WO2011078495A2 - Chemo-sensitive prediction method for snp - Google Patents

Chemo-sensitive prediction method for snp Download PDF

Info

Publication number
WO2011078495A2
WO2011078495A2 PCT/KR2010/008640 KR2010008640W WO2011078495A2 WO 2011078495 A2 WO2011078495 A2 WO 2011078495A2 KR 2010008640 W KR2010008640 W KR 2010008640W WO 2011078495 A2 WO2011078495 A2 WO 2011078495A2
Authority
WO
WIPO (PCT)
Prior art keywords
snp
seq
nucleotide
base
anticancer
Prior art date
Application number
PCT/KR2010/008640
Other languages
French (fr)
Korean (ko)
Other versions
WO2011078495A3 (en
Inventor
김진천
조동형
김용성
김선영
Original Assignee
재단법인 아산사회복지재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 아산사회복지재단 filed Critical 재단법인 아산사회복지재단
Publication of WO2011078495A2 publication Critical patent/WO2011078495A2/en
Publication of WO2011078495A3 publication Critical patent/WO2011078495A3/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/15—Medicinal preparations ; Physical properties thereof, e.g. dissolubility
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • the present invention relates to a method for screening SNPs for anticancer susceptibility prediction, an SNP for predicting susceptibility to anticancer drugs, and a method for predicting susceptibility to specific anticancer drugs using the same.
  • SNPs monobasic polymorphisms
  • the present inventors first confirmed tumor drug responsiveness through in vitro tumor reactivity analysis, and selected and analyzed the results from lymphocyte DNA of the same subject. Through the analysis of the most useful anticancer drug susceptibility prediction SNP genotype was discovered and the present invention was completed.
  • the present invention provides a method for screening anti-cancer drug susceptibility prediction SNP.
  • Another object of the present invention to provide an anticancer drug susceptibility prediction SNP marker.
  • Still another object of the present invention is to provide a kit for predicting anticancer drug sensitivity.
  • Still another object of the present invention is to provide a method for predicting susceptibility to anticancer drugs using the SNP marker.
  • One aspect of the invention relates to a method for screening SNPs for anticancer drug susceptibility prediction.
  • the nominal P-value of the selected genotype is 0.1% or less, the frequency of allele in the Asian genotype, genotype located in the linkage disequilibrium block, htSNP (haplotype tagging SNP), functional SNP and normal Selecting the SNP genotype in consideration of the Hardy-Wineberg equilibrium P value in the population;
  • It relates to a method for screening anticancer drug susceptibility prediction SNP comprising a.
  • step (1) of the above method can be carried out by the method described in the application number 10-2008-0115296.
  • In vitro tumor reactivity test
  • the linkage disequilibrium block (LD block) region is a region that is short enough such that a section on a particular genome is passed over generation and cross-over rarely occurs, or is a result of dense genes. Thus, the genetic information in this section is nearly identical and preserved over generations.
  • htSNP haplotype tagging SNP refers to a minimum set of SNPs that can distinguish a specific haplotype among all haplotypes, and represents a representative SNP. Therefore, LD block SNP and htSNP can reduce the time and expense by eliminating the effort of repeatedly verifying similar SNPs.
  • Hardy-Weinberg equilibrium refers to a genomic equilibrium state when randomly combined in a particular population and is generally expressed as a P value. When this value is less than 0.01, it is out of equilibrium. False positive SNPs resulting from these results can be excluded because they indicate errors in analysis or population selection.
  • Table 1 regimens gene SNP ID Allele type result Reference how FL GPC5 rs553717 G A A155V Capecitabine AJAP1 rs242056 G A G263R Capecitabine ERCC4 rs4309380 C T upstream FOLFIRI TNFRSF11B rs2073618 C G N3K FOLFOX SULT1C2 rs17036104 T G S255A FOLFOX SULT1C4 rs7580171 C T upstream FOLFOX EPHA7 rs2278106 + G A R278C FOLFOX EPHA7 rs2278107 T C I138V FL, FOLFIRI, FOLFOX SSTR4 rs2567608 A G F321S SAHA OR5AC2 rs4518168 G A M200I SAHA OR5H1 rs6775533 T C upstream PXD101 DPYD rs1801265 C T R29C
  • the screening method further comprises the step of associating the SNP genotype selected in step (2) with an existing clinical course.
  • Anticancer agents can be used to validate clinical relevance in the use of anticancer agents whose treatment has been confirmed.
  • the clinical course tracking of the patient was based on the NCCN surveillance guideline (www.nccn, org), and the tumor responsiveness of the anticancer agent was determined by RECIST criteria (Therasse et al., J Natl Cancer Inst 2000; 92). : 205-16).
  • the average follow-up period was 40 months (range 4-108 months), which was judged to be sufficient for judging results. This step eliminates the difference of the in vitro tumor reactivity test with the metabolic environment in the body and allows direct entry into the clinical trial.
  • the screening method preferably further comprises a cell biological verification.
  • a cell biological verification includes gene transformation, cell survival and cytotoxicity assays, apoptosis by caspase-3 western blot and flow cytometry.
  • the cytobiological validation comprises the steps of transforming tumor cells with a wild type gene or a mutant gene; Treating the tumor cells with a specific anticancer agent; It may include the step of measuring the cell viability of the tumor cells.
  • Another aspect of the invention relates to an anticancer drug susceptibility prediction SNP.
  • the SNP of the present invention is as follows.
  • SNPs for predicting susceptibility to the anticancer agent FL are in the rs553717 (SNP id) polynucleotide (SEQ ID NOs: 1 and 13) that constitute a part of the GPC5 (glypican5) gene, 401th Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to anticancer FL than those with reference alleles.
  • the leucovorin is an adjuvant drug that enhances the efficacy of the anticancer drug 5-FU.
  • SNPs for predicting susceptibility to the anticancer agent capecitabine include the 401th base in the rs242056 polynucleotide (SEQ ID NO: 2, No. 1 chromosome) constituting part of the AJAP1 (adherens junctions associated protein 1) gene. Polynucleotides consisting of two or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles have a higher responsiveness to the anticancer agent capecitabine than with reference alleles.
  • SNP for predicting susceptibility to the anticancer agent capecitabine is the 201st in the rs4309380 polynucleotide (SEQ ID NOs: 3 and 16), which forms part of the ERCC4 gene (excision repair cross-complementing rodent repair deficiency, complementation group 4). At least one of polynucleotides or their complementary polynucleotides comprising a base and consisting of eight or more consecutive bases. Those with alternative alleles have a higher responsiveness to the anticancer agent capecitabine than with reference alleles.
  • Anticancer drug FOLFIRI (5-FU + leucovorin + irinotecan): A combination of anticancer drug 5-FU and irinotecan, and leukoborin is a synergistic agent for 5-FU. 301st for rs2073618 polynucleotide (SEQ ID NOs: 4, 8) that forms part of the necrosis factor receptor superfamily member 11B precursor) gene Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to the anticancer agent FOLFIRI than those with reference alleles.
  • Anticancer drug FOLFOX (5-FU + leucovorin + oxaliplatin): A combination of 5-FU and oxaliplatin, and leukoborin is a synergistic agent for 5-FU. 301st for the rs17036104 polynucleotide (SEQ ID NO: 5, 2) which constitutes a part of Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to the anticancer agent FOLFIRI than those with reference alleles.
  • Another susceptibility predictive SNP for the anticancer agent FOLFOX is a polynucleotide comprising the 201 base and consisting of 8 or more consecutive bases in the rs7580171 polynucleotide (SEQ ID NO: 6, 2 chromosome) constituting part of the SULT1C4 gene or Complementary polynucleotides thereof.
  • SEQ ID NO: 6, 2 chromosome a polynucleotide comprising the 201 base and consisting of 8 or more consecutive bases in the rs7580171 polynucleotide (SEQ ID NO: 6, 2 chromosome) constituting part of the SULT1C4 gene or Complementary polynucleotides thereof.
  • Those with alternative alleles are more responsive to the anticancer agent FOLFIRI than those with reference alleles.
  • Another susceptibility predictive SNP for the anticancer agent FOLFOX is the 301th in the rs2278107 (SEQ ID NO: 7, Chromosome No. 7) constituting part of the EPHA7 (ephrin type-A receptor 7 precursor) gene.
  • Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to the anticancer agent FOLFIRI than those with reference alleles.
  • the SNP for predicting susceptibility to at least one of the anticancer agent FL, FOLFIRI or FOLFOX is the 401st of the rs2567608 polynucleotide (SEQ ID NOs: 8 and 20) that constitutes a part of the somatostatin receptor type 4 (SSTR4) gene.
  • Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to at least one of the anticancer agents FL, FOLFIRI or FOLFOX compared to those with the reference allele.
  • SNPs for predicting susceptibility to the anticancer drug SAHA include the 401th base and the 8th base of the rs4518168 polynucleotide (SEQ ID NOs: 9 and 3) that constitute a part of the olfactory receptor 5AC2 (OR5AC2) gene.
  • SNPs for predicting susceptibility to the anticancer drug SAHA include the 251 st base for the rs6775533 polynucleotide (SEQ ID NO: 10, chromosome 3) that forms part of the OR5H1 (olfactory receptor 5H1) gene. At least one of a polynucleotide consisting of two or more consecutive bases or a complementary polynucleotide thereof. Those with alternative alleles are more responsive to anticancer drug SAHA than those with reference alleles.
  • the SNP for predicting susceptibility to the anticancer agent PXD101 is the 401th of rs1801265 polynucleotide (SEQ ID NO: 11, No. 1) which forms part of the DPYD (Dihydropyrimidine dehydrogenase [NADP +] precursor) gene.
  • DPYD Dihydropyrimidine dehydrogenase [NADP +] precursor
  • Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to anticancer agent PXD101 than those with reference alleles.
  • SNP stands for single nucleotide polymorphism, where rs is an abbreviation for the reference sequence, and the number after it is an accession number that distinguishes each single nucleotide polymorphism provided by the database dbSNP.
  • the present invention is the 401 nucleotide of SEQ ID NO: 1,2,8,9,11, the 201 nucleotide of SEQ ID NO: 3,6, the 301 nucleotide of SEQ ID NO: 4,5,7 and the 251 nucleotide of SEQ ID NO: 10
  • one or more anticancer drug sensitivity predictive polynucleotides selected from polynucleotides consisting of 8 or more consecutive bases comprising a complementary polynucleotide thereof.
  • the eight or more consecutive bases are preferably 8 to 100 consecutive bases.
  • susceptibility prediction for an anticancer agent means the prediction of the therapeutic effect when the patient is treated with the anticancer agent. If the sensitivity to the anticancer agent is high, excellent therapeutic effect can be expected, while if the sensitivity to the anticancer agent is low, the therapeutic effect is expected to be low.
  • SNP Single Nucleotide Polymorphism
  • the polynucleotides of SEQ ID NOs. 1-11 described above are polymorphic sequences.
  • the polymorphic sequence refers to a sequence including a polymorphic site representing SNP in the polynucleotide sequence.
  • the polynucleotide can be DNA or RNA.
  • the polynucleotides of SEQ ID NOs. 1-11 described above are allelic-specific.
  • the allele specific polynucleotide means to hybridize specifically to each allele. That is, it means hybridizing so that the base of the polymorphic site in each polymorphic sequence of SEQ ID NO: 1-11 can be distinguished specifically.
  • hybridization is usually carried out under stringent conditions, for example, salt concentrations below 1 M and temperatures above 25 ° C.
  • stringent conditions for example, salt concentrations below 1 M and temperatures above 25 ° C.
  • 5 ⁇ SSPE 750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH7.4
  • 25-30 ° C. may be suitable for allele specific probe hybridization.
  • the allele-specific polynucleotide may be a primer.
  • primers refer to single-stranded oligonucleotides that can act as a starting point for template-directed DNA synthesis under appropriate conditions (eg, dNTP or dUTP, DNA, RNA polymerase or reverse transcriptase) in appropriate buffers and at appropriate temperatures.
  • the appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. In general, short primer molecules require lower temperatures to form stable hybrids with the template.
  • the primer has its 3 'end aligned with the polymorphic site of SEQ ID NOs: 1-11.
  • the primer hybridizes to the target DNA comprising the polymorphic site and initiates amplification of an allelic form in which the primer shows complete homology.
  • This primer is used in pairs with a second primer that hybridizes to the other side. By amplification the product is amplified from two primers, which means that certain allelic forms are present.
  • the allele specific polynucleotide may be a probe.
  • the probe refers to a hybridization probe, and refers to an oligonucleotide capable of sequence-specific binding to the complementary strand of a nucleic acid.
  • the probe of the present invention is an allele-specific probe, in which polymorphic sites exist in nucleic acid fragments derived from two members of the same species, and hybridize to DNA fragments derived from one member, but not to fragments derived from other members. .
  • Hybridization conditions in this case show significant differences in hybridization strength between alleles and should be sufficiently stringent to hybridize to only one of the alleles.
  • the center portion eg, position 7 for 15-nucleotide probes and position 8 or 9 for 16-nucleotide probes. This can lead to good formation differences between different allelic forms.
  • microarray comprising an anticancer drug susceptibility predicting SNP, a polynucleotide comprising a SNP, a polypeptide encoded by the same or a cDNA thereof according to the present invention.
  • Microarrays according to the present invention can be prepared by conventional methods known to those skilled in the art using anti-cancer drug susceptibility prediction SNP.
  • the nucleotide may be immobilized on a substrate coated with an active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde.
  • the substrate may be selected from the group consisting of silicon wafer, glass, quartz, metal and plastic.
  • Another aspect of the present invention relates to a kit for predicting anticancer drug sensitivity comprising the microarray according to the present invention.
  • the kit according to the present invention may further comprise a primer set used to separate and amplify DNA containing the SNP from the subject in addition to the microarray of the present invention.
  • a primer set used to separate and amplify DNA containing the SNP from the subject in addition to the microarray of the present invention.
  • Another aspect of the invention relates to a method for predicting anticancer drug susceptibility using SNPs for anticancer drug susceptibility prediction.
  • DNA is isolated from tissues, body fluids, or cells of a subject, and then amplified by PCR, followed by SNP analysis.
  • SNP analysis can be performed by conventional methods known in the art.
  • the SNP analysis may be performed using a real time PCR system, or may be performed by determining the nucleotide sequence of the nucleic acid directly by the dideoxy method, or a probe including the sequence of the SNP region or a complementary probe thereof.
  • step (2) the base of the SNP position corresponding to the 401th nucleotide of SEQ ID NO: 1 is identified as A (identified by G / A or A / A heterologous type)
  • the anticancer drug FL (5-FU + leucovorin) can be expected to be highly susceptible.
  • the clinical correlation analysis of the FL formulation using group shows a homozygous replacement allele (homozygous substitution allele) in the SNP id rs553717 of the gene GPC 5 having a reference allele (reference allele)
  • the relapse was about 2 times higher, and the average disease-free survival was significantly reduced (Example 3-1). This suggests that the addition of another medicament is recommended for those with alternative allele types.
  • the anticancer drug capcitabine has high sensitivity.
  • the base of the SNP position corresponding to 301 nucleotide of SEQ ID NO: 5 is G
  • the base of the SNP position corresponding to 201 nucleotide of SEQ ID NO: 6 is T
  • the base of the SNP position corresponding to 301 nucleotide of SEQ ID NO: 7 is C
  • the results of clinical association analysis of the FOLFIRI or FOLFOX® drug use group showed a significantly lower anti-cancer drug responsiveness when the reference allele group of EPHA7 rs2272107 and SSTR4 rs2567608 was used (Example 3-2).
  • the base of the SNP position corresponding to the 401 nucleotide of SEQ ID NO: 9 is identified as A or the base of the SNP position corresponding to the 251 nucleotide of SEQ ID NO: 10 can be predicted to have high susceptibility to the anticancer drug SAHA.
  • the base of the SNP position corresponding to the 401 nucleotide of SEQ ID NO: 11 is identified as T, it can be predicted that the susceptibility to the anticancer agent PXD101 is high.
  • the present invention allows the use of small blood samples from patients to predict in advance useful drugs for tumors that are resistant to drugs, enable the selection of the most appropriate anticancer drugs throughout the course of the patient, and develop appropriate genetic diagnostic tools. Was done.
  • the present invention can extend the scope of application to the technology that can newly discover the SNP markers that can predict the reactivity of the anticancer agent and the general treatment using the drug, including the new drug in the future.
  • 1 shows 12 SNP candidates of 11 selected genes showing susceptibility to 6 anticancer agents.
  • Figure 2 shows the overall survival (OS) and disease-free survival (DFS) in the FL-assisted use group according to the GPC5 rs553717 type, showing a significant DFS reduction in the homozygous allele.
  • a total of 766 SNPs out of a total of 344,048 SNPs were obtained by correlating high-intensity high-speed SNP analysis (using Affymetrix SNP Array 5.0) and in vitro tumor reactivity analysis in 104 patients with colorectal cancer.
  • the nominal P-value is 0.001 (0.1%) or less, SNP genotype showing a frequency of 5% or more in the existing Japanese and Chinese analysis data (), and linkage disequilibrium. Candidates were selected and 12 candidate SNPs were further identified through non-synonymous, haplotype-tagging and functional SNP screening (FIG. 1).
  • the cDNA clone of the gene (GPC5 was obtained from Korea Research Institute of Bioscience and Biotechnology; SSTR4 and EPHA7 were obtained from OriGene Technologies, Rockville, MD, USA).
  • SNP-type mutant plasmids were prepared using a site-directed mutagenesis kit and wild-type and mutated plasmids were transferred to RKO cells, a colorectal cancer cell line, by sequencing method, followed by 10 days G418 selection. Cell lines were constructed in which each gene was overexpressed. Primers used for the mutagenesis are listed in Table 4.
  • FIG. 1 The apoptosis of the corresponding agents against the cell lines was indicated by a trypan blue exclusion assay, and cell viability was determined using a cytotoxicity assay kit (CCK8).
  • Figure 3 shows the results of treatment with the corresponding anticancer agent at 24 hours, three repeats showed the same low sensitivity as the clinical association analysis in the reference allele genotype (P ⁇ 0.001).
  • flow cytometry was performed on the corresponding anticancer agents of the imported cell lines of the SSTR4 and EPHA7 genotypes to observe cell death along the cell cycle. Measurement was performed using a FACscaliber flow cytometer (Becton Dickinson, SanJose, CA, USA) using the Annexin V-FITC Apoptosis Detection kit.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a chemosensitive screening method for predicting Single Nucleotide Polymorphism (SNP) using single nucleotide polymorphic markers, and predicting susceptibility to cancer using such SNP markers. The method also provides a means to select the best treatment course and the most suitable anti-cancer medication even in cases of drug resistance after patients have been selectively identified according to the present invention.

