WO2011079361A1

WO2011079361A1 - Modified bacterial strain and use thereof

Info

Publication number: WO2011079361A1
Application number: PCT/BR2010/000431
Authority: WO
Inventors: Angelo Berchieri Jr.
Original assignee: Universidade Estadual Paulista "Julio De Mesquita Filho" - Unesp; Fundação De Amparo À Pesquisa Do Estado de São Paulo
Priority date: 2010-01-04
Filing date: 2010-12-22
Publication date: 2011-07-07
Also published as: BRPI1000173A2

Abstract

The present invention relates to a mutant of Salmonella gallinarum that is defective in the CobS and CbiA (SGCobSCbiA) genes, which are associated with the production of cobalamin by the bacterium in anaerobic conditions, for use as vaccines. The present invention also relates to the use of said mutant Salmonella gallinarum strain for inducing protection in birds against infection by the homologous natural strain and Salmonella enteritidis strain by means of a vaccine.

Description

MODIFIED BACTERIAL CEPA AND USE

FIELD OF INVENTION

The present invention relates to a CobS and CbiA gene defective Salmonella Gallinarum mutant (SGCobSCbiA) associated with bacterial production of cobalamin under anaerobic conditions for use as vaccines. The absence of these genes made the strain attenuated. This strain has been used to induce protection in birds against infection by the natural homologous strain and Salmonella enteritidis strain. The results were motivating, with fall of pathogenic action of the field strains in question.

BACKGROUND OF THE INVENTION

Salmonella diseases are diseases caused by bacteria belonging to the Enterobacteriaceae family, genus Salmonella, S. bongori and S. entérica species. The latter is divided into the enteral, salamae, arizonae, diarizonae, houtenae and indica subspecies. They are Gram negative rods, facultative anaerobes, catalase positive, oxidase negative, nitrate and nitrite reducers, non-spore forming Salmonella Gallinarum is immovable.

Salmonella Gallinarum (SG) is an optional anaerobic intracellular parasite that causes a characteristic disease in birds, Avian Typhus. This serotype is strongly associated with the phagocytic-mononuclear system and disease onset depends on the bacterial ability to survive and replicate within liver and spleen macrophages (BARROW et al, 1994; WIGLEY et al, 2002). By invading and colonizing host macrophages, Salmonella spp. uses various virulence factors to overcome obstacles that are activated with the internalization of the bacteria (FIELDS et al. 1986; RICHTER-DAHLFORS et al. 1997; VAN IMMERSEEL et al. 2004).

After invasion of the animal organism and phagocytic cells, SG causes severe disease characterized by high morbidity and mortality in birds (SHIVAPRASAD, 1997). This behavior was not observed. with the SG cobSAcbiA mutant strain of the present invention which became attenuated and did not cause the disease.

SMITH (1956) found that a rough strain of SG (SG9R) had lost its ability to provoke avian typhus in birds and could be used as a vaccine.

WIGLEY et al. (2005) observed that the attenuation was the decrease in the life span of the bacteria in the liver and spleen of birds. Although by different processes, but due to similar behavior, we investigated the use of SG ÀcobSAcbiA as a vaccine strain candidate to control the infection of birds by SG and SE.

Live vaccines against Salmonella spp. currently available, they are prepared from attenuated strains. Although these vaccines are thought to be capable of generating a strong cellular immune response, some also stimulating antibody production, the protection conferred against the serotype SE is limited (MASTROENI et al., 2000).

Other studies have been conducted on this subject as can be seen in the different documents below:

WO 00/68261 relates to attenuated microorganisms that may be used in vaccine compositions for the prevention or treatment of bacterial or viral infections. The inventors used a strain of Salmonella Typhimurium and caused mutation by altering pathogen-related genes.

US 6,399,074 generally relates to poultry and other poultry vaccines and, more particularly, vaccines to protect poultry and other poultry from infection with pathogenic gram-negative poultry bacteria. Strains with alterations related to somatic antigens are used.

PI 0410355-6 relates to a vaccine composition comprising a combination of a deletion mutant S. Typhimurium microorganism and a deletion mutant E. coli microorganism suitable for mass application to birds. And also A safe and effective method for protecting birds against the destruction of E. colie Salmonella infection and disease is provided.

PI 0211151-9 relates to a different salmonella of the present invention and is directed to the adjuvant component, and it is further proposed to use the heterologous antigen vaccine of another human pathogen.

PI 0507588-2 relates to live attenuated Salmonella cultures for use as vaccines. Salmonella cultures of the present document have a substantially reduced ability to grow and replicate in the presence of bile. The reduced growth capacity is due to the metabolic shift mutation induced by exposure to a combination of nalidixic acid and rifampicin for a time and under conditions sufficient to induce the mutation.

PI 0109322-3 relates to an attenuated mutant Salmonella bacterium that contains inactivated virulence genes that is provided for use in safe and effective vaccines. This invention utilizes different serotypes from those used in the present invention and mutations were performed on pathogenicity genes.

PI 0604997 relates to a vaccine against

streptococcal disease in horses. Salmonella would be just the vector, carrying streptococcus protein.

US 6,890,538 relates to a herpes simplex virus (HSV) vaccine comprising a non-pathogenic or attenuated bacterium.

In some of the above documents, the Salmonella strain has been used as an antigen vector of other pathogens (heterologous antigens). However, none of them describe changes in the CobS and CbiA (SGCobSCbiA) genes or modify any strain of Salmonella Gallinarum. Therefore, there is no coincidence of products.

SUMMARY OF THE INVENTION

The present invention relates to a mutant Salmonella strain. Gallinarum (SEQ. ID. No. 1) containing alteration in both CobS and CbiA (SGCobSCbiA) genes related to the synthesis of Salmonella cobalamin in an anaerobic environment.

The present invention further relates to the use of said mutant Salmonella Gallinarum strain to induce protection in birds against infection by the homologous strain and Salmonella Enteritidis strain by a vaccine.

