WO2011076144A1 - Compositions and methods for microrna expession profiling in plasma of lung cancer - Google Patents
Compositions and methods for microrna expession profiling in plasma of lung cancer Download PDFInfo
- Publication number
- WO2011076144A1 WO2011076144A1 PCT/CN2010/080240 CN2010080240W WO2011076144A1 WO 2011076144 A1 WO2011076144 A1 WO 2011076144A1 CN 2010080240 W CN2010080240 W CN 2010080240W WO 2011076144 A1 WO2011076144 A1 WO 2011076144A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hsa
- mir
- nucleic acid
- lung cancer
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Definitions
- the present invention relates to compositions and methods for microRNA expression profiling in plasma of lung cancer, particularly for adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
- Lung cancer remains the most common cause of cancer-related deaths among man and woman worldwide. There estimated to 1.4 million new cases in 2009 with average annual increase for 2.51% (Frost & Sullivan estimates) and the majority of patients diagnosed with lung cancer in 2009 will die of their disease (Higgins, M.J. et al. (2009) Expert Rev Anticancer Ther 9, 1365-1378). Despite some improvements in surgical techniques and combined therapies over the last several decades, the five-year survival rate for all stages combined is about 15% in the United States and Europe.
- Lung cancers are classified as either small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC).
- SCLC small cell lung cancer
- NSCLC non-small cell lung cancer
- the predominant (>80%) histological form of lung cancer is NSCLC including adenocarcinoma and squamous-cell lung cancer.
- Cigarette smoking is the most important risk factor for lung cancer, accounting for about 80% of lung cancer cases in men and 50% in women worldwide.
- Treatment for lung cancer differs according to the subtype of cancer.
- the treatment of choice for early stage NSCLC is surgery with a 5 year overall survival of 40%.
- a majority of patients are at an advanced disease stage at the time of diagnosis, which limits first-line therapy to multi-agent chemotherapy and an expected survival is less than 8 months.
- Recent advances in targeted therapies require greater accuracy in the subclassification of non-small-cell lung cancer (NSCLC).
- NSCLC non-small-cell lung cancer
- Inhibitors of tumor angiogenesis pose higher risk for adverse response in cases of squamous cell lung cancer (Lebanoy, D. (2009) / Clin Oncol 27, 2030-2037).
- Small cell lung cancer (SCLC) is the most deadly form of the disease, with a case-fatality rate greater than 90%.
- SCLC small cell lung cancer
- miRNAs small regulatory RNA molecules
- nt nucleotides
- miRNAs have advantages over mRNAs as cancer biomarkers, since they are very stable in vitro and long-lived in vivo (Lu, J. et al, (2005) Nature 435, 834-838; Lim, L.P. et al, (2005) Nature 433, 769-773).
- MiRNAs are produced from primary transcripts that are processed to stem-loop structured precursors (pre-miRNAs) by the RNase III Drosha. After transport to the cytoplasm, another RNase III termed Dicer cleaves of the loop of the pre-miRNA hairpin to form a short double-stranded (ds) RNA, one strand of which is incorporated as mature miRNA into a miRNA-protein (miRNP).
- ds short double-stranded
- miRNA-protein miRNA-protein
- the miRNA guides the miRNPs to their target mRNAs where they exert their function (Bartel, D.P. (2004) Cell 23, 281- 292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531).
- miRNAs can guide different regulatory processes.
- Target mRNAs that are highly complementary to miRNAs are specifically cleaved by mechanisms identical to RNA interference (RNAi).
- RNAi RNA interference
- the miRNAs function as short interfering RNAs (siRNAs).
- Target mRNAs with less complementarity to miRNAs are either directed to cellular degradation pathways or are translationally repressed without affecting the mRNA level.
- the mechanism of how miRNAs repress translation of their target mRNAs is still a matter of controversy.
- High-throughput miRNA quantification technologies such as miRNA microarray, real-time RT-PCR-based TaqMan miRNA assays, have provided powerful tools to study the global miRNA profile in whole cancer genome. Emerging data available indicate that dysregulation of miRNA expression may inter alia be associated with the development and/or progression of certain types of cancer. For example, two miRNAs, miR-15 and miR-16-1, were shown to map to a genetic locus that is deleted in chronic lymphatic leukemia (CLL) and it was found that in about 70% of the CLL patients, both miRNA genes are deleted or down-regulated.
- CLL chronic lymphatic leukemia
- tumor-derived miRNAs are present in human plasma or serum in a remarkably stable form that is protected from endogenous RNase activity. These tumor-derived miRNAs in serum or plasma are at levels sufficient to be measurable as biomarkers for cancer detection. Moreover, the levels of plasma and serum miRNAs correlate strongly, suggesting that either plasma or serum samples will be suitable for clinical applications using miRNAs as cancer diagnostic biomarkers (Mitchell, P.S. et al. (2008) Proc Natl Acad Sci USA 105, 10513-10518; Gilad, S.
- miRNA microRNA
- nucleic acid expression signatures and/or compositions in blood for identifying lung cancer, and/or discriminating different types of lung cancer include tumor-related signatures, plasma-specific signatures and an internal stable control.
- the different types of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
- the present invention relates to a diagnostic kit of molecular markers in blood for identifying adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of adenocarcinoma lung cancer.
- the nucleic acid expression signature may comprise at least twelve nucleic acid molecules, and preferably at least six nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy control plasma and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa-miR- 638, hsa-miR-572; plasma-specific signatures: hsa-miR-383, hsa-miR-1233, hsa-miR- 545* and hsa-miR-655, hsa-miR-19b-2*, hsa-miR-548d-5p, hsa-miR-190b, hsa-miR- 623, hsa-miR-923 and an internal stable control: hsa-miR-1238.
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-638, hsa-miR-572, hsa-miR-383, hsa-miR-545*, hsa-miR- 655, hsa-miR-19b-2*, hsa-miR-548d-5p, hsa-miR-190b, hsa-miR-623 , hsa-miR-923 is up-regulated; the expression of hsa-miR-1233 is down-regulated and hsa-miR-1238 is un-changed in the one or more target plasma compared to the one or more healthy control plasma.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa- miR-638, hsa-miR-572 and plasma-specific signatures: hsa-miR-383, hsa-miR-1233, hsa-miR-545*, hsa-miR-655.
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-638, hsa-miR-572, hsa-miR-383, hsa-miR-545*, hsa-miR- 655 is up-regulated and the expression of hsa-miR-1233 is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
- the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-383/hsa-miR- 1233, hsa-miR-19b-2*/hsa-miR-1233, hsa-miR-548d-5p/hsa-miR-1233, hsa-miR-548d- 5p/hsa-miR-1233, hsa-miR-545*/hsa-miR-1233, hsa-miR-923/hsa-miR-483-3p, hsa- miR-638/hsa-miR-483 -3p, hsa-miR- 190b/hsa-miR- 1233, hsa-miR- 190b/hsa-miR- 1233 and hsa-miR-572/hsa-miR-12
- the present invention relates to a diagnostic kit of molecular markers in blood for identifying squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of squamous cell lung cancer.
- the nucleic acid expression signature may comprise at least nineteen nucleic acid molecules, preferably at least six nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy control plasma and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa-miR- 181a, hsa-miR-623, hsa-miR-769-5p, hsa-miR-21 *, hsa-miR-572, hsa-miR-34b*, hsa- miR-221, hsa-miR-939; plasma-specific signatures: hsa-miR-654-5p, hsa-miR-432, hsa-miR-194*, hsa-miR-302a, hsa-miR-485-3p, hsa-miR-654-3p, hsa-miR-22, hsa- miR-423-5p, hsa-miR-520d-3p, hsa-miR-923 and an internal stable
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa- miR-181a, hsa-miR-623, hsa-miR-769-5p and plasma- specific signatures: hsa-miR- 654-5p, hsa-miR-432, hsa-miR-194*.
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-181a, hsa-miR-623, hsa-miR-769-5p, hsa-miR-432, hsa- miR-194* is up-regulated and the expression of hsa-miR-654-5p is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
- the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding:hsa-miR-194*/hsa-miR-654-5p, hsa-miR- 194*/hsa-miR-654-5p, hsa-miR-623/hsa-miR-654-5p, hsa-miR- 181 a/hsa-miR- 654-5p, hsa-miR-432/hsa-miR-654-5p, hsa-miR-520d-3p/hsa-miR-654-5p, hsa-miR- 302a/hsa-miR-654-5p, hsa-miR-423-5p/hsa-miR-654-5p and hsa-miR-221/hsa-miR- 654-5p.
- the present invention relates to a diagnostic kit of molecular markers in blood for identifying small cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of small cell lung cancer.
- the nucleic acid expression signature may comprise at least thirty-six nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least six nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy control plasma and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa-miR- 375, hsa-miR-543, hsa-miR-139-3p, hsa-miR-34b*, hsa-miR-429, hsa-miR-361-5p, hsa-miR-130b, hsa-miR-196a, hsa-miR-200a, hsa-miR-765, hsa-miR-33b* and plasma- specific signatures: hsa-miR-377, hsa-miR-136, hsa-miR-574-5p, hsa-miR-767-3p, hsa- miR-637.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa- miR-375, hsa-miR-543, hsa-miR-139-3p, hsa-miR-34b*, hsa-miR-429, hsa-miR-361-5p, hsa-miR-130b, hsa-miR-196a, hsa-miR-200a, hsa-miR-765, hsa-miR-33b*, hsa-miR- 106a, hsa-miR-874, hsa-miR-142-5p; plasma-specific signatures: hsa-miR-377, hsa- miR-136, hsa-miR-574-5p, hsa-miR-767-3p,
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa-miR-375, hsa-miR-543, hsa-miR-139-3p, hsa-miR-34b*, hsa-miR-429 and hsa-miR-361-5p.
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-543, hsa-miR-34b*, hsa-miR-429 and hsa- miR-361-5p is up-regulated and the expression of hsa-miR-139-3p is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
- the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-520b/hsa-miR-139-3p, hsa-miR-375/hsa-miR-l 06a, hsa-miR- 196a/hsa-miR-l 39-3p, hsa-miR-375/hsa-miR- 193b*, hsa-miR-609/hsa-miR-139-3p, hsa-miR- 136/hsa-miR-139-3p, hsa-miR-377/hsa- miR-637, hsa-miR-375/hsa-miR-637, hsa-miR-200a/hsa-miR-637, hsa-miR-520b/hsa- miR-637,
- the present invention relates to a diagnostic kit of molecular markers in blood for discriminating different types of lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in plasma of different types of lung cancer as well as in healthy control plasma, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of different types of lung cancer, wherein the different types of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
- the nucleic acid expression signatures in blood are differently expressed in adenocarcinoma lung cancer from healthy controls, squamous cell lung cancer and small cell lung cancer.
- the nucleic acid expression signature, as defined herein may comprise at least three nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, squamous cell lung cancer and small cell lung cancer.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-383, hsa-miR-545*, hsa-miR-19b-2*.
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-383, hsa-miR-545*, hsa-miR-19b-2* is up-regulated in the one or more target plasma compared to the one or more healthy controls, squamous cell lung cancer and small cell lung cancer.
- nucleic acid expression signatures in blood are differently expressed in squamous cell lung cancer from healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
- the nucleic acid expression signature, as defined herein may comprise at least three nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-194*, hsa-miR-302a, hsa-miR-432.
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-194*, hsa-miR-302a, hsa-miR-432 is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
- nucleic acid expression signatures in blood are differently expressed in small cell lung cancer from healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
- the nucleic acid expression signature may comprise at least twelve nucleic acid molecules, preferably at least five nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer, and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down- regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a, hsa-miR-139-3p, hsa-miR-106a, hsa-miR-361-5p, hsa- miR-141, hsa-miR-765, hsa-miR-609, hsa-miR-520b and hsa-miR-769-3p.
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a, hsa- miR-361-5p, hsa-miR-141, hsa-miR-765, hsa-miR-609, hsa-miR-520b is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR- 139-3p, hsa-miR-106a, hsa-miR-769-3p is down-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a and hsa-miR-139-3p.
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a is up- regulated and the expression of hsa-miR-139-3p is down-regulated in the one or more target plasma compared to the one or more healthy individual, adenocarcinoma lung cancer and squamous cell lung cancer.
- the present invention relates to a method for identifying one or more target plasma exhibiting lung cancer, the method comprising: (a) determining in the one or more target plasma the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence; (b) determining the expression levels of the plurality of nucleic acid molecules in one or more healthy control plasma; and (c) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control plasma by comparing the respective expression levels obtained in steps (a) and (b), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature, as defined herein, that is indicative for the presence of lung cancer.
- the method comprising: (a) determining in the one or more target plasma the expression levels of a combination of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, and calculate with certain formula, then ; (b) determining the expression levels of the combination of nucleic acid molecules in healthy control plasma, and calculate with certain formula; and (c) identifying the difference of the combination in the one or more target and control plasma by comparing the respective calculation results obtained in steps (a) and (b), wherein the one or more differentially expressed combinations together represent a signature, as defined herein, that is indicative for the presence of lung cancer.
- the method is for the further use of discriminating adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
- the present invention relates to a method for monitoring treatment of lung cancer, the method comprising: (a) identifying in the one or more target plasma a nucleic acid expression signature by using a method, as defined herein; and (b) monitoring in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression in plasma is up-regulated before treatment but is down-regulated after treatment and the expression of a nucleic acid molecule whose expression in plasma is down-regulated before treatment but is up-regulated after treatment.
- the present invention relates to a method for preventing or treating lung cancer, the method comprising: (a) identifying in plasma a nucleic acid expression signature by using a method, as defined herein; and (b) modifying in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression is up-regulated in plasma is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in plasma is up-regulated.
- the present invention relates to a pharmaceutical composition for the prevention and/or treatment of lung cancer in blood, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated in plasma from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down- regulated in plasma from lung cancer patients, as defined herein.
- the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of lung cancer.
- Figure 1 depicts a flow chart schematically illustrating the essential method steps for determining an expression signature according to the present invention for identifying one or more target plasma exhibiting lung cancer and further discriminating adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
- Figure 2 illustrates the human miRNAs comprised in particularly preferred expression signatures in the first aspect according to the present invention for identifying one or more target plasma exhibiting adenocarcinoma lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with adenocarcinoma lung cancer as compared to healthy control plasma (i.e. an up-regulation or a down-regulation).
- Figure 3 illustrates the human miRNAs comprised in particularly preferred expression signatures in the second aspect according to the present invention for identifying one or more target plasma exhibiting squamous cell lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with squamous cell lung cancer as compared to healthy control plasma (i.e. an up-regulation or a down-regulation).
- Figure 4 illustrates the human miRNAs comprised in particularly preferred expression signatures in the third aspect according to the present invention for identifying one or more target plasma exhibiting small cell lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with squamous cell lung cancer as compared to healthy control plasma
- Figure 5 illustrates the human miRNAs comprised in particularly preferred expression signatures in the fourth aspect according to the present invention for discriminating the different types of lung cancer.
- Figure 5A illustrates the expression levels of the miRNA signatures in differentiating adenocarcinoma lung cancer from healthy controls, squamous cell lung cancer and small cell lung cancer.
- Figure 5B illustrates the expression levels of the miRNA signatures in differentiating squamous cell lung cancer from healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
- Figure 5C illustrates the expression levels of the miRNA signatures in differentiating small cell lung cancer from healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
- the present invention is based on the unexpected finding that lung cancer can be reliably identified and different types of lung cancer can be discriminated based on particular miRNA expression profiles in plasma with high sensitivity and specificity, wherein the expression signatures as defined herein typically comprises both up- and down-regulated human miRNAs. More specifically, said miRNA expression signatures - by analyzing the overall miRNA expression pattern and/or the respective individual miRNA expression level(s) in plasma - allow the detection of lung cancer at an early disease state and discriminating the different types of lung cancer.
- miRNA microRNA
- nucleic acid expression signatures and/or compositions in blood for identifying lung cancer and/or discriminating different types of lung cancer.
- the nucleic acid expression signatures include tumor-related signatures and plasma-specific signatures.
- the different types of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
- cancer also referred to as “carcinoma”
- cancer generally denotes any type of malignant neoplasm, that is, any morphological and/or physiological alterations (based on genetic re -programming) of special tissue exhibiting or having a predisposition to develop characteristics of a carcinoma as compared to unaffected (healthy) wild-type control tissues.
- alterations may relate inter alia to cell size and shape (enlargement or reduction), cell proliferation (increase in cell number), cell differentiation (change in physiological state), apoptosis (programmed cell death) or cell survival.
- lung cancer refers to uncontrolled cell growth in the tissue of lung, or cancerous growths in the lung.
- lung cancer different types include adenocarcinoma lung cancer, squamous cell lung cancer and small-cell lung cancer.
- Adenocarcinoma lung cancer or “adenocarcinoma lung carcinoma” is a form of non-small cell lung cancer. Eighty percent of lung cancers are non-small cell cancers (NSCLC), and of these, about 50% are adenocarcinomas. Adenocarcinoma of the lung begins in the outer parts of the lung, and it can be present for a long time before it is diagnosed. It is the type of lung cancer most commonly seen in women and is often seen in non-smokers.
- Squamous cell lung cancer or “squamous cell lung carcinoma” is a form of non-small cell lung cancer. About 30% of NSCLC are squamous cell lung cancer. Squamous cell lung carcinomas usually begin in the bronchial tubes (large airways) in the central part of the lungs. Many people have symptoms early on, commonly hemoptysis (coughing up blood).
- SCLC small cell lung carcinoma
- plasma is the yellow liquid component of blood, in which the blood cells in whole blood would normally be suspended. It makes up about 55% of the total blood volume. It is mostly water (90% by volume) and contains dissolved proteins, glucose, clotting factors, mineral ions, hormones and carbon dioxide (plasma being the main medium for excretory product transportation). Blood plasma is prepared by spinning a tube of fresh blood in a centrifuge until the blood cells fall to the bottom of the tube. The blood plasma is then poured or drawn off. Blood plasma has a density of approximately 1025 kg/m 3 , or 1.025 kg/1. Recent research showed that miRNA is stable in plasma.
- the term "plasma sample” refers to plasma taken from individuals being examined or from healthy control.
- patient refers to a human being at least supposed to have lung cancer, or certain types of lung cancer; where as “target plasma”, as used herein, refers to plasma collected from patients;
- target plasma refers to plasma collected from patients;
- health individual or “healthy control” typically denotes a healthy person not having characteristics of such a cancerous phenotype.
- control plasma denotes plasma collected from healthy individuals.
- the individual having the other types of lung cancer or plasma collected from these individuals is typically considered the "control”.
- the plasma samples used are derived from biological specimens collected from the subjects to be diagnosed for the presence of lung cancer. Furthermore, in order to corroborate the data obtained "comparative samples" may also be collected from subjects having a given known disease state.
- the biological samples may include body tissues and fluids, such as lung tissue, serum, blood cell, sputum, and urine. Furthermore, the biological sample may be obtained from individual have lung cancerous characteristics or suspected to be cancerous. Furthermore, the sample may be purified from the obtained body tissues and fluids if necessary, and then used as the biological sample. According to the present invention, the expression level of the nucleic acid markers of the present invention is determined in the subject-derived biological sample(s).
- the sample used for detection in the in vitro methods of the present invention should generally be collected in a clinically acceptable manner, preferably in a way that nucleic acids (in particular RNA) or proteins are preserved.
- the samples to be analyzed are typically from blood. Furthermore, lung tissue and other types of sample can be used as well. Samples, in particular after initial processing may be pooled. However, also non-pooled samples may be used.
- microRNA (or “miRNA”), as used herein, is given its ordinary meaning in the art (Bartel, D.P. (2004) Cell 23, 281-292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531). Accordingly, a "microRNA” denotes an RNA molecule derived from a genomic locus that is processed from transcripts that can form local RNA precursor miRNA structures.
- the mature miRNA is usually 20, 21, 22, 23, 24, or 25 nucleotides in length, although other numbers of nucleotides may be present as well, for example 18, 19, 26 or 27 nucleotides.