Description

항암제 감수성 예측용 ＳＮＰSNP for anticancer drug sensitivity prediction
본 발명은 항암제 감수성 예측용 SNP 스크리닝하는 방법, 항암제에 대한 감수성을 예측할 수 있는 SNP 및 이를 이용하여 특정 항암제에 대한 감수성을 예측할 수 있는 방법에 관한 것이다.The present invention relates to a method for screening SNPs for anticancer susceptibility prediction, an SNP for predicting susceptibility to anticancer drugs, and a method for predicting susceptibility to specific anticancer drugs using the same.
개인의 다양한 유전체적 차이는 대부분 단염기다형성(SNP)으로 구성되는데 일부의 유전자형에서는 해당 단백질과 그 대사에서 기능적인 차이를 보이며 이는 약리유전체적 대인적 감수성에 민감하게 작용하는 것으로 알려져 있다(Huang and Ratain, CA Cancer J Clin 2009;59:42-55).Various genome differences in individuals consist mostly of monobasic polymorphisms (SNPs). Some genotypes have functional differences in their proteins and their metabolism, which are known to be sensitive to pharmacogenomic interpersonal sensitivity (Huang and Ratain, CA Cancer J Clin 2009; 59: 42-55).
한편, 항암제는 내성과 독성에 관해서 개인차가 크며 동일한 환자에서도 약 반수이상에서 내성을 보이는 문제가 있으므로 적합한 치료반응성 표식자를 이용한 선별은 항암제 치료의 획기적인 진보를 초래할 수 있다. 이에, SNP 유전자형에 따른 개별 항암제의 치료반응성에 관한 연구가 최근 지속적으로 활발하게 전개되고 있다.On the other hand, since anticancer drugs have a large individual difference in resistance and toxicity, and in the same patient, there is a problem of resistance in about half or more. Therefore, selection using appropriate therapeutic responsive markers can lead to a breakthrough in anticancer drug treatment. Accordingly, studies on the therapeutic responsiveness of individual anticancer agents according to the SNP genotype have been actively developed in recent years.
그러나 특정약제에 대한 생체반응 관련요소의 복합적 작용, 치료제 및 투여방식의 다양성과 방대한 시료확보의 어려움으로 아직 괄목할 만한 성과가 미약한 현실이다.However, due to the complex effects of bioreaction-related factors on specific drugs, the diversity of therapeutic agents and administration methods, and the difficulty of obtaining a large sample, the results are still insignificant.
본 발명자는 이러한 약점을 보완하고자, 일차로 종양의 약제반응성을 체외종양반응성분석을 통해 확인하여 그 결과를 동일한 대상환자의 림프구 DNA에서 연관 분석하여 선별하였으며 이를 현재까지 확인된 인간유전체 정보 및 인구유전학적 검정을 통해 가장 유용한 항암제 감수성 예측용 SNP 유전자형을 발굴하고, 본 발명을 완성하기에 이르렀다.In order to compensate for these weaknesses, the present inventors first confirmed tumor drug responsiveness through in vitro tumor reactivity analysis, and selected and analyzed the results from lymphocyte DNA of the same subject. Through the analysis of the most useful anticancer drug susceptibility prediction SNP genotype was discovered and the present invention was completed.
따라서 본 발명은 항암제 감수성 예측용 SNP의 스크리닝 방법을 제공한다.Accordingly, the present invention provides a method for screening anti-cancer drug susceptibility prediction SNP.
본 발명의 다른 목적은 항암제 감수성 예측용 SNP 마커를 제공하는데 있다.Another object of the present invention to provide an anticancer drug susceptibility prediction SNP marker.
본 발명의 또 다른 목적은 항암제 감수성 예측용 키트를 제공하는데 있다.Still another object of the present invention is to provide a kit for predicting anticancer drug sensitivity.
본 발명의 또 다른 목적은 상기 SNP 마커를 이용하여 항암제에 대한 감수성 예측방법을 제공하는데 있다.Still another object of the present invention is to provide a method for predicting susceptibility to anticancer drugs using the SNP marker.
본 발명의 한 측면은 항암제 감수성 예측용 SNP의 스크리닝 방법에 관한 것이다.One aspect of the invention relates to a method for screening SNPs for anticancer drug susceptibility prediction.
(1) 환자의 종양조직을 이용한 체외 종양 반응성 검사 결과와 동일 환자의 SNP 분석 결과를 연관 분석하여 항암제 감수성 예측용 후보 SNP 유전자형을 선별하는 단계; 및(1) selecting candidate SNP genotypes for predicting anticancer drug susceptibility by associating an SNP analysis result of the same patient with an in vitro tumor reactivity test result using the patient's tumor tissue; And
(2) 상기 선별된 유전자형 중 명목 P-값이 0.1% 이하이고, 동양인 유전자형에서 대립유전자의 빈도, 교차불평형 블록 (linkage disequilibrium block)에 위치하는 유전자형, htSNP(haplotype tagging SNP), 기능성 SNP 및 정상 인구군에서 하디-와인버그 평형 P 값을 고려하여 SNP 유전자형을 선별하는 단계;(2) the nominal P-value of the selected genotype is 0.1% or less, the frequency of allele in the Asian genotype, genotype located in the linkage disequilibrium block, htSNP (haplotype tagging SNP), functional SNP and normal Selecting the SNP genotype in consideration of the Hardy-Wineberg equilibrium P value in the population;
를 포함하는 항암제 감수성 예측용 SNP를 스크리닝하는 방법에 관한 것이다.It relates to a method for screening anticancer drug susceptibility prediction SNP comprising a.
상기 방법 중 (1) 단계의 체외 종양 반응성 검사는 출원번호 10-2008-0115296 의 기재된 방법으로 시행될 수 있다. 체외 종양 반응성 검사는, In vitro tumor reactivity test of step (1) of the above method can be carried out by the method described in the application number 10-2008-0115296. In vitro tumor reactivity test,
(i) 1차 항암제 반응판 및 2차 항암제 반응판을 준비하는 단계;(i) preparing a primary anticancer reaction plate and a secondary anticancer reaction plate;
(ii) 피검체로부터 준비한 종양조직 시료를 상기 항암제 반응판의 1차 항암제 반응정 및 2차 항암제 반응정에 분주하고 배양하는 단계;(ii) dispensing and culturing the tumor tissue sample prepared from the subject in a primary anticancer reaction tablet and a secondary anticancer reaction tablet of the anticancer drug reaction plate;
(iii) 1차 항암제 반응판의 반응정 및 2차 항암제 반응판의 반응정에 1차 항암제 후보들을 처리하고 반응시키는 단계;(iii) treating and reacting the primary anticancer drug candidates to the reaction tablet of the primary anticancer drug reaction plate and the reaction tablet of the secondary anticancer drug reaction plate;
(iv) 1차 항암제 반응판의 반응정에 처리된 1차 항암제 후보들의 감수성을 측정 및 분석하고, 2차 항암제 반응판의 반응정에는 1차 항암제와 상이한 조합의 2차 항암제 후보들을 처리하여 반응시키는 단계; 및 (iv) measuring and analyzing the susceptibility of the primary anticancer candidates treated in the reaction tablet of the primary anticancer reaction plate, and reacting the secondary anticancer candidates in a combination different from the primary anticancer agent in the reaction tablet of the secondary anticancer drug reaction plate. Making a step; And
(v) 2차 항암제 반응판의 반응정에 처리된 2차 항암제 후보들의 감수성을 측정 및 분석하는 단계;(v) measuring and analyzing the sensitivity of the secondary anticancer drug candidates treated in the reaction tablet of the secondary anticancer drug reaction plate;
를 포함할 수 있으며 수년에 걸친 임상경과에 대한 분석이 필요하지 않고 신약에 대한 감수성까지도 스크리닝 할 수 있는 장점이 있다. 본 체외 검사방식은 이미 임상에서 사용 중이며 임상결과와 긴밀한 연관성은 이미 알려져 있다.It may include and do not require analysis of the clinical course over the years, there is an advantage that can be screened for sensitivity to new drugs. This in vitro method is already in use in the clinic and its close association with the clinical results is known.
2단계 검증에서는 우선 고집적고속 SNP(Affymetrix SNP Array 5.0 사용)선별과 체외종양반응성 연관분석 결과, 군소 대립유전자의 빈도가 이미 알려진 한국인과 유사한 일본인과 중국인 데이트베이스 (5%이상이며, 일본인 데이트베이스상 교차 불평형 블록(linkage disequilibrium, LD; WGAViewer, Ge D, Zhang K, Need AC, et al. GenomeRes 2008;18:640-643)에서 재조합이 없는 경우, 일배체형 표지 SNP(haplotype tagging SNP, htSNP), 가능한 기능성 SNP 이며, 하디-와인버그 평형 P값이 0.01이상인 SNP를 대상으로 하였다. 군소 대립유전자의 빈도가 5%로 정한 것은 희귀한 변이를 놓치지 않고 표본 대상의 숫자를 줄일 수 있는 통계적 유의성이 있는 최소값으로써 산출하였다. In the two-step verification, first, a high-intensity high-speed SNP (using Affymetrix SNP Array 5.0) screening and in vitro tumor reactivity were analyzed. Linkage disequilibrium, LD; WGAViewer, Ge D, Zhang K, Need AC, et al. GenomeRes 2008; 18: 640-643), the haplotype tagging SNP (htSNP), possible functional SNPs, and SNPs with a Hardy-Weinberg equilibrium P value of 0.01 or more. The 5% frequency of small alleles was calculated as a statistically significant minimum that could reduce the number of sample subjects without missing rare variations.
상기 교차 불평형 블록 (linkage disequilibrium block, LD block) 부위는 특정 게놈 상의 구간이 세대를 거치며 cross-over가 거의 일어나지 않을 정도로 짧거나 유전자가 밀집되어 있어서 생기는 부분이다. 따라서 이 구간에 존재하는 유전적 정보 (genomic information)는 거의 동일하고 세대를 거쳐도 거의 보존된다. 이와 유사하게 htSNP (haplotype tagging SNP) 란, 전체 일배체형(haplotype) 중에서 특정 haplotype을 구분할 수 있는 최소한의 SNP set을 칭하며 인접 SNP을 대표하는 특징을 보인다. 그러므로 LD block SNP와 htSNP은 유사한 성질의 SNP을 반복해서 검증하는 노력을 소멸하여 시간과 경비를 줄일 수 있다. The linkage disequilibrium block (LD block) region is a region that is short enough such that a section on a particular genome is passed over generation and cross-over rarely occurs, or is a result of dense genes. Thus, the genetic information in this section is nearly identical and preserved over generations. Similarly, htSNP (haplotype tagging SNP) refers to a minimum set of SNPs that can distinguish a specific haplotype among all haplotypes, and represents a representative SNP. Therefore, LD block SNP and htSNP can reduce the time and expense by eliminating the effort of repeatedly verifying similar SNPs.
하디-와인버그 평형은 특정 인구군에서 무작위 결합될 때 유전체적으로 평형된 상태를 말하며 일반적으로 P값으로 나타내며 이 값이 0.01이하 일때는 평형상태를 벗어난 경우로써 혈족결혼, 유전자표류, 돌연변이, 선택, 유전자분석 혹은 인구군선정상의 오류를 나타내므로 이러한 결과로부터 생기는 위양성 SNP를 제외할 수 있다.Hardy-Weinberg equilibrium refers to a genomic equilibrium state when randomly combined in a particular population and is generally expressed as a P value. When this value is less than 0.01, it is out of equilibrium. False positive SNPs resulting from these results can be excluded because they indicate errors in analysis or population selection.
상기 2단계 검증까지 발굴된 11종 유전자의 11개의 항암제 반응성 후보 SNP 표식자는 하기 표 1과 같다.The 11 anticancer drug responsive candidate SNP markers of the 11 genes discovered until the two-step verification are shown in Table 1 below.
표 1
regimens 유전자 SNP ID 대립유전자형 결과
참고 대체
FL GPC5 rs553717 G A A155V
카페시타빈 AJAP1 rs242056 G A G263R
카페시타빈 ERCC4 rs4309380 C T upstream
FOLFIRI TNFRSF11B rs2073618 C G N3K
FOLFOX SULT1C2 rs17036104 T G S255A
FOLFOX SULT1C4 rs7580171 C T upstream
FOLFOX EPHA7 rs2278106+ G A R278C
FOLFOX EPHA7 rs2278107 T C I138V