BRIEF DESCRIPTION OF DRAWINGS

FIGURE 1 contains the electrophotogram photo of the 1% agarose gel with bands for intact and altered genes, where:

MW: molecular weight marker (1Kb plus DNA Ladder); 1 - 3 as AcobS ^Specr GS fragment (2964bp); 4-5, cobS fragment (original) from SGNal ^R (994bp); 6, Positive Control with STM F98 àcobS Spec ^r (2964bp); 7-9, SG Acb / A Kan ^r fragment (1930bp); 10 - 11, c fragment / A (original) of SGNal ^r (1360bp); 12 - 13, Positive Control with STM F98 AcbiA Kan ^r (1930bp).

DETAILED DESCRIPTION OF THE INVENTION

The present invention was initiated to study the participation of genes responsible for the respiration of bacteria in anaerobiosis, considering that salmonella are intracellular parasites. To this end, Salmonella Gallinarum (SG) mutants were constructed, containing dead genes for the production of some respiratory enzymes that manifest during the life of the bacteria in an anaerobic environment. One of the mutants has become completely apatogenic for birds. This mutant was then used to immunize birds that were later challenged with wild strains of S. Gallinarum (SG) and also S. Enteritidis (SE). S. Enteritidis is of public health importance due to human cases involving poultry food products. In both cases, bird protection was observed by the "vaccinate" strain.

The present invention has been accomplished by preparing a strain of Enteric Salmonella serovar Gallinarum containing alteration in two genes related to Salmonella cobalamin synthesis in anaerobic environment (SGcobS-cbiA-). These changes made the strain

It is apatogenic to birds and has been shown to be able to elicit an immune response and is able to protect birds from Avian Typhus and Salmonella Enteritidis infection.

Cobalamin biosynthesis (CBL) is only found among facultative prokaryotic, aerobic, anaerobic and anaerobic organisms, including Salmonella Typhimurium. This macromolecule is an essential nutrient for the life of animals and humans. In Salmonella Typhimurium, its synthesis occurs under anaerobic conditions and can be synthesized into aerobiosis or anaerobic conditions when the bacterium is supplied with precursor substances such as cobinamide (Jeter et al., 1984; Escalante-Semerena, 1990). The operon responsible for Ado-CBL biosynthesis contains 17 CbiA-P genes, which are involved in the production of the initial portion of the molecule (corrin rings) and genes involved in nucleotide integration with cobinamide (Cob UST). Salmonella are facultative anaerobic bacteria capable of cobalamin biosynthesis (CBL) during anerobic growth. Vitamin B12 production pathways are very complex, requiring the catalytic activity of more than 24 enzymes. CbiA (Cobyrinic acid a, c-diamide synthetase) is the first anaerobic glutamine aminotransferase for vitamin B12 biosynthesis. This enzyme draws attention by catalyzing chemical reactions at various points in the substrate. The operon contains 17 Cbi and 3 Cob genes.

Defective mutants for the CobS and CbiA genes from Salmonella Gallinarum were then prepared according to the methodology of the protocols contained in the Molecular Cloning Volumes 1, 2 and 3 manual (Sambrook & Russel, 2001), and in the work of Turner et al. (1998), for the preparation of defective genes related to anaerobic respiration of S. Gallinarum. Mutants were prepared by conjugation and transduction as described below:

1. Conjugation of the defective gene (Can ^r or Spc ^r ) in

Salmonella gallinarum

The defective gene, present in Escherichia coli S17.1A pir, will be inserted into the final recipient, S. Gallinarum., Nalidixic acid resistant strain (SG9Nal ^r ). EC S17.11λ pir cultures and SGNal ^r strains will be individually prepared on Luria-Bertani (LB) agar incubated at 37 ° C / 24 hours with shaking. Using a bacteriological loop, the growth of the two cultures will be mixed and spread on the LB agar surface, which will be incubated at 37 ° C / 90 minutes. Using the bacteriological loop, the growth will be harvested and added to 10 mL of LB broth, which will also be spread with a loop on the surface of LB agar containing nalidixic acid (20ug / mL) and kanamycin or spectinomycin. The plates will be incubated at 37 ° C / 24 hours. Emerging colonies will be seeded on LB agar containing discs impregnated with nalidixic acid antibiotics (30pg), chloramphenicol and kanamycin or spectinomycin.

Colonies Nal ^r , Can ^r or Spc ^r and C ^s will be subjected to agglutination test against anti-Factor 9 somatic antigen and acriflavin.

O9 (+) and acriflavine (-) colonies will undergo PCR for definitive characterization of the desired mutant.

PCR will be performed using the 1 + 4 primers of each mutant.

2. Transduction

The preparation of mutants containing two defective genes was performed by transduction.

Salmonella Nal ^r , SG, SP and SE strains containing the cbiACan ^r defective genes will be grown in 10mL LB broth, incubated at

37 ° C / 24h. These cultures have approximately 1.0 x 10 ¹⁰ cfu / mL. 5μί of a solution of bacteriophage 0P22 will be added to give a ratio of 0,030 / 1 bacterium. The mixture will be incubated at 37 ° C / 24h under stirring. Then the cultivation is centrifuged at

4000rpm / 25min / 4 ° C, filter the supernatant (45μιη) and count the 0P22 on Salmonella-layer LB agar (SP, SE or SG). Subsequently, the bacteriophage solution will be added to Salmonella culture (10mL LB broth), prepared by stirring at 37 ° C / 24h. This culture has approximately 3.0 x 10 ⁹ cfu / mL.

Salmonella cultures containing the defective gene CobS Spc ^{r are then} prepared. Prior to the addition of the bacteriophage, the culture will be centrifuged as described above and resuspended in 1 mL LB broth. In this case, the 0P22 / SG ratio should be 0.8 / 1.0. The 0P22 be grown in strain of Salmonella cbiACan Nal ^r ^r, which will be added to the culture of Salmonella Nal ^r Spc ^r cobs. The mixture will be incubated at 37 ° C / 30 minutes and then spread on LB agar plates containing nalidixic acid (20pg / mL) and kanamycin (30pg / mL), which will be incubated at 37 ° C / 24 hours. Emerging colonies will be purified on LB agar plus antibiotic discs impregnated with the antibiotics nalidixic acid (30 g / mL) and kanamycin (30pg / mL) and incubated at 37 ° C / 24 hours. Colonies will be subjected to PCR for confirmation of results.