- the miRNA encoding sequence has the potential to pair with flanking genomic sequences, placing the mature miRNA within an imperfect RNA duplex (herein also referred to as stem-loop or hairpin structure or as pre-miRNA), which serves as an intermediate for miRNA processing from a longer precursor transcript.
- This processing typically occurs through the consecutive action of two specific endonucleases termed Drosha and Dicer, respectively.
- Drosha generates from the primary transcript (herein also denoted "pri-miRNA”) a miRNA precursor (herein also denoted "pre-miRNA”) that typically folds into a hairpin or stem-loop structure.
- miRNA duplex is excised by means of Dicer that comprises the mature miRNA at one arm of the hairpin or stem-loop structure and a similar-sized segment (commonly referred to miRNA*) at the other arm.
- the miRNA is then guided to its target mRNA to exert its function, whereas the miRNA* is degraded.
- miRNAs are typically derived from a segment of the genome that is distinct from predicted protein-coding regions.
- miRNA precursor refers to the portion of a miRNA primary transcript from which the mature miRNA is processed.
- pre-miRNA folds into a stable hairpin (i.e. a duplex) or a stem-loop structure.
- the hairpin structures typically range from 50 to 80 nucleotides in length, preferably from 60 to 70 nucleotides (counting the miRNA residues, those pairing to the miRNA, and any intervening segment(s) but excluding more distal sequences).
- nucleic acid molecule encoding a microRNA sequence denotes any nucleic acid molecule coding for a microRNA (miRNA). Thus, the term does not only refer to mature miRNAs but also to the respective precursor miRNAs and primary miRNA transcripts as defined above. Furthermore, the present invention is not restricted to RNA molecules but also includes corresponding DNA molecules encoding a microRNA, e.g. DNA molecules generated by reverse transcribing a miRNA sequence.
- a nucleic acid molecule encoding a microRNA sequence according to the invention typically encodes a single miRNA sequence (i.e. an individual miRNA). However, it is also possible that such nucleic acid molecule encodes two or more miRNA sequences (i.e. two or more miRNAs), for example a transcriptional unit comprising two or more miRNA sequences under the control of common regulatory sequences such as a promoter or a transcriptional terminator.
- nucleic acid molecule encoding a microRNA sequence is also to be understood to include “sense nucleic acid molecules” (i.e. molecules whose nucleic acid sequence (5' ⁇ 3') matches or corresponds to the encoded miRNA (5' ⁇ 3') sequence) and “anti-sense nucleic acid molecules” (i.e. molecules whose nucleic acid sequence is complementary to the encoded miRNA (5' ⁇ 3') sequence or, in other words, matches the reverse complement (3'— > 5') of the encoded miRNA sequence).
- sense nucleic acid molecules i.e. molecules whose nucleic acid sequence (5' ⁇ 3') matches or corresponds to the encoded miRNA (5' ⁇ 3') sequence
- anti-sense nucleic acid molecules i.e. molecules whose nucleic acid sequence is complementary to the encoded miRNA (5' ⁇ 3') sequence or, in other words, matches the reverse complement (3'— > 5') of the encoded miRNA sequence.
- complementary refers to the capability of an "anti-sense” nucleic acid molecule sequence of forming base pairs, preferably Watson-Crick base pairs, with the corresponding "sense” nucleic acid molecule sequence (having a sequence complementary to the anti-sense sequence).
- two nucleic acid molecules may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides.
- the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions).
- the "complementary" nucleic acid molecule comprises at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in corresponding "sense" nucleic acid molecule.
- the plurality of nucleic acid molecules encoding a miRNA sequence that are comprised in a diagnostic kit of the present invention may include one or more "sense nucleic acid molecules" and/or one or more "anti-sense nucleic acid molecules".
- the diagnostic kit includes one or more "sense nucleic acid molecules” (i.e. the miRNA sequences as such), said molecules are to be considered to constitute the totality or at least a subset of differentially expressed miRNAs (i.e. molecular markers) being indicative for the presence of or the disposition to develop a particular condition, here lung cancer.
- a diagnostic kit includes one or more "anti-sense nucleic acid molecules” (i.e.
- said molecules may comprise inter alia probe molecules (for performing hybridization assays) and/or oligonucleotide primers (e.g., for reverse transcription or PCR applications) that are suitable for detecting and/or quantifying one or more particular (complementary) miRNA sequences in a given sample.
- a plurality of nucleic acid molecules as defined within the present invention may comprise at least two, at least ten, at least 50, at least 100, at least 200, at least 500, at least 1.000, at least 10.000 or at least 100.000 nucleic acid molecules, each molecule encoding a miRNA sequence.
- the term “differentially expressed”, as used herein, denotes an altered expression level of a particular miRNA in the disease plasma as compared to the healthy controls, or as compared to other types of disease samples, which may be an up- regulation (i.e. an increased miRNA concentration in the plasma) or a down-regulation (i.e. a reduced or abolished miRNA concentration in the plasma).
- the nucleic acid molecule is activated to a higher or lower level in the disease plasma samples than in the control plasma.
- a nucleic acid molecule is to considered differentially expressed if the respective expression levels of this nucleic acid molecule in disease plasma samples and control samples typically differ by at least 5% or at least 10%, preferably by at least 20% or at least 25%, and most preferably by at least 30% or at least 50%.
- the latter values correspond to an at least 1.3-fold or at least 1.5-fold up-regulation of the expression level of a given nucleic acid molecule in the disease plasma samples compared to the control plasma samples or vice versa an at least 0.7-fold or at least 0.5-fold down-regulation of the expression level in the disease plasma samples, respectively.
- control plasma typically denotes a plasma sample collected from (healthy) individual not having characteristics of a lung cancer phenotype. However, in some applications, for example, when comparing different types of lung cancers, the plasma collected from other types of lung cancer is typically considered the "control plasma”.
- determining of expression levels typically follows established standard procedures well known in the art (Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F.M. et al. (2001) Current Protocols in Molecular Biology. Wiley & Sons, Hoboken, NJ). Determination may occur at the RNA level, for example by Northern blot analysis using miRNA-specific probes, or at the DNA level following reverse transcription (and cloning) of the RNA population, for example by quantitative PCR or real-time PCR techniques.
- the term "determining”, as used herein, includes the analysis of any nucleic acid molecules encoding a microRNA sequence as described above. However, due to the short half-life of pri-miRNAs and pre-mRNAs typically the concentration of only the mature miRNA is measured.
- the standard value of the expression levels obtained in several independent measurements of a given sample for example, two, three, five or ten measurements
- the standard value may be obtained by any method known in the art. For example, a range of mean ⁇ 2 SD (standard deviation) or mean ⁇ 3 SD may be used as standard value.
- control nucleic acids e.g. housekeeping genes whose expression levels are known not to differ depending on the disease states of the individual from whom the sample was collected.
- housekeeping genes include inter alia ⁇ -actin, glycerinaldehyde 3 -phosphate dehydrogenase, and ribosomal protein PI .
- the control nucleic acid is another miRNA known to be stably expressed during the various non- cancerous and (pre-)cancerous states of the individual from whom the sample was collected.
- the expression levels for plasma sample it may also be possible to define based on experimental evidence and/or prior art data on or more cut-off values for a particular disease phenotype (i.e. a disease state).
- the respective expression levels for the plasma sample can be determined by using a stably expressed control miR A for normalization. If the "normalized” expression levels calculated are higher than the respective cutoff value defined, then this finding would be indicative for an up-regulation of gene expression. Vice versa, if the "normalized” expression levels calculated are lower than the respective cutoff value defined, then this finding would be indicative for a down- regulation of gene expression.
- the term "identifying lung cancer and/or discriminating different types of lung cancer” is intended to also encompass predictions and likelihood analysis (in the sense of "diagnosing”).
- the compositions and methods disclosed herein are intended to be used clinically in making decisions concerning treatment modalities, including therapeutic intervention, diagnostic criteria such as disease stages, and disease monitoring and surveillance for the disease.
- an intermediate result for examining the condition of a subject may be provided. Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to diagnose that a subject suffers from the disease.
- the invention may be used to detect cancerous changes through plasma sample, and provide a doctor with useful information for diagnosis.
- the invention may also be used to discriminate between different types of lung cancers.
- one or more differentially expressed nucleic acid molecules identified together represent a nucleic acid expression signature that is indicative for lung cancer through plasma sample.
- expression signature denotes a set of nucleic acid molecules (e.g., miRNAs), wherein the expression level of the individual nucleic acid molecules differs between the plasma collected from lung cancer patient and the healthy control.
- a nucleic acid expression signature is also referred to as a set of markers and represents a minimum number of (different) nucleic acid molecules, each encoding a miR A sequence that is capable for identifying a phenotypic state of an individual.
- the present invention relates to a diagnostic kit of molecular markers in blood for identifying adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of adenocarcinoma lung cancer.
- the nucleic acid expression signature may comprise at least twelve nucleic acid molecules, and preferably at least six nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
- tumor-related refers to signatures that differentially expressed in plasma from lung cancer patients and in control plasma and are also differentially expressed in lung cancer tissues cells and non-cancer tissue cells.
- the lung cancer tissue cells refer to cancerous lung cells collected from dissections derived from the subjects to be diagnosed for the presence of lung cancer cancer.
- the non-cancer tissue cells typically denotes a (healthy) wild-type cell not having characteristics of such a cancerous phenotype.
- plasma-specific refers to signatures that are that differentially expressed in plasma from lung cancer patients and in control plasma are not found significantly differentially expressed in lung cancer tissues cells and non- cancer tissue cells.
- the nucleic acid molecules comprised in the nucleic acid expression signature are human sequences (hereinafter designated “hsa” (Homo sapiens)).
- the nucleic acid expression signature of the diagnostic kit comprises any one or more of the nucleic acid molecules encoding tumor- related signatures: hsa-miR-638 (SEQ ID NO: l), hsa-miR-572 (SEQ ID NO:2) and plasma-specific signatures: hsa-miR-383 (SEQ ID NO:3), hsa-miR-1233 (SEQ ID NO:4, hsa-miR-545* (SEQ ID NO:5), hsa-miR-655 (SEQ ID NO:6), hsa-miR-19b-2* (SEQ ID NO:7), hsa-miR-548d-5p (SEQ ID NO:8), hsa-miR-190b (SEQ ID NO:9), hsa-miR-623 (SEQ ID NO: 10), hsa-miR-923 (SEQ ID NO: 11) and hsa-m
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-638, hsa-miR-572, hsa-miR-383, hsa-miR- 545*, hsa-miR-655, hsa-miR-19b-2*, hsa-miR-548d-5p, hsa-miR-190b, hsa-miR-623 and hsa-miR-923 is up-regulated; the expression of hsa-miR-1233 is down-regulated, and hsa-miR-1238 is un-changed in the one or more target plasma from adenocarcinoma lung cancer patient compared to the one or more healthy control plasma.
- nucleic acid may relate to any subgroup of the plurality of nucleic acid molecules, e.g., any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, and so forth nucleic acid molecules, each encoding a microRNA sequence that are comprised in the nucleic acid expression signature, as defined herein.
- the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-383/hsa-miR- 1233, hsa-miR-19b-2*/hsa-miR-1233, hsa-miR-548d-5p/hsa-miR-1233, hsa-miR-548d- 5p/hsa-miR-1233, hsa-miR-545*/hsa-miR-1233, hsa-miR-923/hsa-miR-483-3p, hsa- miR-638/hsa-miR-483 -3p, hsa-miR- 190b/hsa-miR- 1233, hsa-miR- 190b/hsa-miR- 1233 and hsa-miR-572/hsa-miR-12
- nucleic acid combinations refers to the usage of at least two nucleic acid expression levels as a whole. Preferably may use the relative changes or calculate results through a formulation as a whole.
- nucleic acid combinations may relate to any subgroup of the plurality of nucleic acid combinations, e.g., any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, and so forth nucleic acid combinations, each comprised of at least two microRNA sequences that are comprised in the nucleic acid expression signature, as defined herein.
- the present invention relates to a diagnostic kit of molecular markers in blood for identifying squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of squamous cell lung cancer.
- the nucleic acid expression signature as defined herein, may comprise at least nineteen nucleic acid molecules, preferably at least six nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa- miR-181a (SEQ ID NO: 12), hsa-miR-623 (SEQ ID NO: 10), hsa-miR-769-5p (SEQ ID NO: 13), hsa-miR-21 * (SEQ ID NO: 14), hsa-miR-572 (SEQ ID NO:2), hsa-miR-34b* (SEQ ID NO:15), hsa-miR-221 (SEQ ID NO: 16), hsa-miR-939 (SEQ ID NO: 17) and plasma-specific signatures: hsa-miR-654-5p (SEQ ID NO: 18), hsa-miR-432 (SEQ ID NO: 19), hsa-miR-194* (SEQ ID NO:20), hsa-miR-30
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-181a, hsa-miR-623, hsa-miR-769-5p, hsa-miR-21 *, hsa- miR-572, hsa-miR-34b*, hsa-miR-221, hsa-miR-939, hsa-miR-432, hsa-miR-194*, hsa- miR-302a, hsa-miR-485-3p, hsa-miR-654-3p, hsa-miR-22, hsa-miR-423-5p, hsa-miR- 520d-3p, hsa-miR-923 is up-regulated; the expression of hsa-miR-654-5p is down- regulated; hsa-miR-12
- the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-194*/hsa-miR-654-5p, hsa-miR- 194*/hsa-miR-654-5p, hsa-miR-623/hsa-miR-654-5p, hsa-miR- 181 a/hsa-miR- 654-5p, hsa-miR-432/hsa-miR-654-5p, hsa-miR-520d-3p/hsa-miR-654-5p, hsa-miR- 302a/hsa-miR-654-5p, hsa-miR-423-5p/hsa-miR-654-5p and hsa-miR-221/hsa-miR- 654-5p.
- the present invention relates to a diagnostic kit of molecular markers in blood for identifying small cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of small cell lung cancer.
- the nucleic acid expression signature may comprise at least thirty-six nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least six nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma from compared to the one or more healthy controls and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa- miR-375 (SEQ ID NO:27), hsa-miR-543 (SEQ ID NO:28), hsa-miR-139-3p (SEQ ID NO:29), hsa-miR-34b* (SEQ ID NO:15), hsa-miR-429 (SEQ ID NO:30), hsa-miR-361- 5p (SEQ ID NO:31), hsa-miR-130b (SEQ ID NO:32), hsa-miR-196a (SEQ ID NO:33), hsa-miR-200a (SEQ ID NO:34), hsa-miR-765 (SEQ ID NO:35), hsa-miR-33b* (SEQ ID NO:36), hsa-miR-106a (SEQ ID NO:
- miRNA Sequence (5' ⁇ 3') hsa-miR-375 uuuguucguucggcucgcgu hsa-miR-543 aaacauucgcggugcacuucuu hsa-miR-139-3p ggagacgcggcccuguuggagu hsa-miR-34b* uaggcagugucauuagcugauug hsa-miR-429 uaauacugucugguaaaaccgu hsa-miR-361-5p uuaucagaaucuccagggguac hsa-miR-130b cagugcaaugaugaaagggcau hsa-miR-196a uagguaguuucauguuguuggg hsa-miR-200a uaacacugucugguaacgaugu hsa-miR-7
- the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-520b/hsa-miR-139-3p, hsa-miR-375/hsa-miR-l 06a, hsa-miR- 196a/hsa-miR-l 39-3p, hsa-miR-375/hsa-miR- 193b*, hsa-miR-609/hsa-miR-139-3p, hsa-miR- 136/hsa-miR-139-3p, hsa-miR-377/hsa- miR-637, hsa-miR-375/hsa-miR-637, hsa-miR-200a/hsa-miR-637, hsa-miR-520b/hsa- miR-637,
- the present invention relates to a diagnostic kit of molecular markers in blood for discriminating different types of lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in plasma of different types of lung cancer as well as in healthy controls, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of different types of lung cancer, wherein the different types of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
- the nucleic acid expression signatures in blood are differently expressed in adenocarcinoma lung cancer from healthy controls, squamous cell lung cancer and small cell lung cancer.
- the nucleic acid expression signature, as defined herein may comprise at least three nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, squamous cell lung cancer and small cell lung cancer.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-383 (SEQ ID NO:3), hsa-miR-545* (SEQ ID NO:5) and hsa-miR-19b-2* (SEQ ID NO:7).
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-383, hsa-miR-545*, hsa-miR-19b-2* is up-regulated in the one or more target plasma compared to the one or more healthy controls, squamous cell lung cancer and small cell lung cancer.
- nucleic acid expression signatures in blood are differently expressed in squamous cell lung cancer from healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
- the nucleic acid expression signature, as defined herein may comprise at least three nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microR A sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-194* (SEQ ID NO:20), hsa-miR-302a (SEQ ID NO:21), hsa-miR-432 (SEQ ID NO: 19).
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-194*, hsa-miR-302a, hsa-miR-432 is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
- the nucleic acid expression signatures in blood are differently expressed in small cell lung cancer from healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
- the nucleic acid expression signature as defined herein, may comprise at least twelve nucleic acid molecules, preferably at least five nucleic acid molecules.
- the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer, and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down- regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
- the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-574-5p (SEQ ID NO:42), hsa-miR-375 (SEQ ID NO:27), hsa-miR-543 (SEQ ID NO:28), hsa-miR-196a (SEQ ID NO:33), hsa-miR-139-3p (SEQ ID NO:29), hsa-miR-106a (SEQ ID NO:37), hsa-miR-361-5p (SEQ ID NO:31), hsa-miR-141 (SEQ ID NO:45), hsa-miR-765 (SEQ ID NO:35), hsa-miR-609 (SEQ ID NO:47), hsa-miR-520b (SEQ ID NO:46) and hsa- miR-769-3p (SEQ ID NO:50).
- the expression of any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a, hsa- miR-361-5p, hsa-miR-141, hsa-miR-765, hsa-miR-609, hsa-miR-520b is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR- 139-3p, hsa-miR-106a, hsa-miR-769-3p is down-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
- the present invention relates to a method for identifying one or more target plasma exhibiting lung cancer, the method comprising: (a) determining in the one or more target plasma the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence; (b) determining the expression levels of the plurality of nucleic acid molecules in one or more healthy control plasma; and (c) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control plasma by comparing the respective expression levels obtained in steps (a) and (b), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature, as defined herein, that is indicative for the presence of lung cancer.
- the method comprising: (a) determining in the one or more target plasma the expression levels of a combination of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, and calculate with certain formula, then; (b) determining the expression levels of the combination of nucleic acid molecules in healthy control plasma, and calculate with certain formula; and (c) identifying the difference of the combination in the one or more target and control plasma by comparing the respective calculation results obtained in steps (a) and (b), wherein the one or more differentially expressed combinations together represent a signature, as defined herein, that is indicative for the presence of lung cancer.
- the method is for the further use of discriminating adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
- the present invention relates to a method for preventing or treating lung cancer, the method comprising: (a) identifying in plasma a nucleic acid expression signature by using a method, as defined herein; and (b) modifying in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression is up-regulated in plasma is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in plasma is up-regulated.
- modifying the expression of a nucleic acid molecule encoding a miRNA sequence denotes any manipulation of a particular nucleic acid molecule resulting in an altered expression level of said molecule, that is, the production of a different amount of corresponding miRNA as compared to the expression of the "wild-type" (i.e. the unmodified control).
- the term "different amount”, as used herein, includes both a higher amount and a lower amount than determined in the unmodified control.
- a manipulation, as defined herein may either up-regulate (i.e. activate) or down-regulate (i.e. inhibit) the expression (i.e. particularly transcription) of a nucleic acid molecule.
- expression of one or more nucleic acid molecules encoding a microRNA sequence comprised in the nucleic acid expression signature is modified in such way that the expression of a nucleic acid molecule whose expression is up-regulated in plasma is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in plasma is up-regulated.