FL,FOLFIRI,FOLFOX SSTR4 rs2567608 A G F321S
SAHA OR5AC2 rs4518168 G A M200I
SAHA OR5H1 rs6775533 T C upstream
PXD101 DPYD rs1801265 C T R29C
Table 1
regimens gene SNP ID Allele type result
Reference how
FL GPC5 rs553717 G A A155V
Capecitabine AJAP1 rs242056 G A G263R
Capecitabine ERCC4 rs4309380 C T upstream
FOLFIRI TNFRSF11B rs2073618 C G N3K
FOLFOX SULT1C2 rs17036104 T G S255A
FOLFOX SULT1C4 rs7580171 C T upstream
FOLFOX EPHA7 rs2278106 + G A R278C
FOLFOX EPHA7 rs2278107 T C I138V
FL, FOLFIRI, FOLFOX SSTR4 rs2567608 A G F321S
SAHA OR5AC2 rs4518168 G A M200I
SAHA OR5H1 rs6775533 T C upstream
PXD101 DPYD rs1801265 C T R29C
*FL, 5-FU/leucovorin; FOLFIRI, FL+ irinotecan; FOLFOX,FL + oxaliplatin* FL, 5-FU / leucovorin; FOLFIRI, FL + irinotecan; FOLFOX, FL + oxaliplatin
+ EPHA7-rs2278106 은 인구유전학적 검증 결과 배제함+ EPHA7-rs2278106 excludes demographic tests
상기 스크리닝 방법은 (2) 단계에서 선별된 SNP 유전자형을 기존 임상 경과와 연관 분석하는 단계를 추가로 더 포함하는 것이 바람직하다. 항암제를 사용하여 치료 경과가 확인된 항암제 제제 사용군을 대상으로 임상적 연관성을 검증할 수 있다. Preferably, the screening method further comprises the step of associating the SNP genotype selected in step (2) with an existing clinical course. Anticancer agents can be used to validate clinical relevance in the use of anticancer agents whose treatment has been confirmed.
본 발명의 일 실시예에서는, 해당 환자의 임상경과 추적은 NCCN surveillance guideline(www.nccn,org)에 의거하였으며, 항암제의 종양 반응성 판정은 RECIST criteria(Therasse et al., J Natl Cancer Inst 2000;92:205-16)에 의거하였다. 해당 환자의 추적 관찰기간은 평균 40개월(범위 4-108개월)이었으며, 결과 판정에 충분한 기간으로 판단되었다. 본 단계를 통해서 체외 종양 반응성 검사의 체내 약물대사 환경과의 상이성을 배제하게 되며, 직접 임상시험에 진입할 수 있다.In one embodiment of the present invention, the clinical course tracking of the patient was based on the NCCN surveillance guideline (www.nccn, org), and the tumor responsiveness of the anticancer agent was determined by RECIST criteria (Therasse et al., J Natl Cancer Inst 2000; 92). : 205-16). The average follow-up period was 40 months (range 4-108 months), which was judged to be sufficient for judging results. This step eliminates the difference of the in vitro tumor reactivity test with the metabolic environment in the body and allows direct entry into the clinical trial.
상기 스크리닝 방법은 세포생물학적 검증을 추가로 포함하는 것이 바람직하다. 여기에는 유전자 형질전환, 세포 생존 및 세포독성분석, 카스파제-3 웨스턴 블롯 및 유세포분석에 의한 세포사멸검증을 포함한다. 이를 통해서 본 발명의 SNP 유전자형의 생물학적 기전을 제시할 수 있으며, 신약개발의 표적 후보물질로 적용이 가능하다.The screening method preferably further comprises a cell biological verification. This includes gene transformation, cell survival and cytotoxicity assays, apoptosis by caspase-3 western blot and flow cytometry. Through this, it is possible to suggest a biological mechanism of the SNP genotype of the present invention, it is possible to apply as a target candidate of new drug development.
한 양태로서, 상기 세포생물학적 검증은 야생형 유전자 또는 돌연변이 유전자로 종양세포를 형질전환시키는 단계; 상기 종양세포에 특정 항암제를 처리하는 단계; 상기 종양세포의 세포 생존율을 측정하는 단계를 포함할 수 있다.In one embodiment, the cytobiological validation comprises the steps of transforming tumor cells with a wild type gene or a mutant gene; Treating the tumor cells with a specific anticancer agent; It may include the step of measuring the cell viability of the tumor cells.
본 발명의 다른 측면은 항암제 감수성 예측용 SNP에 관한 것이다. Another aspect of the invention relates to an anticancer drug susceptibility prediction SNP.
본 발명의 SNP는 구체적으로 다음과 같다. Specifically, the SNP of the present invention is as follows.
항암제 FL(5-FU + 류코보린 (leucovorin))에 대한 감수성 예측용 SNP는 GPC5 (glypican5) 유전자의 일부를 구성하는 rs553717 (SNP id)폴리뉴클레오티드 (서열번호 1, 13번 염색체)에 있어서, 401번째 염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함한다. 대체대립유전자형을 갖는 경우 참고대립유전자형을 갖는 경우에 비해 항암제 FL 에 대한 반응성이 높다. SNPs for predicting susceptibility to the anticancer agent FL (5-FU + leucovorin) are in the rs553717 (SNP id) polynucleotide (SEQ ID NOs: 1 and 13) that constitute a part of the GPC5 (glypican5) gene, 401th Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to anticancer FL than those with reference alleles.
상기 류코보린 (leucovorin)은 항암제 5-FU의 효능을 증진시키는 보조 약제이다.The leucovorin is an adjuvant drug that enhances the efficacy of the anticancer drug 5-FU.
항암제 카페시타빈(capecitabine)에 대한 감수성 예측용 SNP는 AJAP1(adherens junctions associated protein 1) 유전자의 일부를 구성하는 rs242056 폴리뉴클레오티드 (서열번호 2, 1번 염색체)에 있어서, 401번째 염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함한다. 대체 대립유전자형을 갖는 경우, 참고대립유전자형을 갖는 경우에 비해 항암제 카페시타빈에 대한 반응성이 높다.SNPs for predicting susceptibility to the anticancer agent capecitabine include the 401th base in the rs242056 polynucleotide (SEQ ID NO: 2, No. 1 chromosome) constituting part of the AJAP1 (adherens junctions associated protein 1) gene. Polynucleotides consisting of two or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles have a higher responsiveness to the anticancer agent capecitabine than with reference alleles.
항암제 카페시타빈에 대한 다른 감수성 예측용 SNP는 ERCC4(excision repair cross-complementing rodent repair deficiency, complementation group 4) 유전자의 일부를 구성하는 rs4309380 폴리뉴클레오티드 (서열번호 3, 16번 염색체)에 있어서, 201번째 염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적인 폴리뉴클레오티드 중 적어도 하나를 포함한다. 대체 대립유전자형을 갖는 경우, 참고대립유전자형을 갖는 경우에 비해 항암제 카페시타빈에 대한 반응성이 높다.Another SNP for predicting susceptibility to the anticancer agent capecitabine is the 201st in the rs4309380 polynucleotide (SEQ ID NOs: 3 and 16), which forms part of the ERCC4 gene (excision repair cross-complementing rodent repair deficiency, complementation group 4). At least one of polynucleotides or their complementary polynucleotides comprising a base and consisting of eight or more consecutive bases. Those with alternative alleles have a higher responsiveness to the anticancer agent capecitabine than with reference alleles.
항암제 FOLFIRI (5-FU + 류코보린 (leucovorin) + 이리노테칸 (irinotecan): 항암제 5-FU 와 이리노테칸의 복합제제이며, 류코보린은 5-FU의 작용 상승제임)에 대한 감수성 예측용 SNP는 TNFRSF11B (tumor necrosis factor receptor superfamily member 11B precursor) 유전자의 일부를 구성하는 rs2073618 폴리뉴클레오티드 (서열번호 4, 8번 염색체)에 있어서, 301번째 염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함한다. 대체 대립유전자형을 갖는 경우, 참고대립유전자형을 갖는 경우에 비해 항암제 FOLFIRI 에 대한 반응성이 높다.Anticancer drug FOLFIRI (5-FU + leucovorin + irinotecan): A combination of anticancer drug 5-FU and irinotecan, and leukoborin is a synergistic agent for 5-FU. 301st for rs2073618 polynucleotide (SEQ ID NOs: 4, 8) that forms part of the necrosis factor receptor superfamily member 11B precursor) gene Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to the anticancer agent FOLFIRI than those with reference alleles.
항암제 FOLFOX (5-FU+ 류코보린 (leucovorin) + oxaliplatin (옥살리플라틴): 5-FU와 옥살리플라틴의 복합제재이며 류코보린은 5-FU의 작용 상승제임)에 대한 감수성 예측용 SNP는 SULT1C2 (sulfotransferase 1C2) 유전자의 일부를 구성하는 rs17036104 폴리뉴클레오티드 (서열번호 5, 2번 염색체)에 있어서, 301번째 염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함한다. 대체 대립유전자형을 갖는 경우, 참고대립유전자형을 갖는 경우에 비해 항암제 FOLFIRI 에 대한 반응성이 높다.Anticancer drug FOLFOX (5-FU + leucovorin + oxaliplatin): A combination of 5-FU and oxaliplatin, and leukoborin is a synergistic agent for 5-FU. 301st for the rs17036104 polynucleotide (SEQ ID NO: 5, 2) which constitutes a part of Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to the anticancer agent FOLFIRI than those with reference alleles.
항암제 FOLFOX에 대한 다른 감수성 예측용 SNP는 SULT1C4 유전자의 일부를 구성하는 rs7580171 폴리뉴클레오티드 (서열번호: 6, 2번 염색체) 에 있어서, 201번째 염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함한다. 대체 대립유전자형을 갖는 경우, 참고대립유전자형을 갖는 경우에 비해 항암제 FOLFIRI 에 대한 반응성이 높다.Another susceptibility predictive SNP for the anticancer agent FOLFOX is a polynucleotide comprising the 201 base and consisting of 8 or more consecutive bases in the rs7580171 polynucleotide (SEQ ID NO: 6, 2 chromosome) constituting part of the SULT1C4 gene or Complementary polynucleotides thereof. Those with alternative alleles are more responsive to the anticancer agent FOLFIRI than those with reference alleles.
항암제 FOLFOX에 대한 또 다른 감수성 예측용 SNP는 EPHA7 (ephrin type-A receptor 7 precursor) 유전자의 일부를 구성하는 rs2278107 (서열번호: 7, 6번 염색체) 폴리뉴클레오티드에 있어서, 301번째 염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적인 폴리뉴클레오티드를 포함한다. 대체 대립유전자형을 갖는 경우, 참고대립유전자형을 갖는 경우에 비해 항암제 FOLFIRI 에 대한 반응성이 높다.Another susceptibility predictive SNP for the anticancer agent FOLFOX is the 301th in the rs2278107 (SEQ ID NO: 7, Chromosome No. 7) constituting part of the EPHA7 (ephrin type-A receptor 7 precursor) gene. Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to the anticancer agent FOLFIRI than those with reference alleles.
항암제 FL, FOLFIRI 또는 FOLFOX 중 적어도 하나에 대한 감수성 예측용 SNP는 SSTR4 (somatostatin receptor type 4) 유전자의 일부를 구성하는 rs2567608 폴리뉴클레오티드 (서열번호: 8, 20번 염색체)에 있어서, 401번째 염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함한다. 대체 대립유전자형을 갖는 경우, 참고대립유전자형을 갖는 경우에 비해 항암제 FL, FOLFIRI 또는 FOLFOX 중 적어도 하나에 대한 반응성이 높다.The SNP for predicting susceptibility to at least one of the anticancer agent FL, FOLFIRI or FOLFOX is the 401st of the rs2567608 polynucleotide (SEQ ID NOs: 8 and 20) that constitutes a part of the somatostatin receptor type 4 (SSTR4) gene. Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to at least one of the anticancer agents FL, FOLFIRI or FOLFOX compared to those with the reference allele.
항암제 SAHA (suberoylanilide hydroxamic acid)에 대한 감수성 예측용 SNP는 OR5AC2 (olfactory receptor 5AC2) 유전자의 일부를 구성하는 rs4518168 폴리뉴클레오티드 (서열번호: 9, 3번 염색체)에 있어서, 401번째 염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함한다. 대체 대립유전자형을 갖는 경우, 참고대립유전자형을 갖는 경우에 비해 항암제 SAHA 에 대한 반응성이 높다.SNPs for predicting susceptibility to the anticancer drug SAHA (suberoylanilide hydroxamic acid) include the 401th base and the 8th base of the rs4518168 polynucleotide (SEQ ID NOs: 9 and 3) that constitute a part of the olfactory receptor 5AC2 (OR5AC2) gene. Polynucleotides composed of the above consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to anticancer drug SAHA than those with reference alleles.