3. SG AcobSAcbiA vaccine strain genotypic test for detection of deletion in the cobS and cbiA genes

After the preliminary tests, for final characterization of the strains obtained, the PCR and electrophoresis were performed.

3.1. Primer Preparation

The primers were prepared based on the Salmonella genome.

Typhimurium (MCCLELLAND et al, 2001).

CobS gene

First 1: F 5 '- gagatctagaacgaatctgctgtttgcgct - 3' (SEQ 2)

First 4: R 5 '- agtctagaacagacccagcagaaagatc - 3' (SEQ 3)

Gene cbiA

Prime 1: F 5 'catctagaaaggcatcacgcatttattc - 3' (SEQ 4) Primer 4: R 3 '- tgtctagacagccagtgctgcaacattt - 5' (SEQ 5)

3.2. Sample Preparation:

30 μΙ_ X / mix

Χ = 23.00 μΙ_ Η ₂ 0, 3.0 μΙ_ 10Χ buffer, 3.0 2mM dNTP, 0.9 pL MgCl, 0.5 μ [_ primer 1

0.5 pl_ primer 4

0.4 μΙ_ taq DNA polymerase (Invitroven 10342-020)

bacterial colony

3.3. PCR (Polymerase Chain Reaction)

To confirm whether the strain used to prepare the inoculum was SG AcobSAcbiA PCR was performed to detect the presence of altered genes.

A strain of S. Typhimrium F98 with deletion in these same genes (STM F98 AcobSAcbiA) was used as a positive control.

The solution employed for PCR was composed of

50 μ! _, Corresponding to: 47.9 μΙ_ of X-mix solution, 0.6 μΙ_ of each primer (1 and 4), 0.5 μΙ_ of Taq DNA polymerase (Invitrogen, USA) and 0.4 μί of DNA (100ng / μΙ-).

The conditions for PCR were: 95 ° C for 4 minutes and 25 cycles using: 95 ° C for 20 seconds, 45 ° C for 1 minute and 72 ° C for 3 minutes. An extension period at 72 ° C of 5 min was used. After the reaction, the samples remained at 4 ° C and 6μΙ_ of loading buffer was added to each.

3.4. Sample electrophoresis

The samples were submitted to agarose gel electrophoresis to analyze the size of the obtained fragments (Apparatus: Consort E863, 600V 250mA, Horizon 11-14 CE, Life Technology). Consist of 90ml_ The gel (10% agarose, TAE buffer solution diluted with - 4,84g Tris base, 1, 034mL glacial acetic acid, 2ml 0.5 M EDTA pH 8.0, 1000ml_ H ₂ 0), plus the 9μΙ_ 1% aqueous solution of ethidium bromide (Sigma E-4391). Samples plus molecular weight marker (1 μΙ_ DNA Gibco 10787-018, 2pL dye solution, 7μΙ_ distilled water) were subjected to an electrical current of 80V. After 3 hours and 30 minutes, the gel was placed under ultraviolet light and photographed. The

The results are shown in Figure 1.

The tests below were performed orally by inoculating 0.5 ml culture containing viable SG cells (10 ⁸ CFU / mL) into poultry. The oral route is advantageous in birds because it is farmed on an industrial scale, containing a large number of animals (thousands). Breeding poultry farms can have about 50,000 birds per core and commercial laying birds from 10,000 to over 100,000. This product can also be applied parenterally.

4. In vivo testing

These tests followed the models adopted by BERCHIERI et al. (2001a, b). The birds were raised in battery cages with water and ad libitum feed.

At the time of bird arrival, blood samples were collected for serological testing to detect anti-Salmonella antibodies and box bottom swabs, according to ZANCAN et al (2000) for Salmonella spp. The experiments were performed after the tests were performed upon arrival of the day birds. Results were negative for Salmonella spp and anW-Salmonella antibodies, respectively.

The biochemical behavior of Salmonella gallinarum (bacterial physiology) was determined from tests positive: glucose, H ₂ S, lysine, maltose, dulcitol, salicin, cellobiose, tartrate, gelatin, mucate and ornithine; and for negative evidence: urea, indole, tryptophan, motility, sucrose, gas, citrate, malonate.

5. Bacterial Strains

A double mutated nalidixic acid (Nal ^r ) resistant SG strain containing part of the deleted genes of its genome (SG AcobSAcbiA) was used. For the challenge, in the experiments of To evaluate mortality, systemic infection and avian typhus prevention, a wild type strain of nalidixic acid-resistant SG (SGNal ^r ) and a strain of nalidixic acid-resistant SE were used.

spectomycin (SENal ^r Spec ^r ) for studies evaluating the potential for cross-immunization against SE infection. Bacteria are stored in the Spanish Cultivation Type Collection Center at access number 7632.

6. Preparation of inoculum

Cultures for each inoculum were prepared from their respective strains (SGNal ^r , SG AcobSAcbiA and SENal ^r Spec ^r ), which were sown in Luria-Bertani (LB) broth (Invitrogen 12780-052) and incubated for 24 hours. at 37 ° C while stirring (100rpm). One sample from each culture was diluted decimally in 0.9 ml saline, pH 7.4 (PBS) at a ratio of 1: 10. From each dilution 0.1 mL was removed, which was poured onto plates containing bright green agar (Oxoid CM0263) containing novobiocin (1 pg / mL) and nalidixic acid (20 pg / mL) (VB

Nal / Nov), which were incubated at 37 ° C / 24h. The number of colonies per milliliter of LB broth was transformed into logio for presentation of results. The cultures contained approximately 10 ⁸ CFU / mL.

7. Birds

Avian typhus susceptible birds (BERCHIERI et al, 2000; OLIVEIRA et al, 2005) of commercial strain Red (Hy-line Brown) and white variety (Hy-line W36) were used for table egg laying. and one-day-old chicks from a commercial poultry hatchery (COBB 500). The laying birds were housed in broiler cages and broiler chicks were placed in screened wooden boxes. The birds received electric heating during the initial period, water and feed ad libitum.

8. Evaluation of SG AcobSAcbiA bird infection compared to the original SG strain

8.1. Experiment 01: Mortality Assessment To evaluate the behavior of the obtained mutant, it was inoculated in birds compared to the wild strain. Red line commercial poultry were used for table egg laying.