- the modification of expression of a particular nucleic acid molecule encoding a miRNA sequence occurs in an anti-cyclical pattern to the regulation of said molecule in plasma of cancer patients in order to interfere with the "excess activity" of an up-regulated molecule and/or to restore the "deficient activity" of a down-regulated molecule in plasma.
- down-regulating the expression of a nucleic acid molecule comprises introducing into the patient a nucleic acid molecule encoding a sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated.
- introducing into blood refers to any manipulation allowing the transfer of one or more nucleic acid molecules into blood. Examples of such techniques include injection, digestion or any other techniques may be involved.
- complementary nucleic acid molecule introduced into blood is capable of forming base pairs, preferably Watson-Crick base pairs, with the up-regulated endogenous "sense" nucleic acid molecule.
- nucleic acid molecules may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides.
- the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions).
- the "complementary" nucleic acid molecule comprises a stretch of at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in the up-regulated "sense" nucleic acid molecule.
- the "complementary" nucleic acid molecule i.e. the nucleic acid molecule encoding a nucleic acid sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated
- the "complementary" nucleic acid molecule may be a naturally occurring DNA- or RNA molecule or a synthetic nucleic acid molecule comprising in its sequence one or more modified nucleotides which may be of the same type or of one or more different types.
- nucleic acid molecule comprises at least one ribonucleotide backbone unit and at least one deoxyribonucleotide backbone unit.
- the nucleic acid molecule may contain one or more modifications of the RNA backbone into 2'-O-methyl group or 2'-O-methoxyethyl group (also referred to as "2'-O-methylation"), which prevented nuclease degradation in the culture media and, importantly, also prevented endonucleolytic cleavage by the RNA-induced silencing complex nuclease, leading to irreversible inhibition of the miRNA.
- LNAs locked nucleic acids
- RNA inhibitors that can be expressed in cells, as RNAs produced from transgenes, were generated as well.
- microRNA sponges these competitive inhibitors are transcripts expressed from strong promoters, containing multiple, tandem binding sites to a microRNA of interest (Ebert, M.S. et al. (2007) Nat. Methods 4, 721-726).
- the one or more nucleic acid molecules whose expression is to be down-regulated encode microRNA sequences selected from:
- up-regulating the expression of a nucleic acid molecule comprises introducing into blood a nucleic acid molecule encoding the microRNA sequence encoded by nucleic acid molecule to be up- regulated.
- the up-regulation of the expression of a nucleic acid molecule encoding a miRNA sequence is accomplished by introducing into the one or more cells another copy of said miRNA sequence (i.e. an additional "sense" nucleic acid molecule).
- the "sense" nucleic acid molecule to be introduced into blood may comprise the same modification as the "anti-sense" nucleic acid molecules described above.
- the one or more nucleic acid molecules whose expression is to be up-regulated encode microRNA sequences selected from:
- the "sense” and/or the "anti-sense” nucleic acid molecules to be introduced into blood in order to modify the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature may be operably linked to a regulatory sequence in order to allow expression of the nucleotide sequence.
- preliminary functional analyses may be performed with respect to the identification of mRNA target sequences to which the miRNAs may bind. Based on the finding that miRNAs may be involved in both tumor suppression and tumorigenesis (Esquela-Kerscher, A. and Slack, F.J (2006) supra; Calin, G.A. and Croce, CM. (2007) supra; Blenkiron, C. and Miska, E.A. (2007) supra) it is likely to speculate that mRNA target sites for such miRNAs include tumor suppressor genes as well as oncogenes.
- a nucleic acid molecule is referred to as "capable of expressing a nucleic acid molecule" or capable “to allow expression of a nucleotide sequence” if it comprises sequence elements which contain information regarding to transcriptional and/or translational regulation, and such sequences are “operably linked” to the nucleotide sequence encoding the polypeptide.
- An operable linkage is a linkage in which the regulatory sequence elements and the sequence to be expressed (and/or the sequences to be expressed among each other) are connected in a way that enables gene expression.
- promoter regions necessary for gene expression may vary among species, but in general these regions comprise a promoter which, in prokaryotes, contains both the promoter per se, i.e. DNA elements directing the initiation of transcription, as well as DNA elements which, when transcribed into RNA, will signal the initiation of translation.
- promoter regions normally include 5' non- coding sequences involved in initiation of transcription and translation, such as the -35/- 10 boxes and the Shine -Dalgarno element in prokaryotes or the TATA box, CAAT sequences, and 5'-capping elements in eukaryotes.
- These regions can also include enhancer or repressor elements as well as translated signal and leader sequences for targeting the native polypeptide to a specific compartment of a host cell.
- the 3' non-coding sequences may contain regulatory elements involved in transcriptional termination, polyadenylation or the like. If, however, these termination sequences are not satisfactory functional in a particular host environment, then they may be substituted with signals functional in that environment.
- the expression of the nucleic molecules may also be influenced by the presence, e.g., of modified nucleotides (cf. the discussion above).
- modified nucleotides cf. the discussion above.
- LNA locked nucleic acid
- LNA monomers are thought to increase the functional half-life of miR As in vivo by enhancing the resistance to degradation and by stabilizing the miRNA-target duplex structure that is crucial for silencing activity (Naguibneva, I. et al. (2006) Biomed Pharmacother 60, 633-638).
- a nucleic acid molecule of the invention to be introduced into blood may include a regulatory sequence, preferably a promoter sequence, and optionally also a transcriptional termination sequence.
- the promoters may allow for either a constitutive or an inducible gene expression. Suitable promoters include inter alia the E. coli lac ⁇ TV5 and tet (tetracycline-responsive) promoters, the T7 promoter as well as the SV40 promoter or the CMV promoter.
- the nucleic acid molecules of the invention may also be comprised in a vector or other cloning vehicles, such as plasmids, phagemids, phages, cosmids or artificial chromosomes.
- the nucleic acid molecule is comprised in a vector, particularly in an expression vector.
- Such an expression vector can include, aside from the regulatory sequences described above and a nucleic acid sequence encoding a genetic construct as defined in the invention, replication and control sequences derived from a species compatible with the host that is used for expression as well as selection markers conferring a selectable phenotype on host. Large numbers of suitable vectors such as pSUPER and pSUPERIOR are known in the art, and are commercially available.
- the present invention relates to a pharmaceutical composition for the prevention and/or treatment of lung cancer in blood, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated in plasma from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down- regulated in plasma from lung cancer patients, as defined herein.
- the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of lung cancer.
- suitable pharmaceutical compositions include inter alia those compositions suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), peritoneal and parenteral (including intramuscular, subcutaneous and intravenous) administration, or for administration by inhalation or insufflation. Administration may be local or systemic. Preferably, administration is accomplished via the oral or intravenous routes.
- the formulations may also be packaged in discrete dosage units.
- compositions according to the present invention include any pharmaceutical dosage forms established in the art, such as inter alia capsules, microcapsules, cachets, pills, tablets, powders, pellets, multi-particulate formulations (e.g., beads, granules or crystals), aerosols, sprays, foams, solutions, dispersions, tinctures, syrups, elixirs, suspensions, water-in-oil emulsions such as ointments, and oil- in water emulsions such as creams, lotions, and balms.
- pharmaceutical dosage forms established in the art, such as inter alia capsules, microcapsules, cachets, pills, tablets, powders, pellets, multi-particulate formulations (e.g., beads, granules or crystals), aerosols, sprays, foams, solutions, dispersions, tinctures, syrups, elixirs, suspensions, water-in-oil emulsions such as oint
- the ("sense” and "anti-sense”) nucleic acid molecules described above can be formulated into pharmaceutical compositions using pharmacologically acceptable ingredients as well as established methods of preparation (Gennaro, A.L. and Gennaro, A.R. (2000) Remington: The Science and Practice of Pharmacy, 20th Ed., Lippincott Williams & Wilkins, Philadelphia, PA; Crowder, T.M. et al. (2003 ) A Guide to Pharmaceutical Particulate Science. Interpharm/CRC, Boca Raton, FL; Niazi, S.K. (2004) Handbook of Pharmaceutical Manufacturing Formulations, CRC Press, Boca Raton, FL).
- pharmaceutically inert inorganic or organic excipients i.e. carriers
- pharmaceutically inert inorganic or organic excipients i.e. carriers
- a suitable excipient for the production of solutions, suspensions, emulsions, aerosol mixtures or powders for reconstitution into solutions or aerosol mixtures prior to use include water, alcohols, glycerol, polyols, and suitable mixtures thereof as well as vegetable oils.
- the pharmaceutical composition may also contain additives, such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect.
- additives such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect.
- additives such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect.
- the nucleic acid molecules may be incorporated into slow or sustained release or targeted delivery systems, such as liposomes, nanoparticles, and microcapsules.
- One approach involves covalently coupling the passenger strand (miRNA* strand) of the miRNA to cholesterol or derivatives/conjugates thereof to facilitate uptake through ubiquitously expressed cell-surface LDL receptors (Soutschek, J. et al.
- LNA-antimiR locked- nucleic-acid-modified oligonucleotides
- lipidoids synthesis scheme based upon the conjugate addition of alkylacrylates or alkyl-acrylamides to primary or secondary amines
- RNAi therapeutics Akinc, A. et al. (2008) Nat Biotechnol 26, 561-569.
- a further targeting strategy involves the mixing of miRNAs with a fusion protein composed of a targeting antibody fragment linked to protamine, the basic protein that nucleates DNA in sperm and binds miRNAs by charge (Song, E. et al.
- Example 1 Tissue sample collection and preparation
- Patient data (age, sex, imaging data, therapy, other medical conditions, family history, and the like) were derived from the hospital databases for matching the various samples collected.
- Pathologic follow-up (for example, histological analysis via hematoxylin and eosin (H&E) staining) was used for evidently determining the disease state of a given sample as well as to ensure a consistent classification of the specimens.
- Laser-capture micro-dissection was optionally performed for each cancerous sample in order to specifically isolate tumor cell populations (about 200.000 cells).
- a transparent transfer film is applied to the surface of a tissue section or specimen. Under a microscope, the thin tissue section is viewed through the glass slide on which it is mounted and clusters of cells are identified for isolation.
- a near IR laser diode integral with the microscope optics is activated. The pulsed laser beam activates a spot on the transfer film, fusing the film with the underlying cells of choice. The transfer film with the bonded cells is then lifted off the thin tissue section (Emmert-Buck, M.R. et al.
- Example 2 Analysis of the miRNA expression profile in the tissue samples
- a qualitative analysis of the miRNAs (differentially) expressed in a particular sample may optionally be performed using the Agilent miRNA microarray platform (Agilent Technologies, Santa Clara, CA, USA).
- the microarray contains probes for 723 human miRNAs from the Sanger database v.10.1. Total RNA (100 ng) derived from each of 91 LCM-selected lung tissues were used as inputs for labeling via Cy3 incorporation.
- Microarray slides were scanned by XDR Scan (PMT100, PMT5). The labeling and hybridization were performed according to the protocols in the Agilent miRNA microarray system.
- the raw data obtained for single-color (CY3) hybridization were normalized by applying a Quantile method and using GeneSpring GX10 software (Agilent Technologies, Santa Clara, CA, USA) known in the art. Unpaired t-test (p value ⁇ 0.01) after Fisher test (F-test) was used to identify differentially expressed miRNAs between lung cancer and normal lung tissues.
- Example 3 Plasma sample collection and preparation
- Peripheral blood (2 ml) was drawn into EDTA tubes. Within two hours, the tubes were subjected to centrifuge at 820g for 10 min. Then, 1ml aliquots of the plasma was transferred to 1.5 ml tubes and centrifuged at 16,000g for 10 min to pellet any remaining cellular debris. Subsequently, the supernatant was transferred to fresh tubes and stored them at -80 °C.
- a qualitative analysis of the miRNAs (differentially) expressed in a particular plasma sample may optionally be performed using the Agilent miRNA microarray platform (Agilent Technologies, Santa Clara, CA, USA).
- the microarray contains probes for 723 human miRNAs from the Sanger database v.10.1. Total RNA (100 ng) derived from each of 59 plasma specimens were used as inputs for labeling via Cy3 incorporation.
- Microarray slides were scanned by XDR Scan (PMT100, PMT5). The labeling and hybridization were performed according to the protocols in the Agilent miRNA microarray system.
- ROC receiver operating characteristic
- the miRNA was considered to be differentially expressed in lung cancer patients as compared to healthy controls, and/or other types of lung cancer, respectively
- Table 9-11 The expression data on the preferred expression signatures in the first aspect for identifying adenocarcinoma lung cancer from healthy controls are summarized in Table 9-11 below.
- Table 9 lists tumor-related miRNA signatures exhibiting significantly differential expressions in both tissue and plasma of patients with adenocarcinoma lung
- Table 10 summarizes plasma-specific miRNA signatures exhibiting
- Table 12-14 for identifying squamous cell lung cancer from healthy controls are summarized in Table 12-14 below.
- Table 12 lists tumor-related miRNA signatures exhibiting significantly differential expressions in both tissue and plasma of patients with squamous cell lung cancer,
- Table 13 summarizes plasma- specific miRNA signatures
- Table 15-17 The expression data on the preferred expression signatures in the third aspect for identifying small cell lung cancer from healthy controls are summarized in Table 15-17 below.
- Table 15 lists tumor-related miRNA signatures exhibiting significantly 5 differential expressions in both tissue and plasma of small cell lung cancer, Table 16
- Particularly preferred miRNAs are shown in bold.
- Table 18 lists miRNA signatures for adenocarcinoma lung cancer in differentiating 5 healthy controls, squamous cell lung cancer and small cell lung cancer;
- Table 19 summarizes miRNA signatures for squamous cell lung cancer in differentiating healthy controls, adenocarcinoma lung cancer and small cell lung cancer;
- Table 20 displays miRNA signatures for small cell lung cancer in differentiating healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer, whereas Table 20 lists
- miRNA signature combinations for small cell lung cancer in differentiating healthy controls adenocarcinoma lung cancer and squamous cell lung cancer.
- ⁇ denotes healthy controls
- AC denotes adenocarcinoma lung cancer
- SQ denotes squamous cell lung cancer
- SCLC small cell lung cancer.
- Particularly preferred miRNAs SEQ ID NO: 3 in Table 18; SEQ ID NO: 20 in Table
- the respective subsets of miRNAs specified herein represent unique miRNA expression signatures for expression profiling of lung cancer that do not only allow the identification of a cancerogenous state as such but also enables the discrimination between different types of tumors, namely adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
- the identification of the miRNA expression signatures of the present invention provides a unique molecular marker that allows screening, detection, diagnosing and discrimination of different types of lung cancers in blood. Furthermore, the expression signatures can be used to monitor the therapy response and guide the treatment decision in lung cancer patients. Additionally, the expression signatures may be also used for development of anti-lung cancer drugs.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Hospice & Palliative Care (AREA)
- Medicinal Chemistry (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides diagnostic kits comprising a plurality of nucleic acid molecules encoding microRNA sequences for identifying one or more target plasma exhibiting lung cancer, wherein the nucleic acid molecules are differentially expressed in target plasma and in control plasma. The invention further provides methods for identifying one or more target plasma exhibiting lung cancer by using said nucleic acid molecules, and methods and pharmaceutical compositions for preventing or treating lung cancer.
Description
COMPOSITIONS AND METHODS FOR MICRORNA EXPESSION PROFILING IN PLASMA OF LUNG CANCER
FIELD OF THE INVENTION
The present invention relates to compositions and methods for microRNA expression profiling in plasma of lung cancer, particularly for adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer. BACKGROUND OF THE INVENTION
Lung cancer remains the most common cause of cancer-related deaths among man and woman worldwide. There estimated to 1.4 million new cases in 2009 with average annual increase for 2.51% (Frost & Sullivan estimates) and the majority of patients diagnosed with lung cancer in 2009 will die of their disease (Higgins, M.J. et al. (2009) Expert Rev Anticancer Ther 9, 1365-1378). Despite some improvements in surgical techniques and combined therapies over the last several decades, the five-year survival rate for all stages combined is about 15% in the United States and Europe.
Lung cancers are classified as either small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC). The predominant (>80%) histological form of lung cancer is NSCLC including adenocarcinoma and squamous-cell lung cancer. Cigarette smoking is the most important risk factor for lung cancer, accounting for about 80% of lung cancer cases in men and 50% in women worldwide.
Treatment for lung cancer differs according to the subtype of cancer. The treatment of choice for early stage NSCLC is surgery with a 5 year overall survival of 40%. However, a majority of patients are at an advanced disease stage at the time of diagnosis, which limits first-line therapy to multi-agent chemotherapy and an expected survival is less than 8 months. Recent advances in targeted therapies require greater accuracy in the subclassification of non-small-cell lung cancer (NSCLC). Inhibitors of tumor angiogenesis pose higher risk for adverse response in cases of squamous cell lung cancer (Lebanoy, D. (2009) / Clin Oncol 27, 2030-2037). Small cell lung cancer
(SCLC) is the most deadly form of the disease, with a case-fatality rate greater than 90%. Despite often observed high, initial response rates, patients with limited-stage disease have a median survival of approximately 20 months. There is rarely a role for surgery in the management of SCLC and chemotherapy alone or combined with radiation is the choice of treatment.
Besides the different treatments on the different subtypes and etiologies of lung cancer, the inter-observer variability and the lack of specific, standardized assays also limit the current abilities to adequately stratify patients for suitable treatments. Treatment decisions for an individual patient with lung cancer will soon be based on detailed tumor and host characteristics. Specific molecular biomarkers to differentiate subtypes of lung cancers are definitely needed.
The current methods for early detection of lung cancer have not yet been proven to reduce mortality. Chest x-ray, analysis of cells in sputum, and fiberoptic examination of the bronchial passages have shown limited effectiveness in reducing lung cancer mortality. Newer tests, such as low-dose spiral computed tomography (CT) scans and molecular markers in sputum, have produced promising results in detecting lung cancers at earlier, more operable stages when survival is better. However, there are considerable risks associated with lung biopsy and surgery and the net benefit of screening has not been established. Therefore, the development of clinically validated blood-based cancer biomarkers remains an unmet challenge for lung cancer. New approaches that can complement and improve on current strategies for lung cancer detection are urgently needed.
Many diagnostic assays are also hampered by the fact that they are typically based on the analysis of only a single molecular marker, which might affect detection reliability and/or accuracy. In addition, a single marker normally does not enable detailed predictions concerning latency stages, tumor progression, and the like. Thus, there is still a continuing need for the identification of alternative molecular markers and assay formats overcoming these limitations.
One approach to address this issue might be based on small regulatory RNA molecules, in particular on microRNAs (miRNAs) which, constitute an evolutionary conserved class of endogenously expressed small non-coding RNAs of 20-25
nucleotides (nt) in size that can mediate the expression of target mRNAs and thus - since their discovery about ten years ago - have been implicated with critical functions in cellular development, differentiation, proliferation, and apoptosis (Bartel, D.P. (2004) Cell 116, 281-297, Ambros, V. (2004) Nature 431, 350-355; He, L. et al. (2004) Nat Rev Genet 5, 522-531). Furthermore, miRNAs have advantages over mRNAs as cancer biomarkers, since they are very stable in vitro and long-lived in vivo (Lu, J. et al, (2005) Nature 435, 834-838; Lim, L.P. et al, (2005) Nature 433, 769-773).
MiRNAs are produced from primary transcripts that are processed to stem-loop structured precursors (pre-miRNAs) by the RNase III Drosha. After transport to the cytoplasm, another RNase III termed Dicer cleaves of the loop of the pre-miRNA hairpin to form a short double-stranded (ds) RNA, one strand of which is incorporated as mature miRNA into a miRNA-protein (miRNP). The miRNA guides the miRNPs to their target mRNAs where they exert their function (Bartel, D.P. (2004) Cell 23, 281- 292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531).
Depending on the degree of complementarity between the miRNA and its target, miRNAs can guide different regulatory processes. Target mRNAs that are highly complementary to miRNAs are specifically cleaved by mechanisms identical to RNA interference (RNAi). Thus, in such scenario, the miRNAs function as short interfering RNAs (siRNAs). Target mRNAs with less complementarity to miRNAs are either directed to cellular degradation pathways or are translationally repressed without affecting the mRNA level. However, the mechanism of how miRNAs repress translation of their target mRNAs is still a matter of controversy.