항암제 SAHA (suberoylanilide hydroxamic acid)에 대한 다른 감수성 예측용 SNP는 OR5H1 (olfactory receptor 5H1) 유전자의 일부를 구성하는 rs6775533 폴리뉴클레오티드(서열번호:10, 3번 염색체)에 있어서, 251번째염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드 중 적어도 하나를 포함한다. 대체 대립유전자형을 갖는 경우, 참고대립유전자형을 갖는 경우에 비해 항암제 SAHA 에 대한 반응성이 높다.Other SNPs for predicting susceptibility to the anticancer drug SAHA (suberoylanilide hydroxamic acid) include the 251 st base for the rs6775533 polynucleotide (SEQ ID NO: 10, chromosome 3) that forms part of the OR5H1 (olfactory receptor 5H1) gene. At least one of a polynucleotide consisting of two or more consecutive bases or a complementary polynucleotide thereof. Those with alternative alleles are more responsive to anticancer drug SAHA than those with reference alleles.
항암제 PXD101에 대한 감수성 예측용 SNP는 DPYD (Dihydropyrimidine dehydrogenase [NADP+] precursor) 유전자의 일부를 구성하는 rs1801265 폴리뉴클레오티드(서열번호: 11, 1번 염색체)에 있어서, 401번째 염기를 포함하고 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함한다. 대체 대립유전자형을 갖는 경우, 참고대립유전자형을 갖는 경우에 비해 항암제 PXD101에 대한 반응성이 높다.The SNP for predicting susceptibility to the anticancer agent PXD101 is the 401th of rs1801265 polynucleotide (SEQ ID NO: 11, No. 1) which forms part of the DPYD (Dihydropyrimidine dehydrogenase [NADP +] precursor) gene. Polynucleotides comprising a base and consisting of 8 or more consecutive bases or complementary polynucleotides thereof. Those with alternative alleles are more responsive to anticancer agent PXD101 than those with reference alleles.
SNP는 단일염기다형을 나타내는 것으로, 여기서 rs란 reference sequence의 약자이며, 뒤의 숫자는 dbSNP라는 데이터베이스에서 제공하는 각각의 단일염기다형을 구분 짓는 고유 숫자(accession number)이다.SNP stands for single nucleotide polymorphism, where rs is an abbreviation for the reference sequence, and the number after it is an accession number that distinguishes each single nucleotide polymorphism provided by the database dbSNP.
즉, 본 발명은 서열번호 1,2,8,9,11의 401번째 뉴클레오티드, 서열번호 3,6의 201번째 뉴클레오티드, 서열번호 4,5,7의 301번째 뉴클레오티드 및 서열번호 10의 251번째 뉴클레오티드를 포함하는 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드들로부터 선택되는 하나 이상의 항암제 감수성 예측용 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 제공한다.In other words, the present invention is the 401 nucleotide of SEQ ID NO: 1,2,8,9,11, the 201 nucleotide of SEQ ID NO: 3,6, the 301 nucleotide of SEQ ID NO: 4,5,7 and the 251 nucleotide of SEQ ID NO: 10 Provided is one or more anticancer drug sensitivity predictive polynucleotides selected from polynucleotides consisting of 8 or more consecutive bases comprising a complementary polynucleotide thereof.
상기 8개 이상의 연속 염기는 8 내지 100개의 연속 염기인 것이 바람직하다.The eight or more consecutive bases are preferably 8 to 100 consecutive bases.
본 발명에서, 항암제에 대한 감수성 예측이란, 환자에게 해당 항암제를 처리하였을 때 치료 효과가 어느 정도인지를 예측하는 것을 말한다. 해당 항암제에 대한 감수성이 높은 경우는 우수한 치료 효과를 기대할 수 있는 반면, 해당 항암제에 대한 감수성이 낮은 경우는 저조한 치료 효과가 예상된다.In the present invention, susceptibility prediction for an anticancer agent means the prediction of the therapeutic effect when the patient is treated with the anticancer agent. If the sensitivity to the anticancer agent is high, excellent therapeutic effect can be expected, while if the sensitivity to the anticancer agent is low, the therapeutic effect is expected to be low.
본 발명에서, SNP(Single Nucleotide Polymorphism)는 개인과 개인간의 DNA에 존재하는 한 염기쌍(single base-pair variation)의 차이로, DNA 서열 다형성(polymorphism) 중에서 가장 많이 존재하는 형태이다.In the present invention, SNP (Single Nucleotide Polymorphism) is a difference between single base-pair variation in DNA between an individual and an individual, and is the most present form among DNA sequence polymorphisms.
전술된 서열번호 1 내지 11의 폴리뉴클레오티드는 다형성 서열(polymorphic sequence)이다. 다형성 서열이란 폴리뉴클레오티드 서열 중에서 SNP를 나타내는 다형성 부위(polymorphic site)를 포함하는 서열을 말한다. 상기 폴리뉴클레오티드는 DNA 또는 RNA가 될 수 있다.The polynucleotides of SEQ ID NOs. 1-11 described above are polymorphic sequences. The polymorphic sequence refers to a sequence including a polymorphic site representing SNP in the polynucleotide sequence. The polynucleotide can be DNA or RNA.
또한, 전술된 서열번호 1 내지 11의 폴리뉴클레오티드는 대립형질 특이적 (allelic-specific)이다. 상기 대립형질 특이적 폴리뉴클레오티드란 각 대립형질에 특이적으로 혼성화하는 것을 의미한다. 즉, 서열번호 1 내지 11의 각 다형성 서열 중의 다형성 부위의 염기를 특이적으로 구별할 수 있도록 혼성화하는 것을 말한다. 여기서, 혼성화란 엄격한 조건, 예를 들면 1M 이하의 염 농도 및 25℃ 이상의 온도하에서 보통 수행된다. 예를 들면, 5 x SSPE (750mM NaCl, 50mM Na Phosphate, 5mM EDTA, pH7.4) 및 25~30℃의 조건이 대립형질 특이적 프로브 혼성화에 적합할 수 있다.In addition, the polynucleotides of SEQ ID NOs. 1-11 described above are allelic-specific. The allele specific polynucleotide means to hybridize specifically to each allele. That is, it means hybridizing so that the base of the polymorphic site in each polymorphic sequence of SEQ ID NO: 1-11 can be distinguished specifically. Here, hybridization is usually carried out under stringent conditions, for example, salt concentrations below 1 M and temperatures above 25 ° C. For example, conditions of 5 × SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH7.4) and 25-30 ° C. may be suitable for allele specific probe hybridization.
본 발명에 있어서, 상기 대립형질 특이적인 폴리뉴클레오티드는 프라이머 (primer)일 수 있다. 여기서, 프라이머란 적절한 완충용액 중의 적절한 조건 (예, dNTP 또는 dUTP, DNA, RNA 폴리머라제 또는 역전사 효소) 및 적당한 온도 하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드를 말한다. 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있으나, 통상 15 내지 30 뉴클레오티드이다. 일반적으로 짧은 프라이머 분자는 주형과 안정한 혼성체를 형성하기 위해서는 더 낮은 온도를 필요로 한다. 상기 프라이머는 그의 3' 말단이 서열번호 1 내지 11의 다형성 부위와 정렬하는 것이 바람직하다. 상기 프라이머는 다형성 부위를 포함하는 표적 DNA에 혼성화하고, 상기 프라이머가 완전한 상동성을 보이는 대립형질 형태의 증폭을 개시한다. 이 프라이머는 반대편에 혼성화되는 제 2 프라이머와 쌍을 이루어 사용된다. 증폭에 의하여 두 개의 프라이머로부터 산물이 증폭되고, 이는 특정 대립형질 형태가 존재한다는 것을 의미한다.In the present invention, the allele-specific polynucleotide may be a primer. Here, primers refer to single-stranded oligonucleotides that can act as a starting point for template-directed DNA synthesis under appropriate conditions (eg, dNTP or dUTP, DNA, RNA polymerase or reverse transcriptase) in appropriate buffers and at appropriate temperatures. The appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. In general, short primer molecules require lower temperatures to form stable hybrids with the template. Preferably, the primer has its 3 'end aligned with the polymorphic site of SEQ ID NOs: 1-11. The primer hybridizes to the target DNA comprising the polymorphic site and initiates amplification of an allelic form in which the primer shows complete homology. This primer is used in pairs with a second primer that hybridizes to the other side. By amplification the product is amplified from two primers, which means that certain allelic forms are present.
본 발명에 있어서, 상기 대립형질 특이적 폴리뉴클레오티드는 프로브 (probe)일 수 있다. 본 발명에서 프로브란 혼성화 프로브를 의미하는 것으로, 핵산의 상보성 가닥에 서열 특이적으로 결합할 수 있는 올리고뉴클레오티드를 의미한다. 본 발명의 프로브는 대립형질 특이적 프로브로서, 같은 종의 두 구성원으로부터 유래한 핵산 단편 중에 다형성 부위가 존재하여, 한 구성원으로부터 유래한 DNA 단편에는 혼성화하나, 다른 구성원으로부터 유래한 단편에는 혼성화하지 않는다. 이 경우 혼성화 조건은 대립형질간의 혼성화 강도에 있어서 유의한 차이를 보여, 대립형질 중 하나에만 혼성화하도록 충분히 엄격해야 한다. 이러한 본 발명의 프로브는 중앙부위 (예, 15개의 뉴클레오티드로 된 프로브이면 7번 위치가, 16개의 뉴클레오티드로 된 프로브이면 8번 또는 9번 위치)가 상기 서열의 다형성 부위와 정렬하는 것이 바람직하다. 이렇게 함으로써 다른 대립형질성 형태간에 좋은 형성화 차이를 유발할 수 있다.In the present invention, the allele specific polynucleotide may be a probe. In the present invention, the probe refers to a hybridization probe, and refers to an oligonucleotide capable of sequence-specific binding to the complementary strand of a nucleic acid. The probe of the present invention is an allele-specific probe, in which polymorphic sites exist in nucleic acid fragments derived from two members of the same species, and hybridize to DNA fragments derived from one member, but not to fragments derived from other members. . Hybridization conditions in this case show significant differences in hybridization strength between alleles and should be sufficiently stringent to hybridize to only one of the alleles. In the probe of the present invention, it is preferable that the center portion (eg, position 7 for 15-nucleotide probes and position 8 or 9 for 16-nucleotide probes) is aligned with the polymorphic site of the sequence. This can lead to good formation differences between different allelic forms.
본 발명의 또 다른 측면은 본 발명에 따른 항암제 감수성 예측용 SNP, SNP를 포함하는 폴리뉴클레오티드, 그에 의해 코딩되는 폴리펩티드 또는 그의 cDNA를 포함하는 마이크로어레이에 관한 것이다. 본 발명에 따른 마이크로어레이는 항암제 감수성 예측용 SNP를 이용하여 당분야의 당업자에게 알려져 있는 통상적인 방법에 의해 제조될 수 있다.Another aspect of the present invention relates to a microarray comprising an anticancer drug susceptibility predicting SNP, a polynucleotide comprising a SNP, a polypeptide encoded by the same or a cDNA thereof according to the present invention. Microarrays according to the present invention can be prepared by conventional methods known to those skilled in the art using anti-cancer drug susceptibility prediction SNP.
예컨대, 상기 뉴클레오티드는 아미노 실란 (amino-silane), 폴리-L-리신 (poly-L-lysine) 및 알데히드 (aldehyde)로 이루어진 군에서 선택되는 활성기가 코팅된 기판 상에 고정될 수 있다. 또한, 상기 기판은 실리콘 웨이퍼, 유리, 석영, 금속 및 플라스틱으로 이루어진 군에서 선택될 수 있다. 상기 폴리뉴클레오티드를 기판에 고정화시키는 방법은 파이조 일렉트릭 (piezoelectric) 방식을 이용한 마이크로피펫팅법 (micropipetting), 핀 (pin) 형태의 스폿터 (spotter)를 이용한 방법 등을 사용할 수 있다.For example, the nucleotide may be immobilized on a substrate coated with an active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde. In addition, the substrate may be selected from the group consisting of silicon wafer, glass, quartz, metal and plastic. As a method of immobilizing the polynucleotide on a substrate, a micropipetting method using a piezoelectric method, a method using a pin type spotter, or the like can be used.
