands and South America.

Many infected humans have no apparent clinical symptoms, although they may end up developing serious neurological diseases such as meningitis or encephalitis. The development of more moderate symptoms, such as fever, malaise, anorexia, nausea, vomiting, headache, eye discomfort, myalgia, skin rashes and lymphadenopathy, is more common. However, in recent times more virulent variants appear to be appearing, which are turning the virus into a serious problem for public health and that make an early diagnosis of it advisable, to avoid the development of neurological diseases.

The great epidemic outbreak that is affecting America has led to increased interest in the knowledge of the virus, its transmission routes and the means for its detection. Thus, it has been discovered that, in addition to mosquito bites, transmission can also occur through other routes such as blood donation, organ transplantation and breast milk feeding. This has led to US authorities. to study in all donations the possible presence of the WNV genome. In Europe, where strains belonging to at least lineages 1, 2, 3, 4 and 7 appear to circulate, recent outbreaks that have affected virtually all Mediterranean countries have led the European Union to discuss infection control procedures in transplants and donations in the countries of your area of influence and to consider the mandatory analysis of the possible presence of WNV in donations made in European endemic regions.

Since it is not easy to intuit the presence of the virus in an individual, since many WNV carriers are asymptomatic and even, when an active infection occurs, it usually leads to nonspecific symptoms, the systematic checking of the virus is becoming increasingly important. possible presence of the virus in blood samples and organs that can be transplanted. As, normally, the specific antibodies against the virus can be detected only after the viral phase and can even persist for more than a year, making it difficult to distinguish between the situation of active infection and the effects of past exposures, interest in the development of more sensitive methods for virus detection is increasing. Therefore, numerous assays describing genomic amplification methods for the detection of nucleic acids of said virus have been described.

Unfortunately, most of them are targeting the WNV currently circulating in North America, focusing on the detection of virus of lineage 1, without considering the enormous natural variability existing in other parts of the world, with which there are very few methods that consider the need to detect at least a second viral lineage. Moreover, the comparison of the sequences of the primers used demonstrates that, even in the methods developed for strains of lineage 1, there are strains belonging to said lineage that could not be detected by the proposed method.

Thus, for example, Lanciotti et al. (in J Clin. Microbiol.3S: 4066-407 \ (2001)) developed a Real-Time PC assay based on TaqMan probes for the detection of WNV RNA in various samples (both of human origin and obtained from birds or mosquitoes ) which was based on strain NY99, achieving acceptable results for this strain, especially with primers developed for the 3 'Non-Coding Zone (3'NC), but the method is not valid for many other strains of recent lineage outbreaks 1 nor for the other lineages. Subsequent works of the same group (Lanciotti and Kerst, J Clin Microbiol. 39: 4506-45 \ 3 (2001)), managed to improve sensitivity by adapting the methodology to NASBA detection, although the problems of lack of detection capacity of all the lineages subsist. He The same problem exists with the methods that have tried to improve the Lanciotti method by improving the quantification mode (Lo et al., J Virol 77: 10004-10014 (2003)) or the starting samples (Vanlandingham et al., Am J Trop Med Hyg 71: 120-123 (2004)).

On the other hand, many of the methods developed are not totally specific for WNV, but also detect the presence of other serogroup viruses of the Japanese encephalitis virus. Such is the case, for example, of the T-PC method developed by Shirato et al. (Shirato et al., J Virol. Methods 126: 119-125 (2005)), which describes the use of specific primers designed in the area of protein C that allow amplifying lineages I and II of the WNV and the five genotypes of the Japanese encephalitis virus. This method, like several others with similar characteristics, includes a probe, labeled with a fluorochrome, complementary to sequences of the genome of WNV and JEV, which allows the detection of both viruses.

A further improvement that has been introduced in these WNV nucleic acid detection techniques is the incorporation of internal controls (Eisler et al., J Clin. Microbiol 42: 841-843 (2004)) but, in general, the probes designed for their detection they are designed for virus of lineage 1, not being suitable for the rest of the lineages and even strains of lineage 1 exist for which they would not be suitable.

The most frequently used regions for the design of primers for amplification of virus genome fragments and / or probes for detection are those of the 5 'non-coding region, the 3' non-coding region and the corresponding regions to the structural proteins NS1, NS3 and NS5. International patent application WO 2004/036190, for example, describes methods for the detection of West Nile virus in which polynucleotide sequences thereof are amplified and detected. Although, initially, it is indicated in said document that any specific sequence for WNV or other flavivirus can be used for the design of the primers, the specific embodiments described in said document involve the use of primers and probes directed to the non-coding region of '(5 "NC), the non-coding region of 3'(3" NC) or region 3000 (NSl / NS2a region). As is known, it is commented that the degree of amplification observed with a set of primers depends on various factors, among which its length, the ability of oligonucleotides to hybridize with their complementary sequences and the ability of the enzyme to cite polymerize the primers, being determined the stability of the hybrid formed, in general, by the length of the fragment thereof in which perfect pairing occurs between the nucleotides of the complementary chains. The sequence amplification results of the 3TSTC region, for example, with sets of primers specific to that region, demonstrate the difficulty of designing highly sensitive effective assays, even trying to optimize the parameters known to influence the degree of amplification, such as the length of the primers, their specificity and their mating temperature. Thus, in principle the sequence amplification is proposed using a pair of primers that are chosen by taking one of them from a table of direct primers (designed to hybridize with a strand, complementary to the fragment of the 3 'NC region whose sequence is represented by SEQ ID NO: 1 1) and another from a table of inverse primers (designed to hybridize with sequence fragments that would be found in the complementary chain to the previous one and whose sequence is contained in the fragment represented by SEQ ID NO: 12, with preference being preferred particularly that it is contained in the subfragments of the previous one represented by SEQ ID NO: 13 and SEQ ID NO: 14). The specific sequences of each of the direct primers are presented in Table 1, while the sequences of the reverse primers of less than 24 nucleotides are presented in Table 2. The sequences have been indicated so that nucleotides can be seen in those that exist variations between the different lineages; These variations, as well as those indicated in Tables 3 and 4 below, have been identified using as reference, for each lineage, the following strains:

- Lineage 1: NY99eqhs (GenBank: AF260967);

- Lineage 2: B956 (GenBank: AY532665);

- Lineage 3: abensburg (GenBank: AY765264);

- Lineage 4: LEIVKrnd88_190 (GeneBank: AY277251);

- Lineage 5: 804994 (GenBank: DQ256376);

Lineage 6: MP502-66 (Sequence of the 3TSTC zone, represented by SEQ ID NO: 57). Table 1: Direct primers of the 3 'untranslated region of WO 2004/036190

Nucleotides in bold and underlined: variants in strains of the lineage 1

Nucleotides in bold and italic: variants in strains of lineage 2

Nucleotides in italics: variants in strains of lineage 3

- Underlined nucleotides: variants in strains of lineage 4

Nucleotides on a gray background: variants in more than one lineage

Table 2: Inverse primers of the 3 'untranslated region of WO 2004/036190

Nucleotides in italics: variants in strains of lineage 3

- Underlined nucleotides: variants in strains of lineage 4

Nucleotides on a gray background: variants in more than one lineage

Specific amplification assays of strain NY99 (lineage 1) performed by combining three of the direct primers with six of the reverse primers, with 10 replicates of the assay for each combination of primers, demonstrated that not all combinations of primers were capable of giving place for positive results at 10 Replicas of the trial, obtaining 10/10 ratios of positive results versus replicas for only four of eighteen combinations tested:

- when combining primers 64 (SEQ ID NO: 19) or 66 (SEQ ID NO: 21) with primer 76 (SEQ ID NO: 25), or

- when combining primers 64 (SEQ ID NO: 19) or 66 (SEQ ID NO: 21) with primer 77 (SEQ ID NO: 26).

However, if the reverse primer 75 (SEQ ID NO: 24) is used, which contains the sequence of primers 76 and 77 but incorporating in 3 'one or two more nucleotides, respectively, the combination with primers 64 and 66 gives place to relations of only 5/10 and 2/10 positive in the total of replicas, obtaining the maximum of amplifications with the primer 60 (SEQ ID NO: 15), which was only 6/10.

The document also refers that there were even reverse primers that did not give rise to any positive results. These tests demonstrate that, although the percentage of sequence homology is equal or equivalent and the length and temperature of mating similar, not all primers are equivalent, the specific sequence of each primer being very important and the choice of partner not being obvious. suitable for efficient and reproducible amplification of WNV. It is also important to note that these results are obtained with a specific strain of lineage 1, with respect to which the sequence homology of the primers is almost total. The careful observation of Tables 1 and 2 of the present application makes it possible to observe that, if all the lineages are considered, the number of differences presented by each primer is multiplied, so it is expected that for these lineages the effectiveness It would be lower.

WO 2004/036190 also considers the interest of detecting genetic variants of WNV without compromising the sensitivity of the method. To facilitate this, it is proposed that amplification be carried out using triplet primers: a pair of primers complementary to the same chain (taken from Table 1 of this application) in combination with the primer of the complementary chain (of which they would be possible examples those of Table 2 of the present application). Repeating the WNV amplification test of strain NY99 with 10 replicates per combination resulted in 10/10 positive results in the combinations that included two primers in Table 1, although the same result was also obtained in the case in which it was used a single primer from Table 1. The assay included an internal control with a template and primers of human immunodeficiency virus type 1 (HIV-1), which did not affect the amplification of West Nile virus. However, the assays described in application WO 2004/036190, performed to evaluate the ability of the method to amplify and detect a different strain of WNV (specifically, the strain of Uganda), were performed using a single pair of primers for each region. of the virus analyzed (region 5'NC, region 3'NC or region 3000), finding that regions 3000 and 3'NC gave better results, being able to detect up to 7-13 viral copies / ml. Thus, the application WO 2004/036190 does not explicitly consider the possibility of using more than one primer of the same polarity, complementary to the polynucleotide sequence of the virus, to be able to detect in a single test viruses of different strains (or even lineages) present in a sample.