High-throughput miRNA quantification technologies, such as miRNA microarray, real-time RT-PCR-based TaqMan miRNA assays, have provided powerful tools to study the global miRNA profile in whole cancer genome. Emerging data available indicate that dysregulation of miRNA expression may inter alia be associated with the development and/or progression of certain types of cancer. For example, two miRNAs, miR-15 and miR-16-1, were shown to map to a genetic locus that is deleted in chronic lymphatic leukemia (CLL) and it was found that in about 70% of the CLL patients, both miRNA genes are deleted or down-regulated. Furthermore, down- regulation of miR-143 and miR-145 was observed in colorectal neoplasia, whereas
expression of the miRNA let-7 is frequently reduced in lung cancers (Michael, M.Z. et al. (2003) Mol Cancer Res 1, 882-891; Mayr, C. et al. (2007) Science 315, 1576-1579). In fact, it has been speculated based on cancer-associated alterations in miRNA expression and the observation that miRNAs are frequently located at genomic regions involved in cancers that miRNAs may act both as tumor suppressors and as oncogenes (Esquela-Kerscher, A. and Slack, F.J (2006) Nat Rev Cancer 6, 259-269; Calin, G.A. and Croce, CM. (2007) / Clin Invest 117, 2059-2066; Blenkiron, C. and Miska, E.A. (2007) Hum Mol Genet 16, R106-R113). Demonstrated abnormal expression patterns of miRNAs in human cancers highlight their potential use as diagnostic and prognostic biomarkers.
Several studies have reported miRNA expression profiling in human lung cancer (Johnson, S.M. et al. (2005) Cell 120, 635-647; Liang, Y. et al. (2008) BMC Med Genomics 1, 61; Kumar, M.S. et al. (2008) Proc Natl Acad Sci USA 105, 3903-3908; Miko, E. et al. (2009) Exp Lung Res 35, 646-664; Xie, Y et al. (2009 ) Lung Cancer May 13; Lebanony, D. et al. (2009) / Clin Oncol 27, 2030-2037; Kauppinen, S. et al. (2009) Clin Cancer Res 15, 1177-1183; Mascaux, C. et al. (2009) Eur Respir J 33, 352-359). Consistently, these studies have shown that specific miRNAs are aberrantly expressed in malignant tissues as compared to nonmalignant lung tissue. Moreover, studies found that some miRNAs may be related to prognosis (Yu, S.L. et al. (2008) Cancer Cell 13, 48-57; Raponi, M. et al (2009) Cancer Res 69, 5776-5783). Thus, such miRNAs may provide insights into cellular processes involved in the malignant transformation and progression.
Among the many possible types of samples, blood is thought to be ideal for screening high risk individuals, leading to early detection, diagnosis, monitoring and efficient treatment of cancers- since blood can be collected easily in a minimally invasive manner. It has been demonstrated that tumor-derived miRNAs are present in human plasma or serum in a remarkably stable form that is protected from endogenous RNase activity. These tumor-derived miRNAs in serum or plasma are at levels sufficient to be measurable as biomarkers for cancer detection. Moreover, the levels of plasma and serum miRNAs correlate strongly, suggesting that either plasma or serum samples will be suitable for clinical applications using miRNAs as cancer diagnostic
biomarkers (Mitchell, P.S. et al. (2008) Proc Natl Acad Sci USA 105, 10513-10518; Gilad, S. et al. (2008) PLoS ONE 3, e3148; Chen, X. et al. (2008) Cell Res 18, 997- 1006). Chen. X et al studied expression patterns of serum miR As for lung cancer and found that hsa-miR-25 and hsa-miR-223 have potential as blood-based biomarkers for NSCLC. However, lack of sufficient sensitivity and specificity determined by single miRNA is unsuitable as diagnostic biomarker in clinical use.
Thus, there is an urgent need for blood-based diagnostic markers for lung cancer, particularly in form of a "expression signature" or a "molecular footprint", that enable the rapid, reliable and cost-saving detection of different types of lung cancer. In addition, there is a continuing need for corresponding methods for early stage-lung cancer screening, differential diagnosis of different types of lung cancer, early detection of the cancer recurrence, monitoring the cancer therapy and/or effectively treating lung cancer. OBJECT AND SUMMARY OF THE INVENTION
It is an objective of the present invention to provide novel approaches for diagnosing lung cancer, differentially diagnosing different types of lung cancer, monitoring the cancer therapy and/or treating lung cancer by determining a plurality of nucleic acid molecules in blood, each nucleic acid molecule encoding a microRNA (miRNA) sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in plasma for different types of lung cancers, analyzed as compared to healthy controls, and/or as compared to other types of lung cancers, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of lung cancer.
More specifically, it is an object of the invention to provide nucleic acid expression signatures and/or compositions in blood for identifying lung cancer, and/or discriminating different types of lung cancer. Furthermore, the nucleic acid expression signatures include tumor-related signatures, plasma-specific signatures and an internal stable control. The different types of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
Furthermore, it is an object of the invention to provide corresponding methods for identifying one or more nucleic acid expression signatures in blood exhibiting lung cancer. More specifically, it is an object of the invention to provide methods for differentiating different types of lung cancer as compared to healthy controls, and/or other types of lung cancer.
These objectives as well as others, which will become apparent from the ensuing description, are attained by the subject matter of the independent claims. Some of the preferred embodiments of the present invention are defined by the subject matter of the dependent claims.
In a first aspect, the present invention relates to a diagnostic kit of molecular markers in blood for identifying adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of adenocarcinoma lung cancer.
The nucleic acid expression signature, as defined herein, may comprise at least twelve nucleic acid molecules, and preferably at least six nucleic acid molecules.
In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy control plasma and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
In preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa-miR- 638, hsa-miR-572; plasma-specific signatures: hsa-miR-383, hsa-miR-1233, hsa-miR- 545* and hsa-miR-655, hsa-miR-19b-2*, hsa-miR-548d-5p, hsa-miR-190b, hsa-miR- 623, hsa-miR-923 and an internal stable control: hsa-miR-1238.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-638, hsa-miR-572, hsa-miR-383, hsa-miR-545*, hsa-miR- 655, hsa-miR-19b-2*, hsa-miR-548d-5p, hsa-miR-190b, hsa-miR-623 , hsa-miR-923 is up-regulated; the expression of hsa-miR-1233 is down-regulated and hsa-miR-1238 is un-changed in the one or more target plasma compared to the one or more healthy control plasma.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa- miR-638, hsa-miR-572 and plasma-specific signatures: hsa-miR-383, hsa-miR-1233, hsa-miR-545*, hsa-miR-655.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-638, hsa-miR-572, hsa-miR-383, hsa-miR-545*, hsa-miR- 655 is up-regulated and the expression of hsa-miR-1233 is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-383/hsa-miR- 1233, hsa-miR-19b-2*/hsa-miR-1233, hsa-miR-548d-5p/hsa-miR-1233, hsa-miR-548d- 5p/hsa-miR-1233, hsa-miR-545*/hsa-miR-1233, hsa-miR-923/hsa-miR-483-3p, hsa- miR-638/hsa-miR-483 -3p, hsa-miR- 190b/hsa-miR- 1233, hsa-miR- 190b/hsa-miR- 1233 and hsa-miR-572/hsa-miR-1233.
In a second aspect, the present invention relates to a diagnostic kit of molecular markers in blood for identifying squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of squamous cell lung cancer.
The nucleic acid expression signature, as defined herein, may comprise at least nineteen nucleic acid molecules, preferably at least six nucleic acid molecules.
In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy control plasma and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
In preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa-miR- 181a, hsa-miR-623, hsa-miR-769-5p, hsa-miR-21 *, hsa-miR-572, hsa-miR-34b*, hsa- miR-221, hsa-miR-939; plasma-specific signatures: hsa-miR-654-5p, hsa-miR-432, hsa-miR-194*, hsa-miR-302a, hsa-miR-485-3p, hsa-miR-654-3p, hsa-miR-22, hsa- miR-423-5p, hsa-miR-520d-3p, hsa-miR-923 and an internal stable control: hsa-miR- 1238.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-181a, hsa-miR-623, hsa-miR-769-5p, hsa-miR-21 *, hsa- miR-572, hsa-miR-34b*, hsa-miR-221, hsa-miR-939, hsa-miR-432, hsa-miR-194*, hsa- miR-302a, hsa-miR-485-3p, hsa-miR-654-3p, hsa-miR-22, hsa-miR-423-5p, hsa-miR- 520d-3p, hsa-miR-923 is up-regulated; hsa-miR-654-5p is down-regulated and the expression of hsa-miR-1238 is un-changed in the one or more target plasma compared to the one or more healthy control plasma.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa- miR-181a, hsa-miR-623, hsa-miR-769-5p and plasma- specific signatures: hsa-miR- 654-5p, hsa-miR-432, hsa-miR-194*.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-181a, hsa-miR-623, hsa-miR-769-5p, hsa-miR-432, hsa- miR-194* is up-regulated and the expression of hsa-miR-654-5p is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding:hsa-miR-194*/hsa-miR-654-5p, hsa-miR- 194*/hsa-miR-654-5p, hsa-miR-623/hsa-miR-654-5p, hsa-miR- 181 a/hsa-miR-
654-5p, hsa-miR-432/hsa-miR-654-5p, hsa-miR-520d-3p/hsa-miR-654-5p, hsa-miR- 302a/hsa-miR-654-5p, hsa-miR-423-5p/hsa-miR-654-5p and hsa-miR-221/hsa-miR- 654-5p.
In a third aspect, the present invention relates to a diagnostic kit of molecular markers in blood for identifying small cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of small cell lung cancer.
The nucleic acid expression signature, as defined herein, may comprise at least thirty-six nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least six nucleic acid molecules.
In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy control plasma and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
In preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa-miR- 375, hsa-miR-543, hsa-miR-139-3p, hsa-miR-34b*, hsa-miR-429, hsa-miR-361-5p, hsa-miR-130b, hsa-miR-196a, hsa-miR-200a, hsa-miR-765, hsa-miR-33b* and plasma- specific signatures: hsa-miR-377, hsa-miR-136, hsa-miR-574-5p, hsa-miR-767-3p, hsa- miR-637.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-543, hsa-miR-34b*, hsa-miR-429, hsa-miR- 361-5p, hsa-miR-130b, hsa-miR-196a, hsa-miR-200a, hsa-miR-765, hsa-miR-377, hsa- miR-136, hsa-miR-574-5p is up-regulated and the expression of any one or more of the
nucleic acid molecules encoding hsa-miR-139-3p, hsa-miR-33b*, hsa-miR-767-3p, hsa-miR-637 is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa- miR-375, hsa-miR-543, hsa-miR-139-3p, hsa-miR-34b*, hsa-miR-429, hsa-miR-361-5p, hsa-miR-130b, hsa-miR-196a, hsa-miR-200a, hsa-miR-765, hsa-miR-33b*, hsa-miR- 106a, hsa-miR-874, hsa-miR-142-5p; plasma-specific signatures: hsa-miR-377, hsa- miR-136, hsa-miR-574-5p, hsa-miR-767-3p, hsa-miR-637, hsa-miR-548d-5p, hsa-miR- 485-3p, hsa-miR-141, hsa-miR-520b, hsa-miR-609, hsa-miR-423-5p, hsa-miR-1233, hsa-miR-634, hsa-miR-654-5p, hsa-miR-138, hsa-miR-769-3p, hsa-miR-665, hsa-miR- 501-5p, hsa-let-7f, hsa-miR-193b*, hsa-miR-30d* and an internal stable control: hsa- miR-1238.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-543, hsa-miR-34b*, hsa-miR-429, hsa-miR- 361-5p, hsa-miR-130b, hsa-miR-196a, hsa-miR-200a, hsa-miR-765, hsa-miR-377, hsa- miR-136, hsa-miR-574-5p, hsa-miR-548d-5p, hsa-miR-485-3p, hsa-miR-141 , hsa-miR- 520b, hsa-miR-609, hsa-miR-423-5p is up-regulated; the expression of any one or more of the nucleic acid molecules encoding hsa-miR-139-3p, hsa-miR-33b*, hsa-miR-767- 3p, hsa-miR-637, hsa-miR-106a, hsa-miR-874, hsa-miR-142-5p, hsa-miR-1233, hsa- miR-634, hsa-miR-654-5p, hsa-miR-138, hsa-miR-769-3p, hsa-miR-665, hsa-miR-501- 5p, hsa-let-7f, hsa-miR-193b*, hsa-miR-30d* is down-regulated and hsa-miR-1238 is un-changed in the one or more target plasma compared to the one or more healthy control plasma.
In further preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa-miR-375, hsa-miR-543, hsa-miR-139-3p, hsa-miR-34b*, hsa-miR-429 and hsa-miR-361-5p.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-543, hsa-miR-34b*, hsa-miR-429 and hsa-
miR-361-5p is up-regulated and the expression of hsa-miR-139-3p is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-520b/hsa-miR-139-3p, hsa-miR-375/hsa-miR-l 06a, hsa-miR- 196a/hsa-miR-l 39-3p, hsa-miR-375/hsa-miR- 193b*, hsa-miR-609/hsa-miR-139-3p, hsa-miR- 136/hsa-miR-139-3p, hsa-miR-377/hsa- miR-637, hsa-miR-375/hsa-miR-637, hsa-miR-200a/hsa-miR-637, hsa-miR-520b/hsa- miR-637, hsa-miR-429/hsa-miR-637, hsa-miR-548d-5p/hsa-miR-139-3p, hsa-miR- 375/hsa-miR-1233, hsa-miR-543/hsa-miR-637, hsa-miR-375/hsa-miR-874, hsa-miR- 196b/hsa-miR-637, hsa-miR- 136/hsa-miR-637, hsa-miR-136/hsa-miR-637, hsa-miR- 574-5p/hsa-miR-637, hsa-miR- 130b/hsa-miR-634, hsa-miR-361-5p/hsa-miR-634, hsa- miR-765/hsa-miR-634, hsa-miR- 130b/hsa-miR-767-3p, hsa-miR-361 -5p/hsa-miR-767- 3p, hsa-miR-485-3p/hsa-miR-767-3p and hsa-miR-520b/hsa-miR-767-3p.
In a fourth aspect, the present invention relates to a diagnostic kit of molecular markers in blood for discriminating different types of lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in plasma of different types of lung cancer as well as in healthy control plasma, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of different types of lung cancer, wherein the different types of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
In one embodiment, the nucleic acid expression signatures in blood, as defined herein, are differently expressed in adenocarcinoma lung cancer from healthy controls, squamous cell lung cancer and small cell lung cancer. The nucleic acid expression signature, as defined herein, may comprise at least three nucleic acid molecules.
In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is
up-regulated in the one or more target plasma compared to the one or more healthy controls, squamous cell lung cancer and small cell lung cancer.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-383, hsa-miR-545*, hsa-miR-19b-2*.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-383, hsa-miR-545*, hsa-miR-19b-2* is up-regulated in the one or more target plasma compared to the one or more healthy controls, squamous cell lung cancer and small cell lung cancer.
In another embodiment, the nucleic acid expression signatures in blood, as defined herein, are differently expressed in squamous cell lung cancer from healthy controls, adenocarcinoma lung cancer and small cell lung cancer. The nucleic acid expression signature, as defined herein, may comprise at least three nucleic acid molecules.
In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-194*, hsa-miR-302a, hsa-miR-432.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-194*, hsa-miR-302a, hsa-miR-432 is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
In another embodiment, the nucleic acid expression signatures in blood, as defined herein, are differently expressed in small cell lung cancer from healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
The nucleic acid expression signature, as defined herein, may comprise at least twelve nucleic acid molecules, preferably at least five nucleic acid molecules.
In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer, and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down- regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
In preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a, hsa-miR-139-3p, hsa-miR-106a, hsa-miR-361-5p, hsa- miR-141, hsa-miR-765, hsa-miR-609, hsa-miR-520b and hsa-miR-769-3p.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a, hsa- miR-361-5p, hsa-miR-141, hsa-miR-765, hsa-miR-609, hsa-miR-520b is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR- 139-3p, hsa-miR-106a, hsa-miR-769-3p is down-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a and hsa-miR-139-3p.
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a is up- regulated and the expression of hsa-miR-139-3p is down-regulated in the one or more target plasma compared to the one or more healthy individual, adenocarcinoma lung cancer and squamous cell lung cancer.
In a fifth aspect, the present invention relates to a method for identifying one or more target plasma exhibiting lung cancer, the method comprising: (a) determining in the one or more target plasma the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence; (b) determining the expression levels of the plurality of nucleic acid molecules in one or
more healthy control plasma; and (c) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control plasma by comparing the respective expression levels obtained in steps (a) and (b), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature, as defined herein, that is indicative for the presence of lung cancer.
In preferred embodiments of the invention, the method comprising: (a) determining in the one or more target plasma the expression levels of a combination of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, and calculate with certain formula, then ; (b) determining the expression levels of the combination of nucleic acid molecules in healthy control plasma, and calculate with certain formula; and (c) identifying the difference of the combination in the one or more target and control plasma by comparing the respective calculation results obtained in steps (a) and (b), wherein the one or more differentially expressed combinations together represent a signature, as defined herein, that is indicative for the presence of lung cancer.
In more preferred embodiments of the invention, the method is for the further use of discriminating adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
In a sixth aspect, the present invention relates to a method for monitoring treatment of lung cancer, the method comprising: (a) identifying in the one or more target plasma a nucleic acid expression signature by using a method, as defined herein; and (b) monitoring in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression in plasma is up-regulated before treatment but is down-regulated after treatment and the expression of a nucleic acid molecule whose expression in plasma is down-regulated before treatment but is up-regulated after treatment.
In a seventh aspect, the present invention relates to a method for preventing or treating lung cancer, the method comprising: (a) identifying in plasma a nucleic acid expression signature by using a method, as defined herein; and (b) modifying in blood
the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression is up-regulated in plasma is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in plasma is up-regulated.
In an eighth aspect, the present invention relates to a pharmaceutical composition for the prevention and/or treatment of lung cancer in blood, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated in plasma from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down- regulated in plasma from lung cancer patients, as defined herein.
Finally, in a ninth aspect, the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of lung cancer.
Other embodiments of the present invention will become apparent from the detailed description hereinafter. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts a flow chart schematically illustrating the essential method steps for determining an expression signature according to the present invention for identifying one or more target plasma exhibiting lung cancer and further discriminating adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
Figure 2 illustrates the human miRNAs comprised in particularly preferred expression signatures in the first aspect according to the present invention for identifying one or more target plasma exhibiting adenocarcinoma lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients
with adenocarcinoma lung cancer as compared to healthy control plasma (i.e. an up-regulation or a down-regulation). Figure 3 illustrates the human miRNAs comprised in particularly preferred expression signatures in the second aspect according to the present invention for identifying one or more target plasma exhibiting squamous cell lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with squamous cell lung cancer as compared to healthy control plasma (i.e. an up-regulation or a down-regulation). Figure 4 illustrates the human miRNAs comprised in particularly preferred expression signatures in the third aspect according to the present invention for identifying one or more target plasma exhibiting small cell lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with squamous cell lung cancer as compared to healthy control plasma
(i.e. an up-regulation or a down-regulation).
Figure 5 illustrates the human miRNAs comprised in particularly preferred expression signatures in the fourth aspect according to the present invention for discriminating the different types of lung cancer. Figure 5A illustrates the expression levels of the miRNA signatures in differentiating adenocarcinoma lung cancer from healthy controls, squamous cell lung cancer and small cell lung cancer. Figure 5B illustrates the expression levels of the miRNA signatures in differentiating squamous cell lung cancer from healthy controls, adenocarcinoma lung cancer and small cell lung cancer. Figure 5C illustrates the expression levels of the miRNA signatures in differentiating small cell lung cancer from healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based on the unexpected finding that lung cancer can be reliably identified and different types of lung cancer can be discriminated based on particular miRNA expression profiles in plasma with high sensitivity and specificity, wherein the expression signatures as defined herein typically comprises both up- and down-regulated human miRNAs. More specifically, said miRNA expression signatures - by analyzing the overall miRNA expression pattern and/or the respective individual miRNA expression level(s) in plasma - allow the detection of lung cancer at an early disease state and discriminating the different types of lung cancer.
