WO2011084815A1 - Inhibition de l'invasion et de la métastase des cellules cancéreuses médiées par l'ubc9 - Google Patents

Inhibition de l'invasion et de la métastase des cellules cancéreuses médiées par l'ubc9 Download PDF

Info

Publication number
WO2011084815A1
WO2011084815A1 PCT/US2010/061622 US2010061622W WO2011084815A1 WO 2011084815 A1 WO2011084815 A1 WO 2011084815A1 US 2010061622 W US2010061622 W US 2010061622W WO 2011084815 A1 WO2011084815 A1 WO 2011084815A1
Authority
WO
WIPO (PCT)
Prior art keywords
ubc9
antisense
mir
cancer cells
molecule
Prior art date
Application number
PCT/US2010/061622
Other languages
English (en)
Inventor
Yin-Yuan Mo
Original Assignee
Board Of Trustees Of Southern Illinois University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Board Of Trustees Of Southern Illinois University filed Critical Board Of Trustees Of Southern Illinois University
Publication of WO2011084815A1 publication Critical patent/WO2011084815A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C12N2310/3181—Peptide nucleic acid, PNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA

Definitions

  • Ubc9 has a protein sequence of 158 amino acid residues, and a UniProt Consortium accession number P63279.
  • Ubc9 is a single copy gene and is ubiquitously expressed in all human organs and tissues. As a multi-functional protein, Ubc9 has been shown to mediate diverse cellular pathways.
  • Ubc9 impacts cellular pathways through sumoylation
  • Ubc9 can also regulate cellular pathways independent of sumoylation such as nuclear transport or transcription .
  • Ubc9 is frequently up-regulated in tumor specimens. However, the role of Ubc9, if any, in cell invasion and tumor metastasis is not clear. There is a desire for additional therapeutic targets for the prevention and treatment of cancer and particularly tumor metastasis.
  • the present invention contemplates a method for inhibiting invasion or metastasis of cancer cells that contemplates enhancing the expression of miR-224 in those cells, particularly human breast cancer cells.
  • the production of miR-224 can be enhanced by several means. In one
  • the production of miR-224 is enhanced by
  • Ubc9 can be suppressed by administering an effective amount of antisense Ubc9 having a length of 10 to about 170 bases to said cancer cells, which itself can be accomplished by several techniques such as by expression of a Ubc-9siRNA in those cancer cells, and also by administration of antisense Ubc9 RNA, DNA or PNA.
  • a contemplated antisense Ubc9 molecule can have a sequence complementary to a portion of the coding region of Ubc9 mRNA, or a non-coding region such as the 5'-UTR or 3'-UTR.
  • the invention also contemplates a method for enhancing the amount of miR-224 in cancer cells that comprises inhibiting the expression of Ubc9 in those cancer cells, preferably human breast cancer cells.
  • the expression of Ubc9 can also be inhibited in several manners.
  • the expression of Ubc9 is inhibited by administering an effective amount of antisense Ubc9 as discussed above having a length of 10 to about 170 bases to the cancer cells. That administration can be carried out in vitro or in vivo as can the before-discussed enhanced production of miR-224 by suppression of the expression of Ubc-9.
  • a pharmaceutical composition is also contemplated.
  • Such a composition comprises a therapeutically effective amount of an antisense Ubc9 molecule having a length of 10 to about 170 bases, and preferably 10 to about 35 bases, as discussed above that is dissolved or dispersed in a
  • FIG. 1 illustrates the effect of Ubc9-WT (wild type) , Ubc9-DN (dominant negative mutant) and Ubc9-siRNAs on cell invasion.
  • Stable transfected or transiently transfected MDA-MB-231 human breast cancer cells (2 x 10 4 per insert) were subject to cell invasion assays as detailed hereinafter. Cell number on the membrane was counted 24 hours later.
  • Fig. 1A and Fig. IB illustrate that both Ubc9-WT and Ubc9-DN promote cell invasion.
  • the top panel in Fig. 1A is a western blot exhibiting expression of
  • Fig. 1C and Fig. ID illustrate suppression of cell invasion by Ubc9-siRNAs in which the upper panel of Fig. 1C is a western blot that illustrates inhibition of expression of Ubc9.
  • V vector
  • Fig. 1A and Fig. 1C are means ⁇ SE of three independent studies. ** p ⁇ 0.01.
  • FIG. 2 in two parts as Fig.2A and2B, illustrates the effect of Ubc9-WT, Ubc9-DN and Ubc9-siRNA-l on lung metastasis in an experimental metastasis model.
  • Stable transfected or transiently transfected MDA-MB-231 cells (1.5 x 10 6 ) were injected into female nude mice through tail veins as described hereinafter. Mice were sacrificed and tumor nodules in lung were counted 4 weeks after injection.
  • V vector
  • WT Ubc9-WT
  • DN Ubc9-DN
  • SC scrambled oligo
  • FIG. 3 four parts Figs.3A-3D, illustrates the effect of Ubc9 on miRNA expression.
  • Fig. 3A MDA-MB-231 cells transfected with vector alone or Ubc9-WT were subject to miRNA profiling by QuantiMirTM real-time PCR. Shown here is the initial profiling result based on Act values.
  • Fig. 3B shows the secondary profiling result for 35 miRNAs that were most differentially expressed. It is obvious that Ubc9 represses miR-224 (dark) , and at the same time, Ubc9
  • Fig. 3C illustrates further confirmation of the negative effect of both Ubc9-WT and Ubc9-DN on miR-224 by TaqMan® realtime PCR.
  • Fig. 3D shows that Ubc9-siRNAs enhance miR-224 expression, as detected by real-time PCR.
  • the values in Fig. 3C and Fig. 3D are means ⁇ SE of three independent studies. **, P ⁇ 0.01.
  • FIG. 4 in three parts as Figs. 4A-4C, shows that whereas miR-224 suppresses, anti-miR-224 enhances cell invasion.
  • Fig. 4A illustrates that ectopic
  • MDA-MB-231 cells were infected with vector (pCDH) or miR-224 expression vector (miR-224) and then were subject to cell invasion assays as described hereinafter.
  • Fig. 4B illustrates that anti-mi.R- 224 enhances cell invasion.
  • MDA-MB-231 cells were transiently transfected with scrambled LNA oligo (scrambled) or anti-.mi.R- 224 LNA . oligo. The cells were subjected to invasion assays 2 days after transfection.
  • Fig. 4C shows that Ubc9-mediated invasion can be blocked by miR-224.
  • Figs. 4A, 4B and 4C are means ⁇ SE of three independent experiments. ** p ⁇ 0.01. Representative fields of invaded cells are shown either on the right (Figs. 4A and 4B) or above the chart Fig. 4C.
  • Fig. 5A illustrates the effect of miR-224 on the luciferase activity of Luc-CDC42-UTR (CDC42-UTR) and Luc- CDC42-UTR-d (CDC42-UTR-d) .
  • 293T Cells human embryonic kidney cells
  • V vector control
  • miR-224 miR-224
  • 293T cells were transfected with Luc-ATF2-UTR (ATF2-UTR) along with vector control or miR-224.
  • Fig. 5C illustrates suppression of the endogenous CDC42 protein by miR-224 in MDA-MB-231 cells.
  • Fig. 5D shows a putative miR-224 binding site in the CXCR4-UTR at positions 150-156 that was deleted in Luc-CXCR4-UTR-d.
  • Fig. 5E shows the effect of miR-224 on the luciferase activity of Luc-CXCR4- UTR (CXCR4-UTR) and Luc-CXCR4-UTR-d (CXCR4-UTR-d) .
  • Fig. 5F illustrates suppression of the endogenous CXCR4 protein by miR-224 in MDA-MB-231 cells.
  • the values are means ⁇ SE of three independent experiments. **, P ⁇ 0.01; n.s, not
  • FIG. 6 illustrates that suppression of CDC42 and CXCR4 inhibits Ubc9-mediated cell invasion.
  • Fig. 6A is a western blot that reveals upregulation of CDC42 and CXCR4 in Ubc9-DN and Ubc9- T cells, respectively.