For each strain were used two groups each containing 20 birds.

Chicks from one group received 0.5 ml of a culture prepared in LB broth, incubated at 37 ° C / 24h with shaking and the other, this culture diluted to 10 ^{~ 2} in LB broth. The inoculum was administered orally on the fifth day of life.

Birds were observed for four weeks and mortality was recorded.

8.2. Experiment 02: Evaluation of systemic infection

For this test, 80 commercial red-line poultry were used for laying table eggs. The birds were divided into two groups containing 40 birds. Birds of one group were infected with the (undiluted) inoculum of the original strain and those of the other group with the mutant strain on the fifth day of life. At 2, 5, 7, 14, 21 and 28 days post-infection (dpi), five birds from each group were sacrificed to estimate the presence of SGNal ^r and cobSAcbiA in the spleen and liver.

Spleen and liver samples were placed in saline, pH 7.4 (PBS) at a ratio of 1: 10, macerated and diluted decimally in 0.9 mL of PBS. From each dilution 0.1 mL was removed and poured onto plates containing bright green agar (Oxoid CM0263) containing novobiocin (1pg / mL) and nalidixic acid (20 pg / mL) (VB

Nal / Nov), which were incubated at 37 ° C / 24h. The number of colonies per gram organ was transformed to log ₁₀ for analysis of the results. In the absence of growth, the vials containing the sample

homogenized in PBS (1:10), an equal volume of selenite broth (Oxoid CM395) containing novobiocin (0.04%) (SN broth) prepared in double concentration was added. The flask was incubated at 37 ° C / 24h and the Next, its contents were seeded on VB Nal / Nov agar, incubated at 37 ° C / 24h.

9. Evaluation of the potential of the SG AcobSAcbiA mutant as a vaccine strain on wild type SG and SE strains

9.1. Experiment 03: Protection of birds using SG

AcobSAcbiA against SG infection

This experiment was carried out with commercial laying eggs for red eggs.

The inoculations of the SG AcobSAcbiA vaccine strain and the SGNal ^r challenge strain were prepared according to the procedure described.

previously in item 6.

Three groups were formed containing 40 birds each. Group A birds were vaccinated at five days of age, Group B birds at five and twenty-five days of age and Group C birds received nothing (control). The vaccine dose consisted of 0.5 ml of the SG culture.

AcobSAcbiA, inoculated orally, directly into the chat. At 45 days of age, all birds were challenged with 1.0 mL inoculum containing the wild SGNal ^r strain.

Birds were examined for 28 days, recording mortality and clinical signs. On the 28th day of life, the remaining birds were sacrificed for examination.

bacteriological method using sterile cotton swabs. The samples were placed in tubes containing 2 mL of SN broth and incubated at 37 ° / 24h. After enrichment, the samples were seeded on VB Nal / Nov agar. The plates were then incubated at 37 ° C for 24 hours. After this period, the plates were read.

9.2. Experiment 04: Protection of birds using SG

AcobSAcbiA against SE infection

This experiment was carried out with commercial laying eggs for white eggs. The inocula of the SG AcobSàcbiA vaccine strain and the SENal ^r Spec ^r challenge strain were prepared according to the procedure described above in item 6.

AcobSàcbiA, inoculated orally, directly into the chat.

In this trial, fecal excretion and systemic infection of the challenge strain were evaluated.

Fecal excretion was assessed by investigating the presence of SENal ^r Spec ^r in the stool twice a week for four weeks by collecting cloacal stool with sterile cotton swab. Swabs were placed in tubes containing 2 ml of SN broth. After shaking, they were seeded on VB Nal / Nov agar. The plates and tubes were then incubated at 37 ° C for 24 hours. In the absence of growth on VB Nal / Nov agar, the enriched swabs were again seeded on plates containing VB Nal / Nov agar incubated at 37 ° C / 24 hours. After this period, the plates were read.

To evaluate systemic infection, 2, 5, 7, 14, 21 and 28 days after infection (dpi), 5 birds from each group were sacrificed to estimate the amount of SE in spleen, liver and cecal content (BERCHIERI et al. 2001 a, b).

Spleen, liver and caecal content samples were placed in pH 7.4 saline (PBS) 1:10, macerated (caecal content homogenized) and diluted decimally to 0.9 ml PBS. From each dilution 0.1 ml was taken, which was poured into VB Nal / Nov agar plates, which were incubated at 37 ° C / 24h. The number of colonies per gram of organ was logified for analysis of the results. In the absence of growth, vials containing the homogenized sample in PBS (1:10) were Equal volume of SN broth prepared in double concentration is added. The flask was incubated at 37 ° C / 24h and its contents were seeded on VB Nal / Nov agar with incubation at 37 ° C / 24h. After this period, the plates were read.

10. Statistical Analysis

Mortality data were analyzed by the non-parametric Chi-square test with a significance level of 5% (p <0.05) (GREENWOOD & NIKULIN, 1996). Tukey's multiple comparison test was used to analyze the results obtained in SG and SE organ counts at a significance level of 5% (p <0.05) (DANIEL, 1991).

11. Evaluation of SG AcobSAcbiA bird infection compared to the original SG strain

11.1. Experiment 1: Mortality Assessment

Table 1 shows the mortality data of birds that received the undiluted innocuous and the 10 ^{~ 2} diluted SG AcobSAcbiA strain and SGNaí wild strain. During the 28 days of observation, in the groups of birds that received the mutant SG

AcobSAcbiA, diluted or not, mortality was zero. In the control group, the SGNal ^r strain caused mortality in 83.3% of birds receiving undiluted culture and 60% of birds receiving 100 times diluted culture. At 28 ° dpi, the remaining birds were sacrificed for bacteriological liver examination. SGNal ^r or SG AcobSAcbiA were not recovered in the birds of their respective groups.

Table 1. Mortality of commercial red birds for laying experimentally challenged on the fifth day of life with SG AcoóSAcò / A culture compared to wild strain SGNal ^r .