Neither are the polynucleotide sequences chosen for the design of the probes described in the application WO 2004/036190 optimal for the detection of strains of all WNV lineages. An analysis of the sequences chosen for the 3'NC region, reproduced in Table 3 below, shows that none of them has a total homology with the strains of all lineages:

Table 3.- WNV sequences chosen for the design of probes of the 3 'untranslated region in WO 2004/036190

Nucleotides in italics: variants in strains of lineage 3

Underlined nucleotides: variants in strains of lineage 4

Nucleotides on a gray background: variants in more than one lineage Other similar methods also show preference for the 3'NC region for the choice of amplification primers and / or detection probes, but also present the problem of having been specifically designed for strains of lineage 1, as with the method described in the International patent application WO2005 / 047522, even with the preferred primer pair in said international application, shown below in Table 4:

Table 4: Preferred primers of application WO 2005/047522

Nucleotides in italics: variants in strains of lineage 3

Underlined nucleotides: variants in strains of lineage 4

- Nucleotides on a gray background: variants in more than one lineage

In other cases, primers and probes have been designed so that they are not specific to VWNV, but with the purpose of being able to detect several members of the Japanese encephalitis virus serogroup. Such is the case, for example, of the method for the detection of flavivirus described in the international patent application published as WO 2004/092412, where the ability of the method to detect several members of the serogroup of the virus of the virus is mentioned as a desirable characteristic. Japanese encephalitis in a single trial. According to this, none of the known amplification and detection methods allow the detection of all WNV lineages. However, proper analysis of blood bank samples and diagnosis of the disease require a broad spectrum method, covering all lineages. Preferably, said method should not only be able to detect all West Nile virus lineages, but specific for said virus, allowing to distinguish between WNV and other closely related viruses, such as those of the Japanese encephalitis virus serogroup. It would also be preferable for the method to have a high sensitivity, which would allow virus detection even if the number of copies present in a sample was not high.

The method of the present invention is a solution to these problems. SUMMARY OF THE INVENTION

The present invention provides a method of amplification and detection of West Nile virus (WNV), capable of sensing with sensitivity and specificity any of the seven known lineages of the virus. The method targets the 3 'non-coding region (3'NC), which is a region subjected to conservation pressures due to its involvement in the formation of secondary structures required for viral replication, and is particularly indicated to be carried out by Real Time PCR. It has the peculiarity that the probe used for the detection of the amplified fragment, as well as the oligonucleotides used as primers in the amplification of the viral genome by means of Real Time PCR, are minimally degenerated, which allows covering the six viral lineages for which knows the sequence of the virus, as well as the seventh partially sequenced viral lineage. The sequence of the oligonucleotides used as primers, as well as the sequence of the detection probe, have been carefully chosen to obtain a high sensitivity, similar for all lineages, while maintaining the condition of being specific for West Nile virus, not being detected by The method of the invention closely related to WNV viruses such as those of the same serogroup, the Japanese encephalitis virus serogroup.

Thus, one aspect of the invention relates to a method for the detection of West Nile virus present in a sample comprising the steps of:

a) amplifying the West Nile virus nucleic acids present in said sample by PCR using the oligonucleotides with the sequences as primers:

5'-CGGAAGTYGRGTAKACGGTGCTG-3 '(SEQ ID NO: l) (WNVRT-F, direct), and

5 '-CGGT WYTGAGGGCTTACRTGG-3' (SEQ ID NO: 2) (WNVRT-Re, reverse);

b) detect the amplified nucleic acid fragment,

wherein the detection of the amplified nucleic acid indicates the presence of West Nile virus in said sample.

In a preferred embodiment of the invention, the detection of the amplified nucleic acid is performed using the oligonucleotide having the sequence as a probe:

5'-WCCCCAGGWGGACTG-3 '(SEQ ID NO: 3) optionally attached to a marker that allows its detection.

In one embodiment of the method of the invention, step a) of amplifying the West Nile virus nucleic acids present in the sample comprises the following sub-stages:

i) synthesis of cDNA from West Nile virus RNA present in the sample by reverse transcriptase;

ii) amplification of the cDNA by PC in Real Time using as primers the oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2; and step b) of detecting the amplified nucleic acid fragment is carried out by using a fluorogenic probe (capable of emitting fluorescence) consisting of a single stranded oligonucleotide complementary to the amplified nucleic acid fragment in the PCR reaction, covalently bound to at least one fluorochrome compound. It is particularly preferred that the oligonucleotide used as a probe has the nucleotide sequence of SEQ ID NO: 3.

In a preferred embodiment of the above, the cDNA amplification reaction is carried out in the presence of a double stranded DNA fragment that serves as an internal control. Said internal control is a DNA fragment that is amplified with the same oligonucleotides as the target region of the virus genome and, therefore, must contain a sequence fragment that comprises in one of its strands both the sequence complementary to one of the primers of SEQ ID NO: 1 and SEQ ID NO: 2 and the sequence of the other primer of the couple, both sequences being located (sequence of SEQ ID NO: l, for example, and sequence inverted and complementary to SEQ ID NO: 2 ) as flanking fragments among which is a heterologous fragment, such as, for example, the exogenous sequence of a virus from a different family. On this heterologous fragment its specific detection probe is designed.

A possible embodiment of said variant of the method of the invention is that in which the internal control comprises the sequence represented by

5'- CGGAAGTYGRGTAKACGGTGCTG CCAGCACACATGTGTCTACT

CC TO YGTAA GCCCTCAR WA CCG -3 '(SEQ ID NO: 6).

In it, the 5 'end (underlined nucleotides) is the primer sequence of SEQ ID NO: 1, the 3' end (underlined and italicized nucleotides) is the inverted sequence and complementary to that of the primer of SEQ ID NO: 2 and the intermediate fragment is a BK virus sequence.

Thus, in the case that said internal control is used, it is preferred that the probe used for its detection is constituted by an oligonucleotide with the nucleotide sequence:

5 '-CC AGC AC AC ATGTGTCT ACT-3' (SEQ ID NO: 7)

to which at least one fluorochrome other than the fluorochrome or fluorochromes attached to the probe that allows the detection of the amplified fragment of the West Nile virus is covalently linked.

The method of the invention can be used to detect the possible presence of West Nile virus in samples from different sources, not only geographical, but also in regard to the species from which a biological sample is obtained. Thus, although the preferred embodiments of the method of the invention will be those in which the method is applied for the amplification (stage a)) and detection (stage b)) of nucleic acids extracted from biological samples taken from a human being (especially, those of cerebrospinal fluid, organ samples (eg, destined for transplants), and blood or serum obtained from it), the method can also be applied when starting from biological samples obtained from other species, such as a arthropod or a bird.

Another aspect of the invention relates to a kit specially designed to carry out the method of the invention. Thus, one aspect of the invention is a kit comprising the oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2. It is particularly preferred that the kit also contains a probe with the nucleotide sequence of SEQ ID NO: 3, especially if it is labeled 5 'with a fluorochrome and 3' with a non-fluorescent quencher attached to an MGB moiety {Minor Groove Binder ). It is also preferred that the kit additionally contain a probe with the nucleotide sequence of SEQ ID NO: 7, especially if it is labeled with a fluorochrome absent from the probe of SEQ ID NO: 3. In the case where the probe of SEQ ID NO: 7 is present, the kit may also contain the oligonucleotides of SEQ ID NO: 4 and SEQ ID NO: 5 or a DNA molecule comprising the sequence of SEQ ID NO: 6 , a DNA molecule that can be, for example, a plasmid, linearized or not.

The invention will now be explained in more detail with the help of the Figures and Examples below. BRIEF DESCRIPTION OF THE FIGURES

Fig. 1 shows a graph in which the sensitivity in the detection of the internal control is represented by the PC in real time. The numbers on the curves indicate the number of copies of the internal control per reaction. The horizontal line marks the limit of detection.

Fig. 2 shows a graph depicting the sensitivity in the detection of the EglOl strain, of the WNV lineage 1. Again, the numbers on the curves indicate the number of copies of the plasmid containing the virus genome fragment between the primers of SEQ ID NO: 1 and SEQ ID NO: 2.

Fig. 3 shows a graph depicting the sensitivity in the detection of strain HU2925 / 06 with the Real Time PCR assay of the invention.

Fig. 4 refers to the genome position of the primers and probes of the invention and their sequence homology with related genomes:

- Fig. 4A shows sequence fragments of the 3 'non-coding region

(3 'NC) of various West Nile virus strains, whose name is indicated on the left, the areas corresponding to the direct (shaded on the left) and reverse (shaded on the right) primers shaded. Among them is the fragment amplified in the Real Time PCR. The sequence indicated as "wntrSONDA" corresponds to the sequence used as a detection probe (SEQ ID NO: 3), which is located in the area of the amplified fragment to which it binds.