The present invention illustratively described in the following may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein.
The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. The drawings described are only schematic and are to be considered non- limiting.
Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. For the purposes of the present invention, the term "consisting of is considered to be a preferred embodiment of the term "comprising of. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also to be understood to disclose a group, which preferably consists only of these embodiments.
Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated.
The term "about" in the context of the present invention denotes an interval of accuracy that the person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates deviation from the indicated numerical value of ± 10%, and preferably ± 5%.
Furthermore, the terms first, second, third, (a), (b), (c), and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.
Further definitions of term will be given in the following in the context of which the terms are used.
The following terms or definitions are provided solely to aid in the understanding of the invention. These definitions should not be construed to have a scope less than understood by a person of ordinary skill in the art.
It is an objective of the present invention to provide novel approaches for diagnosing and/or monitoring treatment of lung cancer by determining a plurality of nucleic acid molecules in blood, each nucleic acid molecule encoding a microRNA (miRNA) sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in plasma for different types of lung cancers, analyzed as compared to healthy control plasma, or as compared to other types of lung cancers, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of lung cancer.
More specifically, it is an object of the invention to provide nucleic acid expression signatures and/or compositions in blood for identifying lung cancer and/or discriminating different types of lung cancer. More specifically, the nucleic acid expression signatures include tumor-related signatures and plasma-specific signatures. The different types of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
The term "cancer" (also referred to as "carcinoma"), as used herein, generally denotes any type of malignant neoplasm, that is, any morphological and/or physiological alterations (based on genetic re -programming) of special tissue exhibiting or having a predisposition to develop characteristics of a carcinoma as compared to unaffected (healthy) wild-type control tissues. Examples of such alterations may relate
inter alia to cell size and shape (enlargement or reduction), cell proliferation (increase in cell number), cell differentiation (change in physiological state), apoptosis (programmed cell death) or cell survival.
The term "lung cancer", as used herein, refers to uncontrolled cell growth in the tissue of lung, or cancerous growths in the lung.
The term "different types of lung cancer", as used herein, include adenocarcinoma lung cancer, squamous cell lung cancer and small-cell lung cancer.
"Adenocarcinoma lung cancer" or "adenocarcinoma lung carcinoma" is a form of non-small cell lung cancer. Eighty percent of lung cancers are non-small cell cancers (NSCLC), and of these, about 50% are adenocarcinomas. Adenocarcinoma of the lung begins in the outer parts of the lung, and it can be present for a long time before it is diagnosed. It is the type of lung cancer most commonly seen in women and is often seen in non-smokers.
"Squamous cell lung cancer" or "squamous cell lung carcinoma" is a form of non-small cell lung cancer. About 30% of NSCLC are squamous cell lung cancer. Squamous cell lung carcinomas usually begin in the bronchial tubes (large airways) in the central part of the lungs. Many people have symptoms early on, commonly hemoptysis (coughing up blood).
"Small cell lung cancer", or "small cell lung carcinoma" (SCLC), is thought to arise from neuroendocrine cells which form part of the epithelium (lining) of the bronchi (airways). SCLC accounts for about 18% of all cases of lung cancer. SCLCs are very aggressive. They grow quickly and spread via the bloodstream to the liver, lung, bones and brain. It is quite common for tumour deposits to be found in these organs at the time of diagnosis.
The term "plasma", as used herein, is the yellow liquid component of blood, in which the blood cells in whole blood would normally be suspended. It makes up about 55% of the total blood volume. It is mostly water (90% by volume) and contains dissolved proteins, glucose, clotting factors, mineral ions, hormones and carbon dioxide (plasma being the main medium for excretory product transportation). Blood plasma is prepared by spinning a tube of fresh blood in a centrifuge until the blood cells fall to the bottom of the tube. The blood plasma is then poured or drawn off. Blood plasma has a
density of approximately 1025 kg/m3, or 1.025 kg/1. Recent research showed that miRNA is stable in plasma. The term "plasma sample" refers to plasma taken from individuals being examined or from healthy control.
The term "patient", as used herein, refers to a human being at least supposed to have lung cancer, or certain types of lung cancer; where as "target plasma", as used herein, refers to plasma collected from patients; The term "healthy individual" or "healthy control" typically denotes a healthy person not having characteristics of such a cancerous phenotype. And "control plasma", as used herein, denotes plasma collected from healthy individuals. However, in some applications, for example, when comparing different types of lung cancer, the individual having the other types of lung cancer or plasma collected from these individuals is typically considered the "control".
Typically, the plasma samples used are derived from biological specimens collected from the subjects to be diagnosed for the presence of lung cancer. Furthermore, in order to corroborate the data obtained "comparative samples" may also be collected from subjects having a given known disease state. The biological samples may include body tissues and fluids, such as lung tissue, serum, blood cell, sputum, and urine. Furthermore, the biological sample may be obtained from individual have lung cancerous characteristics or suspected to be cancerous. Furthermore, the sample may be purified from the obtained body tissues and fluids if necessary, and then used as the biological sample. According to the present invention, the expression level of the nucleic acid markers of the present invention is determined in the subject-derived biological sample(s).
The sample used for detection in the in vitro methods of the present invention should generally be collected in a clinically acceptable manner, preferably in a way that nucleic acids (in particular RNA) or proteins are preserved. The samples to be analyzed are typically from blood. Furthermore, lung tissue and other types of sample can be used as well. Samples, in particular after initial processing may be pooled. However, also non-pooled samples may be used.
The term "microRNA" (or "miRNA"), as used herein, is given its ordinary meaning in the art (Bartel, D.P. (2004) Cell 23, 281-292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531). Accordingly, a "microRNA" denotes an RNA molecule
derived from a genomic locus that is processed from transcripts that can form local RNA precursor miRNA structures. The mature miRNA is usually 20, 21, 22, 23, 24, or 25 nucleotides in length, although other numbers of nucleotides may be present as well, for example 18, 19, 26 or 27 nucleotides.
The miRNA encoding sequence has the potential to pair with flanking genomic sequences, placing the mature miRNA within an imperfect RNA duplex (herein also referred to as stem-loop or hairpin structure or as pre-miRNA), which serves as an intermediate for miRNA processing from a longer precursor transcript. This processing typically occurs through the consecutive action of two specific endonucleases termed Drosha and Dicer, respectively. Drosha generates from the primary transcript (herein also denoted "pri-miRNA") a miRNA precursor (herein also denoted "pre-miRNA") that typically folds into a hairpin or stem-loop structure. From this miRNA precursor a miRNA duplex is excised by means of Dicer that comprises the mature miRNA at one arm of the hairpin or stem-loop structure and a similar-sized segment (commonly referred to miRNA*) at the other arm. The miRNA is then guided to its target mRNA to exert its function, whereas the miRNA* is degraded. In addition, miRNAs are typically derived from a segment of the genome that is distinct from predicted protein-coding regions.
The term "miRNA precursor" (or "precursor miRNA" or "pre-miRNA"), as used herein, refers to the portion of a miRNA primary transcript from which the mature miRNA is processed. Typically, the pre-miRNA folds into a stable hairpin (i.e. a duplex) or a stem-loop structure. The hairpin structures typically range from 50 to 80 nucleotides in length, preferably from 60 to 70 nucleotides (counting the miRNA residues, those pairing to the miRNA, and any intervening segment(s) but excluding more distal sequences).
The term "nucleic acid molecule encoding a microRNA sequence", as used herein, denotes any nucleic acid molecule coding for a microRNA (miRNA). Thus, the term does not only refer to mature miRNAs but also to the respective precursor miRNAs and primary miRNA transcripts as defined above. Furthermore, the present invention is not restricted to RNA molecules but also includes corresponding DNA molecules encoding a microRNA, e.g. DNA molecules generated by reverse
transcribing a miRNA sequence. A nucleic acid molecule encoding a microRNA sequence according to the invention typically encodes a single miRNA sequence (i.e. an individual miRNA). However, it is also possible that such nucleic acid molecule encodes two or more miRNA sequences (i.e. two or more miRNAs), for example a transcriptional unit comprising two or more miRNA sequences under the control of common regulatory sequences such as a promoter or a transcriptional terminator.
The term "nucleic acid molecule encoding a microRNA sequence", as used herein, is also to be understood to include "sense nucleic acid molecules" (i.e. molecules whose nucleic acid sequence (5'→ 3') matches or corresponds to the encoded miRNA (5'→ 3') sequence) and "anti-sense nucleic acid molecules" (i.e. molecules whose nucleic acid sequence is complementary to the encoded miRNA (5'→ 3') sequence or, in other words, matches the reverse complement (3'— > 5') of the encoded miRNA sequence). The term "complementary", as used herein, refers to the capability of an "anti-sense" nucleic acid molecule sequence of forming base pairs, preferably Watson-Crick base pairs, with the corresponding "sense" nucleic acid molecule sequence (having a sequence complementary to the anti-sense sequence).
Within the scope of the present invention, two nucleic acid molecules (i.e. the "sense" and the "anti-sense" molecule) may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides. Alternatively, the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions). Preferably, the "complementary" nucleic acid molecule comprises at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in corresponding "sense" nucleic acid molecule.
Accordingly, the plurality of nucleic acid molecules encoding a miRNA sequence that are comprised in a diagnostic kit of the present invention may include one or more "sense nucleic acid molecules" and/or one or more "anti-sense nucleic acid molecules". In case, the diagnostic kit includes one or more "sense nucleic acid molecules" (i.e. the miRNA sequences as such), said molecules are to be considered to constitute the totality or at least a subset of differentially expressed miRNAs (i.e.
molecular markers) being indicative for the presence of or the disposition to develop a particular condition, here lung cancer. On the other hand, in case a diagnostic kit includes one or more "anti-sense nucleic acid molecules" (i.e. sequences complementary to the miRNA sequences), said molecules may comprise inter alia probe molecules (for performing hybridization assays) and/or oligonucleotide primers (e.g., for reverse transcription or PCR applications) that are suitable for detecting and/or quantifying one or more particular (complementary) miRNA sequences in a given sample.
A plurality of nucleic acid molecules as defined within the present invention may comprise at least two, at least ten, at least 50, at least 100, at least 200, at least 500, at least 1.000, at least 10.000 or at least 100.000 nucleic acid molecules, each molecule encoding a miRNA sequence.
The term "differentially expressed", as used herein, denotes an altered expression level of a particular miRNA in the disease plasma as compared to the healthy controls, or as compared to other types of disease samples, which may be an up- regulation (i.e. an increased miRNA concentration in the plasma) or a down-regulation (i.e. a reduced or abolished miRNA concentration in the plasma). In other words, the nucleic acid molecule is activated to a higher or lower level in the disease plasma samples than in the control plasma.
Within the scope of the present invention, a nucleic acid molecule is to considered differentially expressed if the respective expression levels of this nucleic acid molecule in disease plasma samples and control samples typically differ by at least 5% or at least 10%, preferably by at least 20% or at least 25%, and most preferably by at least 30% or at least 50%. Thus, the latter values correspond to an at least 1.3-fold or at least 1.5-fold up-regulation of the expression level of a given nucleic acid molecule in the disease plasma samples compared to the control plasma samples or vice versa an at least 0.7-fold or at least 0.5-fold down-regulation of the expression level in the disease plasma samples, respectively.
The term "expression level", as used herein, refers to extent to which a particular miRNA sequence is transcribed from its genomic locus, that is, the concentration of a miRNA in the plasma sample to be analyzed.
As outlined above, the term "control plasma" typically denotes a plasma sample collected from (healthy) individual not having characteristics of a lung cancer phenotype. However, in some applications, for example, when comparing different types of lung cancers, the plasma collected from other types of lung cancer is typically considered the "control plasma".
The determining of expression levels typically follows established standard procedures well known in the art (Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F.M. et al. (2001) Current Protocols in Molecular Biology. Wiley & Sons, Hoboken, NJ). Determination may occur at the RNA level, for example by Northern blot analysis using miRNA-specific probes, or at the DNA level following reverse transcription (and cloning) of the RNA population, for example by quantitative PCR or real-time PCR techniques. The term "determining", as used herein, includes the analysis of any nucleic acid molecules encoding a microRNA sequence as described above. However, due to the short half-life of pri-miRNAs and pre-mRNAs typically the concentration of only the mature miRNA is measured.
In specific embodiments, the standard value of the expression levels obtained in several independent measurements of a given sample (for example, two, three, five or ten measurements) and/or several measurements within several samples or control samples are used for analysis. The standard value may be obtained by any method known in the art. For example, a range of mean ± 2 SD (standard deviation) or mean ± 3 SD may be used as standard value.
The difference between the expression levels obtained for disease and control plasma may be normalized to the expression level of further control nucleic acids, e.g. housekeeping genes whose expression levels are known not to differ depending on the disease states of the individual from whom the sample was collected. Exemplary housekeeping genes include inter alia β-actin, glycerinaldehyde 3 -phosphate dehydrogenase, and ribosomal protein PI . In preferred embodiments, the control nucleic acid is another miRNA known to be stably expressed during the various non- cancerous and (pre-)cancerous states of the individual from whom the sample was collected.
However, instead of determining in any experiment the expression levels for plasma sample it may also be possible to define based on experimental evidence and/or prior art data on or more cut-off values for a particular disease phenotype (i.e. a disease state). In such scenario, the respective expression levels for the plasma sample can be determined by using a stably expressed control miR A for normalization. If the "normalized" expression levels calculated are higher than the respective cutoff value defined, then this finding would be indicative for an up-regulation of gene expression. Vice versa, if the "normalized" expression levels calculated are lower than the respective cutoff value defined, then this finding would be indicative for a down- regulation of gene expression.
In the context of the present invention, the term "identifying lung cancer and/or discriminating different types of lung cancer" is intended to also encompass predictions and likelihood analysis (in the sense of "diagnosing"). The compositions and methods disclosed herein are intended to be used clinically in making decisions concerning treatment modalities, including therapeutic intervention, diagnostic criteria such as disease stages, and disease monitoring and surveillance for the disease. According to the present invention, an intermediate result for examining the condition of a subject may be provided. Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to diagnose that a subject suffers from the disease. Alternatively, the invention may be used to detect cancerous changes through plasma sample, and provide a doctor with useful information for diagnosis. Furthermore, the invention may also be used to discriminate between different types of lung cancers.
Within the present invention, one or more differentially expressed nucleic acid molecules identified together represent a nucleic acid expression signature that is indicative for lung cancer through plasma sample. The term "expression signature", as used herein, denotes a set of nucleic acid molecules (e.g., miRNAs), wherein the expression level of the individual nucleic acid molecules differs between the plasma collected from lung cancer patient and the healthy control. Herein, a nucleic acid expression signature is also referred to as a set of markers and represents a minimum
number of (different) nucleic acid molecules, each encoding a miR A sequence that is capable for identifying a phenotypic state of an individual.
In a first aspect, the present invention relates to a diagnostic kit of molecular markers in blood for identifying adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of adenocarcinoma lung cancer.
The nucleic acid expression signature, as defined herein, may comprise at least twelve nucleic acid molecules, and preferably at least six nucleic acid molecules.
In preferred embodiment, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
The term "derived from tumor" or "tumor-related", as used herein, refers to signatures that differentially expressed in plasma from lung cancer patients and in control plasma and are also differentially expressed in lung cancer tissues cells and non-cancer tissue cells.
The lung cancer tissue cells, as used herein, refer to cancerous lung cells collected from dissections derived from the subjects to be diagnosed for the presence of lung cancer cancer. The non-cancer tissue cells, as used herein, typically denotes a (healthy) wild-type cell not having characteristics of such a cancerous phenotype.
The term "plasma-specific", as used herein, refers to signatures that are that differentially expressed in plasma from lung cancer patients and in control plasma are not found significantly differentially expressed in lung cancer tissues cells and non- cancer tissue cells.
Typically, the nucleic acid molecules comprised in the nucleic acid expression signature are human sequences (hereinafter designated "hsa" (Homo sapiens)).
In preferred embodiments, the nucleic acid expression signature of the diagnostic kit comprises any one or more of the nucleic acid molecules encoding tumor- related signatures: hsa-miR-638 (SEQ ID NO: l), hsa-miR-572 (SEQ ID NO:2) and plasma-specific signatures: hsa-miR-383 (SEQ ID NO:3), hsa-miR-1233 (SEQ ID NO:4, hsa-miR-545* (SEQ ID NO:5), hsa-miR-655 (SEQ ID NO:6), hsa-miR-19b-2* (SEQ ID NO:7), hsa-miR-548d-5p (SEQ ID NO:8), hsa-miR-190b (SEQ ID NO:9), hsa-miR-623 (SEQ ID NO: 10), hsa-miR-923 (SEQ ID NO: 11) and hsa-miR-1238 (SEQ ID NO:55).
The nucleic acid sequences of the above -referenced miRNAs are listed in Table
1.
TAB LE 1
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths- Jones S. et al. (2008) Nucl.
Acids Res. 36, D154-D158).
In more preferred embodiments, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-638, hsa-miR-572, hsa-miR-383, hsa-miR- 545*, hsa-miR-655, hsa-miR-19b-2*, hsa-miR-548d-5p, hsa-miR-190b, hsa-miR-623 and hsa-miR-923 is up-regulated; the expression of hsa-miR-1233 is down-regulated,
and hsa-miR-1238 is un-changed in the one or more target plasma from adenocarcinoma lung cancer patient compared to the one or more healthy control plasma.
The terms " at least one nucleic acid " as used herein, may relate to any subgroup of the plurality of nucleic acid molecules, e.g., any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, and so forth nucleic acid molecules, each encoding a microRNA sequence that are comprised in the nucleic acid expression signature, as defined herein.
In particularly preferred embodiments, the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-383/hsa-miR- 1233, hsa-miR-19b-2*/hsa-miR-1233, hsa-miR-548d-5p/hsa-miR-1233, hsa-miR-548d- 5p/hsa-miR-1233, hsa-miR-545*/hsa-miR-1233, hsa-miR-923/hsa-miR-483-3p, hsa- miR-638/hsa-miR-483 -3p, hsa-miR- 190b/hsa-miR- 1233, hsa-miR- 190b/hsa-miR- 1233 and hsa-miR-572/hsa-miR-1233.
The term "nucleic acid combinations", as used herein, refers to the usage of at least two nucleic acid expression levels as a whole. Preferably may use the relative changes or calculate results through a formulation as a whole.
The term "at least one of the nucleic acid combinations" as used herein, may relate to any subgroup of the plurality of nucleic acid combinations, e.g., any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, and so forth nucleic acid combinations, each comprised of at least two microRNA sequences that are comprised in the nucleic acid expression signature, as defined herein.
In a second aspect, the present invention relates to a diagnostic kit of molecular markers in blood for identifying squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of squamous cell lung cancer.
The nucleic acid expression signature, as defined herein, may comprise at least nineteen nucleic acid molecules, preferably at least six nucleic acid molecules.
In preferred embodiment, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa- miR-181a (SEQ ID NO: 12), hsa-miR-623 (SEQ ID NO: 10), hsa-miR-769-5p (SEQ ID NO: 13), hsa-miR-21 * (SEQ ID NO: 14), hsa-miR-572 (SEQ ID NO:2), hsa-miR-34b* (SEQ ID NO:15), hsa-miR-221 (SEQ ID NO: 16), hsa-miR-939 (SEQ ID NO: 17) and plasma-specific signatures: hsa-miR-654-5p (SEQ ID NO: 18), hsa-miR-432 (SEQ ID NO: 19), hsa-miR-194* (SEQ ID NO:20), hsa-miR-302a (SEQ ID NO:21), hsa-miR- 485-3p (SEQ ID NO:22), hsa-miR-654-3p (SEQ ID NO:23), hsa-miR-22 (SEQ ID NO:24), hsa-miR-423-5p (SEQ ID NO:25), hsa-miR-520d-3p (SEQ ID NO:26), hsa- miR-923 (SEQ ID NO: 11) and an internal stable control: hsa-miR-1238 (SEQ ID NO:55).