본 발명의 다른 측면은 본 발명에 따른 마이크로어레이를 포함하는 항암제 감수성 예측용 키트에 관한 것이다.Another aspect of the present invention relates to a kit for predicting anticancer drug sensitivity comprising the microarray according to the present invention.
본 발명에 따른 키트는 본 발명의 마이크로어레이 이외에 피검체로부터 해당 SNP를 포함하는 DNA를 분리 및 증폭하는데 사용되는 프라이머 세트를 추가로 포함할 수 있다. 상기 적절한 프라이머 세트는 본 발명의 서열을 참조하여 당업자는 용이하게 설계할 수 있을 것이다.The kit according to the present invention may further comprise a primer set used to separate and amplify DNA containing the SNP from the subject in addition to the microarray of the present invention. Such suitable primer sets will be readily apparent to those skilled in the art with reference to the sequences of the present invention.
본 발명의 또 다른 측면은 항암제 감수성 예측용 SNP를 이용하여 항암제 감수성을 예측하는 방법에 관한 것이다. Another aspect of the invention relates to a method for predicting anticancer drug susceptibility using SNPs for anticancer drug susceptibility prediction.
상기 방법은, The method,
(1) 사람으로부터 핵산 시료를 분리하는 단계; 및(1) separating the nucleic acid sample from the human; And
(2)서열번호 1내지 11로 구성되는 폴리뉴클레오티드의 SNP의 위치의 염기 타입을 상기 분리된 핵산분자에서 확인하는 단계를 포함한다.(2) identifying the base type of the position of the SNP of the polynucleotide consisting of SEQ ID NOs: 1 to 11 in the isolated nucleic acid molecule.
예를 들어 대상자의 조직, 체액 또는 세포로부터 DNA를 분리해낸 후 PCR을 통해 DNA를 증폭시킨 후 SNP 분석을 실시한다. SNP 분석은 당업계에 공지된 통상적인 방법에 의해 수행될 수 있다. 예를 들면, Real time PCR System을 이용하여 SNP 분석을 수행하거나, 디데옥시법에 의해 직접적인 핵산의 뉴클레오티드 서열의 결정을 통해 수행할 수 있으며, 또는 SNP 부위의 서열을 포함하는 프로브 또는 그에 상보적인 프로브를 상기 DNA와 혼성화시키고 그로부터 얻어지는 혼성화 정도를 측정함으로써 다형성 부위의 뉴클레오티드 서열을 결정하거나, 대립형질 특이적 프로브 혼성화 방법(allele-specific probe hybridization), 대립형질 특이적 증폭 방법(allele-specific amplification), 서열분석법(sequencing), 5' 뉴클레아제 분해법(5' nuclease digestion), 분자 비콘 에세이법(molecular beacon assay), 올리고뉴클레오티드 결합 에세이법(oligonucleotide ligation assay), 크기 분석법(size analysis) 및 단일 가닥 배좌 다형성법(single-stranded conformation polymorphism) 등을 이용하여 수행될 수 있다.For example, DNA is isolated from tissues, body fluids, or cells of a subject, and then amplified by PCR, followed by SNP analysis. SNP analysis can be performed by conventional methods known in the art. For example, the SNP analysis may be performed using a real time PCR system, or may be performed by determining the nucleotide sequence of the nucleic acid directly by the dideoxy method, or a probe including the sequence of the SNP region or a complementary probe thereof. Determine the nucleotide sequence of the polymorphic site by hybridizing with the DNA and measuring the degree of hybridization resulting therefrom, allele-specific probe hybridization, allele-specific amplification, Sequencing, 5 'nuclease digestion, molecular beacon assay, oligonucleotide ligation assay, size analysis and single stranded assignment It may be performed using a single-stranded conformation polymorphism.
상기 예측 방법에 있어서, 단계 (2)에서 서열번호 1의 401번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 A로 확인 (G/A 혹은 A/A 이형유전자형으로 확인) 되면 항암제 FL (5-FU + 류코보린)에 감수성이 높은 것으로 예측할 수 있다. In the above prediction method, in step (2), the base of the SNP position corresponding to the 401th nucleotide of SEQ ID NO: 1 is identified as A (identified by G / A or A / A heterologous type) The anticancer drug FL (5-FU + leucovorin) can be expected to be highly susceptible.
본 발명의 일실시예에서는 FL 제제 사용군을 대상으로 임상연관분석을 한 결과, 유전자 GPC 5의 SNP id rs553717에서 동형대체대립유전자형 (homozygous substitution allele) 을 보이는 경우 참고대립유전자형 (reference allele)을 가지는 경우에 비해 다변량분석상 약 2배의 재발이 많았으며, 평균 무병 생존기간이 현저히 단축됨을 알 수 있었지만 (실시예 3-1) 세포사멸시험 상 이형대체대립유전자형을 갖는 경우 본 FL 제제에 대한 감수성이 높으므로 대체대립유전자형을 갖는 경우 다른 약제의 추가가 권장됨을 시사한다.In one embodiment of the present invention, when the clinical correlation analysis of the FL formulation using group shows a homozygous replacement allele (homozygous substitution allele) in the SNP id rs553717 of the gene GPC 5 having a reference allele (reference allele) In multivariate analysis, the relapse was about 2 times higher, and the average disease-free survival was significantly reduced (Example 3-1). This suggests that the addition of another medicament is recommended for those with alternative allele types.
서열번호 2의 401번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 A , 서열번호 3의 201번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 T 로 확인되면 항암제 카페시타빈에 감수성이 높은 것으로 예측할 수 있다.When the base of the SNP position corresponding to the 401th nucleotide of SEQ ID NO: 2 is A and the base of the SNP position corresponding to the 201 nucleotide of SEQ ID NO: 3 is identified as T, it can be predicted that the anticancer drug capcitabine has high sensitivity.
서열번호 4의 301번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 G 로 확인되면 항암제 FOLFIRI (5-FU +류코보린 + 이리노테칸) 에 대한 감수성이 높은 것으로 예측할 수 있다.When the base of the SNP position corresponding to the 301 nucleotide of SEQ ID NO: 4 is identified as G, it can be predicted that the susceptibility to the anticancer agent FOLFIRI (5-FU + leukovorin + irinotecan) is high.
서열번호 5의 301번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 G , 서열번호 6의 201번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 T 또는 서열번호 7의 301번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 C로 확인되면 항암제 FOLFOX (5-FU + 류코보린 + 옥살리플라틴)에 대한 감수성이 높은 것으로 예측할 수 있다.The base of the SNP position corresponding to 301 nucleotide of SEQ ID NO: 5 is G, the base of the SNP position corresponding to 201 nucleotide of SEQ ID NO: 6 is T, or the base of the SNP position corresponding to 301 nucleotide of SEQ ID NO: 7 is C If confirmed, the anticancer drug FOLFOX (5-FU + leukovorin + oxaliplatin) can be expected to be highly susceptible.
서열번호 8의 401번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 G 로 확인되면 항암제 FL, FOLFIRI 또는 FOLFOX 중 적어도 하나에 대한 감수성이 높은 것으로 예측할 수 있다.When the base of the SNP position corresponding to the 401th nucleotide of SEQ ID NO: 8 is identified as G, it can be predicted that the susceptibility to at least one of the anticancer agent FL, FOLFIRI or FOLFOX is high.
본 발명의 일 실시예에 의하면, FOLFIRI 또는 FOLFOX　제제 사용군을 대상으로 임상연관 분석을 실시한 결과, EPHA7 rs2272107과 SSTR4 rs2567608의 참고 대립유전자군을 가지는 경우 현저하게 항암제 반응성이 낮은 결과를 보였다 (실시예 3-2).According to one embodiment of the present invention, the results of clinical association analysis of the FOLFIRI or FOLFOX® drug use group showed a significantly lower anti-cancer drug responsiveness when the reference allele group of EPHA7 rs2272107 and SSTR4 rs2567608 was used (Example 3-2).
서열번호 9의 401번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 A 또는 서열번호 10의 251번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 C 로 확인되면 항암제 SAHA에 대한 감수성이 높은 것으로 예측할 수 있다.When the base of the SNP position corresponding to the 401 nucleotide of SEQ ID NO: 9 is identified as A or the base of the SNP position corresponding to the 251 nucleotide of SEQ ID NO: 10 can be predicted to have high susceptibility to the anticancer drug SAHA.
서열번호 11의 401번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 T 로 확인되면 항암제 PXD101에 대한 감수성이 높은 것으로 예측할 수 있다.If the base of the SNP position corresponding to the 401 nucleotide of SEQ ID NO: 11 is identified as T, it can be predicted that the susceptibility to the anticancer agent PXD101 is high.
본 발명은 환자의 소량 혈액시료를 이용하여 약제에 내성을 보이는 종양에 대해서도 유용한 약제를 미리 예측하게 하며, 환자의 치료경과 전체에 걸쳐서 가장 적합한 항암제 선택을 가능하게 하며, 적절한 유전자적 진단도구를 개발하게 되었다.The present invention allows the use of small blood samples from patients to predict in advance useful drugs for tumors that are resistant to drugs, enable the selection of the most appropriate anticancer drugs throughout the course of the patient, and develop appropriate genetic diagnostic tools. Was done.
또한, 본 발명은 향후 지속적으로 신약을 포함한 약제를 이용하여 항암제 및 일반 치료제의 반응성을 예측할 수 있는 SNP 표식자를 새로이 발굴할 수 있는 기술로 적용범위를 넓힐 수 있다.In addition, the present invention can extend the scope of application to the technology that can newly discover the SNP markers that can predict the reactivity of the anticancer agent and the general treatment using the drug, including the new drug in the future.
도 1은 6종의 항암제에 감수성을 보이는 선별된 11종 유전자의 12개 SNP 후보를 나타낸 것이다.1 shows 12 SNP candidates of 11 selected genes showing susceptibility to 6 anticancer agents.
도 2는 GPC5 rs553717자형에 따른 FL 보조 사용군에서의 전체생존(OS) 및 무병생존율(DFS)을 나타낸 것으로, 동형대체대립유전자형에서 유의한 DFS 감소를 보이고 있다.Figure 2 shows the overall survival (OS) and disease-free survival (DFS) in the FL-assisted use group according to the GPC5 rs553717 type, showing a significant DFS reduction in the homozygous allele.
도 3은 GPC5 대체대립유전자형을 지닌 경우 유의하게 높은 FL 제제 감수성을 보임을 나타내고 있다.3 shows significantly higher FL formulation susceptibility with GPC5 alternative alleles.
이하, 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the examples are only for illustrating the present invention in more detail, and the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, those skilled in the art. Will be self-evident.
<실시예 1> SNP 유전자형 선별 제 1단계Example 1 SNP Genotyping Screening Step 1