- Fig. 4B shows sequence fragments of the 3 '(3' NC) non-coding region of various strains of the Japanese encephalitis serogroup virus, strains whose name is indicated on the left, headed by the virus abbreviation: SLEV (St. Louis encephalitis virus), JEV (Japanese encephalitis virus), USUV (Usutu virus) and MVEV (Murria Valley encephalitis virus), and which are shown along with the sequences of the reverse primers, both the initially chosen one ("First Re Real Time WN) and the inverse primer of the method of the invention (" REWNnew "), the areas corresponding to the pairing position of said primer with respect to the rest of the serogroup viruses at which one belongs WNV. DETAILED DESCRIPTION OF THE INVENTION

As mentioned, the present invention relates to a method of amplification and detection of West Nile virus (WNV) present in a sample that specifically comprises the steps of:

a) amplifying the West Nile virus nucleic acids present in said sample by PC using oligonucleotides with the sequences as primers:

5 '-CGGAAGTYGRGTAKACGGTGCTG-3' (SEQ ID NO: l) (WNV T-F, direct), and

5 '-CGGT WYTGAGGGCTTACRTGG-3' (SEQ ID NO: 2) (WNV T- e, inverse);

b) detect the amplified nucleic acid fragment,

Thus, similar to other previous methods, designed for the amplification of the nucleic acids of the virus and subsequent detection of the amplified material, the method of the present invention has been designed to amplify the RNA molecules of the virus present in a sample, including for this in the method a step in which a PCR reaction is performed. For this, a pair of primers have been developed, (the oligonucleotides whose sequence is represented by SEQ ID NO: l and SEQ ID NO: 2), which target the 3'NC region of the virus genome, a region considered of interest also in other methods of amplification and detection of WNV previously described. However, unlike other methods described so far, which only cover 1 or 2 evolutionary lineages, without considering the great natural variability in the world, the method of the invention has been designed to allow the detection of the 7 evolutionary lineages of the West Nile virus known so far. To do this, all strains of the virus for which genomic sequences are deposited in public databases have been analyzed, specifically, the 79 sequences that have the following access numbers to the GenBank database (www.ncbi.nlm.nih. gov / Genbank /): AY712948, AY712947, AY490240, AY278442, AY278441, AY277252, AF404757, AF404756, AF404755, AF404754, AF404753, AF481864, AY603654, AY646354, AY289214, AY795965, AY842931, AY660002, AF196835, DQ164206, DQ164202, DQ164197, AF260969, AF260968, AF260967, DQ211652, DQ164204, DQ164200, DQ164201, AF533540, DQ005530, DQ118127, DQ164205, DQ164203, DQ164199, D00246, DQ164196, DQ080058, DQ080054, DQ080055, DQ080056, DQ164193, DQ164186, DQ164195, DQ164191, DQ164205, DQ080053, AY848696, AB185917, DQ080052, AB185914, DQ080051, DQ164189, AF404756, DQ164190, AY712945, AY712946, DQ080059, DQ164188, DQ164187, DQ164192, AF404757, AY277252, AY274505, DQ116961, DQ318019, M12294, EF429200, AY532665, EF429198, EF429199, EF429197, NC001563, AY688948, DQ 176636 , DQ318020, AY765264, AY277251, DQ256376. In addition, it has also been considered a sixth evolutionary lineage, recently identified from an isolate of a Malaysian mosquito, that of strain MP502-66 (strain whose region 3 "NC is represented by SEQ ID NO: 57 and whose gene of The envelope has the access number in GenBank AF196534), as well as a seventh evolutionary lineage, recently discovered in Spain (isolated HU2925 / 06), which has been partially sequenced, also considering the sequence fragments that have been known until now so that the method of the invention also allowed its amplification and detection in the case of being present in a sample.

Thus, the PC carried out with these primers allows the amplification, in all known lineages, of a fragment of the 3'NC region of the virus genome, represented by SEQ ID NO: 8, which corresponds specifically to the cDNA fragment of 93 nucleotides between positions 10530 and 10622 in the genome of the EglOl strain (GenBank accession number AF260968, whose complete sequence is reproduced as SEQ ID NO: 56). In turn, the sequences SEQ ID NO: 9 and SEQ ID NO.10 have the amplified fragment, respectively, in virus of lineages 6 (isolated MP502-66) and 7 (isolated HU2925 / 06).

The method has the particularity that the primers used contain degenerate sequences, in order to effectively cover the amplification of all known viral variants. In the methods hitherto known, on the contrary, only the amplification using primers pairs (or, at most, triplets), each with a specific fixed sequence, had been considered. In general, as discussed in the "Background of the invention" section, the description of said methods presented oligonucleotide lists, from which to choose the direct primer and the reverse primer. In most of the cases, the sequences of the primers had been chosen considering a single strain, generally belonging to the most common lineage in North America, the lineage 1, not being suitable for the rest of the lineages or, even, not all the known strains of the lineage being covered 1. This hindered the detection of circulating WNV strains in Europe, Africa, Asia and Oceania, which belong to different virus lineages.

As previously mentioned, in addition, the tests described to illustrate the application of said methods, as with the method described in the international patent application WO2004 / 036190, demonstrate that, although the design of the primers is carried out Trying to optimize parameters such as sequence homology with the target, length or pairing temperature, not all primers are equivalent, observing a lot of disparity in amplification efficiency between pairs of primers of very similar sequences. This demonstrates the importance of the specific sequence of the chosen primers and the difficulties of choosing the right pair of primers to obtain an efficient and reproducible amplification of a specific WNV strain, despite the currently available primer design techniques .

Surprisingly, despite the sequence homology of the primers of the present invention (represented by SEQ ID NO: l and SEQ ID NO: 2) with some oligonucleotides described in previous documents relating to WNV amplification, in which difficulties were observed In order to obtain positive amplification results with several pairs of primers directed to the same region of the virus genome, the primers of the present invention allow amplification of all lineages sequenced so far of WNV virus, in all cases with high sensitivity, similar between the different lineages (having observed values of between 2 and 20 microlite molecules in the tests described later in the Examples of the present application). This has been achieved by carefully choosing the sequence of the primers, introducing degenerations into them so that they were able to cover all known lineages but, at the same time, carefully choosing their sequence so that the number of degenerations was minimal and maintained the condition of Be specific to WNV. Thus, as demonstrated in the tests described later in the Examples of the present application, the method of the invention, despite being carried out with degenerated primers (particularity that is not it had been suggested so far in the known related methods), it does not lead to the amplification of viruses phylogenetically very close to WNV, such as JEV, MVEV, SLEV or USUV. This demonstrates that, despite the difficulties indicated by the trials and teachings of related documents of the prior art, a pair of primers have been found with the appropriate sequence to effectively amplify all known WNV lineages and, at the same time, to allow specific tests to determine the presence or absence of the virus in a sample and not of other phylogenetically related viruses. Thus, the method of the invention is particularly suitable for the analysis of samples of human beings from any source, being able to determine the presence of the virus in them regardless of the lineage to which it belongs, and allowing at the same time to distinguish if the virus detected is really WNV and not another flavivirus. This facilitates not only the analysis of organ and blood donations, in which the study of the presence of WNV is mandatory in the United States and is being discussed in Europe, but also the diagnosis of the presence of the virus in any individual, facilitating an early treatment, which prevents the development of serious neurological diseases such as encephalitis.

In a preferred embodiment of the invention, the determination of the presence of the virus in the starting sample is made from the detection of the amplified fragment in the PC reaction by the use of a probe complementary to said fragment and, therefore, able to hybridize with it. For this, the oligonucleotide is used that has as a sequence

5'-WCCCCAGGWGGACTG-3 '(SEQ ID NO: 3)

optionally attached to a marker that allows its detection.

Like the oligonucleotides used as primers, the oligonucleotide that is part of the probe is also minimally degenerated, to cover the six viral lineages for which the virus sequence is known, as well as the seventh partially sequenced viral lineage.

The use of a probe complementary to the sequence of the amplified fragment offers different possibilities for the design of the detection method used. Thus, for example, the complementarity between sequences can be used, for example, in chromatographic methods, in which the sample in which the PCR amplified fragment is contacted with the immobilized probe (for example, being bound to the particles of a resin packed in a column), whereby the strand complementary to the probe will be attached to it and retained, and may be subsequently eluted. For its detection, for example, another probe marked with colloidal gold can be used.

It is particularly preferred that the amplification of the genomic sequence fragment comprised between the primers is carried out by what is known as Real Time PCR, which is basically a conventional PCR that is performed in the presence of molecules that have at least one residue with fluorescence emission capacity (fluorochromes) and molecules (can be the same) with the ability to accept the energy emitted by fluorochrome (which is usually known as the quencher term, which can also be a fluorochrome) so that when conditions allow the quencher to accept the energy emitted by the first fluorochrome, fluorescence emission cannot be detected (unless the quencher is a fluorochrome in turn); Generally, as in the system known as TaqMan, the design of the molecules is such that only when the DNA polymerase results in the fluorochrome being released from the quencher's action is fluorescence emitted, so the fluorescence emitted during each cycle PCR is proportional to the amount of DNA that is being amplified. Real-time PCR is carried out in thermal cyclers that have a fluorescence detection system incorporated that allows monitoring, in real time, what is happening inside each tube in each amplification cycle and replacing the amplification, electrophoresis and analysis steps. Image of a traditional PCR. In addition to the simplicity of the process, Real-time PCR is preferred because of its greater sensitivity and the fact that the quantification results obtained in it are more reproducible and accurate, because the quantification is performed based on the threshold cycle value (Ct ), which is defined as the cycle from which the fluorescence is statistically significant above the background noise.