Bird mortality (dpi) in groups of 30 birds

Total%

Strain Culture 1 2 3 4 5 6 7 8 9 10 11 12 22 28 Remaining

^" SGÃcõb N - - - - - - - - - ÕãΌ 30

SAcò / A 10 ^-2 0 to 0 30

N - - - 2 5 9 7 1 - - 1 - - - 25 b 83.3 5

SGNal ^r

10 ^"2 - - - - 2 10 4 2 18 b 60 12 dpi: days after infection; N: undiluted culture; birds sacrificed at 28 ° dpi. Different letters indicate

statistically significant difference (χ ² , p <0.05), considering the same inoculum concentration.

11.2.Experiment 2: Evaluation of systemic infection

The box bottom swabs and the serological tests performed at the arrival of the day birds were negative for Salmonella spp and anii-Salmonella antibodies, respectively.

Results for systemic infection are shown in Table 2. The amount of SG AcobSAcbiA in poultry liver and spleen was

significantly lower than the wild type strain (SGNal ^r) at 5 and 7 dpi. In less multiplication, SG AcobSAcbiA mutant strain was found in the liver of birds even at 7 dpi, whereas the wild type strain persisted in the liver and spleen of birds in the control group to 14 ° dpi. Starting at 21 ° dpi, the SG AcobSAcbiA mutant strain was not found in any of the organs examined and the control group had no birds for inspection due to mortality.

Table 2. Number (Log ₁₀ ) of viable cells (CFU / g) of Salmonella Gallinarum in the spleen and liver of commercial laying birds challenged on the fifth day of life with SG cobSàcbiA culture or wild strain (SGNaí).

SG Aco6SA / A SGNal ^r

dpi organs 1 2 3 4 5 μ 6 7 8 9 10 μ

Spleen 2 0 2.3 0 0 0.86a 2.69 0 3.71 2.47 4.04 2.58a

2 Liver 2 2 2.47 2 0 1, 69a 2 0 3.14 2 3.25 2.08a

Spleen 0 3.41 0 2.95 3.38 1, 95b 6.07 5.59 5.76 6.11 6.2 5.94a

5 Liver 0 2.47 0 2.3 2.9 1, 53b 6.07 5.07 6.04 7.07 6.07 6.07a

Spleen 0 0 4.27 0 0 0.85b 7.07 4.71 5.87 4.72 4.77 5.43a

7 Liver 0 0 0 2 2 0.8b 6.96 5.36 6.14 4.72 6.41 5.92a

Spleen 0 0 0 2 2 0.8a 4.14 0 5.68 0 0 1, 96a

14 Liver 0 0 0 0 0 0 3 0 3.36 0 0 1, 27a

Spleen 0 0 0 0 0 0 M M M M M

21 Liver 0 0 0 0 0 0 M M M M M

Spleen 0 0 0 0 0 0 M M M M M

28 Liver 0 0 0 0 0 0 M M M M M

dpi: days after infection; 0: negative, M: birds not inspected for mortality. Means followed by equal letters do not differ statistically from each other by the Tukey test (p <0.05).

12. Evaluation of SG AcobSAcbiA mutant as a vaccine strain against infection with wild type SG and SE strains

12.1. Experiment 3: Protection of birds using SG

AcobSAcbiA against SG infection

The data presented in Table 3 reveal that the mutant strain

SG AcobSAcbiA conferred protection against the SGNal ^r wild strain, reducing mortality among vaccinated birds. Mortality was 15% among group A birds, 25% among group B birds and 75% among group C birds (control), which did not receive the mutant strain inoculum. The difference between group A and B bird mortality and group C (control) mortality was statistically significant (p <0.05).

Table 3. Mortality of SG AcobSAcbiA orally vaccinated birds and orally challenged with SGNaI wild strain.

Different letters indicate statistically significant difference (χ ² ,

GROUPS

A B C

Vaccination (age) 5 days 5 and 25 days unvaccinated number of dead birds / total 3/20 ^to 5/20 ^to 15/20% mortality 15 25 75 p <0.05).

12.2. Experiment 4: Protection of birds using SG

AcobSAcbiA against SE infection

For the evaluation of the protection of birds by SG strain

AcobSAcbiA against SE fecal excretion was analyzed by cloaca swab examination and systemic infection by estimating the presence of

SENal ^r Spec ^r in spleen, liver and caecal content.

Table 4 shows the results for the analysis of fecal excretion of SENal ^r Spec ^r . In group B, in which birds received the SG AcobSAcbiA vaccine strain at 5 and 25 days of age, there was a significant reduction (p <0.05) in the fecal excretion of the SENal ^r Spec ^r strain used in the challenge. The cloacal swabs were performed twice a week. in birds from groups A, B and C. The number of birds tested decreased as sacrifices were made to collect organ samples.

Table 5 presents the results of the evaluation of systemic infection by SENal ^r Spec ^r strain used in the challenge of birds. Vaccination of birds with the mutant SG ÀcobSAcbiA reduced the number of SENal ^r Spec ^r in spleen, liver and caecum in group A and B birds compared to group C (control) birds. At 2 and 5 dpi, the Senal Spec ^r ^r count in caecal contents of birds in group C

(control) was significantly higher (p <0.05) than in group B and 5 and 7 dpi to Senal ^r ^Specr count in the liver of birds in groups A and B also differ statistically with respect to group C (control).

Table 4. Number of positive swabs after inspection of the laying poultry cloaca for SENal ^r Spec ^r used as challenge strain after vaccination of SG cobSAcbiA cultured birds. dpi: days after infection; D: Result of direct seeding (Oh); AND:

GROUPS

A B c vaccination

5 days 5 and 25 days unvaccinated (age)

dpi D E T D E T D E T

2 16 12 28 11 8 19 11 10 21

5 17 11 28 5 5 10 14 13 27

8 0 3 3 0 0 0 2 7 9

12 0 1 1 0 0 0 0 3 3

15 1 1 2 0 0 0 1 1 2

19 0 1 1 0 0 0 0 0 0

22 0 1 1 0 0 0 0 1 1

26 0 2 2 0 0 0 0 0 0

TOTAL 34 32 66b 16 13 29a 28 35 63b

Sowing result after enrichment (24h); T: Total. Different letters indicate a statistically significant difference (χ ² , p <0.05).