  • Fig. 6B illustrates suppression of CDC42 and CXCR4 by RNAi.
  • MDA-MB-231 cells were infected with CDC42 or CXCR4 shRNA and their expression levels were detected by western blot.
  • Fig. 6C both CDC42 and CXCR4 shRNAs are shown separately and together to suppress cell invasion.
  • the cells as indicated were subject to MatrigelTM chamber assays as detailed hereinafter. Values were means ⁇ SE of three independent studies.
  • FIG. 7 illustrates that although Ubc9-WT increases, Ubc9-DN inhibits protein sumoylation.
  • the membrane was probed with Ubc9 antibody.
  • the membrane was probed with SUMO-1 antibody.
  • Ubc9* denotes the exogenous Ubc9 (either WT or DN) ; the arrow indicates free SUMO-1.
  • V vector control; DN, Ubc9- DN; WT, Ubc9-WT.
  • FIG. 8 illustrates that Ubc9 promotes cell invasion in LM2-4142 (human breast cancer) and MDA-MB-468 (human breast cancer) cells, respectively.
  • Cells expressing vector (V) , Ubc9-DN (DN) or Ubc9-WT (WT) were subject to MatrigelTM chamber assays. Invaded cells were counted 24 hours later. The relative cell number was normalized as 100 for vector control. Values in the bar graphs are means of two studies, whereas the cell photos are representative fields of the invasive cells.
  • FIG. 9 illustrates the effect of Ubc9 on cell proliferation.
  • MDA-MB-231 Fig. 9A
  • LM2-4142 cells Fig. 9B
  • ectopically expressing Ubc9-DN or Ubc9-WT or vector alone were grown in 96-well plates and relative cell growth was determined by MTT assays at indicated time points.
  • Fig. 9C illustrates MDA-MB-231 cells transfected with scrambled oligo or Ubc9-siRNA-l and then subjected to MTT assays. Values in each graph are means ⁇ SE of three separate studies.
  • FIG. 10 illustrates overexpression of miR-224 or suppression of miR-224 by anti-miR-224, as detected by TaqMan® real-time PCR, where the vector alone or a scrambled miR-224 sequence was used as a control.
  • FIG. 11 illustrates suppression of cell invasion by
  • CDC42-siRNA CDC42-Si
  • CXCR4 shRNA CXCR4-sh#2
  • MDA-MB-231 cells were transfected with synthetic CDC42 siRNA, or MDA-MB-231 cells infected with CXCR4 shRNA #2 were subject to western blot or invasion assays.
  • Figs. 11A and 11C show western blots that reveal reduced levels of CDC42 or CXCR4, respectively.
  • Figs. 11B and 11C show MatrigelTM chamber assays that reveal suppression of invasion by CDC42-Si or CXCR-sh#2, respectively.
  • the present invention has several benefits and advantages .
  • One benefit is that cancer cell invasion or metastasis can be inhibited by enhancing the expression of miR-224, which can be achieved in several manners.
  • An advantage of the invention is that one way to enhance expression of miR-224 is to suppress the expression of Ubc-9.
  • a further benefit of the invention is that cell invasion or metastasis of breast cancer cells in particular can be achieved.
  • a further advantage of the invention is that one can enhance the amount of miR-224 in cancer cells by inhibiting expression of Ubc-9.
  • administering or “providing” refer making a molecule available to cells in vivo or in vitro, so that the molecule can act biologically on the cells, e.g., a vector which is taken up and expressed or a naked RNA which enters the cell and acts as an antisense molecule .
  • therapeutic effective amount of an antisense miR-224 refers to a result which substantially decreases the level or expression of, including for example, an about 20% reduction, preferably an about 25% reduction, more preferably an about 33% reduction, even more preferably an about 50% reduction, even more preferably an about 67% reduction, even more preferably an about 80% reduction, even more preferably an about 90% reduction, even more preferably an about 95% reduction, even more preferably an about 99% reduction, and most preferable complete silencing of miR-101.
  • an "effective amount” or “therapeutic effective amount” can refer to that which provides a substantial decrease in the level or functional activity of Ubc9 as compared to a negative control, either in an unaffected tissue from the subject being treated, or in a suitable corresponding tissue of an unaffected control animal. It can be convenient to refer to the decrease in Ubc9 in a test sample in terms of its proportion to the negative control.
  • the Ubc9 level in the test sample can be decreased by an amount equal to the level of the negative control. More preferably, the test sample level can be decreased by an amount equal to about twice the level of the negative control (a two fold reduction) . Even more
  • the level can be decreased by about five fold, about six fold, about seven fold, about eight fold, about nine fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 1000 fold, or even about 10,000 fold as compared to the level of the negative control.
  • complete silencing of Ubc9 is most preferred.
  • nucleic acid or “oligonucleotide” or “oligo” refers to multiple nucleotides (i.e., molecules comprising a sugar (e.g. ribose or
  • deoxyribose linked to a phosphate group and to an
  • exchangeable organic base which is either a substituted pyrimidine (e.g. cytosine (C) , thymidine (T) or uracil (U) ) or a substituted purine (e.g. adenine (A) or guanine (G) ) .
  • a substituted pyrimidine e.g. cytosine (C) , thymidine (T) or uracil (U)
  • a substituted purine e.g. adenine (A) or guanine (G)
  • the term also includes polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base-containing polymer.
  • Purines and pyrimidines include but are not limited to adenine, .
  • nucleic acid also encompasses nucleic acids with substitutions or modifications, such as in the bases and/or sugars.
  • nucleic acid when a "modified" nucleic acid is referred to, that nucleic acid contains at least one base that is modified, and the modification can be in the base itself as in a fluorinated base, the sugar ring as where a locked nucleic acid is used (as described hereinafter) or the base-to-base linking group that is normally a
  • phosphorothioate group is used between two bases.
  • nucleic acid includes DNAs, RNAs and peptide nucleic acids (“PNAs”) .
  • isolated nucleic acid refers primarily to a nucleic acid molecule as defined above that is a DNA, RNA or PNA or a modified DNA, RNA or PNA. That nucleic acid molecule is substantially separated from other cellular materials such as nucleic acids with which it would be associated in its natural state (i.e., with in cells or tissues) .
  • An isolated nucleic acid can further represent a molecule produced directly by biological or synthetic means and separated from other components present during its production.
  • polypeptide and “polypeptide” are used interchangeably herein and refer to a compound made up of a chain of amino acid residues linked by peptide bonds.
  • An "active portion" of a polypeptide means a peptide that is less than the full 2010/061622
  • Locked nucleic acids are a class of nucleic acid analogues in which the ribose ring is "locked” by, e.g., a methylene or ethylene bridge connecting the 2'-0 atom and the 4'-C atom.
  • LNA nucleosides contain the common nucleobases (T, C, G, A, U and mC) and are able to form base pairs
  • LNA Locking the molecule with the methylene bridge the LNA is constrained in the ideal conformation for Watson- Crick binding.
  • LNA therefore makes the pairing with a complementary
  • nucleotide strand more rapid and increases the stability of the resulting duplex.
  • LNA/DNA mixmer or “mixmer” is used to refer to a nucleic acid that contains at least one LNA unit and at least one RNA or DNA unit (e.g., a naturally-occurring RNA or DNA unit) .