For the design of the Real-Time PCR of the method of the invention, it has been taken into account, as previously mentioned, that WNV is an RNA virus of positive polarity. Therefore, the virus nucleic acids present in the sample to be analyzed will be RNA molecules. Thus, it is convenient to perform reverse transcription of said NA, to obtain the corresponding cDNA molecules and to be able to use said cDNA as a template for PCR amplification. Therefore, the amplification step of the WNV nucleic acids present in the sample in turn implies two sub-stages, the synthesis of the cDNA from the RNA of the virus present in the starting sample, by means of a reverse transcriptase; and amplification of the cDNA by real-time PCR using the oligonucleotides of SEQ ID NO: l and SEQ ID NO: 2 as primers. Although RNA amplification by real-time PCR really requires two different sub-stages, the method can be designed so that the reverse transcription reaction and PCR amplification take place in a single step, mixing all the necessary reagents (including reverse transcriptase) in the same tube in which the amplification reaction takes place, which simplifies the process and minimizes the chances of contamination.

In either case, Real Time PCR implies the presence of at least one molecule / residue capable of emitting fluorescence. It is preferred that the molecule with which the ability to emit fluorescence is associated and, therefore, allows the detection of the amplified nucleic acid fragment, is a fluorogenic probe (capable of emitting fluorescence) consisting of a single stranded oligonucleotide complementary to the fragment of nucleic acid amplified in the PCR reaction. The probe, therefore, must have a sequence complementary to the sequence fragment between the positions to which the primers bind. It is particularly preferred that the oligonucleotide used as a probe has the nucleotide sequence of SEQ ID NO: 3, specifically designed, as discussed, to specifically detect all known WNV lineages.

It is preferred that the oligonucleotide used as a probe is labeled 5 'with a fluorochrome and that it is the 3' end that has a compound acceptor of the energy emitted by the fluorochrome, the so-called "quencher", being common among experts in The technique refers to probes marked in this way as TaqMan probes.

A possible design of this type of probes, as mentioned, is that the quencher is also a fluorochrome compound, which dissipates the energy received from the first fluorochrome in the form of fluorescence of greater wavelength than that emitted by the first fluorochrome, the process efficiency depending on the distance between the first fluorochrome and the quencher, such that when DNA polymerase (Taq polymerase usually) begins to amplify the primer attached to the template DNA, it displaces the 5 'end of the probe, which is degraded by the 5' exonuclease activity -> 3 'of Taq polymerase, releasing the fluorochrome to the medium and separating it from the quencher, which causes an irreversible increase in the detected fluorescence.

An alternative to the above, which is particularly preferred for the method of the present invention, is that of the configuration of commercial probes known as TaqMan ^® MGB ™, in which the quencher 3 'attached to the probe is a non-molecule. fluorescent (NFQ: Non Fluorescent Quencher), which contains a moiety capable of binding to the minor groove of the DNA (which is known by the abbreviation MGB), as this probe design offers the advantage that the background signal is smaller, increasing the accuracy of quantification, and that the MGB stabilizes the hybridized probe and raises the melting temperature (Tm: melting temper ature), which facilitates the use as a probe of a short oligonucleotide such as SEQ ID NO: 3, reducing the risk that some of the nucleotides of the probe do not give rise to perfect matches (risk of mismatches) with the target sequence. The probe used in the tests described in the examples of the present application is a probe of the TaqMan ^® MGB ™ type, whose nucleotide sequence is that represented by SEQ ID NO: 3 and which carries the 5-fluorochrome known as FAM ( 6-carboxyfluorescein).

As for the previous step of extracting the RNA present in the starting sample, it can be carried out by any of the techniques known to those skilled in the art.

In another preferred embodiment of the method of the invention, compatible with the above, the method includes an internal reaction control, which allows the identification of potential false negative results due to problems in the extraction or amplification of the samples.

To carry out the method of the invention according to this preferred embodiment, an internal control was designed using a strategy similar to that described by Fedele et al. (Fedele et al, J Clin Microbiol 44: 4464-4470 (2006)), adapting it to the method of the present invention: an oligonucleotide pair was designed, at whose 5 'ends are the sequences of the direct and reverse primers used for the detection of WNV, while the 3' sequences are sequences complementary to each other, that define the sequence of the specific probe designed for the detection of the internal control and that, after mating, allow the in vitro synthesis of the internal control, by replication of the unpaired sequence fragment.

In the specific case of the internal control used in the Examples of the present application, the internal control was synthesized from the following oligonucleotides:

5 '-CGGAAGTYG GTAKACGGTGCTGCCAGCACACATGTGTCTACT-3'

(SEQ ID NO: 4) (CIWNF primer)

5 '-CGGTWYTGAGGGCTTACRTGGAGTAGACACATGTGTGCTGG-3' (SEQ ID NO: 5) (CIWNRe primer)

at whose 5 'ends (underlined nucleotides) are the sequences of the direct and reverse primers used for the detection of WNV and, therefore, allow simultaneous amplification of the internal control and the cDNA corresponding to WNV, resulting in the reaction WNV amplification becomes a competitive PCR in which cDNA and internal control are amplified from the same primers.

According to this design, the product of the amplification reaction of the primers of SEQ ID NO: 4 and SEQ ID NO: 5 (which, in turn, also act as template DNA) must contain in one of its strands the sequence represented by:

5'- CGGAAGTYGRGTAKACGGTGCTG CCAGCACACATGTGTCTACT CCAYGTAAGCCCTCARWACCG -3 '(SEQ ID NO: 6)

wherein the underlined and italicized fragment is the sequence complementary and inverted to that of the reverse primer designed for amplification of WNV nucleic acids, the primer of SEQ ID NO: 2, while the underlined fragment of 5 'is the sequence of the primer of SEQ ID NO: l.

In the specific reaction described in the Examples herein, the amplification product represented by SEQ ID NO: 6 was cloned into a bacterial plasmid, using the plasmid obtained, once linearized, as a reaction control. Cloning in a plasmid makes it possible to have multiple copies of the fragment of interest available as an internal control, after the culture of bacteria previously transformed with said plasmid and the isolation of the generated plasmid copies. Alternatively, the method of the present invention may include a previous step to obtain the internal reaction control, in which said control is synthesized. internal in a reaction in which the primers of SEQ ID NO: 4 and SEQ ID NO: 5 are amplified.

The heterologous fragment flanked by the sequences corresponding to the primers designed for WNV amplification determines the sequence of the probe to be used to detect the amplification of the internal control. This probe will hybridize with the internal control amplification product only if the amplification reaction has not been inhibited; the absence of a signal for it will indicate problems in the amplification reaction and, therefore, will be an indication that the possible absence of a signal for the probe that detects the amplification of WNV does not demonstrate the absence of the virus in the starting sample. Therefore, when a DNA molecule comprising the sequence represented by SEQ ID NO: 6 is used as an internal control, it is preferred that the probe used for its detection comprises the nucleotide sequence:

5 '-CCAGCAC ACATGTGTCTACT-3' (SEQ ID NO: 7) to which at least one fluorochrome other than fluorochrome or fluorochromes attached to the probe that allows the detection of the amplified fragment of WNV is covalently attached.

With this condition, a possible design for the method of the present invention, as presented in the Examples that appear later in the present application, is that the probe designed for the detection of internal control consists of the sequence of SEQ ID NO : 7, to which the NED fluorochrome is covalently attached, in 5 '. This is compatible with the use of the sequence represented by SEQ ID NO: 3, marked 5 'with FAM and covalently linked to the NFQ-MGB complex in 3', as a probe for the detection of the amplified fragment of WNV.

The presence of an internal control in the amplification reaction allows not only to detect problems in the amplification reaction but also, if desired, in the extraction phase. For this, in a possible alternative embodiment of the method of the invention, the DNA molecule to be used as an internal control can be added to the sample in which it is desired to analyze the presence of WNV prior to RNA extraction, so that the method It includes the co-purification of the virus and internal control. This embodiment allows the detection of problems due to poor extraction of nucleic acids present in the starting sample. As described, the implementation of the method of the present invention requires the use of the primer pair specifically designed for said method, the primers of SEQ ID NO: l and SEQ ID NO: 2, which allow the specific amplification of all the known WNV lineages, with a similar sensitivity for the six lineages of which the genome sequence is available, also allowing the amplification of the seventh lineage recently identified. Preferably, the use of these primers is carried out in conjunction with the probe of SEQ ID NO: 3, especially if it is marked with a marker that allows its detection, such as a fluorochrome. In the case of choosing to use an internal control, the probe that allows the detection of said internal control (SEQ ID NO: 7), especially if it is marked with another fluorochrome, as well as the primers that allow the synthesis of the fragment of interest as an internal control (SEQ ID NO: 5 and SEQ ID NO: 6) or the internal control itself already synthesized, either in the form of a DNA molecule that independently comprises the fragment of interest (SEQ ID NO: 6 ) or with said fragment included in a larger molecule, such as a plasmid.

Therefore, it is a further aspect of the invention a kit comprising the elements that allow carrying out the method of the invention. Said kit will comprise at least the oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2.

Preferably, the kit will also comprise the probe with the nucleotide sequence of SEQ ID NO: 3. It will be especially preferred that the probe has the design of the probe used in the Examples of the present application, with a 5 'covalently linked fluorochrome and a non-fluorescent quencher attached to a 3' MGB moiety.