Group A: vaccination with SG ÀcobSAcbiA strain at 5 days of age

Group B: vaccination with SG ÀcobSAcbiA strain at 5 and 25 days of life Group C: control (unvaccinated). Table 5. Count (Logio) of the number of viable cells (CFU / g) of the SENal ^r Spec ^r challenge strain in spleen, liver and caecal content of laying birds, orally vaccinated with cobSàcbiA SG culture. dpi: days after infection; 0: Negative; Means (μ) followed by equal letters do not differ statistically from each other by the Tukey test (p <0.05).

GROUPS

A (5 days) B (5 and 25 days) C (unvaccinated)

Birds Birds Birds

dpi Organs 1 2 3 4 5 1 2 3 4 5 μ 1 2 3 4 5 u

Spleen 2 2 0 0 0 0.8a 0 0 0 0 0 0a 2 0 2 0 2 1.2a

2 Liver 0 0 0 0 0 0a 0 0 0 0 0 0 0a 0 0 2 0 0 0.4a

Cecum 2 3.64 4.07 2 2 2.74ab 2 0 2 2 2 1.6b 5.47 2 4.65 2 6.11 4.05a

Spleen 0 0 2 2 2 1.2ab 0 0 0 0 2 0.4b 2 2 2 2 2 2a

5 Liver 0 0 0 2 0 0.4b 0 0 0 0 2 0.4b 2 2 2 2 2 2a

Cecum 2 4.82 2 4.55 4.89 3.65ab 0 5.69 2 0 0 1.54b 2 6.62 7.07 6.2 6.27 5.63a

Spleen 2 2 2 0 0 1.2a 0 2 0 0 2 0.8a 2 2 2 2 2 2a

7 Liver 0 2 0 0 0 0.4b 0 0 0 0 2 0.4b 2 2 2 2 2 2a

Cecum 0 0 0 2 2 0.8a 0 0 2 2 2 1.2a 2 2 2 2 2 2a

Spleen 0 0 2 0 0 0.4a 0 0 2 0 0 0.4a 0 2 0 2 2 1.2a

14 Liver 0 0 0 0 0 0a 0 0 0 0 0 0 0a 0 0 0 2 2 0.8a

Cecum 2 2 0 0 0 0,8a 0 0 2 0 0 0,4a 0 2 2 2 2 1,6a

Spleen 0 0 0 0 0 0a 0 0 0 0 0 0 0 0 0 0 2 0 0 0.4a

21 Liver 0 0 0 0 0 0a 0 0 0 0 0 0a 0 0 0 0 0 0a

Cecum 0 0 0 0 0 0a 2 0 0 0 0 0.4a 0 0 0 0 0 Oa

Spleen 0 0 0 0 0 0a 0 0 0 0 0 0 0 0 0 0 2 0 0 0.4a

28 Liver 0 0 0 0 0 0a 0 0 0 0 0 0a 0 0 0 0 0 Oa

Cecum 0 0 0 0 0 0 2 2 0 0 0 0 0,4a 2 2 0 0 0 0,8a

Group A: vaccination with SG cobS cbiA strain at 5 days of age; Group B: vaccination with SG cobS cbiA strain at 5 and 25 days of age; Group C: control (unvaccinated).

13. Discussion of results

As shown in Table 1, in the groups in which birds received the mutant SG ÀcobSAcbiA, no mortality was observed, while in the control groups, mortality was 83.3% (25/30) when the undiluted inoculum was used. and 60% (18/30) as the inoculum was diluted 10 ^-2 in LB broth, similar to results observed in previous studies on typhoid (Barrow et al, 1987;. Oliveira et al, 2005).

In addition to studies on the relationship between the mutant strain and birds, studies have been done on systemic infection. As can be seen in Table 2, the mutant strain was recovered from the liver to 7 ° dpi, while the wild strain remained in this organ up to 14 ° dpi, as previously described by OLIVEIRA et al. (2005) with the infection of adult laying birds using the same strain of SG. Bacterial organ counts revealed a lower amount of SG acobSAcbiA than wild strain SG. At 21 dpi, SG ÀcobSAcbiA was not found in the organs examined, while the control group had no birds, due to mortality caused by the wild strain. Thus, it can be stated that deletion of the coòS and cbiA genes brought to the mutant strain metabolic disorders that reflected in its in vivo behavior with respect to growth and virulence in the host organism. The metabolic alteration of microorganisms leads to the impairment of their survival in the host organism. SHAH ef al. (2007) found a similar situation when they rendered the metC gene inoperative in a strain of SG. The inability of this bacterium to synthesize methionine interfered with its growth in invaded organs (liver and spleen), significantly reducing its virulence.

The cobalamin biosynthesis pathway in Salmonella spp. may be compromised when any cob operon gene becomes inoperable and unable to synthesize this molecule if precursor substances not found in the environment (GRABAU & ROTH, 1992). Cobalamin is an important molecule for Salmonella Typhimurium, whose primary function would be to degrade carbon sources, such as propanediol and tetrationate, to obtain energy (JETER, 1990; AILION et al, 1993; BOBIK et al, 999 ; PRICE-CARTER et al., 2001). Therefore, this substance influences bacterial multiplication and its absence may lead to attenuation of the bacterium (FIELDS et al, 1986). From the results obtained in the present invention it is noted the influence of cobalamin on the bacterial metabolism of SG. However, such participation may vary among Salmonella spp. Serotypes, as described in the previous work (BJÖRKMAN et al., 1996), a strain of Salmonella Typhimurium with alteration of genes involved in cobalamin biosynthesis continued to express the same virulence.

The strain used in the present invention has two altered genes, related to cobalamin biosynthesis, whereas SG mutants containing alteration in the co6S or cbiA gene,

individually, did not have decreased virulence in the same way (PAIVA et al, 2007). The single deletion may not have been sufficient to block vitamin B ₁₂ biosynthesis, perhaps because the bacterium uses an alternative process that does not depend on that enzyme, while the double alteration has been able to cause irreparable damage.