The nucleic acid sequences of the above -referenced miRNAs are listed in Table
2.
TAB LE 2
miRNA Sequence (5'→ 3')
hsa-miR-181a aacauucaacgcugucggugagu
hsa-miR-623 aucccuugcaggggcuguugggu
hsa-miR-769-5p ugagaccucuggguucugagcu
hsa-miR-572 guccgcucggcgguggccca
hsa-miR-21 * caacaccagucgaugggcugu
hsa-miR-34b* uaggcagugucauuagcugauug
hsa-miR-221 agcuacauugucugcuggguuuc
hsa-miR-939 uggggagcugaggcucugggggug
hsa-miR-654-5p uggugggccgcagaacaugugc
hsa-miR-432 ucuuggaguaggucauugggugg
hsa-miR-194* ccaguggggcugcuguuaucug
hsa-miR-485-3p gucauacacggcucuccucucu
hsa-miR-302a uaagugcuuccauguuuugguga
hsa-miR-654-3p uaugucugcugaccaucaccuu
hsa-miR-22 aagcugccaguugaagaacugu
hsa-miR-423-5p ugaggggcagagagcgagacuuu
hsa-miR-520d-3p aaagugcuucucuuuggugggu
hsa-miR-923 uggggagcugaggcucugggggug
hsa-miR-1238 cuuccucgucugucugcccc
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths- Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-181a, hsa-miR-623, hsa-miR-769-5p, hsa-miR-21 *, hsa- miR-572, hsa-miR-34b*, hsa-miR-221, hsa-miR-939, hsa-miR-432, hsa-miR-194*, hsa- miR-302a, hsa-miR-485-3p, hsa-miR-654-3p, hsa-miR-22, hsa-miR-423-5p, hsa-miR- 520d-3p, hsa-miR-923 is up-regulated; the expression of hsa-miR-654-5p is down- regulated; hsa-miR-1238 is un-changed in the one or more target plasma compared to the one or more healthy control plasma.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-194*/hsa-miR-654-5p, hsa-miR- 194*/hsa-miR-654-5p, hsa-miR-623/hsa-miR-654-5p, hsa-miR- 181 a/hsa-miR- 654-5p, hsa-miR-432/hsa-miR-654-5p, hsa-miR-520d-3p/hsa-miR-654-5p, hsa-miR- 302a/hsa-miR-654-5p, hsa-miR-423-5p/hsa-miR-654-5p and hsa-miR-221/hsa-miR- 654-5p.
In a third aspect, the present invention relates to a diagnostic kit of molecular markers in blood for identifying small cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma as compared to healthy control plasma, and wherein the differentially expressed signatures are derived from tumor-related or plasma-specific signatures, and wherein the one or more differentially expressed nucleic acid molecules
together represent a nucleic acid expression signature that is indicative for the presence of small cell lung cancer.
The nucleic acid expression signature, as defined herein, may comprise at least thirty-six nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least six nucleic acid molecules.
In preferred embodiment, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma from compared to the one or more healthy controls and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa- miR-375 (SEQ ID NO:27), hsa-miR-543 (SEQ ID NO:28), hsa-miR-139-3p (SEQ ID NO:29), hsa-miR-34b* (SEQ ID NO:15), hsa-miR-429 (SEQ ID NO:30), hsa-miR-361- 5p (SEQ ID NO:31), hsa-miR-130b (SEQ ID NO:32), hsa-miR-196a (SEQ ID NO:33), hsa-miR-200a (SEQ ID NO:34), hsa-miR-765 (SEQ ID NO:35), hsa-miR-33b* (SEQ ID NO:36), hsa-miR-106a (SEQ ID NO:37), hsa-miR-874 (SEQ ID NO:38), hsa-miR- 142-5p (SEQ ID NO:39) and plasma-specific signatures: hsa-miR-377 (SEQ ID NO:40), hsa-miR-136 (SEQ ID NO:41), hsa-miR-574-5p (SEQ ID NO:42), hsa-miR-767-3p (SEQ ID NO:43), hsa-miR-637 (SEQ ID NO:44), hsa-miR-548d-5p (SEQ ID NO:8), hsa-miR-485-3p (SEQ ID NO:22), hsa-miR-141 (SEQ ID NO:45), hsa-miR-520b (SEQ ID NO:46), hsa-miR-609 (SEQ ID NO:47), hsa-miR-423-5p (SEQ ID NO:25), hsa- miR-1233 (SEQ ID NO:4), hsa-miR-634 (SEQ ID NO: 18), hsa-miR-654-5p (SEQ ID NO:48), hsa-miR-138 (SEQ ID NO:49), hsa-miR-769-3p (SEQ ID NO:50), hsa-miR- 665 (SEQ ID NO:6), hsa-miR-501-5p (SEQ ID NO:51), hsa-let-7f (SEQ ID NO:52), hsa-miR-193b* (SEQ ID NO:53), hsa-miR-30d* (SEQ ID NO:54) and an internal stable control: hsa-miR-1238 (SEQ ID NO:55).
The nucleic acid sequences of the above -referenced miRNAs are listed in Table 3.
TAB LE 3
miRNA Sequence (5'→ 3') hsa-miR-375 uuuguucguucggcucgcgu hsa-miR-543 aaacauucgcggugcacuucuu hsa-miR-139-3p ggagacgcggcccuguuggagu hsa-miR-34b* uaggcagugucauuagcugauug hsa-miR-429 uaauacugucugguaaaaccgu hsa-miR-361-5p uuaucagaaucuccagggguac hsa-miR-130b cagugcaaugaugaaagggcau hsa-miR-196a uagguaguuucauguuguuggg hsa-miR-200a uaacacugucugguaacgaugu hsa-miR-765 uggaggagaaggaaggugaug hsa-miR-33b* cagugccucggcagugcagccc hsa-miR-106a aaaagugcuuacagugcagguag hsa-miR-874 cugcccuggcccgagggaccga hsa-miR-142-5p cauaaaguagaaagcacuacu hsa-miR-377 aucacacaaaggcaacuuuugu hsa-miR-136 acuccauuuguuuugaugaugga hsa-miR-574-5p ugagugugugugugugagugugu hsa-miR-767-3p ucugcucauaccccaugguuucu hsa-miR-637 acugggggcuuucgggcucugcgu hsa-miR-548d-5p aaaaguaauugugguuuuugcc hsa-miR-485-3p gucauacacggcucuccucucu hsa-miR-141 uaacacugucugguaaagaugg hsa-miR-520b aaagugcuuccuuuuagaggg hsa-miR-609 aggguguuucucucaucucu hsa-miR-423-5p ugaggggcagagagcgagacuuu hsa-miR-1233 ugagcccuguccucccgcag hsa-miR-634 aaccagcaccccaacuuuggac hsa-miR-654-5p uggugggccgcagaacaugugc hsa-miR-138 agcugguguugugaaucaggccg hsa-miR-769-3p cugggaucuccggggucuugguu hsa-miR-665 accaggaggcugaggccccu hsa-miR-501-5p aauccuuugucccugggugaga hsa-let-7f ugagguaguagauuguauaguu
hsa-miR-193b* cgggguuuugagggcgagauga
hsa-miR-30d* cuuucagucagauguuugcugc
hsa-miR-1238 cuuccucgucugucugcccc
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths- Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-543, hsa-miR-34b*, hsa-miR-429, hsa-miR- 361-5p, hsa-miR-130b, hsa-miR-196a, hsa-miR-200a, hsa-miR-765, hsa-miR-377, hsa- miR-136, hsa-miR-574-5p, hsa-miR-548d-5p, hsa-miR-485-3p, hsa-miR-141 , hsa-miR- 520b, hsa-miR-609, hsa-miR-423-5p is up-regulated; the expression of any one or more of the nucleic acid molecules encoding hsa-miR-139-3p, hsa-miR-33b*, hsa-miR-767- 3p, hsa-miR-637, hsa-miR-106a, hsa-miR-874, hsa-miR-142-5p, hsa-miR-1233, hsa- miR-634, hsa-miR-654-5p, hsa-miR-138, hsa-miR-769-3p, hsa-miR-665, hsa-miR-501- 5p, hsa-let-7f, hsa-miR- 193b*, hsa-miR-30d* is down-regulated and hsa-miR-1238 is un-changed in the one or more target plasma compared to the one or more healthy control plasma.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-520b/hsa-miR-139-3p, hsa-miR-375/hsa-miR-l 06a, hsa-miR- 196a/hsa-miR-l 39-3p, hsa-miR-375/hsa-miR- 193b*, hsa-miR-609/hsa-miR-139-3p, hsa-miR- 136/hsa-miR-139-3p, hsa-miR-377/hsa- miR-637, hsa-miR-375/hsa-miR-637, hsa-miR-200a/hsa-miR-637, hsa-miR-520b/hsa- miR-637, hsa-miR-429/hsa-miR-637, hsa-miR-548d-5p/hsa-miR-139-3p, hsa-miR- 375/hsa-miR-1233, hsa-miR-543/hsa-miR-637, hsa-miR-375/hsa-miR-874, hsa-miR- 196b/hsa-miR-637, hsa-miR- 136/hsa-miR-637, hsa-miR-136/hsa-miR-637, hsa-miR- 574-5p/hsa-miR-637, hsa-miR- 130b/hsa-miR-634, hsa-miR-361-5p/hsa-miR-634, hsa- miR-765/hsa-miR-634, hsa-miR- 130b/hsa-miR-767-3p, hsa-miR-361-5p/hsa-miR-767- 3p, hsa-miR-485-3p/hsa-miR-767-3p and hsa-miR-520b/hsa-miR-767-3p.
In a fourth aspect, the present invention relates to a diagnostic kit of molecular markers in blood for discriminating different types of lung cancer, the kit comprising a
plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in plasma of different types of lung cancer as well as in healthy controls, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of different types of lung cancer, wherein the different types of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
In one embodiment, the nucleic acid expression signatures in blood, as defined herein, are differently expressed in adenocarcinoma lung cancer from healthy controls, squamous cell lung cancer and small cell lung cancer. The nucleic acid expression signature, as defined herein, may comprise at least three nucleic acid molecules.
In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, squamous cell lung cancer and small cell lung cancer.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-383 (SEQ ID NO:3), hsa-miR-545* (SEQ ID NO:5) and hsa-miR-19b-2* (SEQ ID NO:7).
The nucleic acid sequences of the above -referenced miRNAs are listed in Table
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths- Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-383, hsa-miR-545*, hsa-miR-19b-2* is up-regulated in
the one or more target plasma compared to the one or more healthy controls, squamous cell lung cancer and small cell lung cancer.
In another embodiment, the nucleic acid expression signatures in blood, as defined herein, are differently expressed in squamous cell lung cancer from healthy controls, adenocarcinoma lung cancer and small cell lung cancer. The nucleic acid expression signature, as defined herein, may comprise at least three nucleic acid molecules.
In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microR A sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-194* (SEQ ID NO:20), hsa-miR-302a (SEQ ID NO:21), hsa-miR-432 (SEQ ID NO: 19).
The nucleic acid sequences of the above -referenced miRNAs are listed in Table
5.
TAB LE 5
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths- Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-194*, hsa-miR-302a, hsa-miR-432 is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
In another embodiment, the nucleic acid expression signatures in blood, as defined herein, are differently expressed in small cell lung cancer from healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer. The nucleic acid
expression signature, as defined herein, may comprise at least twelve nucleic acid molecules, preferably at least five nucleic acid molecules.
In preferred embodiments, the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer, and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down- regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-574-5p (SEQ ID NO:42), hsa-miR-375 (SEQ ID NO:27), hsa-miR-543 (SEQ ID NO:28), hsa-miR-196a (SEQ ID NO:33), hsa-miR-139-3p (SEQ ID NO:29), hsa-miR-106a (SEQ ID NO:37), hsa-miR-361-5p (SEQ ID NO:31), hsa-miR-141 (SEQ ID NO:45), hsa-miR-765 (SEQ ID NO:35), hsa-miR-609 (SEQ ID NO:47), hsa-miR-520b (SEQ ID NO:46) and hsa- miR-769-3p (SEQ ID NO:50).
The nucleic acid sequences of the above -referenced miRNAs are listed in Table
6.
TAB LE 6
miRNA Sequence (5'→ 3')
hsa-miR-574-5p ugagugugugugugugagugugu
hsa-miR-375 uuuguucguucggcucgcgu
hsa-miR-543 aaacauucgcggugcacuucuu
hsa-miR-196a uagguaguuucauguuguuggg
hsa-miR-139-3p ggagacgcggcccuguuggagu
hsa-miR-106a aaaagugcuuacagugcagguag
hsa-miR-361-5p uuaucagaaucuccagggguac
hsa-miR-141 uaacacugucugguaaagaugg
hsa-miR-765 uggaggagaaggaaggugaug
hsa-miR-609 aggguguuucucucaucucu
hsa-miR-520b aaagugcuuccuuuuagaggg
hsa-miR-769-3p cugggaucuccggggucuugguu
All miR A sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths- Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).
Particular preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a, hsa- miR-361-5p, hsa-miR-141, hsa-miR-765, hsa-miR-609, hsa-miR-520b is up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR- 139-3p, hsa-miR-106a, hsa-miR-769-3p is down-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
In a fifth aspect, the present invention relates to a method for identifying one or more target plasma exhibiting lung cancer, the method comprising: (a) determining in the one or more target plasma the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence; (b) determining the expression levels of the plurality of nucleic acid molecules in one or more healthy control plasma; and (c) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control plasma by comparing the respective expression levels obtained in steps (a) and (b), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature, as defined herein, that is indicative for the presence of lung cancer.
In preferred embodiments of the invention, the method comprising: (a) determining in the one or more target plasma the expression levels of a combination of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, and calculate with certain formula, then; (b) determining the expression levels of the combination of nucleic acid molecules in healthy control plasma, and calculate with certain formula; and (c) identifying the difference of the combination in the one or more target and control plasma by comparing the respective calculation results obtained in steps (a) and (b), wherein the one or more differentially expressed combinations
together represent a signature, as defined herein, that is indicative for the presence of lung cancer.
In more preferred embodiments of the invention, the method is for the further use of discriminating adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
In a seventh aspect, the present invention relates to a method for preventing or treating lung cancer, the method comprising: (a) identifying in plasma a nucleic acid expression signature by using a method, as defined herein; and (b) modifying in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression is up-regulated in plasma is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in plasma is up-regulated.
The term "modifying the expression of a nucleic acid molecule encoding a miRNA sequence", as used herein, denotes any manipulation of a particular nucleic acid molecule resulting in an altered expression level of said molecule, that is, the production of a different amount of corresponding miRNA as compared to the expression of the "wild-type" (i.e. the unmodified control). The term "different amount", as used herein, includes both a higher amount and a lower amount than determined in the unmodified control. In other words, a manipulation, as defined herein, may either up-regulate (i.e. activate) or down-regulate (i.e. inhibit) the expression (i.e. particularly transcription) of a nucleic acid molecule.
Within the present invention, expression of one or more nucleic acid molecules encoding a microRNA sequence comprised in the nucleic acid expression signature is modified in such way that the expression of a nucleic acid molecule whose expression is up-regulated in plasma is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in plasma is up-regulated. In other words, the modification of expression of a particular nucleic acid molecule encoding a miRNA sequence occurs in an anti-cyclical pattern to the regulation of said molecule in plasma of cancer patients in order to interfere with the "excess activity" of an up-regulated
molecule and/or to restore the "deficient activity" of a down-regulated molecule in plasma.
In a preferred embodiment of the inventive method, down-regulating the expression of a nucleic acid molecule comprises introducing into the patient a nucleic acid molecule encoding a sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated.
The term "introducing into blood", as used herein, refers to any manipulation allowing the transfer of one or more nucleic acid molecules into blood. Examples of such techniques include injection, digestion or any other techniques may be involved.
The term "complementary sequence", as used herein, is to be understood that the
"complementary" nucleic acid molecule (herein also referred to as an "anti-sense nucleic acid molecule") introduced into blood is capable of forming base pairs, preferably Watson-Crick base pairs, with the up-regulated endogenous "sense" nucleic acid molecule.
Two nucleic acid molecules (i.e. the "sense" and the "anti-sense" molecule) may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides. In other embodiments, the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions). In further embodiments, the "complementary" nucleic acid molecule comprises a stretch of at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in the up-regulated "sense" nucleic acid molecule.
The "complementary" nucleic acid molecule (i.e. the nucleic acid molecule encoding a nucleic acid sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated) may be a naturally occurring DNA- or RNA molecule or a synthetic nucleic acid molecule comprising in its sequence one or more modified nucleotides which may be of the same type or of one or more different types.
For example, it may be possible that such a nucleic acid molecule comprises at least one ribonucleotide backbone unit and at least one deoxyribonucleotide backbone unit. Furthermore, the nucleic acid molecule may contain one or more modifications of
the RNA backbone into 2'-O-methyl group or 2'-O-methoxyethyl group (also referred to as "2'-O-methylation"), which prevented nuclease degradation in the culture media and, importantly, also prevented endonucleolytic cleavage by the RNA-induced silencing complex nuclease, leading to irreversible inhibition of the miRNA. Another possible modification - which is functionally equivalent to 2'-O-methylation - involves locked nucleic acids (LNAs) representing nucleic acid analogs containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA-mimicking sugar conformation (Oram, U.A. et al. (2006) Gene 372, 137-141).
Another class of silencers of miRNA expression was recently developed. These chemically engineered oligonucleotides, named "antagomirs", represent single-stranded 23-nucleotide RNA molecules conjugated to cholesterol (Krutzfeldt, J. et al. (2005) Nature 438, 685-689). As an alternative to such chemically modified oligonucleotides, microRNA inhibitors that can be expressed in cells, as RNAs produced from transgenes, were generated as well. Termed "microRNA sponges", these competitive inhibitors are transcripts expressed from strong promoters, containing multiple, tandem binding sites to a microRNA of interest (Ebert, M.S. et al. (2007) Nat. Methods 4, 721-726).
In particularly preferred embodiments of the inventive method, the one or more nucleic acid molecules whose expression is to be down-regulated encode microRNA sequences selected from:
(a) the group consisting of hsa-miR-638, hsa-miR-572, hsa-miR-383, hsa- miR-545*, hsa-miR-655, hsa-miR-190b, hsa-miR-19b-2*, hsa-miR- 548d-5p, hsa-miR-623, and hsa-miR-923 with respect to the expression signature, presumably indicative for lung adenocarcinoma as defined above; and/or
(b) the group consisting of hsa-miR-181a, hsa-miR-769-5p, hsa-miR-21 * , hsa-miR-34b*, hsa-miR-221 , hsa-miR-623, hsa-miR-572, hsa-miR-939, hsa-miR-194*, hsa-miR-485-3p, hsa-miR-302a, hsa-miR-432, hsa-miR- 654-3p, hsa-miR-520d-3p, hsa-miR-923, hsa-miR-22, hsa-miR-423-5p with respect to the expression signature presumably indicative for lung squamous cell carcinoma as defined above; and/or
(c) the group consisting of hsa-miR-375, hsa-miR-34b*, hsa-miR-429, hsa- miR-543, hsa-miR-200a, hsa-miR-361-5p, hsa-miR-130b, hsa-miR-196a, hsa-miR-765, hsa-miR-377, hsa-miR-141, hsa-miR-548d-5p, hsa-miR- 609, hsa-miR-136, hsa-miR-485-3p, hsa-miR-574-5p, hsa-miR-520b and hsa-miR-423-5p with respect to the expression signature presumably indicative for lung small cell carcinoma as defined above.