  • a "headmer” is defined by a contiguous stretch of beta-D-oxy-LNA or LNA derivatives at the 5 1 -end followed by a r
  • tailmer is defined by a contiguous stretch of DNA or
  • modified monomers recognizable and cleavable by the RNaseH at the 5 1 -end followed by a contiguous stretch of beta-D-oxy-LNA or LNA derivatives towards the 3' -end.
  • a “gapmer” is based on a central stretch of 4-20 base DNA (gap) typically flanked by 1 to 6 residues of 2'-0 modified nucleotides (beta-D-oxy-LNA in our case, flanks) that are able to act via an RNaseH mediated mechanism to reduce the target sequence's level.
  • said sub-sequence comprises a stretch of 3 to about 5
  • nucleotide analogues such as LNA nucleotide analogues, as defined herein, followed by a stretch of 4 to about 20 nucleotides, which is followed by a stretch of 3 to about 5 nucleotide analogues, such as LNA nucleotide analogues as defined herein, optionally with a single nucleotide at the 3' end.
  • LNA nucleotide analogues such as LNA nucleotide analogues, as defined herein
  • said sub-sequence comprises a stretch of 3 nucleotide analogues, such as LNA nucleotide analogues, as defined herein, followed by a stretch of 15 nucleotides, which is followed by a stretch of 3 nucleotide analogues, such as LNA nucleotide analogues as defined herein, optionally with a single nucleotide at the 3' end.
  • 3 nucleotide analogues such as LNA nucleotide analogues, as defined herein
  • conjugate refers to a chemical moiety, either a nucleotide, oligonucleotide, polynucleotide or an amino acid, peptide or protein or other chemical, that when added to another sequence, provides additional utility or confers useful properties, particularly in the delivery, trafficking, detection or isolation of that sequence.
  • the conjugate is cholesterol added to the 3' end of an LNA, which confers the ability of the LNA of the invention to be cell-permeable.
  • histidine residues e.g., 4 to 8 consecutive histidine residues
  • amino acid sequences, peptides, proteins or fusion partners representing epitopes or binding determinants reactive with specific antibody molecules or other molecules (e.g., flag epitope, c- myc epitope, transmembrane epitope of the influenza A virus hemaglutinin protein, protein A, cellulose binding domain, calmodulin binding protein, maltose binding protein, chitin binding domain, glutathione S-transferase, and the like) can be added to proteins to facilitate protein isolation by procedures such as affinity or immunoaffinity chromatography. Numerous other tag moieties are known to, and may be
  • a “pharmaceutical formulation” or “pharmaceutical composition” includes formulations for human and veterinary use with no significant adverse toxicological effect.
  • composition refers to a composition or formulation that permits the effective distribution of a nucleic acid molecule of the instant invention in the physical location most suitable for their desired activity.
  • pharmaceutically acceptable carrier is intended to include any and all solvents
  • dispersion media such as dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated.
  • the phrases "enhanced” and “suppressed” used herein in relation to miR-224 or Ucb-9 in cancer cells is used to mean that one can see a difference in the amount of one or the other present between cells in an assayed sample and cells of a control. That difference can be determined by standard assays such as in situ hybridization, northern blot, blot hybridization, PCR, TMA, invader or microarray.
  • the cancer cells can also be cultured in the presence of an inhibitor. Using western or northern blot technology, a worker of ordinary skill can often observe the differences between matched sample and control samples by eye alone. Density scanning can also be used.
  • co-administration and “combination therapy” refer to providing or administering to a subject two or more therapeutically active agents.
  • the agents can be contained in a single pharmaceutical composition and be administered at the same time, or the agents can be contained in separate formulation and administered serially to a subject. So long as the two agents can be detected in the subject at the same time, the two agents are said to be coadministered.
  • Ubc9 is a multi-functional protein that promotes cell invasion and metastasis independent of sumoylation. Suppression of Ubc9 expression suppresses cell invasion and metastasis. Moreover, Ubc9 negatively regulates miR-224. Identification of CDC42 and CXCR4 as direct targets for miR-224 provides new insight into Ubc9- mediated cell invasion and metastasis.
  • Ubc9 is a therapeutic target for cancer intervention because Ubc9 is often up-regulated in various types of tumors [McDoniels-Silvers et al., (2002) Clin Cancer Res, 8 (4) : 1127-1138; Mo et al. (2005) Oncogene,
  • Ubc9-DN sumoylation-deficient Ubc9
  • Ubc9-WT sumoylation-deficient Ubc9
  • miRNAs such as miR-224 are one of its downstream players. These findings prompted conducting a profile of miRNA expression in the MDA-MB-231 cells over-expressing Ubc9 that demonstrated that miR-224 is specifically suppressed by Ubc9.
  • miRNAs such as miR-17 ⁇ 92, miR- 34, miR-21, and miR-223 have been shown to be regulated by transcription factors, such as c-MYC [He et al. , (2005)
  • miR-224 is an intronic gene embedded in the GABRE gene [Wilke et al., (1997) Genomics, 45(1):1-10], there are at least two possibilities that miR-224 can be transcriptionally regulated.
  • miR-224 is co-regulated by the GAGRE gene.
  • miR-224 may carry its own promoter.
  • the present invention thus contemplates a method for inhibiting invasion or metastasis of cancer cells by enhancing the expression of miR-224 in those cells, particularly human breast cancer cells.
  • expression of miR-224 is enhanced by expressing additional miR-224 within the cancer cell. Such additional expression can be effected by
  • transfecting infecting the cancer cells with an expression vector that expresses miR-224 or by adding a previously formed miR-224 molecule.
  • the production of miR-224 is enhanced by suppressing the expression of Ubc9 in those cancer cells. Expression of Ubc9 can itself be
  • antisense Ubc9 having a length of 10 to about 170 bases to those cancer cells, which itself can be accomplished by several techniques such as by expression of a Ubc-9siRNA in those cancer cells, and also by administration of antisense Ubc9 as one or more of RNA, DNA or PNA.
  • a contemplated antisense Ubc9 molecule can have a length of 10 to about 170 bases. More preferably, the length of the antisense molecule is 10 to about 30 bases, and most preferably, the length is about 18 to about 25 bases.
  • a contemplated antisense Ubc9 molecule specifically binds to Ubc9 mRNA and such binding can be assayed in vitro by standard techniques.
  • a contemplated antisense molecule can have a sequence that is the exact complement to a sequence in Ubc9 mRNA to which it specifically binds. Such a molecule can also contain one gap or mismatch in the complementarity to the corresponding sequence in Ubc9 mRNA as is illustrated in the sequences of CDC42 and miR-224 as shown hereinafter in Example 5.
  • the length of sequence complementarity between the specific binding sequences can be between six or more bases.
  • binding can occur within a coding region of the mRNA