According to JETER et al (1984), Salmonella mutants

Typhimurium unable to synthesize cobalamin fall into three phenotypic classes: 1 ^a . Deletion in part I of cob operon: the bacterium synthesizes cobalamin only when cobinamide is supplied; 2nd. Deletion in part II of cob operon: the bacterium synthesizes cobalamin only when dimethyl benzimidazole (DMB) is provided; 3rd. When deletion occurs in part III of the cob operon: mutants fail cobalamin synthesis even when both precursors (cobinamide and DMB) are provided. The db / gene gene located in part I of the cob operon is the first reading site to initiate cobalamin synthesis and in Salmonella Typhimurium encodes an amidase that acts late in the biosynthetic pathway (ROTH et al., 1993). Thus, in the SG AcobSAcbiA mutant, one part I (cbiA) and one part III (cooS) gene was disrupted, breaking the cobalamin biosynthesis pathway.

Genes that encode enzymes for carbohydrate, nucleotide, or amino acid metabolism are called maintenance genes and are known to participate in virulence mechanisms through the acquisition of nutrients essential for intracellular growth of enteric Salmonella. Cobalamin is important when acting as a cofactor in reactions such as homocysteine methyl transferase (CAUTHEN et al., 1966) and ethanolamine ammonia lyase (SCARLETT & TURNER, 1976), responsible for

respectively, by methionine synthesis and degradation of

ethanolamine. Thus, the broad spectrum of action suggests that this molecule is essential, not only because it has an essential function, but because it is a catalyst for various stages of bacterial metabolism.

According to the above results, cobalamin deficiency interfered with the multiplication and persistence of SG, indicating that attenuation is linked to loss of ability to survive within the phagocytic mononuclear system.

According to the data presented in Table 3 oral vaccination with the SG AcobSAcbiA strain protected the birds against challenge with the wild SG strain. In groups of 20 birds,

17 birds survived in one vaccine dose, 15 when 2 vaccine doses were used, with only 5 live birds remaining after challenge by the wild SG strain, differing from the vaccinated groups (χ ² , p <0.05). The immune response generated by the application of one vaccine dose was as effective as the use of two doses. These results suggest that SG AcobSAcbiA strain can immunize birds by oral inoculation, reducing the incidence of Avian Typhus. Some similar results have been reported.

previously with the use of strain SG9R. According to BOUZOUBAA et al. (1989), a wild SG strain that caused mortality in 60% of control birds, did not cause mortality in the SG9R vaccinated group, although it caused focal necrotic liver damage in up to 55% of birds, similarly previous report (SILVA et al., 1981). In an experiment described by LEE et al. (2005), after challenge with a pathogenic SG strain, mortality ranged from 95 to 100% in the control groups, whereas in SG9R vaccinated groups this variation was 0 to 5%. Like SG9R, the SG strain

AcobS cbiA can be successfully used to control avian typhus, with some advantages such as the absence of severe organ damage and the possibility of differentiating it from other SG strains. CHACANA & TERZOLO (2006) noted that vaccination with an attenuated SE strain (Salmonella TAD E) was able to protect birds against SG serotype after three doses. However, immunity was not lasting and when the challenge was performed at longer intervals, the mortality of vaccinated birds was equal to that of the control group. Therefore, the best protection against Avian Typhus is obtained when using vaccines prepared from SG strains.

Considering that Gallinarum and Enteritidis serotypes have similar antigenic composition, belonging to serogroup D1 (O: 1, 9, 12), we investigated the possibility of using SG cobSAcbiA strain as a vaccine to control the infection of birds by SE.

Two experiments were carried out to evaluate the protection against an ES challenge strain, one with white-liner birds and the other with broiler chicks.

In the experiment with laying birds, after the challenge

fecal excretion and colonization of liver, spleen and caecum by SE were inspected. The results regarding the examination of the cloacal swabs (Table 4) demonstrate a reduction in fecal excretion of SE in the group in which The birds received two applications of SG AcobSAcbiA strain at 5 and 25 days (χ ² , p <0.05). There was no difference in the number of positive swabs between the group of birds that received a dose of the vaccine strain at five days and the control group (χ ² , p> 0.05). SILVA et al (1981) reported a 20% reduction in fecal STM excretion in birds vaccinated orally or subcutaneously with the SG9R strain. BARROW et al. (1991) noted that there was no reduction in fecal excretion of an SE strain used to challenge birds after SG9R vaccination. In the present invention, involving the use of the SG AcobSAcbiA strain, fecal SE excretion was reduced by about 55% when birds received two doses of the vaccine strain and no birds excreted the challenge strain after 5 ° dpi. While the excretion of SE was observed throughout the post-challenge experimental phase (22 ° dpi), in the birds of the vaccine strain group and the control group (without vaccination) (Table 4). These results are motivating, considering that BETANCOR et al. (2005) also observed a reduction in fecal excretion of SE in vaccinated birds (two doses) with attenuated SE strain, but with the presence of bacteria in feces for a longer period of 15 days.

As shown in Table 5, there was a reduction in the amount of SE recovered in the liver of birds vaccinated with a SG dose.

AcobSAcbiA from 5 ° and 7 ° dpi, whereas in the group in which birds received two doses of vaccine, the reduction was significant in cecal content at 2 ° and 5 ° dpi, in the liver at 5 ° and 7 ° dpi and in the liver. spleen at 5 ° dpi. Thus, it can be stated that the vaccine strain was able to reduce bird infection by SE when two doses were used. These results are innovative, given that the available live vaccines are unable to completely prevent the installation of SE in the caecum and colonization of bird organs, and are sometimes expressive in the protection afforded against systemic infection (BARROW et al. ., 1991; COOPER et al., 1994; GANTOIS et al., 2006). Vaccines containing other Salmonella serotypes to protect birds from SE have also been evaluated. HASSAN & CURTISS

(1994b) used an attenuated Salmonella Typhimurium Acya Acrp strain to inhibit the presence of group B, C, D and E Salmonella serotypes in birds. In birds vaccinated at 2 and 4 ^th week and challenged by SE in the sixth week of life, protection against colonization of the cecum was weak, since reducing the amount of SE recovered in the organs was better when minimally invasive strains were used to challenge the birds.