104명의 대장암 환자에서 고집적고속 SNP(Affymetrix SNP Array 5.0 사용)분석과 체외종양반응성분석 결과를 연관 분석하여 총 344,048개의 SNP 중 766개의 SNP를 선별함으로써 항암제 감수성 SNP 유전자형의 기본 자료를 획득하였다.A total of 766 SNPs out of a total of 344,048 SNPs were obtained by correlating high-intensity high-speed SNP analysis (using Affymetrix SNP Array 5.0) and in vitro tumor reactivity analysis in 104 patients with colorectal cancer.
<실시예 2> SNP 유전자형 선별 제 2단계Example 2 SNP Genotype Selection Second Step
상기 제 1단계에서 선별된 SNP 유전자형 중 명목 P-값이 0.001(0.1%)이하이며, 기존 일본인 및 중국인의 분석자료에서 5% 이상의 빈도를 보이고 (), 교차 불평형(Linkage disequilibrium)을 보이는 SNP 유전자형 후보를 선별하였으며, 추가로 non-synonymous, haplotype-tagging 및 기능성 SNP 선별을 통해서 12종의 후보 SNP를 발굴하였다 (도 1). Among the SNP genotypes selected in the first step, the nominal P-value is 0.001 (0.1%) or less, SNP genotype showing a frequency of 5% or more in the existing Japanese and Chinese analysis data (), and linkage disequilibrium. Candidates were selected and 12 candidate SNPs were further identified through non-synonymous, haplotype-tagging and functional SNP screening (FIG. 1).
이어서, 330명의 정상 인구군 림프구 DNA 시료를 이용한 동일 SNP 유전자형 검증에서 하디-와인버그 평형이탈이 현저하지 않은 (P>0.01) 11종의 SNP를 제 3 단계의 실시예를 통한 최종 검증을 위한 임상 및 생물학적 검증 후보로 선별하였다.(표2)Subsequently, 11 SNPs (P> 0.01) with no significant Hardy-Weinberg deviations (P> 0.01) in the same SNP genotyping with 330 normal population lymphocyte DNA samples were used for clinical and final validation using the third step. Biological validation candidates were selected (Table 2).
표 2 2단계 검증까지 발굴된 11종 유전자의 11개의 항암제 반응성 후보 SNP 표식자 (EPHA7-rs2278106 은 인구유전학적 검증결과 배제함)
regimens 유전자 SNP ID 대립유전자형 결과
참고 대체
FL GPC5 rs553717 G A A155V
카페시타빈 AJAP1 rs242056 G A G263R
카페시타빈 ERCC4 rs4309380 C T upstream
FOLFIRI TNFRSF11B rs2073618 C G N3K
FOLFOX SULT1C2 rs17036104 T G S255A
FOLFOX SULT1C4 rs7580171 C T upstream
FOLFOX EPHA7 rs2278106+ G A R278C
FOLFOX EPHA7 rs2278107 T C I138V
FL, FOLFIRI,FOLFOX SSTR4 rs2567608 A G F321S
SAHA OR5AC2 rs4518168 G A M200I
SAHA OR5H1 rs6775533 T C upstream
PXD101 DPYD rs1801265 C T R29C
TABLE 2 11 anticancer drug responsive candidate SNP markers of 11 genes discovered up to stage 2 validation (EPHA7-rs2278106 excludes demographic tests)
regimens gene SNP ID Allele type result
Reference how
FL GPC5 rs553717 G A A155V
Capecitabine AJAP1 rs242056 G A G263R
Capecitabine ERCC4 rs4309380 C T upstream
FOLFIRI TNFRSF11B rs2073618 C G N3K
FOLFOX SULT1C2 rs17036104 T G S255A
FOLFOX SULT1C4 rs7580171 C T upstream
FOLFOX EPHA7 rs2278106 + G A R278C
FOLFOX EPHA7 rs2278107 T C I138V
FL, FOLFIRI, FOLFOX SSTR4 rs2567608 A G F321S
SAHA OR5AC2 rs4518168 G A M200I
SAHA OR5H1 rs6775533 T C upstream
PXD101 DPYD rs1801265 C T R29C
*FL, 5-FU/leucovorin; FOLFIRI, FL+ irinotecan; FOLFOX,FL + oxaliplatin* FL, 5-FU / leucovorin; FOLFIRI, FL + irinotecan; FOLFOX, FL + oxaliplatin
+ EPHA7-rs2278106 은 인구유전학적 검증 결과 배제함+ EPHA7-rs2278106 excludes demographic tests
<실시예 3> SNP 유전자형과 기존 임상경과의 연관 분석 단계Example 3 Association Analysis Step of SNP Genotype and Existing Clinical Course
임상연관분석에서는 해당 항암제를 사용하여 치료 경과가 확인된 223 예의 FL(5-FU+leucovorin) 제제 사용군, 43 예의 FOLFIRI(capecitabine 포함) 제제 사용군, 36 예의 FOLFOX 제제 사용군을 대상으로 임상적 연관성을 검증하였다. 해당 환자의 임상경과 추적은 NCCN surveillance guideline(www.nccn,org)에 의거하였으며, 항암제의 종양 반응성 판정은 RECIST criteria(Therasse et al., J Natl Cancer Inst 2000;92:205-16)에 의거하였다. 해당 환자의 추적 관찰기간은 평균 40개월(범위 4-108개월)이었으며, 결과 판정에 충분한 기간으로 판단되었다.Clinical correlation analysis was performed in 223 patients using FL (5-FU + leucovorin), 43 patients using FOLFIRI (including capecitabine), and 36 patients using FOLFOX. Association was verified. Follow-up of the patient was based on the NCCN surveillance guideline (www.nccn, org). Tumor responsiveness of anticancer drugs was determined according to RECIST criteria (Therasse et al., J Natl Cancer Inst 2000; 92: 205-16). . The average follow-up period was 40 months (range 4-108 months), which was judged to be sufficient for judging results.
3-1. FL 제제 사용군을 대상으로 한 임상연관분석3-1. Clinical Correlation Analysis of the Use of FL Agents
제 1~2 단계까지 도출된 개별 항암 제제별 반응성 SNP 유전자형을 임상에서 이미 해당 제제에 의한 치료가 종결된 대장암 환자에서 연관분석을 시행하였다. 우선 230명의 근치적절제후 FL 제제에 의한 수술 후 보조 치료군에서 관련 SNP 유전자형인 GPC5 rs553717에서 동형 대체 대립유전자형(homozygous substitution allele)을 보이는 경우 참고 대립 유전자형(reference allele)을 가지는 경우에 비해 다변량 분석상 약 2배의 재발이 많았으며(RR, 3,874 95% CI, 1.261-11.902, P=0.018), 평균 무병 생존기간이 현저히 단축되었다 (52.8± 7.3 months v. 87.9± 2.8months). FL 제제 선정시 GPC5 rs553717 유전자형 검사가 필수적임을 확인하였다 (도 2).Relevant SNP genotypes of individual anticancer agents derived from stages 1 and 2 were analyzed in colorectal cancer patients whose treatment was already terminated in the clinic. First, in the postoperative adjuvant treatment group treated with FL agents after 230 radical curative resections, the related SNP genotype GPC5 rs553717 showed a homozygous substitution allele in the multivariate analysis compared to the reference allele. There was a double relapse (RR, 3,874 95% CI, 1.261-11.902, P = 0.018) and the mean disease-free survival was significantly shortened (52.8 ± 7.3 months v. 87.9 ± 2.8months). It was confirmed that GPC5 rs553717 genotyping is essential in selecting FL formulations (FIG. 2).
3-2. FOLFIRI 또는 FOLFOX 제제 사용군을 대상으로 한 임상연관분석3-2. Clinical Correlation of FOLFIRI or FOLFOX Formulation Groups
FOLFIRI (FL 대신 동일계 capecitabine 사용한 경우를 포함) 제제 치료군 43명 및 FOLFOX (FL 대신 동일계 capecitabine 사용한 경우를 포함) 제제 치료군 36명에서 각각 제 1~2단계에서 선별된 SNP 유전자형을 보면 EPHA7 rs2278107과 SSTR4 rs2567608의 참고 대립 유전자군을 가지는 경우 현저하게 질병 반응율이 낮은 결과를 보였다 (P = 0.014, 0.022)(표 3). The SNP genotypes selected in steps 1 and 2 of the FOLFIRI (including in-situ capecitabine instead of FL) and FOLFOX (including in-situ capecitabine instead of FL) treatment groups, respectively, were identified in EPHA7 rs2278107 and SSTR4 rs2567608. In the case of the reference allele group, the disease response rate was remarkably low (P = 0.014, 0.022) (Table 3).
표 3 전이암환자에서 특이 항암제재에 대한 후보 SNP 유전자형에 따른 감수성
Genes SNP ID Genotypes No. with disease-control response/ total patients (%)
irinotecan P-value Oxaliplatin P-value
EPHA7 rs2278106 GG 21/33(64) 0.558 14/28(50) 0.064
GA+AA 6/10(60) 7/8(88)
EPHA7 rs2278107 TT 22/35(63) 0.642 14/29(48) 0.014
TC+CC 5/8(63) 7/7
SSTR4 rs2567608 AA 2/8(25) 0.022 4/7 0.633
AG+GG 25/35(71) 17/29
TABLE 3 Susceptibility to Candidate SNP Genotypes for Specific Anticancer Agents in Metastatic Cancer Patients
Genes SNP ID Genotypes No. with disease-control response / total patients (%)
irinotecan P-value Oxaliplatin P-value
EPHA7 rs2278106 GG 21/33 (64) 0.558 14/28 (50) 0.064
GA + AA 6/10 (60) 7/8 (88)
EPHA7 rs2278107 TT 22/35 (63) 0.642 14/29 (48) 0.014
TC + CC 5/8 (63) 7/7
SSTR4 rs2567608 AA 2/8 (25) 0.022 4/7 0.633
AG + GG 25/35 (71) 17/29
<실시예 4> 세포 생물학적 검증Example 4 Cell Biological Verification
해당 유전자의 cDNA 클론 (GPC5는 한국생명공학연구원으로부터 입수함; SSTR4 및 EPHA7은 OriGene Technologies, Rockville, MD, USA로부터 입수함)을 확보하였다. 위치 지정 돌연변이 키트(site-directed mutagenesis kit)를 이용하여 SNP형의 돌연변이 플라스미드를 제작하고 시퀀싱(sequencing) 방법을 통해 야생형과 돌연변형 플라스미드를 대장암 세포주인 RKO 세포에 이입하여 열흘간의 G418 선별을 통해 각각의 유전자가 과발현되는 세포주를 제작하였다. 상기 돌연변이 유발에 사용된 프라이머는 표 4에 기재하였다.The cDNA clone of the gene (GPC5 was obtained from Korea Research Institute of Bioscience and Biotechnology; SSTR4 and EPHA7 were obtained from OriGene Technologies, Rockville, MD, USA). SNP-type mutant plasmids were prepared using a site-directed mutagenesis kit and wild-type and mutated plasmids were transferred to RKO cells, a colorectal cancer cell line, by sequencing method, followed by 10 days G418 selection. Cell lines were constructed in which each gene was overexpressed. Primers used for the mutagenesis are listed in Table 4.
표 4 돌연변이 유발에 사용된 프라이머
유전자 SNP ID 프라이머 서열 서열번호
GPC5 rs553717 포워드 - GTATTTATTTGGTGTGGATGTTAATCCTGAAG 12
리버스 - CTTCAGGATTAACATCCACACCAAATAAATAC 13
EPHA7 rs2278107 포워드 - GACACTGGCAGGAATGTAAGAGAAAACCTC 14
리버스 - GAGGTTTTCTCTTACATTCCTGCCAGTGTC 15
SSTR4 rs2567608 포워드 - GACAACTTCCGCCGATCCTTCCAGCGGGTTC 16
리버스 - GAACCCGCTGGAAGGATCGGCGGAAGTTGTC 17
Table 4 Primer used for mutagenesis
gene SNP ID Primer sequence SEQ ID NO:
GPC5 rs553717 Forward-GTATTTATTTGGTGTGGATGTTAATCCTGAAG 12
Reverse-CTTCAGGATTAACATCCACACCAAATAAATAC 13
EPHA7 rs2278107 Forward-GACACTGGCAGGAATGTAAGAGAAAACCTC 14
Reverse-GAGGTTTTCTCTTACATTCCTGCCAGTGTC 15
SSTR4 rs2567608 Forward-GACAACTTCCGCCGATCCTTCCAGCGGGTTC 16
Reverse-GAACCCGCTGGAAGGATCGGCGGAAGTTGTC 17
상기 세포주들에 대한 해당 제제의 반응성을 트리판 블루 배제 에세이 (trypan blue exclusion assay)를 통해 세포사멸을 표시하였으며, 세포 생존율은 세포 독성 에세이 키트 (cell cytotoxicity assay kit, CCK8)를 사용하였다. 도 3은 24시간째 해당 항암 제제를 처리한 결과를 나타낸 것으로, 3회의 반복실험 결과 참고 대립 유전자형에서 임상 연관분석과 동일하게 낮은 감수성을 보였다 (P<0.001). The apoptosis of the corresponding agents against the cell lines was indicated by a trypan blue exclusion assay, and cell viability was determined using a cytotoxicity assay kit (CCK8). Figure 3 shows the results of treatment with the corresponding anticancer agent at 24 hours, three repeats showed the same low sensitivity as the clinical association analysis in the reference allele genotype (P <0.001).
추가로 세포주기에 따른 세포사멸을 관찰하기 위해서 SSTR4 및 EPHA7 유전자형의 이입 세포주의 해당 항암 제제에 대한 유세포분석을 시행하였다. Annexin V-FITC Apoptosis Detection kit를 사용해서 FACscaliber flow cytometer (Becton Dickinson, SanJose, CA, USA)로 측정하였다. In addition, flow cytometry was performed on the corresponding anticancer agents of the imported cell lines of the SSTR4 and EPHA7 genotypes to observe cell death along the cell cycle. Measurement was performed using a FACscaliber flow cytometer (Becton Dickinson, SanJose, CA, USA) using the Annexin V-FITC Apoptosis Detection kit.