It is especially preferred that the kit also includes the elements for the use of an internal control. Thus, it is preferred that the kit comprises the probe of SEQ ID NO: 7, labeled with a fluorochrome other than that of the probe of SEQ ID NO: 3. Optionally, the kit may comprise the oligonucleotides of SEQ ID NO: 4 and SEQ ID NO: 5, which will allow the synthesis of the fragment of interest as an internal control or, alternatively, a DNA molecule comprising the sequence represented by SEQ ID NO : 6, DNA molecule that can be a plasmid. In that case, even, the kit could also comprise bacteria capable of being transformed with said plasmid or, optionally, bacteria already transformed with the plasmid, whose culture it would allow the plasmid to be replicated and obtain multiple copies thereof and, therefore, the fragment of interest as an internal amplification control, which can also be used as an internal control for proper nucleic acid extraction from the starting sample.

Thus, a possible embodiment of the kit is that comprising the elements used in the Examples of the present application:

- the oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2;

the oligonucleotide of SEQ ID NO: 3, labeled 5 'with FAM and 3' marked with a non-fluorescent quencher that includes an MGB;

- the oligonucleotide of SEQ ID NO: 7, labeled 5 'with NED; Y

- the oligonucleotides of SEQ ID NO: 4 and SEQ ID NO: 5, or

- a plasmid comprising the sequence represented by SEQ ID NO: 6.

The invention will now be explained in more detail by means of the Examples and Figures that appear below, which serve to illustrate possible embodiments of said invention.

EXAMPLES

- Example 1.- Obtaining the plasmids of interest

Plasmids were obtained to be used as an internal amplification control and, for each lineage, in order to obtain a quantifiable mold to be used in the optimization of some techniques. Such plasmids were used to calculate the sensitivity of the technique.

Plasmids of lineages 1, 2, 3 and 6, plasmids were obtained by inserting amplified fragments from previously cultured viral strains.

For lineages 4 and 5, synthetic DNAs containing the same sequences as the original strains were used.

The method also incorporates an internal reaction control in each reaction tube to identify potential false negative results due to problems in the extraction or amplification of the samples. The internal control is amplified with the same oligonucleotides that amplify the viral target region, but it has a heterologous fragment on which the detection probe is designed. The fragment of Interest as an internal control was also cloned into a plasmid, which, once linearized, was used as an internal control.

1.1. Obtaining amplification products

As mentioned, for lineages 1, 2, 3 and 6, an amplification fragment was obtained from isolated viruses after a previous culture of the corresponding viral strains. The strains used were:

- Lineage 1: WNEglOl (GenBank: AF260968)

- Lineage 2: WNArB3573 / 82 (GenBank: DQ318020)

- Lineage 3: WN abensburg (GenBank: AY765264)

- Lineage 6: MP502-66 (3'NC region, represented by SEQ ID NO: 57)

For the realization of the isolation of the different viruses, cell cultures of Vero E6 cells (acquired at (to cultivate lineage strains 1, 2 and 6) and C6 / 36 cells (to cultivate the strain corresponding to lineage 3) were used. The details related to each of these cell lines and their culture were as follows:

- Vero E6 cells: It is a continuous lineage of African green monkey kidney epithelial cells. The Vero E6 line derives from the Vero 76 clone that is more susceptible to infection with some arboviruses. The cells were purchased from the American Type Culture Collection (ATCC - http://www.lgcpromochem-atcc.com). For their culture, the cells were kept in Eagle's minimum essential medium (EMEM, Sigma) supplemented with 10% fetal bovine serum (SFB, Gibco-Invitrogen) to which penicillin and streptomycin (20,000 U / mL, had previously been added). Biowhitaker) and L-Glutamine (200 mM, Biowhitaker). Cell growth was carried out in an oven at 37 ° C and in an environment without C0 ₂ atmosphere. For the maintenance of the cell line, serial passes were made by detachment of the tapestry confluent with trypsin-verseno, consisting of 100 ml of 2.5% trypsin in 1 liter of verseno. Once detached, trypsin-verseno was diluted by adding the appropriate amount of growth medium to perform the dilution necessary to make the pass based on the surface of the container to be used.

In order to carry out the infections, cultures at approximately 80% confluence of the cell monolayer were used, in bottles of 25 cm ² of surface. For this, the medium was removed from the bottles and 1 ml of EMEM was added to 2% of SFB, after which 100 or 50 μΐ were added depending on the sample. A bottle was left uninfected as a cell control. The viral inoculum was allowed to adsorb 1 hour at 37 ° C while stirring, and after this time 7 ml of 2% EMF medium of SBF was added and incubated in an oven at 37 ° C in the absence of C0 ₂ , observed daily under the microscope to detect any possible ECP (cytopathic effect).

- C6 / 36 / HT cells: It is a cell line obtained from Aedes albopictus donated by the Central Veterinary Laboratory, Algete, Madrid. It is a C6 / 36 clone that has adapted to grow at 33 ° C instead of 28 ° C, thus improving viral replication capacity. They were cultured in 2% EMB of SFB and supplemented with 1% of nonessential amino acids (aa-NE), penicillin, streptomycin and glutamine, and 0.1% of vitamins. Cell growth was carried out in an oven at 33 ° C and in an environment without C0 ₂ atmosphere. The infection was carried out using the same protocol as that described for Vero E6 cells, with the differences necessary to adapt it to C6 / 36 such as: the culture medium, the incubation temperature and the absence of C0 ₂ .

Both in the case of Vero E6 and C6 / 36 / HT cells, the infections were maintained until an ECP of approximately 80% of the cell monolayer was observed, then proceeding to viral collection.

All procedures that involved the presence or use of non-inactivated cultured virus were performed at the level 3 biological safety facilities (NSB-3) available at the National Center for Microbiology (Majadahonda, Madrid, Spain).

- Viral RNA extraction: To carry out the extraction, the commercial team QIAamp Viral RNA (Qiagen, Izasa, Spain) was used, following the manufacturer's recommendations, which were the following:

140 μΐ of the sample supernatant was added to a tube with 560 μΐ of the AVL viral lysis buffer (which inactivates the virus and serves for the extraction of viral RNA), present in the Qiamp viral RNA kit. The sample was vortexed for 5 seconds and centrifuged for 10 minutes at 13,000 rpm to clean it of cell debris. To this mixture was added 500 µΐ of absolute ethanol, stirred by turning the tube from top to bottom and a centrifugal pulse was given. The sample was subsequently transferred to a QIAamp column (for RNA binding) and centrifuged at 13,000 rpm for 1 minute in a microcentrifuge at 4 ° C. All Centrifugations from here were performed at a temperature of 22 ° C. The filtrate was removed and two consecutive washes were performed with 500 μΐ of the buffers AW1 and AW2 respectively, adding the buffer to the column and centrifuging at each step at 13,000 rpm for 1 minute in the first and 5 minutes in the second. To dry the membrane and remove ethanol residues, the filtrate was removed again and centrifuged at 13,000 rpm for 2 minutes. Finally, the nucleic acids were eluted in 60 μΐ of AVE buffer (RNase-free water), which was added to the column and incubated for 2 minutes before centrifuging the tube at 13,000 rpm for 2 minutes. The eluate obtained, which contained the RNA extracted from the sample, was stored at -80 ° C until later use.

In cases where it is desired that virus co-purification and internal control take place, the DNA molecule to be used as an internal control is added to the sample in which it is desired to analyze the presence of WNV prior to RNA extraction. To do this, 400 copies of the internal control (CI) are added to the AVL buffer.

Once the viral RNA was extracted, it was amplified.

- Amplification: Once the RNA of each viral strain was obtained, the first thing that was done was to verify that the viral RNA had actually been obtained. For this, a generic RT-Nested-PCR for flavivirus (Sánchez-Seco et al., Tropical Medicine & International Health 11: 1432-1441 (2006)) was carried out. Once the corresponding band size was verified, the cDNA of the viral strains was obtained, for which 5 μΐ of the extracted RNA and 1 μΐ of random hexamers (280 pmol / μΐ) were added and incubated 5 minutes at 70 ° C in the thermal cycler. Once this reaction was carried out, 14 μΐ of the following mixture was added to each sample:

Reagent Volume

Water 6.4 μΐ

5x () buffer 4 μΐ

dNTPs (25 mM) 0.4 μΐ

DTT (0.1 MI) 2 μΐ

RNAsin (Applied-Biosystem) 0.2 μΐ

RT Super Script III (Invitrogen) 1 μΐ and incubated 45 minutes at 48 ° C, followed by 5 minutes at 70 ° C, with 4 ° C for the maintenance of the product obtained until the moment of use. Once the cDNA was obtained, the fragment chosen for the invention was amplified using the primers of SEQ ID NO: l and SEQ ID NO: 2 in a conventional PC, and subsequently cloned. For amplification of the fragment 1 μΐ of cDNA was added to 49 μΐ of the following reaction mixture:

Reagent Volume

Sterile water 36.5 μΐ

Buffer 1 Ox II (Applied-Biosystem) 5 μΐ

Cl ₂ Mg (25 mM) (Applied-Biosystem) 5 μΐ

dNTPs (25 mM) 1 μΐ

Primer WNRT-F (100 pmol) (SEQ ID NO: l) 0.5 μΐ

WNRT-Re primer (100 pmol) (SEQ ID NO: 2) 0.5 μΐ

Taq Polymerase (Applied-Biosystem) 0.5 μΐ

The reaction began with an initial denaturation of the cDNA and polymerase activation of 5 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 94 ° C, 30 seconds at 60 ° C hybridization and 1 minute at 72 ° C elongation, followed by a final elongation of 5 minutes at 72 ° C with 4 ^o C for product maintenance.