  • the antisense molecule binds in a non-coding region such as in the 5'-UTR or the 3'-UTR. That is, the antisense molecule has a sequence that is complementary to the coding region of the Ubc9 mRNA, whereas in other aspects, the antisense molecule has a sequence that is complementary to a non-coding region of that mRNA.
  • the siRNA molecules are understood to be complementary to the coding region of Ubc9 mRNA whereas, miR-30c or miR-30e are understood 1622
  • a method for inhibiting invasion or metastasis of cancer cells in accordance with the invention includes, can further include administering to the subject (animal) one or more compounds (or agents) selected from the group consisting of a radionuclide, cancer chemotherapeutic agent, targeted anticancer agent, DNA interacalating/damaging agent, cell cycle check point inhibitor, anti-metabolite, HSP inhibitor, antibiotic, kinase inhibitor, radionuclide,
  • This method also includes administering to the animal one or more compounds (or agents) selected from the group consisting of ⁇ - ⁇ 1, 90 ⁇ , ⁇ , 2113 ⁇ 4t,
  • bleomycin busulphan
  • cisplatin carboplatin, carmustine, capecitabine, chlorambucil, cytarabine, cyclophosphamide, camptothecin, dacarbazine, dactinomycin, daunorubicin,
  • dexrazoxane docetaxel, doxorubicin, etoposide, epothilones, floxuridine, fludarabine, fluorouracil, gemcitabine,
  • hydroxyurea idarubicin, ifosfamide, irinotecan, lomustine, mechlorethamine, mercaptopurine, meplhalan, methotrexate, rapamycin, sirolimus, mitomycin, mitotane, mitoxantrone, nitrosurea, pamidronate, pentostatin, plicamycin,
  • procarbazine procarbazine, rituximab, streptozocin, teniposide,
  • thioguanine thiotepa
  • taxane vinblastine, vincristine, vinorelbine, taxol, a combretastatin, a discodermolide
  • bevacizumab carboxyamidotriazole, TNP-470, C 101, IFN-a, IL- 12, platelet factor-4, suramin, SU5416 (semaxanib) ,
  • thrombospondin VEGFR antagonists, cartilage-derived angiogenesis inhibitory factor, angiostatin, endostatin, 2-methoxyestradiol, tecogalan, thrombospondin, prolactin, ⁇ 3 inhibitor, tecogalan, BAY 12-9566 (tanomastat) , AG3340
  • vatalanib fumagillin, an analogue of fumagillin, BB-94 (batimastat) , linomide, oxaliplatin, paclitaxel and
  • a pharmaceutical composition (or formulation) in accordance with the invention can be, e.g., carried in a liposome, polymer-based nanoparticle, cholesterol conjugate, cyclodextran complex, polyethylenimine polymer or a protein complex.
  • a pharmaceutical composition in accordance with the invention can be, e.g., formulated administration directly to diseased tissue, intravenously, subcutaneously,
  • intramuscularly nasally, intraperitonealy, vaginally, anally, orally, intraocularly or intrathecally.
  • a composition provided by the invention includes one modified to facilitate cell-type selective targeting or to enhance the uptake of oligonucleotides. These include, e.g., modifications that target specific receptors (CTLs, cell targeting ligands) and agents that enhance transmembrane permeation (primarily cell penetrating peptides, CPPs) .
  • CTLs target specific receptors
  • CPPs transmembrane permeation
  • Suitable CTLs include lipoprotein receptors (particularly those in the liver), integrins and receptor tyrosine kinases.
  • Suitable CPPs include polycationic peptides rich in arginine and lysine and membrane-interactive hydrophobic sequences, e.g., KALA peptide ( EAKLAKALAKALAKHLAKALAKALKACEA (SEQ ID NO: 10), PG peptide (GALFLGWLGAAGSTMGAPKKKRKV (SEQ ID NO: 11), R9 peptide (RRRRRRRRR (SEQ ID NO: 12), Transportan (GenBank
  • the invention provides a method that contemplates transfecting cancer cells, which are preferably breast cancer cells, in vitro. Suitable methods of in vitro transfection are well known and- are exemplified hereinafter. Among those illustrative methods is transfection by infection of the target cell with a lentiviral vector or an adenoviral vector.
  • Suitable methods of in vivo transfection are also contemplated by the invention and are well known in the art, and can often also be used for in vitro transfection.
  • Illustrative examples of methods of in vivo transfection include delivery using liposomes or nanoparticles, in
  • albumin bound nanoparticles coupling to peptides or stabilizing the oligonucleotides by chemical modification such as 2 ' -O-methylation or 2 ' - 4 ' linkage of the sugar phosphate backbone.
  • chemical modification such as 2 ' -O-methylation or 2 ' - 4 ' linkage of the sugar phosphate backbone.
  • LNA Longed Nucleic Acid
  • RNAfectinTM Transfection Reagent an aqueous lipid-based liquid 10061622
  • composition available from QIAGEN, Inc., Valencia CA, for transforming cells with antisense molecules.
  • the targeting portion is an analog of an oligonucleotide wherein at least one of the 2 ' -deoxy ribofuranosyl moieties of the nucleoside unit is modified.
  • a hydrogen or a hydroxyl, halo, azido, amino, methoxy or alkyl functional group can be added.
  • heterocycloalkyl aminoalkylamino, heterocycloalkylamino, polyalkylamino, substituted silyl, a RNA cleaving moiety or a group for improving the pharmacodynamic properties of an oligonucleotide or a group for improving the pharmacokinetic properties of an oligonucleotide where alkyl is a straight or branched chain of Ci to Ci 2 , can be used, with unsaturation within the carbon chain, such as allyloxy, being particularly preferred, and "lower alkyl" being Ci ⁇ C6.
  • Suitable modifications of the antisense oligonucleotides in accordance with the invention include those resulting in cyclobutyl moieties, e.g., cyclobutyl moieties that include a purine or pyrimidine heterocyclic base attached at a C-l cyclobutyl position and where cyclobutyl moieties are joined through a C-2, C-3 or C-4 position on a first of said cyclobutyl moieties and a C-2, C-3, or C-4
  • such embodiments include nucleosides, nucleoside analogs, nucleotides, nucleotide analogs, heterocyclic bases, and heterocyclic base analogs based on the purine ring system.
  • a pharmaceutical composition is also contemplated. Such a composition is typically utilized in a contemplated method as discussed herein.
  • One contemplated pharmaceutical composition comprises an effective amount of an antisense Ubc9 discussed before dissolved or dispersed in a pharmaceutically acceptable carrier.
  • a useful pharmaceutically acceptable carrier is well known in the art and is typically aqueous and is a liquid at room temperature .
  • a contemplated antisense molecule-containing composition comprises one or more of a DNA, RNA, LNA or PNA molecule having a length of 10 nucleotides to about 170 nucleotides, preferably 10 to about 30 nucleotides in length, more preferably about 18 to about 25 nucleotides in length.
  • the in vitro administration of the antisense Ubc9 composition to a cell reduces the level of Ubc9 in that cell by at least about 50%, preferably by at least about 80%, more preferably by at least about 90% and most preferably by at least about 95% or inhibits the Ubc9 activity in that cell by at least about 50%, preferably by at least about 80%, more preferably by at least about 90% and most preferably by at least about 95% as measured by any suitable assay known to those of ordinary skill in the art including, such as are described hereinafter.
  • An antisense Ubc9 molecule in accordance with one aspect of the invention contains one or more pseudophosphate bonds at one or both of the 3'- and 5' -termini, and preferably a plurality of pseudophosphate bonds at each of the 3'- and 5'-termini.
  • Such antisense Ubc9 molecules can be in the form of a pri-miRNA, pre-miRNA, mature miRNA, ds miRNA and