In a further preferred embodiment of the inventive method, up-regulating the expression of a nucleic acid molecule comprises introducing into blood a nucleic acid molecule encoding the microRNA sequence encoded by nucleic acid molecule to be up- regulated. In other words, the up-regulation of the expression of a nucleic acid molecule encoding a miRNA sequence is accomplished by introducing into the one or more cells another copy of said miRNA sequence (i.e. an additional "sense" nucleic acid molecule). The "sense" nucleic acid molecule to be introduced into blood may comprise the same modification as the "anti-sense" nucleic acid molecules described above.
In a particularly preferred embodiment, the one or more nucleic acid molecules whose expression is to be up-regulated encode microRNA sequences selected from:
(a) hsa-miR- with respect to the expression signature, presumably indicative for lung adenocarcinoma as defined above; and/or
(b) hsa-miR-654-5p with respect to the expression signature presumably
indicative for lung squamous cell carcinoma as defined above; and/or
(c) the group consisting of hsa-miR-33b*, hsa-miR-139-3p, hsa-miR-874, hsa-miR-106a, hsa-miR- 142-5p, hsa-let-7f , hsa-miR-767-3p, hsa-miR- 637, hsa-miR-654-5p, hsa-miR-665, hsa-miR-501-5p, hsa-miR-138, hsa- miR-1233, hsa-miR-30d*, hsa-miR-193b, hsa-miR-769-3p and hsa-miR- 634 with respect to the expression signature presumably indicative for lung small cell carcinoma as defined above.
The "sense" and/or the "anti-sense" nucleic acid molecules to be introduced into blood in order to modify the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature may be operably linked to a regulatory sequence in order to allow expression of the nucleotide sequence.
In order to unravel any potential implication of the miRNAs identified in the cancerous or pre-cancerous samples preliminary functional analyses may be performed with respect to the identification of mRNA target sequences to which the miRNAs may bind. Based on the finding that miRNAs may be involved in both tumor suppression and tumorigenesis (Esquela-Kerscher, A. and Slack, F.J (2006) supra; Calin, G.A. and Croce, CM. (2007) supra; Blenkiron, C. and Miska, E.A. (2007) supra) it is likely to speculate that mRNA target sites for such miRNAs include tumor suppressor genes as well as oncogenes.
A nucleic acid molecule is referred to as "capable of expressing a nucleic acid molecule" or capable "to allow expression of a nucleotide sequence" if it comprises sequence elements which contain information regarding to transcriptional and/or translational regulation, and such sequences are "operably linked" to the nucleotide sequence encoding the polypeptide. An operable linkage is a linkage in which the regulatory sequence elements and the sequence to be expressed (and/or the sequences to be expressed among each other) are connected in a way that enables gene expression.
The precise nature of the regulatory regions necessary for gene expression may vary among species, but in general these regions comprise a promoter which, in prokaryotes, contains both the promoter per se, i.e. DNA elements directing the initiation of transcription, as well as DNA elements which, when transcribed into RNA, will signal the initiation of translation. Such promoter regions normally include 5' non- coding sequences involved in initiation of transcription and translation, such as the -35/- 10 boxes and the Shine -Dalgarno element in prokaryotes or the TATA box, CAAT sequences, and 5'-capping elements in eukaryotes. These regions can also include enhancer or repressor elements as well as translated signal and leader sequences for targeting the native polypeptide to a specific compartment of a host cell. In addition, the 3' non-coding sequences may contain regulatory elements involved in transcriptional termination, polyadenylation or the like. If, however, these termination sequences are not satisfactory functional in a particular host environment, then they may be substituted with signals functional in that environment.
Furthermore, the expression of the nucleic molecules, as defined herein, may also be influenced by the presence, e.g., of modified nucleotides (cf. the discussion
above). For example, locked nucleic acid (LNA) monomers are thought to increase the functional half-life of miR As in vivo by enhancing the resistance to degradation and by stabilizing the miRNA-target duplex structure that is crucial for silencing activity (Naguibneva, I. et al. (2006) Biomed Pharmacother 60, 633-638).
Therefore, a nucleic acid molecule of the invention to be introduced into blood provided may include a regulatory sequence, preferably a promoter sequence, and optionally also a transcriptional termination sequence. The promoters may allow for either a constitutive or an inducible gene expression. Suitable promoters include inter alia the E. coli lac\TV5 and tet (tetracycline-responsive) promoters, the T7 promoter as well as the SV40 promoter or the CMV promoter.
The nucleic acid molecules of the invention may also be comprised in a vector or other cloning vehicles, such as plasmids, phagemids, phages, cosmids or artificial chromosomes. In a preferred embodiment, the nucleic acid molecule is comprised in a vector, particularly in an expression vector. Such an expression vector can include, aside from the regulatory sequences described above and a nucleic acid sequence encoding a genetic construct as defined in the invention, replication and control sequences derived from a species compatible with the host that is used for expression as well as selection markers conferring a selectable phenotype on host. Large numbers of suitable vectors such as pSUPER and pSUPERIOR are known in the art, and are commercially available.
In an eighth aspect, the present invention relates to a pharmaceutical composition for the prevention and/or treatment of lung cancer in blood, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated in plasma from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down- regulated in plasma from lung cancer patients, as defined herein.
Finally, in a ninth aspect, the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of lung cancer.
Within the scope of the present invention, suitable pharmaceutical compositions include inter alia those compositions suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), peritoneal and parenteral (including intramuscular, subcutaneous and intravenous) administration, or for administration by inhalation or insufflation. Administration may be local or systemic. Preferably, administration is accomplished via the oral or intravenous routes. The formulations may also be packaged in discrete dosage units.
Pharmaceutical compositions according to the present invention include any pharmaceutical dosage forms established in the art, such as inter alia capsules, microcapsules, cachets, pills, tablets, powders, pellets, multi-particulate formulations (e.g., beads, granules or crystals), aerosols, sprays, foams, solutions, dispersions, tinctures, syrups, elixirs, suspensions, water-in-oil emulsions such as ointments, and oil- in water emulsions such as creams, lotions, and balms.
The ("sense" and "anti-sense") nucleic acid molecules described above can be formulated into pharmaceutical compositions using pharmacologically acceptable ingredients as well as established methods of preparation (Gennaro, A.L. and Gennaro, A.R. (2000) Remington: The Science and Practice of Pharmacy, 20th Ed., Lippincott Williams & Wilkins, Philadelphia, PA; Crowder, T.M. et al. (2003 ) A Guide to Pharmaceutical Particulate Science. Interpharm/CRC, Boca Raton, FL; Niazi, S.K. (2004) Handbook of Pharmaceutical Manufacturing Formulations, CRC Press, Boca Raton, FL).
In order to prepare the pharmaceutical compositions, pharmaceutically inert inorganic or organic excipients (i.e. carriers) can be used. To prepare e.g. pills, tablets, capsules or granules, for example, lactose, talc, stearic acid and its salts, fats, waxes, solid or liquid polyols, natural and hardened oils may be used. Suitable excipients for the production of solutions, suspensions, emulsions, aerosol mixtures or powders for reconstitution into solutions or aerosol mixtures prior to use include water, alcohols, glycerol, polyols, and suitable mixtures thereof as well as vegetable oils.
The pharmaceutical composition may also contain additives, such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect. The
latter is to be understood that the nucleic acid molecules may be incorporated into slow or sustained release or targeted delivery systems, such as liposomes, nanoparticles, and microcapsules.
To target most tissues within the body, clinically feasible noninvasive strategies are required for directing such pharmaceutical compositions, as defined herein, into cells. In the past years, several approaches have achieved impressive therapeutic benefit following intravenous injection into mice and primates using reasonable doses of siR As without apparent limiting toxicities.
One approach involves covalently coupling the passenger strand (miRNA* strand) of the miRNA to cholesterol or derivatives/conjugates thereof to facilitate uptake through ubiquitously expressed cell-surface LDL receptors (Soutschek, J. et al.
(2004) Nature 432, 173-178). Alternatively, unconjugated, PBS-formulated locked- nucleic-acid-modified oligonucleotides (LNA-antimiR) may be used for systemic delivery (Elmen, J. et al. (2008) Nature 452, 896-899). Another strategy for delivering miRNAs involves encapsulating the miRNAs into specialized liposomes formed using polyethylene glycol to reduce uptake by scavenger cells and enhance time spent in the circulation. These specialized nucleic acid particles (stable nucleic acid-lipid particles or SNALPs) delivered miRNAs effectively to the liver (and not to other organs (Zimmermann, T.S. et al. (2006) Nature 441, 111-1 14). Recently, a new class of lipid- like delivery molecules, termed lipidoids (synthesis scheme based upon the conjugate addition of alkylacrylates or alkyl-acrylamides to primary or secondary amines) has been described as delivery agents for RNAi therapeutics (Akinc, A. et al. (2008) Nat Biotechnol 26, 561-569).
A further targeting strategy involves the mixing of miRNAs with a fusion protein composed of a targeting antibody fragment linked to protamine, the basic protein that nucleates DNA in sperm and binds miRNAs by charge (Song, E. et al.
(2005) Nat. Biotechnol. 23, 709-717). Multiple modifications or variations of the above basic delivery approaches have recently been developed. These techniques are known in the art and reviewed, e.g., in de Fougerolles, A. et al. (2007) Nat. Rev. Drug Discov 6, 443-453; Kim, D.H. and Rossi, J.J. (2007) Nat Genet 8, 173-184).
The invention is further described by the figures and the following examples,
which are solely for the purpose of illustrating specific embodiments of this invention, and are not to be construed as limiting the scope of the invention in any way.
EXAMPLES
Example 1 : Tissue sample collection and preparation
Ninety-one lung cancer tissue specimens were taken during surgery. Surgical specimens were snap-frozen in liquid nitrogen at or immediately after collection. Samples were stored at -80°C. Baseline characteristics of the tumor specimens used in the invention are shown in Table 7.
Table 7
Baseline characteristics of the tissue specimens in the invention
Patient data (age, sex, imaging data, therapy, other medical conditions, family history, and the like) were derived from the hospital databases for matching the various samples collected. Pathologic follow-up (for example, histological analysis via hematoxylin and eosin (H&E) staining) was used for evidently determining the disease state of a given sample as well as to ensure a consistent classification of the specimens.
Laser-capture micro-dissection was optionally performed for each cancerous sample in order to specifically isolate tumor cell populations (about 200.000 cells). In brief, a transparent transfer film is applied to the surface of a tissue section or specimen. Under a microscope, the thin tissue section is viewed through the glass slide on which it is mounted and clusters of cells are identified for isolation. When the cells of choice are in the center of the field of view, a near IR laser diode integral with the microscope
optics is activated. The pulsed laser beam activates a spot on the transfer film, fusing the film with the underlying cells of choice. The transfer film with the bonded cells is then lifted off the thin tissue section (Emmert-Buck, M.R. et al. (1996) Science 274, 998-1001; Espina, V. et al. (2007) Expert Rev Mol Diagn 7, 647-657). The preparation of the cryostat sections and the capturing step using a laser capture microspope (Arcturus Veritas™ Laser Capture Microdissection Instrument (Molecular Devices, Inc., Sunnyvale, CA, USA) were performed essentially according to the instructions of the manufacturer.
Total RNA was extracted from the tissue sections by using mirVana miRNA isolation kit according to the instructions from the manufacturer (Ambion, Austin, TX). The concentration was quantified by NanoDrop 1000 Spectrophotometer (NanoDrop Technologies, Waltham, MA). The quality control of RNA was performed by a 2100 Bioanalyzer using the RNA 6000 Pico LabChip kit (Agilent Technologies, Santa Clara, CA).
Example 2: Analysis of the miRNA expression profile in the tissue samples
A qualitative analysis of the miRNAs (differentially) expressed in a particular sample may optionally be performed using the Agilent miRNA microarray platform (Agilent Technologies, Santa Clara, CA, USA). The microarray contains probes for 723 human miRNAs from the Sanger database v.10.1. Total RNA (100 ng) derived from each of 91 LCM-selected lung tissues were used as inputs for labeling via Cy3 incorporation. Microarray slides were scanned by XDR Scan (PMT100, PMT5). The labeling and hybridization were performed according to the protocols in the Agilent miRNA microarray system.
For the data analysis, the raw data obtained for single-color (CY3) hybridization were normalized by applying a Quantile method and using GeneSpring GX10 software (Agilent Technologies, Santa Clara, CA, USA) known in the art. Unpaired t-test (p value < 0.01) after Fisher test (F-test) was used to identify differentially expressed miRNAs between lung cancer and normal lung tissues.
Independent experiments on 91 tissue specimens were performed for each measurement and the miRNA expression level determined represents the mean value of
the respective individual data obtained.
Example 3 : Plasma sample collection and preparation
The principal method steps for identifying lung cancer in the target plasma are shown in Figure 1.
Fifty-nine blood specimens from the lung cancer patients and healthy individuals were collected at Zhongshan Hospital in Shanghai between 2008 and 2009. Baseline characteristics of the blood specimens used in the invention are shown in Table 8. All of the samples from the patients were procured before surgery. Patient data (age, sex, imaging data, therapy, other medical conditions, family history, and the like) were derived from the hospital databases. Tumor histopathology was classified according to the World Health Organization Classification of Tumor system by three pathologists independently.
Table 8
Baseline characteristics of blood specimens in the invention
Peripheral blood (2 ml) was drawn into EDTA tubes. Within two hours, the tubes were subjected to centrifuge at 820g for 10 min. Then, 1ml aliquots of the plasma was transferred to 1.5 ml tubes and centrifuged at 16,000g for 10 min to pellet any remaining cellular debris. Subsequently, the supernatant was transferred to fresh tubes and stored them at -80 °C.
Total RNA was extracted from the plasma by using mirVana PARIS miRNA
Isolation kit according to the instructions from the manufacturer (Ambion, Austin, TX). The concentration was quantified by NanoDrop 1000 Spectrophotometer (NanoDrop Technologies, Waltham, MA). The quality control of RNA was performed by a 2100 Bioanalyzer using the RNA 6000 Pico LabChip kit (Agilent Technologies, Santa Clara, CA).
Example 4: Analysis of the miRNA expression profile in the plasma samples
A qualitative analysis of the miRNAs (differentially) expressed in a particular plasma sample may optionally be performed using the Agilent miRNA microarray platform (Agilent Technologies, Santa Clara, CA, USA). The microarray contains probes for 723 human miRNAs from the Sanger database v.10.1. Total RNA (100 ng) derived from each of 59 plasma specimens were used as inputs for labeling via Cy3 incorporation. Microarray slides were scanned by XDR Scan (PMT100, PMT5). The labeling and hybridization were performed according to the protocols in the Agilent miRNA microarray system.
For the data analysis, the raw data obtained for single-color (CY3) hybridization were normalized by applying an internal stable control has-miR-1238. Unpaired t-test after Fisher test (F-test) was used to identify differentially expressed miRNAs between lung cancer vs. healthy controls or other types of lung cancer, respectively.
For the specificity and sensitivity of the individual miRNA as diagnostic biomarkers, MedCalc software was used to perform receiver operating characteristic (ROC) curve analysis of the individual miRNA in the healthy individuals vs. primary HCC or metastatic liver cancer, and controls (healthy individuals, colorectal and lung cancers) vs. primary HCC, respectively. 95% confidence interval was used to determine the significance.
For assessing whether a particular miRNA is differentially expressed in lung cancer as compared to healthy controls or other types of lung cancer the following criteria were used:
i) p-value (probability value) of < 0.05 with an > 2-fold change ii) AUC (accuracy as a diagnostic biomarker) AUC of > 0.700
In case, the two criteria were fulfilled, the miRNA was considered to be
differentially expressed in lung cancer patients as compared to healthy controls, and/or other types of lung cancer, respectively
Independent experiments on 59 plasma samples were performed for each measurement and the miRNA expression level determined represents the mean value of 5 the respective individual data obtained.
The expression data on the preferred expression signatures in the first aspect for identifying adenocarcinoma lung cancer from healthy controls are summarized in Table 9-11 below. Table 9 lists tumor-related miRNA signatures exhibiting significantly differential expressions in both tissue and plasma of patients with adenocarcinoma lung
10 cancer, Table 10 summarizes plasma-specific miRNA signatures exhibiting
significantly differential expressions only in plasma of patients with adenocarcinoma lung cancer, whereas Table 11 lists the best combinations of the miRNA signatures for adenocarcinoma lung cancer. In the column "t" denotes the lung cancer tissue, and "n" denotes match normal control tissue, whereas "p" denotes the patient plasma and "h"
15 denotes healthy control plasma. Particularly preferred miRNAs (SEQ ID NO: 1 to SEQ
ID NO: 2 in Table 9; SEQ ID NO: 3 to SEQ ID NO: 10 in Table 2, respectively) are shown in bold.
TABLE 9
Tumor -related miRNA signatures in plasma of adenocarcinoma lung cancer
20
TABLE 10
Plasma-specific miRNA signatures for adenocarcinoma lung cancer
Name t-test fold ROC analysis
p-value p/h Sensitivity Specificity AUC 95% CI hsa-miR-383 5.0E-07 17.4 84 83 0.899 0.767 to 0.971 hsa-miR-1233 3.0E-03 0.2 63 87 0.730 0.571 to 0.855 hsa-miR-545* 3.2E-03 7.7 79 70 0.720 0.560 to 0.847
hsa-miR-655 6.9E-03 5.5 84 65 0.716 0.556 to 0.844 hsa-miR-19b-2* 3.1E-03 5.0 84 57 0.746 0.588 to 0.867 hsa-miR-548d-5p 5.3E-03 4.4 90 53 0.714 0.554 to 0.843 hsa-miR-190b 1.5E-02 3.8 68 83 0.799 0.646 to 0.906 hsa-miR-623 1.3E-02 2.4 84 65 0.755 0.598 to 0.874 hsa-miR-923 4.6E-02 2.3 74 78 0.716 0.556 to 0.844
TABLE 11
Combined miRNA signatures in plasma of adenocarcinoma lung cancer
5 The expression data on the preferred expression signatures in the second aspect
for identifying squamous cell lung cancer from healthy controls are summarized in Table 12-14 below. Table 12 lists tumor-related miRNA signatures exhibiting significantly differential expressions in both tissue and plasma of patients with squamous cell lung cancer, Table 13 summarizes plasma- specific miRNA signatures
10 exhibiting significantly differential expressions only in plasma of patients with
squamous cell lung cancer, whereas Table 14 lists the best combinations of the miRNA signatures for squamous cell lung cancer. In the column "t" denotes the lung cancer tissue, and "n" denotes match normal control tissue, whereas "p" denotes the patient plasma and "h" denotes the healthy control plasma. Particularly preferred miRNAs
15 (SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13 in Table 12; SEQ ID NO: 18 to
SEQ ID NO: 20 in Table 13, respectively) are shown in bold.
TABLE 12
Tumor -related miRNA signatures in plasma of squamous cell lung cancer
TABLE 13
5 Plasma-specific miRNA signatures for squamous cell lung cancer
TABLE 14
Combined miRNA signatures in plasma of squamous cell lung cancer
Name Sensitivity Specificity AUC 95% CI hsa-miR- 194*/hsa-miR-654-5p 100 61 0.854 0.688 to 0.952 hsa-miR-623/hsa-miR-654-5p 90 74 0.843 0.675 to 0.946 hsa-miR- 181 a/hsa-miR-654-5p 90 74 0.839 0.670 to 0.943 hsa-miR-432/hsa-miR-654-5p 90 61 0.826 0.655 to 0.935
hsa-miR-520d-3p/hsa-miR-654-5p 90 70 0.809 0.634 to 0.924 hsa-miR-302a/hsa-miR-654-5p 80 78 0.807 0.632 to 0.923 hsa-miR-423-5p/hsa-miR-654-5p 70 83 0.804 0.630 to 0.921 hsa-miR-22 l/hsa-miR-654-5p 80 74 0.802 0.627 to 0.920
The expression data on the preferred expression signatures in the third aspect for identifying small cell lung cancer from healthy controls are summarized in Table 15-17 below. Table 15 lists tumor-related miRNA signatures exhibiting significantly 5 differential expressions in both tissue and plasma of small cell lung cancer, Table 16
summarizes plasma-specific miRNA signatures exhibiting significantly differential expressions only in plasma of patients with small cell lung cancer, whereas Table 17 lists the best combinations of the miRNA signatures for small cell lung cancer. In the column "t" denotes the lung cancer tissue, and "n" denotes match normal control tissue, 10 whereas "p" denotes the patient plasma and "h" denotes the healthy control plasma.