- Visualization and purification of the band: Once the amplification reaction was finished, the visualization of the resulting products was carried out by electrophoresis in agarose gels. For this purpose, 2% agarose gels (MS8, Hispanlab, Spain) were prepared in tris-borate-EDTA buffer (TBE), stained with ethidium bromide at a concentration of 0.5 μg / ml. From each sample, 10 μΐ were loaded into the gels after adding a loading buffer containing 30% glycerol in water, 0.25% bromophenol blue and 0.25% xylene cyanol. The molecular weight marker used was a commercial DNA standard of 1Kb (Invitrogen) at a concentration of 100 ng / μΐ. The electrophoresis was developed in TBE at an electric current intensity of 100 volts for approximately 30 minutes, the amplification products being visualized under UV light. The amplification products detected in the agarose gel and with a size similar to that expected, were purified for subsequent sequencing and identification. This process was carried out with two different techniques:

• If a single band of the expected size was observed in the gel, the purification was done with the QIAquick PCR Purification (Qiagen). The sample is transferred to a 1.5 ml eppendorf tube with 200 μΐ of PB buffer, mixed and added to a purification column. It was centrifuged at 13,000 rpm for 1 minute at room temperature. After removing the eluate, the column was washed with 750 μΐ of PE buffer, centrifuging at 13,000 rpm for 1 minute at room temperature. To dry the column membrane, another centrifugation was performed at the same speed and duration. The column was placed in a 1.5 ml eppendorf tube, 30 μΐ of distilled water was added, and after allowing the column to soak for 1 minute, it was centrifuged for another minute at 13,000 rpm to obtain the purified, which was kept at -20 ° C until sequencing.

• If several bands of different sizes were observed in the agarose gel, the amplification product was re-visualized, but this time in 1% low melting agarose gels (Sigma). The band of the expected size was cut from the gel with a scalpel and purified with the QIAquick Gel Extraction (Qiagen) equipment. The eppendorf tube containing the cut agarose was weighed and 300 μΐ of QC buffer was added for each mg of agarose. Then an incubation was carried out at 50 ° C in a thermoblock for 10 minutes, until the total dissolution of the agarose. Then 100 μΐ of cold isopropanol was added for each mg of agarose. The resulting mixture was passed through a purification column by centrifuging at 13,000 rpm for 1 minute and at room temperature. The eluate was removed and the column was washed with 750 μΐ of PE buffer, centrifuging at 13,000 rpm for 1 minute at room temperature. To dry the column membrane, another centrifugation was performed at the same speed and with the same duration. The column was then placed in a 1.5 ml eppendor tube and 30 μΐ of distilled water was added, after 1 minute of incubation it was centrifuged for 1 minute and at 13,000 rpm to obtain the purified, which was kept at -20 ° C until sequencing.

Once the pure DNA was obtained, the construction of the plasmids of interest that included the amplified products was carried out, for subsequent quantification. 1.2. Cloning of amplified products

The commercial cloning equipment TOPO TA Cloning® (Invitrogen) was used, following the manufacturer's instructions. This system was chosen because of the efficiency with which transformants that have incorporated the plasmid are obtained and because all the requirements of the ligation process are included in the commercial equipment. The technique consists of inserting the amplified product (previously purified) into the vector pC ^® 4-TOPO (TopoTA). To do this, the first thing is to bind the amplified product to the plasmid by the following reaction:

Reagent Volume

Water 2 μΐ

1 μΐ saline solution

Insert (amplified purified) 2 μΐ

Vector pCR ^® 4-TOPO 1 μΐ

Test reagents are left before a T ^at ambient, the mixture is stirred with fingers and incubated 30 minutes ^at room T.

1.3. Transformation in bacteria

The products obtained were used to transform a culture of competent E. coli cells to obtain a greater amount of the recombinant plasmid. For this, chemically competent bacterial cells from E. coli (One Shot® TOP10 Competent Cells, from Invitrogen) were used. The plasmid contains the Ampicillin resistance gene, which serves to select the transformed bacteria, being the only ones capable of growing in the presence of said antibiotic. For this, 5 μΐ of plasmid linked to the vector were mixed with 50 μΐ of competent cells, and incubated on ice for 30 minutes, after which the mixture was given a temperature shock (30 seconds at 42 ° C) to facilitate DNA entry into the cells, and re-incubated on ice for 5 minutes. After this time, 250 μΐ of SOC medium, which is an enriched medium to promote the recovery of the bacteria, was added to the tube containing this mixture. It was incubated for 1 hour with stirring and the entire transformation product was seeded in a Petri dish containing LB solid medium with Ampicillin, spreading it throughout the plate with a seeding handle. After inverting the plate, it was incubated overnight at 37 ° C. Colonies that grew in the selective solid medium were grown individually in a tube with liquid medium of LB with Ampicillin, incubating it with stirring at 37 ° C overnight. The next day, the presence of the expected plasmid in the cells of the culture was checked by means of a PCR, for this purpose 5 μΐ of the bacterial culture was added in a reaction mixture containing the appropriate primers to amplify the cloned insert and it was checked in a gel 2% agarose the size of the amplified fragment.

Once the presence of the plasmid of interest in each broth has been verified, it is purified. Subsequently, the absence of mutations in the area of interest is verified by sequencing the insert from the plasmid.

1.4. Plasmid DNA purification

Plasmid DNA was extracted from those broths in which bacteria grew with the expected plasmid and carried out with the commercial team QIAprep Spin Miniprep (Qiagen). For this, the broth was centrifuged and the cell pellet was resuspended in 250 μΐ of Pl buffer and transferred to a 1.5 ml eppendorf. 250 μΐ of P2 buffer was added and mixed by inverting the tube 3-4 times. Then 350 μΐ of N3 buffer was added and mixed by inverting the tube 3-4 times. It was centrifuged for 10 minutes at 13,000 rpm. The supernatant was passed through a column of the kit and centrifuged at 13,000 rpm for 1 minute. The column was then washed with 750 μΐ of PE buffer by centrifuging for 1 minute at 13,000 rpm. The eluate was discarded and centrifuged again to dry the column membrane. Finally, 50 μΐ of EB buffer was added to elute the purified plasmid.

1.5. Sequencing of the cloned insert

To verify the absence of mutations in the area where the primers hybridize and the probe in the cloned insert was sequenced. For this, the ABI Prism BigDye Terminator Cycle Sequencing v2.0 Ready Reaction (Applied Biosystems, Foster City, CA) commercial equipment was used, using a primer in each reaction in order to individually synthesize fragments of each strand of DNA, according to The following reaction: Reagent Volume

Water 4.2 μΐ

Big Dye 3 μΐ

2 μΐ plasmid

Primer MI 3 (Forward or Reverse) [20μΜ] 0.8 μΐ

The reaction began with an initial denaturation phase of DNA and polymerase activation of 5 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 94 ° C, 30 seconds at 50 ° C hybridization and 1 minute at 72 ° C elongation, followed by a final elongation of 5 minutes at 72 ° C with 4 ° C forever.

Synthesized DNA fragments are sequenced using an ABI model 377 automated sequencer (Applied Biosystems) automatic sequencer.

1.6. Linearization of plasmid DNA

Once the plasmid of interest was purified, the DNA was quantified in a photometer spectrum (NanoDrop® LCR) and subsequently linearized. For this, a restriction enzyme was chosen that cut once in the plasmid but had no recognition domain in the sequence of cloned interest. The enzymes chosen were SnaBI (Promega) for plasmids of lineages 1, 2, 3, 4, 6, and for internal control, while Alflll (BioLabs) was used for lineage 5. The reaction was incubated overnight. in a bath at 37 ° C and it was the following:

Reagent Volume

Water variable μΐ

Buffer lOx 5 μΐ

Plasmid 5-10 μΐ

BSA 1 μΐ

The amount of DNA to be cut depends on the concentration. The calculation in molecules is carried out using Avogadro's formula, since the NanoDrop® spectrometry equipment gives the concentration in nanograms / microliter.

1.7. Obtaining viral chimeras

Due to the unavailability of viral genome belonging to lineages 4 and 5 in the inventors' laboratory, DNA chimeras (synthetic DNAs) containing the sequences were constructed, in the region selected for the Real-time PCR design, of the viruses belonging to each of these lineages, specifically of the sequences corresponding to the following GenBank base access numbers AY277251 (isolated LEIV-Krnd88-190) and DQ256376 (strain 804994), respectively.

To do this, two primers, approximately 60 nucleotides in size, were designed with an overlapping fragment of approximately 20 nucleotides so that the amplification reaction could begin.

For the LEIV-Krnd88-190 isolate (GenBank: AY277251), the primers were: 5'GCCGCCACCGGAAGTTGGGTATACGGTGCTGCCTGTGACCCAACCC CAGGAGGACTGGGAT -3 '(SEQ ID NO: 52) (direct primer 4WNQ05-10, nucleotide 4WNQ-10, Krill.