  • the antisense Ubc9 molecule is a naked synthetic RNA.
  • the antisense Ubc9 molecule is a synthetic, chemically modified RNA or DNA that has been modified with a chemical moiety selected from the group consisting of a boranophosphate, 2' -O-methyl, 2'-fluoro, PEG, terminal inverted-dT base, and combinations thereof and/or modified to include a 2'-F, 2'-ara-F (FANA) , 4'- thioribose, 2'-OMe, 2'- OE, NMAC, D AEAc, LNA, ENA,
  • a chemical moiety selected from the group consisting of a boranophosphate, 2' -O-methyl, 2'-fluoro, PEG, terminal inverted-dT base, and combinations thereof and/or modified to include a 2'-F, 2'-ara-F (FANA) , 4'- thioribose, 2'-OMe, 2'- OE, NMAC, D AEAc, LNA, ENA,
  • Another contemplated pharmaceutical composition comprises a therapeutically effective amount of miR-224 dissolved or dispersed in a pharmaceutically acceptable carrier.
  • a contemplated miR-224 molecule can be a miR-224 RNA, DNA or PNA as discussed elsewhere.
  • Another contemplated pharmaceutical composition contains a vector that expresses miR-224 that provides an effective amount of miR-224 by transfecting the cancer cells.
  • the vector that expresses miR-224 is a viral vector so that the miR-224 is provided by transduction.
  • the viral vector is a lentiviral vector or an adenoviral vector.
  • the invention contemplates a pharmaceutically acceptable carrier containing dissolved or dispersed therein an antisense Ubc9 molecule that comprises an effective amount of a DNA, RNA, LNA or PNA molecule 10 nucleotides to about 170 nucleotides in length, preferably 10 to about 30 bases and more preferably about 18 to about 25 nucleotides in length, wherein the in vitro administration of the antisense Ubc9 molecule to a cancer cell, preferably a breast cancer cell, reduces the level of Ubc9 in that cell by at least 50% or inhibits the activity of Ubc9 in that cell by at least 50%.
  • a cancer cell preferably a breast cancer cell
  • Suitable oligonucleotides useful in various embodiments of the present invention can be composed of naturally occurring nucleobases, sugars and internucleoside (backbone) linkages as well as oligonucleotides having non- naturally-occurring portions that function similarly or with specific improved functions. Fully or partly modified or substituted oligonucleotides are often preferred over native forms because of several desirable properties of such
  • oligonucleotides for instance, the ability to penetrate a cell membrane, good resistance to extra- and intracellular nucleases, high affinity and specificity for the nucleic acid target.
  • Suitable oligonucleotides can be unmodified or chemically modified single-stranded DNA molecules.
  • oligonucleotide hybridizes with Ubc9 mRNA under stringent conditions (e.g., high salt, high temperature).
  • a contemplated antisense Ubc9 molecule is preferably an oligonucleotide that contains one to more preferably up to about 8 non-phosphodiester bonds between (linking) the nucleobases. Such non-phosphodiester bonds are preferably arrayed at both the 5'- and the 3' -termini of the molecule. Contemplated non-phosphodiester bonds are referred to herein as pseudophosphate bonds, and. are resistant to exonuclease T/US2010/061622
  • pseudophosphate bonds include, but are not limited to,
  • exonuclease-and/or endonuclease- resistant oligonucleotides can be obtained by blocking the 3'- and/or 5' -terminal nucleotides with substituent groups such as acridine, caps such as 5-methylguanosine or poly (A) tails, as are well known in the art.
  • LNA modification is deemed herein to be a pseudophosphate bond. LNA modification is also deemed to embrace both methylene and ethylene linkages between the 2'- and 4 '-positions of the sugar ring of a nucleotide base.
  • That LNA modification is also particularly preferred to be present at least between at least the two terminal bases at each of the 3'- and 5' -termini of an antisense Ubc9
  • LNA modification can be used along with phosphodiester bonds as well as non-phosphodiester bonds between the bases.
  • LNA phosphoramidite monomers are available from Exiquon and also from Glen Research Corp. of Sterling, VA, and can be used herein.
  • Suitable antisense Ubc9 molecules include those in which one or more of the bases is modified, e.g., to include a 2'-F, 2'-ara-F, FANA ( 2 ' -fluoro-p-D-arabinonucleic acid), 4'- thioribose, 2 1 -OMe (i.e., 2 -O-methyl backbone), 2 ' -MOE (2'-0- dimethylaminoethyloxyethyl-modified) , NMAC .
  • the bases is modified, e.g., to include a 2'-F, 2'-ara-F, FANA ( 2 ' -fluoro-p-D-arabinonucleic acid), 4'- thioribose, 2 1 -OMe (i.e., 2 -O-methyl backbone), 2 ' -MOE (2'-0- dimethylaminoethyloxyethyl-modified) , NMAC
  • an Ubc9 antisense molecule in accordance with the invention includes that wherein the molecule comprises, e.g., a gapmer, mixmer or headmer.
  • An antisense Ubc9 composition or formulation in accordance with the invention can further comprise a pharmaceutically- acceptable carrier.
  • the antisense Ubc9 molecules provided by the invention include those where at least one of said one or more DNA, RNA , LNA or PNA oligonucleotides is modified by the addition of any one of cholesterol, bis-cholesterol, PEG, PEG- ylated carbon nanotube, poly-L- lysine, cyclodextran,
  • oligonucleotides in accordance with the invention can be modified by any polymeric species including a synthetic or naturally occurring polymer or protein.
  • nucleic acids administered in vivo are taken up and distributed to cells and tissues [Huang, et al., (2004) FEBS Lett. 558 (1-3) : 69-73] .
  • Nyce et al. have shown that antisense oligodeoxynucleotides (ODNs) when inhaled bind to endogenous surfactant (a lipid produced by lung cells) and are taken up by lung cells without a need for additional carrier lipids [Nyce et al., (1997) Nature, 385:721-725].
  • ODNs antisense oligodeoxynucleotides
  • siRNAs have been used for therapeutic silencing of an endogenous genes by systemic administration [Soutschek et al., (2004) Nature 432:173-178].
  • Ubc9 to be administered in the treatment or prophylaxis of disease, the physician evaluates circulating plasma levels, formulation toxicities, and progression of the disease.
  • the dose administered to a 70 kilogram patient is typically in the range equivalent to dosages of currently-used therapeutic antisense oligonucleotides such as VitraveneTM (fomivirsen sodium injection) that is approved by the FDA for treatment of cytomegaloviral RNA, adjusted for the altered activity or serum half-life of the relevant composition.
  • Antisense Ubc9 is administered to cells in an effective amount, e.g., about 100 nM per 70% confluent cells in a 6- or 12-well plate. In vitro lentiviral infections are typically carried out at about multiplicity of infection of about 1 to about 3.
  • the pharmaceutically acceptable carrier is preferably adapted for parenteral administration as compared to oral or topical administration.
  • pharmaceutically acceptable salts, buffers and the like are present that collectively are referred to as pharmaceutically acceptable diluents as compared to those that can be present in a composition that is not intended for pharmaceutical use, as in an in vitro assay.
  • a contemplated antisense Ubc9 molecule is typically a polyphosphate ester that is anionic at physiological pH values and is usually present in a contemplated pharmaceutical formulation or composition as a salt of a cation such as sodium, potassium, magnesium or ammonium ions, or mixtures of such cations.