Claims (21)

  1. (1) 환자의 종양조직을 이용한 체외 종양 반응성 검사 결과와 동일 환자의 SNP 분석 결과를 연관 분석하여 항암제 감수성 예측용 후보 SNP 유전자형을 선별하는 단계; 및(1) selecting candidate SNP genotypes for predicting anticancer drug susceptibility by associating an SNP analysis result of the same patient with an in vitro tumor reactivity test result using the patient's tumor tissue; And
    (2) 상기 선별된 유전자형 중 명목 P-값이 0.1% 이하이고, 동양인 유전자형에서 대립유전자의 빈도, 교차불평형 블록 (linkage disequilibrium block)에 위치하는 유전자형, htSNP(haplotype tagging SNP), 기능성 SNP 및 정상 인구군에서 하디-와인버그 평형 P 값을 고려하여 SNP 유전자형을 선별하는 단계;(2) the nominal P-value of the selected genotype is 0.1% or less, the frequency of allele in the Asian genotype, genotype located in the linkage disequilibrium block, htSNP (haplotype tagging SNP), functional SNP and normal Selecting the SNP genotype in consideration of the Hardy-Wineberg equilibrium P value in the population;
    를 포함하는 항암제 감수성 예측용 SNP를 스크리닝하는 방법.Method for screening anticancer drug susceptibility prediction SNP comprising a.
  2. 제 1항에 있어서, 상기 (2) 단계의 대립유전자 빈도는 5% 이상인 것을 특징으로 하는 방법.The method of claim 1, wherein the allele frequency of step (2) is at least 5%.
  3. 제 1항에 있어서, 상기 (2) 단계의 하디-와인버그 평형 P 값이 0.01 이상인 SNP 유전자형을 선별하는 것을 특징으로 하는 방법.The method of claim 1, wherein the SNP genotype of the Hardy-Wineberg equilibrium P value of step (2) is 0.01 or more is selected.
  4. 제 1항에 있어서, 상기 단계 (2)에서 선별된 SNP 유전자형을 기존 임상 경과와 연관 분석하는 단계를 추가로 더 포함하는 것을 특징으로 하는 방법.The method of claim 1, further comprising associating the SNP genotype selected in step (2) with an existing clinical course.
  5. 제 1항에 있어서, 세포 생물학적 검증을 추가로 더 포함하는 것을 특징으로 하는 방법.The method of claim 1, further comprising cell biological validation.
  6. 제 5항에 있어서, 상기 세포 생물학적 검증은 유전자 형질전환, 세포 생존 및 세포독성분석, 카스파제-3 웨스턴 블롯 또는 유세포 분석에 의한 것을 특징으로 하는 방법.6. The method of claim 5, wherein said cell biological validation is by gene transformation, cell survival and cytotoxicity analysis, caspase-3 western blot or flow cytometry.
  7. 제 5항에 있어서, 상기 세포 생물학적 검증은 야생형 유전자 또는 돌연변이 유전자로 종양세포를 형질전환시키는 단계;The method of claim 5, wherein the cell biological verification comprises: transforming tumor cells with a wild type gene or a mutant gene;
    상기 종양세포에 특정 항암제롤 처리하는 단계; 및Treating the tumor cells with a specific anticancer agent; And
    상기 종양세포의 세포 생존율을 측정하는 단계; Measuring cell viability of the tumor cells;
    를 포함하는 것을 특징으로 하는 방법.Method comprising a.
  8. 서열번호 1,2,8,9,11의 401번째 뉴클레오티드, 서열번호 3,6의 201번째 뉴클레오티드, 서열번호 4,5,7의 301번째 뉴클레오티드 및 서열번호 10의 251번째 뉴클레오티드를 포함하는 8개 이상의 연속 염기로 구성되는 폴리뉴클레오티드들로부터 선택되는 하나 이상의 항암제 감수성 예측용 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드.8 containing the 401 nucleotide of SEQ ID NOs: 1,2,8,9,11, the 201 nucleotide of SEQ ID NOs: 3,6, the 301 nucleotide of SEQ ID NOs: 4,5,7, and the 251 nucleotide of SEQ ID NO: 10 At least one anticancer susceptibility prediction polynucleotide selected from polynucleotides consisting of at least consecutive bases or a complementary polynucleotide thereof.
  9. 제 8항에 있어서, 상기 8개 이상의 연속 염기는 8 내지 100 개의 연속 염기인 것을 특징으로 하는 폴리뉴클레오티드.9. The polynucleotide of claim 8, wherein said at least 8 consecutive bases are 8 to 100 consecutive bases.
  10. 제 8항 또는 제 9항에 따른 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드로 이루어진 항암제 감수성 예측용 프라이머.A anti-cancer drug susceptibility primer comprising the polynucleotide according to claim 8 or 9 or a complementary polynucleotide thereof.
  11. 제 8항 또는 제 9항에 따른 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드로 이루어진 항암제 감수성 예측용 프로브.Probe for anticancer drug sensitivity comprising the polynucleotide according to claim 8 or 9 or a complementary polynucleotide thereof.
  12. 제 8항 또는 제 9항에 따른 폴리뉴클레오티드, 그에 의해 코딩되는 폴리펩티드 또는 그의 cDNA 를 포함하는 항암제 감수성 예측용 마이크로어레이.The anticancer agent susceptibility microarray comprising the polynucleotide according to claim 8 or 9, a polypeptide encoded by the same or cDNA thereof.
  13. 제 12항의 마이크로어레이를 포함하는 항암제 감수성 예측용 키트.Anticancer drug sensitivity prediction kit comprising the microarray of claim 12.
  14. (1) 사람으로부터 핵산 시료를 분리하는 단계; 및(1) separating the nucleic acid sample from the human; And
    (2)서열번호 1 내지 11로 구성되는 폴리뉴클레오티드의 SNP의 위치의 염기 타입을 상기 분리된 핵산분자에서 확인하는 단계;(2) identifying the base type of the position of the SNP of the polynucleotide consisting of SEQ ID NOs: 1 to 11 in the isolated nucleic acid molecule;
    를 포함하는 것을 특징으로 하는 항암제 감수성 예측방법. Anticancer drug sensitivity prediction method comprising a.
  15. 제 14항에 있어서, 상기 단계 (2)에서, 서열번호 1의 401번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 A 로 확인되면 항암제 FL (5-FU + 류코보린)에 대한 감수성이 높은 것으로 예측하는 것을 특징으로 하는 방법.15. The method according to claim 14, wherein in step (2), if the base of the SNP position corresponding to the 401th nucleotide of SEQ ID NO: 1 is identified as A, it is predicted to be highly susceptible to the anticancer agent FL (5-FU + leucovorin). Characterized in that the method.
  16. 제 14항에 있어서, 상기 단계 (2)에서, 서열번호 2의 401번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 A 또는 서열번호 3의 201번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 T 로 확인되면 항암제 카페시타빈에 대한 감수성이 높은 것으로 예측하는 것을 특징으로 하는 방법.The method according to claim 14, wherein in step (2), if the base of the SNP position corresponding to the 401th nucleotide of SEQ ID NO: 2 is A or the base of the SNP position corresponding to the 201 nucleotide of SEQ ID NO: 3 is identified as T, the anticancer agent A method characterized by predicting high sensitivity to capecitabine.
  17. 제 14항에 있어서, 상기 단계 (2)에서, 서열번호 4의 301번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 G 로 확인되면 항암제 FOLFIRI (5-FU +류코보린 + 이리노테칸) 에 대한 감수성이 높은 것으로 예측하는 것을 특징으로 하는 방법.15. The method according to claim 14, wherein in step (2), if the base of the SNP position corresponding to 301 nucleotide of SEQ ID NO: 4 is identified as G, the susceptibility to the anticancer agent FOLFIRI (5-FU + leucovorin + irinotecan) is high. Predicting.
  18. 제 14항에 있어서, 상기 단계 (2)에서, 서열번호 5의 301번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 G , 서열번호 6의 201번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 T 또는 서열번호 7의 301번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 C로 확인되면 항암제 FOLFOX (5-FU + 류코보린 + 옥살리플라틴)에 대한 감수성이 높은 것으로 예측하는 것을 특징으로 하는 방법.15. The method of claim 14, wherein in step (2), the base of the SNP position corresponding to the nucleotide 301 of SEQ ID NO: 5 is G, the base of the SNP position corresponding to the 201 nucleotide of SEQ ID NO: 6 is T or SEQ ID NO: 7 If the base of the SNP position corresponding to the 301th nucleotide of the C is confirmed that the sensitivity to the anticancer agent FOLFOX (5-FU + leucovorin + oxaliplatin) is characterized in that high.
  19. 제 14항에 있어서, 상기 단계 (2)에서, 서열번호 8의 401번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 G 로 확인되면 항암제 FL, FOLFIRI 또는 FOLFOX 중 적어도 하나에 대한 감수성이 높은 것으로 예측하는 것을 특징으로 하는 방법.15. The method of claim 14, wherein in step (2), if the base of the SNP position corresponding to the 401th nucleotide of SEQ ID NO: 8 is identified as G, it is predicted to be highly susceptible to at least one of the anticancer agent FL, FOLFIRI or FOLFOX. How to feature.
  20. 제 14항에 있어서, 상기 단계 (2)에서, 서열번호 9의 401번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 A 또는 서열번호 10의 201번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 C 로 확인되면 항암제 SAHA에 대한 감수성이 높은 것으로 예측하는 것을 특징으로 하는 방법.15. The method according to claim 14, wherein in step (2), if the base of the SNP position corresponding to the 401th nucleotide of SEQ ID NO: 9 is A or the base of the SNP position corresponding to the 201 nucleotide of SEQ ID NO: 10 is identified as C, the anticancer agent A method characterized by predicting a high susceptibility to SAHA.
  21. 제 14항에 있어서, 상기 단계 (2)에서, 서열번호 11의 401번째 뉴클레오티드에 해당하는 SNP 위치의 염기가 T 로 확인되면 항암제 PXD101에 대한 감수성이 높은 것으로 예측하는 것을 특징으로 하는 방법.15. The method according to claim 14, wherein in step (2), if the base at the SNP position corresponding to the 401th nucleotide of SEQ ID NO: 11 is identified as T, the method is predicted to be highly susceptible to anticancer agent PXD101.
PCT/KR2010/008640 2009-12-24 2010-12-03 Chemo-sensitive prediction method for snp WO2011078495A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020090130540A KR20110073799A (en) 2009-12-24 2009-12-24 Snp for predicting sensitivity to an anti-cancer agent
KR10-2009-0130540 2009-12-24