5 'TTCCGAAACGGTATTGAGGGCTTACGTGGATCGCTCCATGGCTTTG ATATCCCAGTCCTCCTGGGGT -3' (SEQ ID NO: 53) (reverse primer 4WNQ e, nucleotides 10512-10578 of the LEIV-Krnd88-190 isolate)

For strain 804994 (GenBank: DQ256376), the primers were:

5'TCCGCCACCGGATGTTGAGTAGACGGTGCTGCCTGCGTCTCAACCC CAGGAGGACTGGGTG -3 '(SEQ ID NO: 54) (direct primer 5WNQF, nucleotides 10509-10570 of strain 804994)

5'CTTCCGAGGCGGTTCTGAGGGCTTACATGGATCGCTCCGCAGCTTT GTTCACCCAGTCCTCCTGGGGTT -3 '(SEQ ID NO: 55) (5WNQRe reverse primer, nucleotides 10551-10619 of strain 804994)

In the sequences of these primers, the underlined fragments correspond to the areas where the PCR primers would hybridize in real time, WNRT-F (SEQ ID NO: l) in the case of direct primers and WNRT-Re (SEQ ID NO: 2) in the case of reverse primers.

Thus, for both chimeras fragments of about 140 bp were obtained. Said amplification fragments were obtained by carrying out a conventional PCR, using as primers pairs SEQ ID NO: 52 and SEQ ID NO: 53 for the chimera of lineage 4 and SEQ ID NO: 54 and SEQ ID NO: 55 for that of the Lineage 5. The reaction began with an initial denaturation of 5 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C and 1 minute at 72 ° C, with a final elongation of 10 minutes at 72 ° C.

Once this band was obtained, it was purified with the QIAquick PCR Purification Kit (Qiagen) following the manufacturer's instructions, and was cloned into plasmids as it was indicated in section 1.2. The plasmid obtained was quantified (measurement of the amount of DNA in a spectrophotometer) and was subsequently used in real-time PC tests.

1.8. Obtaining and optimizing internal control

As previously mentioned, the method also incorporates an internal reaction control in each reaction tube to identify potential false negative results due to problems in the amplification of the samples. The internal control is amplified with the same oligonucleotides as the viral target region, but it has a heterologous fragment on which the detection probe is designed. The fragment of interest as an internal control was also cloned into a plasmid, which, once linearized, was used as an internal control

As an internal control (CI), an approach similar to that described by Fedele and collaborators mentioned above was used, adapted to this particular case, for which the same process was followed as for obtaining the chimeras of lineages 4 and 5. It is that is, overlapping primers were designed that at the ends contained the sequences of the PCR primers in Real Time and inside an exogenous sequence of a virus, in this case the BK virus, which determines the sequence to be used as a probe for Detect the internal control. It is a TaqMan probe, but marked with another fluorochrome, NED, thus avoiding interference with the one designed for WNV. The primers to amplify the IC and to amplify WNV are the same, so it is a competitive PCR.

As previously mentioned, in this case the internal control was synthesized from the following oligonucleotides:

5 '-CGGAAGTYGRGTAKACGGTGCTGCCAGCACACATGTGTCTACT-3' (SEQ ID NO: 4) (CIWNF primer)

5 '-CGGTWYTGAGGGCTTACRTGGAGTAGACACATGTGTGCTGG-3' (SEQ ID NO: 5) (CIWNRe primer)

at whose 5 'ends (underlined nucleotides) are the sequences of the direct and reverse primers used for the detection of WNV and whose amplification results in a DNA fragment that must contain in one of its strands the sequence represented by: 5'- CGGAAGTYG GTAKACGGTGCTG CCAGCACACATGTGTCTACT CCA YGTAA GCCCTCAR WACCG -3 '(SEQ ID NO: 6)

wherein the underlined and italicized fragment is the sequence complementary and inverted to that of the reverse primer designed for amplification of WNV nucleic acids, the primer of SEQ ID NO: 2, while the underlined fragment of 5 'is the sequence of the primer of SEQ ID NO: l. The fragment between the two determines the sequence to be used as a probe.

Specifically, the probe used for the detection of internal control was as follows:

5'-NED-CCAGCACACATGTGTCTACT-MGB-NFQ (SEQ ID NO: 7)

The amplification product represented by SEQ ID NO: 6 was cloned into a bacterial plasmid, using the plasmid of interest obtained, once linearized, as a reaction control, analogously to that described in previous sections 1.2-1.5. Once the plasmid was obtained, the conditions for its use were optimized. The linearized plasmid is subsequently referred to in other examples as "CI" (Internal Control).

To carry out the optimization, starting from serial dilutions in base 10 from 10,000 to 1 copies / reaction was used and sterile water was used as a negative control, all of which were tested in duplicate. For this, the following reaction mixture was prepared:

Reagent Volume

Sterile water 17.2 μΐ

2x buffer (Applied-Biosystem) 25 μΐ

WNVRT-F primer (100 pmol) 0.4 μΐ

WNVRT-Re primer (100 pmol) 0.4 μΐ

IC probe (5 μΜ) 2 μΐ

45 μΐ of said mixture and 5 μΐ of the dilution to be tested in the IC were added to each tube. The reaction began with an initial denaturation and activation of the polymerase for 10 minutes at 95 ° C, followed by 40 cycles of 15 seconds at 95 ° C and 1 minute at 60 ° C. The results are represented in Fig. 1, in which it can be seen that a limit detection of 10 copies / reaction was reached.

By analogy with analogous methods previously designed in the laboratory of the group of the inventors, it was decided to use as an internal control for viral amplification reactions an amount equivalent to 20 times the detection limit, ie 200 copies / reaction.

- Example 2.- Development of Real Time PCR

2.1. Choice of primers

To make the choice of primers and probe, they were analyzed in the program

Primer Express (Primer Express® Software v2.0, Applied Biosystems) representative sequences of each lineage (lineage 1: NY99eqhs (GenBank: AF260967); lineage 2: B956 (GenBank: AY532665); lineage 3: abensburg (GenBank: AY765264); lineage 4: LEIVKrnd88190 (GenBank: AY277251); lineage 5: 804994 (GenBank: DQ256376), lineage 6: MP502-66 (SEQ ID NO: 57)). In the 3'NC region, a proposal for primers and probes was chosen that, after being modified with the introduction of degenerate positions, were theoretically capable of amplifying and detecting all possible WNV lineages.

Initially, as detailed in Example 3, the following were chosen as primer pairs:

WNVRT-F: 5 '-CGGAAGTYGRGTAKACGGTGCTG-3' (SEQ ID NO: l)

WNVRT-Pvl: 5'- CGAGACGGTWYTGAGGGCTTAC-3 '(SEQ ID NO: 51) and as a probe, a probe with the configuration of the TaqMan MGB probes (double-labeled probe, with the donor-FAM-oligonucleotide-MGB-acceptor structure) , with the following sequence:

5 'FAM- WCCCCAGGWGGACTG-3' (SEQ ID NO: 3),

5 'marked with FAM fluorochrome.

However, as discussed in Example 3 below, the specificity tests performed with JEV, MVEV, SLEV and USUV, gave rise to detection for all of them except for SLEV. Therefore, the primers and the probe were reviewed and a change was made in the reverse primer, displacing it 4 positions in the genome (4 nucleotides were added at its 3 'end), incorporating a new degeneration and shortening it at its 5 'end. The probe was not modified. Thus, the pair of primers finally chosen was as follows:

WNVRT-F: 5 '-CGGAAGT YGRGT AKACGGTGCTG-3' (SEQ ID NO: l)

WNVRT-Re: 5 '-CGGTWYTGAGGGCTTACRTGG-3' (SEQ ID NO: 2) that determine the genomic sequence fragment of the virus between nucleotides 10530 and 10622 in the genome of the WNV EglOl isolate (GenBank accession number AF260968, whose Full sequence is reproduced as SEQ ID NO: 56).

The process for which these primers and probe are needed, as mentioned, is a real-time PCR in two steps, the first consisting of obtaining cDNA from the samples to be analyzed (SuperScript ™ III Reverse Transcriptase, Invitrogen) and subsequently PCR amplification (TaqMan® Universal PCR Master Mix, No Amperase® UNG, Applied Biosystem). Therefore, the reaction conditions for the chosen reagents were optimized.

The parameter to take into account in the optimization of the reaction is the so-called threshold cycle (Ct or Threshold Cyclé), which is inversely proportional to the initial amount of template molecules.

2.2. Real-time PCR optimization and validation

The strain used as a template was the reference strain EglOl of lineage 1 of WNV. This fragment was first amplified in a conventional PCR, using primers designed for Real Time PCR.

The amplified fragment was purified and cloned into a plasmid, following the procedure specified in Example 1. The resulting plasmid was purified, quantified and linearized, after which dilutions were obtained with known final concentrations in number of copies / μΐ to be able to carry Out optimization. All these steps were followed analogously to that described in previous trials.

To find the optimal conditions, the concentration of the primers (from 10 to 40 pmol) was varied first and then the concentration of the probe (from 50 to 400 pmol).

The final reaction conditions were as follows: Table 5: Real-time PCR reaction mixture

Reagent Volume

Sterile water 17.2 μΐ

2x buffer (Applied-Biosystem) 25 μΐ

WNV T-F primer (100 pmol) 0.4 μΐ

WNVRT-Re primer (100 pmol) 0.4 μΐ

WN probe (5 μΜ) 4 μΐ

IC probe (5 μΜ) 2 μΐ

CI 10 ⁴ 1 μΐ

45 μΐ of the mixture was added to each tube and loaded with 5 μΐ of the sample. The reaction began with an initial denaturation and activation of the polymerase for 10 minutes at 95 ° C, followed by 40 cycles of 15 seconds at 95 ° C and 1 minute at 60 ° C.