  • a contemplated pharmaceutical formulation or composition as a salt of a cation such as sodium, potassium, magnesium or ammonium ions, or mixtures of such cations.
  • Further pharmaceutically acceptable cations can be found in Berge, (1977) J. Pharm. Sci. 68(1):1-19 for lists of commonly used pharmaceutically acceptable acids and bases that form pharmaceutically acceptable salts with pharmaceutical compounds.
  • the antisense Ubc-9 can be present as part of a vector such as a lentivector discussed elsewhere, or as an isolated nucleic acid free of a vector (as an
  • a contemplated pharmaceutical composition or formulation can be administered containing conventional nontoxic pharmaceutically acceptable carriers, adjuvants, and vehicles as desired, and is preferably adapted for parenteral administration.
  • parenteral as used herein includes subcutaneous injections, intravenous (which is most
  • intramuscular, intrasternal injection, or infusion techniques intramuscular, intrasternal injection, or infusion techniques.
  • Formulation of drugs is discussed in, for example, Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania; 1975 and Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980.
  • a preferred injectable preparation for example, sterile, injectable aqueous solution or suspension can be formulated according to the known art using suitable
  • dispersing or wetting agents and suspending agents are dispersing or wetting agents and suspending agents.
  • acceptable vehicles and solvents that can be employed are water, Ringer's solution, and isotonic sodium chloride solution, phosphate-buffered saline.
  • Sterile water solutions of antisense Ubc9 or sterile solution of antisense Ubc9 in a room temperature liquid that is mostly water and also comprises ethanol or propylene glycol are examples of liquid compositions suitable for parenteral administration.
  • a contemplated antisense Ubc9 is provided as a dry powder, typically a lyophilized powder that is to be dissolved in an appropriate liquid medium such as sodium chloride for injection prior to use.
  • a sterile solution can be prepared by dissolving the antisense Ubc9 in 2
  • a mammal in need of treatment (a subject) and to which a pharmaceutical composition containing a contemplated compound is administered can be a primate such as a human, an ape such as a chimpanzee or gorilla, a monkey such as a
  • cynomolgus monkey or a macaque a laboratory animal such as a rat, mouse or rabbit, a companion animal such as a dog, cat, horse, or a food animal such as a cow or steer, sheep, lamb, pig, goat, llama or the like.
  • a sample to be assayed such as cells and tissue can be used.
  • These in vitro compositions typically contain the water, sodium or potassium chloride, and one or more buffer salts such as and acetate and phosphate salts, Hepes or the like, a metal ion chelator such as EDTA that are buffered to a desired pH value such as about pH 4.0 to about 8.5, preferably about pH 7.2 to about 7.4, depending on the assay to be performed, as is well known .
  • the pharmaceutical composition is in unit dosage form.
  • the composition is divided into unit doses containing appropriate quantities of the
  • the unit dosage form can be a packaged
  • the package containing discrete quantities of the preparation, for example, in vials or ampules.
  • IRDye 800CW or IRDye 680 were purchased from LI-COR Biosciences (Lincoln, NE) .
  • PCR primers were purchased from Sigma-Genosys (Woodland, TX) or IDT (Coralville, IA) and LNA antagomirs were purchased from IDT.
  • CDC42 shRNAs and CXCR4 shRNAs were purchased from Open Biosystems (Huntsville, AL) , as catalogue entries RHS4531- NM_001039802 and RHS4531- NM_001008540, respectively.
  • Synthetic CDC42 siRNA was from Santa Cruz (Santa Cruz, CA) .
  • Ubc9-siRNAs were from Ambion, now Applied Biosystems (Foster City, CA) , as catalogue entries sl4590 and sl4591.
  • MDA- MB-231, LM2-4142 and MDA-MB-468 cells were grown in RPMI 1640 (Cambrex, Walkersville, MD) supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich, St. Louis, MO) .
  • FBS fetal bovine serum
  • 293T Cells were cultured in Dulbecco' s modified Eagle's medium (DMEM)
  • RNA profiling using QuantiMirTM kit (System Biosciences, Mountain View, CA) .
  • a total of 474 miRNAs registered in Sanger miRBases (version 9.2) were ' profiled in this study.
  • Three ⁇ g total RNA was first anchor-tailed by poly A polymerase, and then annealed by an oligo dT adapter at 60°C for 5 minutes.
  • 10 iL of RT master mix [1.5 ⁇ of water, 4 pL 5 x buffer, 1.5 ]iL of 0.1 M DTT, 2 ⁇ , of 10 mM dNTPs, 1 ⁇ > of reverse transcriptase (RT) ] were combined with 10 ⁇ , template (poly A tailed) .
  • the 20 ⁇ RT reaction was incubated at 42°C for 60 minutes, 95° C for 10 minutes, cooled to room temperature, and then diluted 6-fold with 100 pL of water .
  • Wild type Ubc9 (Ubc9-WT) or dominant negative mutant Ubc9 (Ubc9-DN) was constructed in pCMV-Myc as previously described [Lu et al., (2006) Exp Cell Res, 312 (10) : 1865-1875] .
  • the same DNA fragment carrying Myc-Ubc9 or Myc-Ubc9-DN was also cloned into a lentiviral vector pCDH-CMV-MCS-EFl-copGFP (pCDH, System Biosciences) . Restriction enzyme sites were introduced by PCR using standard methods.
  • a plasmid expressing miR-224 an about 0.5 lb DNA fragment covering the pre-microRNA was first amplified using genomic DNA from a healthy blood donor as a template. PCR reactions were performed using the high fidelity Phusion® enzyme (New England Biolabs Ipswich, MA) and corresponding specific primers: mxR-224-5.1 (sense)
  • the luciferase-UTR reporter plasmids such as Luc- CDC42-UTR and Luc-CXCR4-UTR, were constructed by introducing the CDC42 or CXCR4 3'-UTR carrying a putative miR-224 binding site into pGL3 control vector (Promega, Madison, WI) .
  • pGL3 control vector Promega, Madison, WI
  • CDC42 or CXCR4 3'-UTR sequence was amplified from MCF-IOA cDNA using PCR primers:
  • PCR products were also first cloned into a PCR cloning vector and then subcloned into a modified pGL3 control vector as described previously [Sachdeva et al. , (2009) Proc Natl
  • Transfection of 293T cells was carried out using the calcium phosphate method, as described previously [Mo et al., (1999) Exp Cell Res, 252 (1) : 50-62 ] .
  • the transfected cells were cultured overnight (about 18 hours) before they were harvested and lysed for luciferase assay or for extraction of protein or RNA.
  • Luciferase assay was carried out in 293T cells to determine the effect of miR-224 on the activity of Luc-CDC42- UTR or Luc-CXCR4-UTR. First, cells were transfected with appropriate plasmids in 12-well plates. Then, the cells were harvested and lysed for luciferase assay 24 hours after transfection. The assays were carried out using a luciferase assay kit (Promega) according to the manufacturer's protocol. ⁇ -Galactosidase or renilla luciferase was used for normalization .
  • PCR reactions were performed to amplify the 3'-UTR of CDC42 or CXCR4 according to the standard three-step procedure. Annealing temperature varied depending on the primers used.
  • RT-PCR total RNA was isolated using Trizol reagent (Invitrogen) per the manufacturer's protocol. To detect mature miR-224 expression in cell lines, Trizol reagent was also used to isolate total RNA, which was then amplified by TaqMan® stem-loop RT-PCR method, as described previously [Chen et al., (2005) Nucleic Acids Res, 33 (20) : el79; Lao et al., (2006) Bioche Biophys Res Commun, 343 (1) : 85-89] .