Publications (2)

Publication Number Publication Date
WO2011078495A2 true WO2011078495A2 (en) 2011-06-30
WO2011078495A3 WO2011078495A3 (en) 2011-11-10

Family

ID=44196248

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/008640 WO2011078495A2 (en) 2009-12-24 2010-12-03 Chemo-sensitive prediction method for snp

Country Status (2)

Country Link
KR (1) KR20110073799A (en)
WO (1) WO2011078495A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112195247A (en) * 2020-11-06 2021-01-08 南京普恩瑞生物科技有限公司 FOLFOX drug scheme effectiveness detection method and kit
CN112680517A (en) * 2020-12-28 2021-04-20 广东南芯医疗科技有限公司 Method for guiding oxaliplatin personalized medicine gene and kit

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CHA, PC ET AL.: 'Single nucleotide polymorphism in ABCG2 is associated with irinotecan- induced severe myelosuppression.' JOURNAL OF HUMAN GENETICS. vol. 54, no. 10, October 2009, pages 572 - 580 *
DATABASE NCBI 04 December 2007 Database accession no. rs553717 *
GAMELIN, E ET AL.: 'Pharmacogenetics of anti-cancer drugs' ANNALES PHARMACEUTIQUES FRANCḉAISES vol. 65, no. 6, November 2007, pages 390 - 401 *
KIM, JC ET AL.: 'Genome-wide identification of chemosensitive single nucleotide polymorphism markers in colorectal cancer' CANCER SCIENCE vol. 101, no. 4, 08 December 2009, pages 1007 - 1013 *
LIU, C ET AL.: 'Genome-wide association scan identifies candidate polymorphisms associated with differential response to anti-TNF treatment in rheumatoid arthritis' MOLECULAR MEDICINE vol. 14, no. 9-10, September 2008, pages 575 - 581 *
NORDGARD, SH ET AL.: 'Pathway based analysis of SNPs with relevance to 5-FU therapy: relation to intratumoral mRNA expression and survival' INTERNATIONAL JOURNAL OF CANCER vol. 123, no. 3, 01 August 2008, pages 577 - 585 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112195247A (en) * 2020-11-06 2021-01-08 南京普恩瑞生物科技有限公司 FOLFOX drug scheme effectiveness detection method and kit
CN112195247B (en) * 2020-11-06 2024-02-23 南京普恩瑞生物科技有限公司 FOLFOX drug regimen effectiveness detection method and kit
CN112680517A (en) * 2020-12-28 2021-04-20 广东南芯医疗科技有限公司 Method for guiding oxaliplatin personalized medicine gene and kit

Also Published As

Publication number Publication date
KR20110073799A (en) 2011-06-30
WO2011078495A3 (en) 2011-11-10

Similar Documents

Publication Publication Date Title
WO2016167408A1 (en) Method for predicting organ transplant rejection using next-generation sequencing
WO2015156519A1 (en) Method of predicting reaction to sorafenib treatment using gene polymorphism
WO2021029473A1 (en) Multi-high speed pharmacogenomic diagnostic kit for personalized pharmacotherapy and predicting drug side effects of multiple prescription drugs associated with cancer and chronic diseases
KR20120043793A (en) Snp for diagnosing hip dysplasia in dog and uses thereof
WO2019151751A1 (en) Gene panel for personalized medicine, method for forming same, and personalized treatment method using same
WO2011159004A1 (en) Snp for predicting the sensitivity to anticancer targeted therapeutic formulation
WO2011078495A2 (en) Chemo-sensitive prediction method for snp
WO2017007275A1 (en) Composition for determining nasal phenotype
JP5078358B2 (en) Interferon therapy responsiveness identification marker for renal cell carcinoma
WO2019132581A1 (en) Composition for diagnosing cancer such as breast cancer and ovarian cancer, and use thereof
KR100754398B1 (en) Multiple SNP for diagnosing cardiovascular disease microarray and kit comprising the same and method for diagnosing cardiovascular disease using the same
Grzemski et al. and Genes are Not Promising Markers for Obesity in Labrador Retriever Dogs
KR20110034297A (en) Marker for diagnosing intrinsic atopic dermatitis and use thereof
WO2020096247A1 (en) Method for preparing probe for detecting mutation derived from cells in tissues of breast cancer and detection method
Mifsud et al. ABO genotyping—identification of, and alleles using the polymerase chain reaction–sequence specific oligonucleotide (PCR-SSO) technique
KR101174823B1 (en) Single nucleotide polymorphism marker for personal identification and its use
WO2018026039A1 (en) Kit and method for detecting single nucleotide polymorphism
JP2006288279A (en) Method for determining tendency toward extension of bleeding time
WO2011118967A2 (en) Single nucleotide polymorphism for the prognosis of hepatocellular carcinoma
WO2017222247A2 (en) Marker for predicting efficacy of therapeutic agent for hemophilia and use thereof
WO2022030840A1 (en) Snp marker for diagnosing immunoglobulin a nephropathy and vasculitis and diagnosis method using same
WO2011118968A2 (en) Single nucleotide polymorphism for diagnosis of recurrence of hepatocellular carcinoma
WO2023080478A1 (en) Nucleic acid molecule for detecting hla-b*5801 allele, and method using same
WO2022131803A1 (en) Ultra-high sensitivity method for selectively amplifying breast cancer genetic mutation, and composition therefor
WO2024096618A1 (en) Cancer risk prediction method

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10839692

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10839692

Country of ref document: EP

Kind code of ref document: A2