The results obtained for the lineage (strain EglOl) are represented in Fig. 2. Once obtained, a test was made with the linearized plasmids corresponding to the lineages from 1 to 5 whose production is described in Example 1, and with the strain MP502-66. To calculate the sensitivity of each of the different lineages, concentrations were used for each sample ranging from 10 ⁴ to 0.1 copies / reaction, testing each dilution in duplicate. For each of the six samples (lineages 1 to 5 and MP502-66) an approximate detection limit of 5 to 20 copies / μΐ was reached.

In this same test, the detection of the sample corresponding to isolate HU2925 / 06, which is considered to belong to a seventh lineage, was tested. For this, cDNA was obtained from the RNA of the sample, analogously to that previously described for other lineages, and the dilutions 10 ^"1 , 10 ^{" 2} and 10 ^"3 of the obtained cDNA were tested in duplicate. in Fig. 3, the 10 ^"3 dilution was not detected in either tube. Only a positive result for 10 ^"2 dilution was achieved, and there was a signal in both tubes when using 10 ^{" 1} .

2.3. Viral specificity

The specificity of the reaction was verified by obtaining negative results in the genome amplification of other encephalitis serocomplex flaviviruses. Japanese, to which WNV belongs, for which RNAs from strains available in the laboratory of the inventors' group were amplified. Specifically, the ability to detect samples of the JEV, MVEV, SLEV and USUV viruses was checked.

For this, cDNA of the strains was obtained analogously to that described in Example 1 for WNV strains, and with that cDNA, and in duplicate, the Real-Time PCR designed as described in points 2.1. and 2.2. The results obtained are summarized below in Table 6:

Table 6: Results obtained in the viral specificity test

N.D .: Not detected

Dev. St. Ct: Standard deviation of Ct

No positive clinical samples were available, but sera and / or cerebrospinal fluid (CSF) were used from patients with a clinical picture compatible with WNV infection, in which there was no real-time PCR detection and in those with other techniques The non-presence of the virus was verified. - Example 3.- Trials with other pairs of primers (Reference example)

As discussed in Example 2, initially, the following were chosen as primer pairs:

WNV TF: 5 '-CGGAAGTYGRGTAKACGGTGCTG-3' (SEQ ID NO: l) WNVRT-R1: 5'- CGAGACGGTWYTGAGGGCTTAC-3 '(SEQ ID NO: 51) and as a probe, a probe with the configuration of the TaqMan MGB probes ( doubly labeled probe, with the donor-FAM-oligonucleotide-MGB-acceptor structure), with the following sequence:

5 '- WCCCCAGGWGGACTG - 3' (SEQ ID NO: 3),

5 'marked with FAM fluorochrome.

With this pair of primers, once the conditions of the Real Time PCR were optimized (point 2.2. Of Example 2 above), the same tests described in said Example were carried out to calculate the sensitivity of the reaction with lineage strains 1 to 6, which was the same as in the definitive technique, with an average detection for the 6 lineages of 5 to 20 copies / μΐ.

However, when performing the specificity tests with JEV, MVEV, SLEV and USUV, it was observed that this pair of primers amplified JEV, MVEV and USUV, detecting the fragments amplified with the chosen probe. The results obtained are summarized below in Table 7:

Table 7: Results of the initial viral specificity test

ND: Not Detected For this reason, the primers and the probe were reviewed and a change was made in the reverse primer, displacing it 4 positions in the genome (adding 4 nucleotides at the 3 'end of the primer), incorporating a new degeneration and shortening it at its end 5 '.

As demonstrated in Example 2, with these modifications the sensitivity was similar, but the test was achieved to be specific for WNV.

The sequence homology of the primers and probe definitely chosen with WNV strains can be seen in Fig. 4A, while the relative positions in the genome of the reverse primers WNRT-Rl and WNRT-Re, as well as the sequence homology with WNV and virus strains of the same serogroup can be checked in Fig. 4B.

This Example, together with the Examples of prior art documents discussed above, illustrates the difficulties in finding a set of sequences that allow the amplification and detection of strains of all known WNV lineages with sensitivity, efficacy and specificity. Therefore, the pair of primers finally chosen, especially in combination with the probe designed for the detection of the fragment amplified by them, represents an advantage over the pairs of primers and probes known until now, which did not seem obvious to be able to reach.

Claims

1. A method for the detection of West Nile virus present in a sample comprising the steps of:

a) amplifying the West Nile virus nucleic acids present in said sample using the oligonucleotides with the sequences as primers:

5 '-CGGAAGTYG GTAKACGGTGCTG-3' (SEQ ID NO: l) (direct), and 5'- CGGTWYTGAGGGCTTACRTGG-3 '(SEQ ID NO: 2) (reverse);

b) detect the amplified nucleic acid fragment,

2. Method according to claim 1, wherein the detection of the amplified nucleic acid is performed using as a probe the sequence represented by SEQ ID NO: 3.

3. Method according to claim 1 or 2, wherein step a) of amplification of the West Nile virus nucleic acids present in the sample comprises the following sub-stages:

ii) amplification of the cDNA by Real Time PCR using as primers the oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2; and step b) of detecting the amplified nucleic acid fragment is carried out by using a fluorogenic probe consisting of a single stranded oligonucleotide, complementary to the amplified nucleic acid fragment in the PCR reaction, covalently linked to at least one fluorochrome compound.

4. Method according to claim 3, wherein the oligonucleotide used as a probe has the nucleotide sequence of SEQ ID NO: 3.

5. A method according to claim 4, wherein the oligonucleotide used as a probe is covalently linked 5 'to a first fluorochrome compound and 3' to a second fluorochrome quencher compound capable of accepting the energy emitted by the first fluorochrome when both are bound to the oligonucleotide of SEQ ID NO: 3 and dissipate it in the form of fluorescence of greater wavelength than that emitted by the first fluorochrome.

6. The method according to claim 4, wherein the oligonucleotide used as a probe is covalently bonded in 5 'to a fluorochrome compound and in 3' to a non-fluorescent quencher compound, capable of accepting the energy emitted by the fluorochrome compound when both are bound to the oligonucleotide of SEQ ID NO: 3 and containing an MGB moiety capable of binding to the minor groove of the DNA.

7. The method of claim 6, wherein the 5'-linked fluorochrome compound is 6-carboxyfluorescein (FAM).

Method according to any one of the preceding claims, wherein the amplification of the West Nile Virus nucleic acids is carried out in the presence of a DNA molecule useful as an internal control comprising a fragment that can be amplified by PC with the primers of SEQ ID NO: l and SEQ ID NO: 2 for comprising sequences complementary to both primers, located such that each chain of the DNA molecule contains the sequence of one of said primers and the sequence complementary to the other primer, said said sequences corresponding to the primers separated by a heterologous fragment, exogenous with respect to both the genome of the West Nile virus and the genome of the species from which the sample in which it is desired to check the presence of the West Nile virus has been extracted.

9. The method of claim 8, wherein the DNA molecule useful as an internal control comprises the sequence represented by SEQ ID NO: 6.

10. Method according to claim 9, wherein the amplification of the DNA useful as an internal control is detected by using a probe with the nucleotide sequence of SEQ ID NO: 7.

11. The method of claim 10, wherein the nucleotide sequence of

SEQ ID NO: 7 covalently carries a fluorochrome compound other than any fluorochrome present in the probe of SEQ ID NO: 3.

12. Method according to claim 11, wherein the fluorochrome compound is NED.

13. A method according to any one of claims 9 to 12, comprising a previous step in which a PCR amplification reaction of the oligonucleotides of SEQ ID NO: 4 and SEQ ID NO: 5 is carried out, which serve both as primers as molds, resulting in an amplification product comprising the sequence of SEQ ID NO: 6.

14. A method according to any one of the preceding claims, wherein the nucleic acids amplified in step a) of the method have been extracted from a biological sample.

15. Method according to claim 14, wherein the biological sample has been taken from a human being.

16. The method of claim 15, wherein the biological sample is selected from cerebrospinal fluid, organ samples, blood or serum samples obtained therefrom.

17. The method of claim 14, wherein the biological sample is derived from an arthropod or a bird.

18. A kit comprising the oligonucleotides of SEQ ID NO: 1 and SEQ ID

NO: 2.

19. Kit according to claim 18, further comprising a probe containing the nucleotide sequence of SEQ ID NO: 3.

20. Kit according to claim 19, wherein the probe of SEQ ID NO: 3 has a fluorochrome compound attached to the 5 'end and a non-fluorescent quencher compound 3' capable of accepting the energy emitted by the fluorochrome compound when both are bound to the oligonucleotide of SEQ ID NO: 3, a non-fluorescent quencher compound containing an MGB moiety capable of binding to the minor groove of the DNA.

21. Kit according to claim 20, which additionally contains a probe with the nucleotide sequence of SEQ ID NO: 7.

22. Kit according to claim 21, wherein the probe with the nucleotide sequence of SEQ ID NO: 8 covalently carries a fluorochrome compound other than any fluorochrome present in the probe of SEQ ID NO: 3.

23. Kit according to claim 21 or 22, further comprising the oligonucleotides of SEQ ID NO: 4 and SEQ ID NO: 5.

24. Kit according to claim 21 or 22, further comprising a DNA molecule comprising the sequence represented by SEQ ID NO: 6.

25. Kit according to claim 24, wherein the DNA molecule is a plasmid.