  • Ubc9-siRNAs were seeded into inserts at 2-4 x 10 4 per insert in serum-free medium and then transferred to wells filled with the culture medium containing 10% FBS. After 24 hours of incubation, non-invading cells on the top of the membrane were removed by cotton swabs. Invaded cells on the bottom of the membrane were fixed, followed by staining with 0.05% crystal violet .
  • Invaded cells on the membrane were then counted as follows. Because the distribution of cells on the membrane was not always even, a photo was taken at a low magnification, and the image was then enlarged in a computer screen with grids so that all of the cells on the entire membrane were counted.
  • mice Female athymic nude (nu/nu) mice (4-5 weeks old) were purchased from Harlan Sprague Dawley (Indianapolis, IN) and were maintained in the Southern Illinois University School of Medicine's accredited animal facility. All animal studies were conducted in accordance with NIH animal use guidelines and a protocol approved by SIU Animal Care Committee. In brief, 1.5 x 10 6 exponentially growing MDA-MB-231 cells (vector control, Ubc9-WT, Ubc9-DN, scrambled oligo or Ubc9-siRNA-l ) were injected into nude mice through tail veins. Four weeks after injection, the animals were sacrificed. The lungs were harvested, fixed in Bouin's solution and tumor nodules were countered. Statistical analysis
  • Ubc9 expression was suppressed by Ubc9 specific siRNAs.
  • Ubc9-siRNA-l and Ubc9- siRNA-2 efficiently suppressed Ubc9 expression, as detected by Western blot.
  • Invasion assay indicated that Ubc9-siRNA-l substantially inhibited invasiveness of MDA-MB-231 cells (Fig. 1C and D) .
  • a similar inhibitory result was also seen with Ubc9-siRNA-2 , which was derived from a different location of the Ubc9 sequence.
  • This example illustrates the effect of Ubc9 on metastasis in an experimental model.
  • Ubc9-DN had the same effect on invasion and metastasis as Ubc9-WT, it was not included in the profiling assays.
  • miRNAs were particularly interesting because as non-coding RNAs, miRNAs have been shown to play an important role in tumor metastasis [Ma et al., (2007) Nature, 449 (7163) : 682- 688].
  • Fig. 3A A total of 474 miRNAs were profiled by real time PCR. As shown in Fig. 3A, the vast majority of miRNAs were expressed at similar levels between Ubc9-WT and vector control. Only a small fraction of miRNAs were differentially expressed. Thirty-five miRNAs were selected that revealed the most differential expression for further verification, and showed that three miRNAs, miR-224, miR-200b and miR-559, were most down-regulated or up-regulated (dark bars), Fig.3B.
  • Ubc9-DN both suppressed miR-224 using TaqMan® real time PCR as is shown (Fig. 3C) .
  • Ubc9-siRNAs increased miR- 224 expression (Fig. 3D) .
  • This example illustrates suppression of cell invasion by miR-224. Suppression of miR-224 by Ubc9 suggests that miR-224 may play a suppressive role in invasion.
  • miR-224 was ectopically expressed in MDA- B-231 cells and the invasion ability was then measured. Fluorescence microscopy confirmed a high transduction rate (over 90%) and real-time PCR revealed a high level of mature miR-224 compared to vector control (Fig. 10A) . As expected, miR-224 significantly reduced the number of invaded cells (Fig. 4A) . For example, miR-224 infected cells revealed only 45% of invaded cells.
  • miR-224 was suppressed by anti-miR-224.
  • miR-224 is an important effector in the Ubc9-mediated cell invasion.
  • a miR-224 expression vector was introduced into the Ubc9 over-expressing MDA-MB-231 cells by infection, and the possible miR-224- induced blockage of Ubc9 induced-invasion was assayed. As shown in Fig. 4C, miR-224 significantly suppressed Ubc9- induced invasion.
  • miR-224 caused over 50% reduction of invasion in the cells that were
  • miR-224 suppressed the luciferase activity of Luc-CDC42-UTR by about 60% compared to vector control, whereas the result for ATF2 was similar to the control.
  • the site was deleted, providing Luc-CDC42-UTR-d. This deletion abolished the suppression activity of miR-224 (Fig. 5B) , suggesting that miR-224 silences CDC42 expression through interaction with this binding site.
  • a partial sequence of CDC42 UTR with putative miR- 224 binding site at positions 747-753 is shown below as SEQ ID • NO: 14, whereas the pertinent ' portion of miR-224 that contains the sequence that can hybridize with a portion of CDC42 UTR is shown as SEQ ID NO: BBBB, with the hybridizable sequence underlined for added clarity.
  • the endogenous miR-224 was suppressed by antisense miR-224. This suppression enhanced the luciferase activity compared to that obtained using a scrambled sequence by about 30% (data not shown), which was a statistically significant amount.
  • the antisense miR-224 utilized for these studies contained locked nucleic acids (LNA) as each of the three bases at each of the termini of the oligonucleotide molecule.
  • LNA locked nucleic acids
  • SEQ ID NO: 16 The sequence of the antisense molecule used is shown below as SEQ ID NO: 16, and the molecule is referred to as hnti-miR-224.
  • Anti-miR-224 AACGGAACCACTAGTGACTTG
  • SEQ ID NO: 16 A western blot study detected a reduced level of the endogenous CDC42 in cells to which miR-224 was administered compared to vector control administration (Fig. 5C) , further supporting a suppressive role of miR-224 in CDC42.
  • miR-224 Similar to the results of CDC42, miR-224 also suppressed CXCR4 in a statistically significant manner, and had no apparent effect on AFT2 (Fig. 5D) . Further analysis indicated that miR-224 exerted its silencing function by directly binding to the miR-224 site in the 3'-UTR of CXCR4 (Fig. 5E) . In contrast, anti-mi.R-224 enhanced the luciferase activity of Luc-CXCR4-UTR. Finally, miR-224 suppressed the endogenous CXCR4 (Fig. 5F) .
  • CXCR4 UTR with putative miR-224 binding site at positions 150-156 is shown below SEQ ID NO: 17, whereas the pertinent portion of miR-224 that contains the sequence that can hybridize with a portion of CXCR4 UTR shown as SEQ ID NO : BBBB, with the hybridizable sequence underlined for added clarity.
  • This example shows that suppression of CDC42 and CXCR4 inhibits Ubc9-mediated cell invasion.
  • Ubc9 indirectly affects CDC42 and CXCR4 levels
  • the CDC42 and CXCR4 levels in Ubc9-DN or Ubc9-WT cells were examined.
  • Ubc9-DN and Ubc9-WT up- regulated CDC42 and CXCR4 as compared to use of the vector alone (Fig. 6A) .
  • CDC42 and CXCR4 were suppressed by RNAi (Fig. 6B) . It was noted that knockdown of CDC42 also slightly suppressed CXCR4, and vise versa for some reason.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention a pour objet une méthode d'inhibition de l'invasion ou de la métastase des cellules cancéreuses qui concerne l'augmentation de l'expression de miR-224 dans ces cellules, en particulier les cellules du cancer du sein humain. La production de miR-224 peut être augmentée par la suppression de l'expression d'Ubc9 dans ces cellules cancéreuses. L'expression d'Ubc9 peut être supprimée par l'administration à ces cellules cancéreuses d'une quantité efficace d'Ubc9 antisens ayant une séquence complémentaire d'une partie de la région codante ou d'une région non codante de l'ARNm d'Ubc9 et possède une longueur de 10 à environ 170 bases.
PCT/US2010/061622 2009-12-21 2010-12-21 Inhibition de l'invasion et de la métastase des cellules cancéreuses médiées par l'ubc9 WO2011084815A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US28872709P 2009-12-21 2009-12-21
US61/288,727 2009-12-21