CERQUETTI & GHERARDI (2000) used an attenuated SE strain to vaccinate birds in the first days of life. The vaccine strain conferred good protection against the SE and SG serotypes when the challenge was performed 14 days after the last immunizing dose was applied but was unable to protect against STM challenge. This strain

presented some characteristics that may undermine its use in the field. It was necessary to apply four doses of vaccine, which increases the stress of birds and the cost of vaccination for producers. After the last dose, the birds excreted the vaccine strain into the environment for up to two weeks. The SG AcobSAcbiA strain has some

advantageous characteristics when considering its use as a vaccine. Single dose oral inoculation was effective against SG. Another advantage that SG AcobSAcbiA has over other available vaccine strains, especially against SE, is that even after oral inoculation, fecal excretion and

consequent contamination of the environment are inexpressive, besides the need of few applications (maximum two) for effective protection against heterologous serotype.

In a field study, FEBERWEE et al (2001a) related the reduction of SE infections in commercial laying poultry flocks to the use of the SG9R vaccine, in conjunction with the application of a biosecurity program, including other health measures that reduce risk of SE infections. In the present invention, the inoculants used to challenge the birds contained large amounts of bacteria that would hardly be found under normal field conditions. The conditions under which the experiments were performed led to the constant reinfection of birds due to the high contamination in the environment within the infectious ones. The use of the SG AcobSAcbiA strain in poultry farms has not yet been tested, but the results of the tests indicate that SG AcobSAcbiA may be an important tool to combat SG and SE infections.

In view of the favorable results for the use of the SG AcobSAcbiA strain as a vaccine, its use was investigated to prevent early-life SE cecal colonization of birds in the form of competitive exclusion. It has been reported that Salmonella Typhimurium strain can inhibit cecal colonization of birds by homologous strains (BERCHIERI JR & BARROW, 1990). COOPER ef al. (1994) were able to prevent cecal colonization of newborn birds by SE by orally applying an inoculum containing an attenuated SE strain on the first day of life. In the experiment in which broiler chicks received SG AcobSAcbiA on the first day of life, there was no inhibition of SE which was inoculated orally on the second day of life, which colonized and multiplied in the cecum of birds of both groups. The amount of SE found in the cecal content of control and vaccinated group chicks, sacrificed at 5 ^o dpi, was high and did not differ from each other (Table 6). Thus, the SG AcobSAcbiA strain did not prevent cecal colonization by the challenge strain, as did the attenuated SE strain (COOPER et al, 1994). METHNER et al. (2001) analyzed the use of a STM attenuated strain to prevent cecal colonization of chicks challenged by a homologous pathogenic strain in ^the third day of life, without success. Colonization of the intestine by a "vaccine" strain of Salmonella would be a way of protecting newly hatched birds and newly vaccinated birds against infection by pathogenic strains, because during this period the immune response still It is limited. However, this action appears to be far from the capacity of available vaccine strains, including SG AcobSAcbiA. Attenuated strains of SE showed better results; however, they are excreted in the environment, which is an undesirable feature for a vaccine. Protection of the intestinal tract of birds during this period seems to be most satisfactorily exercised by the competitive exclusion method (METHNER et al, 2001; STERZO et al, 2005).

The attenuated SG AcobSAcbiA strain was shown to protect birds against challenge by the pathogenic SG strain and was also effective in reducing SE infection when inoculated twice in laying birds. Thus, the results obtained in the present invention are promising and should guide future studies aiming at the application of the SG AcobSAcbiA strain as a vaccine to control SG and SE bird infection under controlled experimental conditions, as well as to extend them to applied field research. .

Therefore, under the experimental conditions adopted in the present invention it was concluded that:

The SG AcobSAcbiA strain became attenuated and did not cause mortality in birds.

Application of one or two doses of the SG AcobSAcbiA strain is able to protect birds against challenge by a wild SG strain.

Inoculation of two doses of SG AcobSAcbiA strain was able to generate cross-immunity and protect birds against challenge by an SE strain.

- There was a significant reduction in the amount of SE found in the liver, spleen and cecal content of birds receiving two doses of SG AcobSAcbiA.

The application of two doses of the SG AcobSAcbiA strain caused a large reduction in the fecal excretion of SE used to challenge the birds.

- The SG AcobSAcbiA strain is invasive and has not been able to prevent caecum colonization by the SE strain. Vaccination with two doses of SG cobSAcbiA caused a reduction in SE organs, cecal content and fecal excretion, so the protection conferred by the vaccine strain should be classified as partial.

The SG AcobSàcbiA strain has advantages such as the impossibility of excretion in the faeces, complete attenuation, excellent immunogenicity against SG, the inability to infect humans and the possibility of being detected and differentiated by molecular techniques.

The above detailed description of the invention and the examples herein are provided for illustration and description purposes only and not as a limitation. Therefore, it is contemplated that the present invention comprises any and all modifications, variations or equivalents within the scope of the basic underlying principles disclosed above and claimed herein.

Claims

1. Modified bacterial strain characterized by being identified by SEQ. ID No. 1.

Modified bacterial strain according to claim 1, characterized in that it is defective in the cobS and cbiA genes.

Modified bacterial strain according to claim

1, characterized by being attenuated due to deletion of both cobS and cbiA genes.

Modified bacterial strain according to claim

3, characterized in that the deletion occurs in a gene in part I of the cob operon, where cbiA is located and a gene in part III of the cob operon.

Modified bacterial strain according to claim 2, characterized in that the genes are associated with the production of cobalamin in an anaerobic environment.

Modified bacterial strain according to claim 1, characterized in that it is prepared by conjugation and transduction.

Modified bacterial strain according to claim 1, characterized in that it has been prepared from Sa / mone // the enteric sorovar Gallinarum.

Modified bacterial strain according to claim 3, characterized in that the primers for detection of deletion in the cobS genes are primer 1 (SEQ. ID No. 2) and primer 2 (SEQ. ID No. 3).

Modified bacterial strain according to claim 3, characterized in that the primers for deletion detection in the cbiA genes are primer 1 (SEQ. ID No. 4) and primer 2 (SEQ. ID No. 5).

Modified bacterial strain according to claim 1, characterized in that it is impossible to be excreted in faeces.

Modified bacterial strain according to claim 1, characterized in that it is incapable of infecting humans.

12. Modified bacterial strain characterized by the fact that it conforms to CECT sample 7632.

Use of the modified bacterial strain as defined in any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11,

characterized by the fact that it is to produce a vaccine to induce protection in birds against infection by the natural homologous strain and strain of Salmonella Enteritidis.