Publications (1)

Publication Number Publication Date
WO2011084815A1 true WO2011084815A1 (fr) 2011-07-14

Family

ID=44305746

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/061622 WO2011084815A1 (fr) 2009-12-21 2010-12-21 Inhibition de l'invasion et de la métastase des cellules cancéreuses médiées par l'ubc9

Country Status (1)

Country Link
WO (1) WO2011084815A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106822171A (zh) * 2017-01-10 2017-06-13 哈尔滨医科大学 Ubc9的反义核苷酸序列在制备抑制癌细胞生长药物中的应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020031818A1 (en) * 2000-06-22 2002-03-14 Ronai Ze?Apos;Ev A. Modification of Mdm2 activity
US20080306017A1 (en) * 2006-01-05 2008-12-11 The Ohio State University Microrna-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Lung Cancer
US20090017103A1 (en) * 2003-09-12 2009-01-15 Hassan Adwan Antisense oligonucleotides for prevention of metastasis formation of cancer cells
US20090176723A1 (en) * 2004-11-12 2009-07-09 David Brown Methods and compositions involving miRNA and miRNA inhibitor molecules

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020031818A1 (en) * 2000-06-22 2002-03-14 Ronai Ze?Apos;Ev A. Modification of Mdm2 activity
US20090017103A1 (en) * 2003-09-12 2009-01-15 Hassan Adwan Antisense oligonucleotides for prevention of metastasis formation of cancer cells
US20090176723A1 (en) * 2004-11-12 2009-07-09 David Brown Methods and compositions involving miRNA and miRNA inhibitor molecules
US20080306017A1 (en) * 2006-01-05 2008-12-11 The Ohio State University Microrna-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Lung Cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
MOSCHOS ET AL.: "SAGE and antibody array analysis of melanoma-infiltrated lymph nodes: identification of Ubc9 as an important molecule in advanced-stage melanomas.", ONCOGENE, vol. 26, 2007, pages 4216 - 4225 *
SACHDEVA ET AL.: "MicroRNA-145 suppresses cell invasion and metastasis by directly targeting mucin 1.", CANCER RESEARCH, vol. 70, no. 1, 8 December 2009 (2009-12-08), pages 378 - 387, XP055090431, DOI: doi:10.1158/0008-5472.CAN-09-2021 *
ZHU ET AL.: "Ubc9 promotes breast cell invasion and metastasis in a sumoylation-independent manner", ONCOGENE, 12 April 2011 (2011-04-12), Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2845735> *
ZHU ET AL.: "Ubc9 promotes breast cell invasion and metastasis in a sumoylation-independent manner", ONCOGENE, vol. 29, no. 12, 21 December 2009 (2009-12-21), pages 1763 - 1772 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106822171A (zh) * 2017-01-10 2017-06-13 哈尔滨医科大学 Ubc9的反义核苷酸序列在制备抑制癌细胞生长药物中的应用
CN106822171B (zh) * 2017-01-10 2019-12-03 哈尔滨医科大学 Ubc9的反义核苷酸序列在制备抑制癌细胞生长药物中的应用

Similar Documents

Publication Publication Date Title
US10526602B2 (en) Segmented micro RNA mimetics
JP6851201B2 (ja) ポンペ病の治療に有用なアンチセンスオリゴヌクレオチド
EP2547769B1 (fr) Antagonistes d&#39;arnmi d&#39;oligonucléotides de molécules se liant au sillon mineur (mgb)
EP1986697B1 (fr) Compositions et procédés permettant l&#39;inhibition de silençage de gènes par l&#39;interférence arn
US10538763B2 (en) Compounds and methods for modulation of DUX4
JP2017140030A (ja) 治療剤のためのｕｎａオリゴマーおよびアミダイト
JP2018500027A (ja) リガンド修飾二本鎖核酸
EP4126070A2 (fr) Synthèse d&#39;oligonucléotides modifiés à stabilité accrue
KR20220069103A (ko) 최소 플루오린 함량을 갖는 작은 간섭 rna의 화학적 변형
US20230365974A1 (en) Compositions and methods for inhibiting gys2 expression
EP2142672B1 (fr) Compositions et procédés pour le silençage de gènes
WO2011084815A1 (fr) Inhibition de l&#39;invasion et de la métastase des cellules cancéreuses médiées par l&#39;ubc9
WO2014053014A1 (fr) Modulation de l&#39;activité arn et de la perméabilité vasculaire
WO2011068865A1 (fr) Le micro-arn-101 stimule la croissance indépendante des œstrogènes et confère une résistance au tamoxifène dans des cellules cancéreuses er-positives
JPWO2007126150A1 (ja) 癌の新規治療用組成物
Stetsenko Mesyl Phosphoramidate Oligonucleotides: A New Promising Type of Antisense Agents
US20160152979A1 (en) Novel compounds
WO2022266486A2 (fr) Produits et compositions
CN114829601A (zh) Sbds抑制剂用于治疗乙型肝炎病毒感染的用途
EP4359526A1 (fr) Thérapie d&#39;inactivation spécifique de l&#39;allèle pour dfna21 utilisant des oligonucléotides antisens
CA3223577A1 (fr) Oligonucleotides pour la modulation de la voie de signalisation de l&#39;ifn-?
WO2018026282A1 (fr) Composé oligomère antisens destiné au traitement de la maladie de pompe

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10842736

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10842736

Country of ref document: EP

Kind code of ref document: A1