Particularly preferred miRNAs (SEQ ID NO: 27 to SEQ ID NO: 29, SEQ ID NO: 15, SEQ ID NO: 30 to SEQ ID NO: 36 in Table 15; SEQ ID NO: 40 to SEQ ID NO: 44 in Table 16, respectively) are shown in bold.
TABLE 15
15 Tumor -related miRNA signatures in plasma of small cell lung cancer
Name Tissue Plasma
t-test fold t-test Fold ROC analysis
p -value t/n p -value p/h Sensitivity Specificity AUC 95% CI hsa-miR-375 5.2E-20 36.9 9.2E-04 47.6 86 96 0.882 0.712 to 0.970 hsa-miR-543 2.7E-02 3.1 2.5E-03 12.6 100 70 0.882 0.712 to 0.970 hsa-miR-139-3p 2.8E-04 0.3 2.8E-02 0.1 71 96 0.87 0.696 to 0.964 hsa-miR-34b* 3.5E-03 0.2 8.7E-07 16.7 71 96 0.866 0.693 to 0.962 hsa-miR-429 1.1E-09 5.9 4.9E-03 13.1 86 70 0.851 0.674 to 0.954 hsa-miR-361-5p 1.1E-02 2.0 2.5E-02 6.3 100 57 0.851 0.674 to 0.954 hsa-miR-130b 1.3E-15 23.4 2.7E-02 5.1 86 70 0.820 0.637 to 0.935 hsa-miR-196a 7.1E-03 8.3 1.8E-03 4.0 71 83 0.807 0.623 to 0.928 hsa-miR-200a 3.5E-04 4.4 1.9E-02 9.7 86 70 0.804 0.619 to 0.926 hsa-miR-765 2.6E-02 0.5 3.1E-03 3.5 57 100 0.789 0.602 to 0.916 hsa-miR-33b* 3.3E-03 0.5 1.0E-03 0.4 100 78 0.907 0.744 to 0.982 hsa-miR-106a 4.5E-06 3.8 5.0E-03 0.1 86 83 0.773 0.584 to 0.905 hsa-miR-874 9.2E-07 0.5 2.8E-02 0.1 71 96 0.708 0.514 to 0.859 hsa-miR-142-5p 3.2E-07 0.2 1.8E-02 0.1 57 96 0.702 0.508 to 0.854
TABLE 16
Plasma-specific miRNA signatures for small cell lung cancer
TABLE 17
Combined miRNA signatures in plasma of small cell lung cancer
Name Sensitivity Specificity AUC 95% CI hsa-miR-520b/hsa-miR- 139-3p 100 91 0.975 0.841 to 1.000 hsa-miR-361 -5p/hsa-miR-634 100 96 0.969 0.831 to 0.999 hsa-miR-361 -5p/hsa-miR-767-3p 100 83 0.963 0.822 to 0.999 hsa-miR-375/hsa-miR- 106a 100 78 0.963 0.822 to 0.999 hsa-miR- 196a/hsa-miR- 139-3p 86 91 0.938 0.786 to 0.993 hsa-miR-375/hsa-miR- 193b* 100 78 0.935 0.781 to 0.992 hsa-miR-765/hsa-miR-634 100 74 0.932 0.777 to 0.991 hsa-miR- 136/hsa-miR- 139-3p 86 87 0.932 0.777 to 0.991 hsa-miR-609/hsa-miR- 139-3p 100 74 0.932 0.777 to 0.991
hsa-miR-485-3p/hsa-miR-767-3p 87 100 0.925 0.768 to 0.989 hsa-miR-200a/hsa-miR-637 100 83 0.925 0.768 to 0.989 hsa-miR-375/hsa-miR-637 86 96 0.925 0.768 to 0.989 hsa-miR-377/hsa-miR-637 100 70 0.925 0.768 to 0.989 hsa-miR- 130b/hsa-miR-767-3p 86 87 0.919 0.760 to 0.987 hsa-miR- 130b/hsa-miR-634 100 78 0.919 0.760 to 0.987 hsa-miR-548d-5p/hsa-miR- 139-3p 86 96 0.919 0.760 to 0.987 hsa-miR-429/hsa-miR-637 100 74 0.919 0.760 to 0.987 hsa-miR-520b/hsa-miR-637 86 91 0.919 0.760 to 0.987 hsa-miR-375/hsa-miR-874 100 74 0.913 0.752 to 0.984 hsa-miR-543/hsa-miR-637 86 96 0.913 0.752 to 0.984 hsa-miR-375/hsa-miR-1233 86 83 0.913 0.752 to 0.984 hsa-miR- 136/hsa-miR-637 86 91 0.907 0.744 to 0.982 hsa-miR- 196b/hsa-miR-637 86 83 0.907 0.744 to 0.982 hsa-miR-520b/hsa-miR-767-3p 86 96 0.901 0.736 to 0.979 hsa-miR-574-5p/hsa-miR-637 86 87 0.901 0.736 to 0.979
The expression data on the preferred expression signatures in the fourth aspect for discriminating different types of lung cancer are summarized in Table 18-20 below. Table 18 lists miRNA signatures for adenocarcinoma lung cancer in differentiating 5 healthy controls, squamous cell lung cancer and small cell lung cancer; Table 19 summarizes miRNA signatures for squamous cell lung cancer in differentiating healthy controls, adenocarcinoma lung cancer and small cell lung cancer; Table 20 displays miRNA signatures for small cell lung cancer in differentiating healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer, whereas Table 20 lists
10 miRNA signature combinations for small cell lung cancer in differentiating healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer. In the column Ή" denotes healthy controls, "AC" denotes adenocarcinoma lung cancer, "SQ" denotes squamous cell lung cancer, whereas "SCLC" denotes small cell lung cancer. Particularly preferred miRNAs (SEQ ID NO: 3 in Table 18; SEQ ID NO: 20 in Table
15 19; SEQ ID NO: 42, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 33 and SEQ ID NO: 29 in Table 20, respectively) are shown in bold.
TABLE 18
miRNA signatures for adenocarcinoma lung cancer in differentiating healthy controls, squamous cell lung caner and small cell lung cancer
5 TABLE 19
miRNA signatures for squamous cell lung cancer in differentiating healthy controls, adenocarcinoma lung cancer and small cell lung cancer
TABLE 20
10 miRNA signatures for small cell lung cancer in differentiating healthy controls,
adenocarcinoma lung cancer and squamous cell lung cancer
t-test fold Sensitivity Specificity AUC 95% CI p -value SQ/H-SQ-AC
hsa-miR-574-5p 3.9E-05 4.2 100 75 0.915 0.813 to 0.972 hsa-miR-375 3.0E-05 68.7 86 98 0.904 0.799 to 0.965 hsa-miR-543 7.5E-04 12.4 100 67 0.874 0.761 to 0.946 hsa-miR-196a 7.0E-04 3.0 86 77 0.843 0.725 to 0.925 hsa-miR-139-3p 1.6E-03 0.1 71 83 0.823 0.701 to 0.910 hsa-miR-106a 2.3E-03 0.1 86 81 0.775 0.647 to 0.873 hsa-miR-361-5p 4.3E-02 4.9 100 48 0.764 0.635 to 0.865 hsa-miR-141 2.6E-02 7.2 100 44 0.762 0.634 to 0.863 hsa-miR-765 4.7E-03 2.6 57 100 0.742 0.611 to 0.847 hsa-miR-609 2.5E-04 3.9 86 69 0.742 0.611 to 0.847 hsa-miR-520b 4.1E-03 3.2 86 58 0.728 0.596 to 0.836 hsa-miR-769-3p 2.0E-02 0.2 71 83 0.718 0.586 to 0.828
The results obtained demonstrate a global highly specific regulation of miRNA expression in lung cancer. Thus, the respective subsets of miRNAs specified herein represent unique miRNA expression signatures for expression profiling of lung cancer that do not only allow the identification of a cancerogenous state as such but also enables the discrimination between different types of tumors, namely adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
The identification of the miRNA expression signatures of the present invention provides a unique molecular marker that allows screening, detection, diagnosing and discrimination of different types of lung cancers in blood. Furthermore, the expression signatures can be used to monitor the therapy response and guide the treatment decision in lung cancer patients. Additionally, the expression signatures may be also used for development of anti-lung cancer drugs.
The present invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by embodiments and optional features, modifications and variations of the inventions embodied therein may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
Other embodiments are within the following claims. In addition, where features
or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
Claims
1. Diagnostic kit of molecular markers in blood for identifying one or more target plasma exhibiting lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence,
wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma and in one or more control plasma, and
wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of lung cancer, and/or different types of lung cancer, and
wherein the different lung cancers consist of adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
2. The kit of claim 1, wherein the lung cancer is adenocarcinoma lung cancer.
3. The kit of claim lor 2, wherein the nucleic acid expression signature comprises at least twelve nucleic acid molecules, preferably at least six nucleic acid molecules.
4. The kit of any of claims 1 to 3, wherein the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more control plasma and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more control plasma.
5. The kit of any of claims 1 to 4, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor-related signatures: hsa-miR-638, hsa-miR-572; plasma-specific signatures: hsa-miR-383, hsa- miR-1233, hsa-miR-545*, hsa-miR-655, hsa-miR-19b-2*, hsa-miR-548d-5p, hsa-miR- 190b, hsa-miR-623, hsa-miR-923 and an internal stable control: hsa-miR-1238.
6. The kit of claim 5, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-638, hsa-miR-572, hsa-miR-383, hsa-miR-545*, hsa- miR-655, hsa-miR-19b-2*, hsa-miR-548d-5p, hsa-miR-190b, hsa-miR-623, hsa-miR- 923 is up-regulated; the expression of hsa-miR-1233 is down-regulated and hsa-miR- 1238 is un-changed in the one or more target plasma compared to the one or more healthy control plasma.
7. The kit of any of claim 1 to 3, wherein the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-irriR-383/hsa-miR- 1233, hsa-miR-19b-2*/hsa-miR-1233, hsa-miR-548d-5p/hsa-miR-1233, hsa-miR-548d- 5p/hsa-miR-1233, hsa-miR-545 */hsa-miR- 1233, hsa-miR-923/hsa-miR-483-3p, hsa- miR-638/hsa-miR-483-3p, hsa-miR-190b/hsa-miR-1233, hsa-miR-190b/hsa-miR-1233 and hsa-miR-572/hsa-miR-1233.
8. The kit of claim 1, wherein the lung cancer is squamous cell lung cancer.
9. The kit of claim lor 8, wherein the nucleic acid expression signature comprises at least nineteen nucleic acid molecules, preferably at least six nucleic acid molecules.
10. The kit of any of claim 1 or 8 to 9, wherein the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more control plasma and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more control plasma.
11. The kit of any of claim 1 or 8 to 10, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor- related signatures: hsa-miR-181a, hsa-miR-623, hsa-miR-769-5p, hsa-miR-21*, hsa- miR-572, hsa-miR-34b*, hsa-miR-221, hsa-miR-939; plasma- specific signatures: hsa- miR-654-5p, hsa-miR-432, hsa-miR-194*, hsa-miR-302a, hsa-miR-485-3p, hsa-miR- 654-3p, hsa-miR-22, hsa-miR-423-5p, hsa-miR-520d-3p, hsa-miR-923 and an internal stable control: hsa-miR-1238.
12. The kit of any of claim 1 or 8 to 11, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-181a, hsa-miR-623, hsa-miR-769-5p, hsa-miR-21*, hsa-miR-572, hsa-miR-34b*, hsa-miR-221, hsa-miR-939, hsa-miR-432, hsa-miR-194*, hsa-miR-302a, hsa-miR-485-3p, hsa-miR-654-3p, hsa-miR-22, hsa- miR-423-5p, hsa-miR-520d-3p, hsa-miR-923 is up-regulated; hsa-miR-654-5p is down- regulated and the expression of hsa-miR-1238 is un-changed in the one or more target plasma compared to the one or more healthy control plasma.
13. The kit of any of claim 1 or 8 to 9, wherein the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR-194*/hsa- miR-654-5p, hsa-miR-194*/hsa-miR-654-5p, hsa-miR-623/hsa-miR-654-5p, hsa-miR- 181a/hsa-miR-654-5p, hsa-miR-432/hsa-miR-654-5p, hsa-miR-520d-3p/hsa-miR-654- 5p, hsa-miR-302a/hsa-miR-654-5p, hsa-miR-423-5p/hsa-miR-654-5p and hsa-miR- 221/hsa-miR-654-5p.
14. The kit of claim 1, wherein the lung cancer is small cell lung cancer.
15. The kit of claim lor 14, wherein the nucleic acid expression signature, as defined herein, may comprise at least thirty- six nucleic acid molecules, preferably at least sixteen nucleic acid molecules, and particularly preferably at least six nucleic acid molecules.
16. The kit of any of claim 1 or 14 to 15, wherein the nucleic acid expression signature comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy control plasma and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy control plasma.
17. The kit of any of claim 1 or 14 to 16, wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding tumor- related signatures: hsa-miR-375, hsa-miR-543, hsa-miR-139-3p, hsa-miR-34b*, hsa- miR-429, hsa-miR-361-5p, hsa-miR-130b, hsa-miR-196a, hsa-miR-200a, hsa-miR-765, hsa-miR-33b*, hsa-miR-106a, hsa-miR-874, hsa-miR-142-5p; plasma- specific signatures: hsa-miR-377, hsa-miR-136, hsa-miR-574-5p, hsa-miR-767-3p, hsa-miR- 637, hsa-miR-548d-5p, hsa-miR-485-3p, hsa-miR-141, hsa-miR-520b, hsa-miR-609, hsa-miR-423-5p, hsa-miR-1233, hsa-miR-634, hsa-miR-654-5p, hsa-miR-138, hsa- miR-769-3p, hsa-miR-665, hsa-miR-501-5p, hsa-let-7f, hsa-miR-193b*, hsa-miR-30d* and an internal stable control: hsa-miR-1238.
18. The kit of any of claim 1 or 14 to 17, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-375, hsa-miR-543, hsa-miR-34b*, hsa- miR-429, hsa-miR-361-5p, hsa-miR-130b, hsa-miR-196a, hsa-miR-200a, hsa-miR-765, hsa-miR-377, hsa-miR-136, hsa-miR-574-5p, hsa-miR-548d-5p, hsa-miR-485-3p, hsa- miR-141, hsa-miR-520b, hsa-miR-609, hsa-miR-423-5p is up-regulated; the expression of any one or more of the nucleic acid molecules encoding hsa-miR-139-3p, hsa-miR- 33b*, hsa-miR-767-3p, hsa-miR-637, hsa-miR-106a, hsa-miR-874, hsa-miR-142-5p, hsa-miR-1233, hsa-miR-634, hsa-miR-654-5p, hsa-miR-138, hsa-miR-769-3p, hsa- miR-665, hsa-miR-501-5p, hsa-let-7f, hsa-miR-193b*, hsa-miR-30d* is down- regulated and hsa-miR-1238 is un-changed in the one or more target plasma compared to the one or more healthy control plasma.
19. The kit of any of claim 1 or 14 to 16, wherein the nucleic acid expression signature comprises any one or more nucleic acid combinations encoding hsa-miR- 520b/hsa-miR-139-3p, hsa-miR-375/hsa-miR-106a, hsa-miR-196a/hsa-miR-139-3p, hsa-miR-375/hsa-miR-193b*, hsa-miR-609/hsa-miR-139-3p, hsa-miR-136/hsa-miR- 139-3p, hsa-miR-377/hsa-miR-637, hsa-miR-375/hsa-miR-637, hsa-miR-200a/hsa- miR-637, hsa-miR-520b/hsa-miR-637, hsa-miR-429/hsa-miR-637, hsa-miR-548d- 5p/hsa-miR-139-3p, hsa-miR-375/hsa-miR-1233, hsa-miR-543/hsa-miR-637, hsa-miR- 375/hsa-miR-874, hsa-miR-196b/hsa-miR-637, hsa-miR-136/hsa-miR-637, hsa-miR- 136/hsa-miR-637, hsa-miR-574-5p/hsa-miR-637, hsa-miR-130b/hsa-miR-634, hsa- miR-361-5p/hsa-miR-634, hsa-miR-765/hsa-miR-634, hsa-miR-130b/hsa-miR-767-3p, hsa-miR-361-5p/hsa-miR-767-3p, hsa-miR-485-3p/hsa-miR-767-3p and hsa-miR- 520b/hsa-miR-767-3p.
20. The kit of claim 1 to 19, for the further use of discriminating adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
21. The kit of claim 1 to 20, for the further use of discriminating adenocarcinoma lung cancer from healthy control, squamous cell lung cancer, small cell lung cancer, and
wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-383, hsa-miR-545*, hsa-miR-19b-2*.
22. The kit of claim 21, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-383, hsa-miR-545*, hsa-miR-19b-2* is up- regulated in the one or more target plasma compared to the one or more healthy controls, squamous cell lung cancer and small cell lung cancer.
23. The kit of claim 1 to 20, for the further use of discriminating squamous cell lung cancer from healthy control, adenocarcinoma lung cancer, small cell lung cancer, and wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-194*, hsa-miR-302a, hsa-miR-432.
24. The kit of claim 23, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-194*, hsa-miR-302a, hsa-miR-432 is up-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and small cell lung cancer.
25. The kit of claim 1 to 20, for the further use of discriminating small cell lung cancer from healthy control, adenocarcinoma lung cancer, squamous cell lung cancer, and
wherein the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa- miR-196a, hsa-miR-139-3p, hsa-miR-106a, hsa-miR-361-5p, hsa-miR-141, hsa-miR- 765, hsa-miR-609, hsa-miR-520b and hsa-miR-769-3p.
26. The kit of claim 25, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-574-5p, hsa-miR-375, hsa-miR-543, hsa-miR-196a, hsa-miR-361-5p, hsa-miR-141, hsa-miR-765, hsa-miR-609, hsa-miR-520b is up- regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-139-3p, hsa-miR-106a, hsa-miR-769-3p is down-regulated in the one or more target plasma compared to the one or more healthy controls, adenocarcinoma lung cancer and squamous cell lung cancer.
27. Method for identifying one or more target plasma exhibiting lung cancer, the method comprising:
(a) determining in the one or more target plasma the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence;
(b) determining the expression levels of the plurality of nucleic acid molecules in one or more healthy control plasma; and
(c) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control plasma by comparing the respective expression levels obtained in steps (a) and (b), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature, as defined in any of 1 to 26, that is indicative for the presence of lung cancer.
28. The method of claim 27, for the further use of discriminating adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
29. Method for monitoring treatment of lung cancer, the method comprising:
(a) identifying in the one or more target plasma a nucleic acid expression signature by using a method, as defined herein; and
(b) monitoring in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression in plasma is up-regulated before treatment but is down-regulated after treatment and the expression of a nucleic acid molecule whose expression in plasma is down-regulated before treatment but is up-regulated after treatment.
30. Method for preventing or treating lung cancer, the method comprising:
(a) identifying a nucleic acid expression signature in blood by using a method, as defined claim 28 or 29, and
(b) modifying in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression is up-regulated in blood is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in blood is up-regulated.
31. Pharmaceutical composition for the prevention and/or treatment of lung cancer in blood, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up- regulated in plasma from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down-regulated in plasma from lung cancer patients, as defined in any of claim 1 to 29.
32. Use of the pharmaceutical composition of 31 for the manufacture of a medicament for the prevention and/or treatment of lung cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201080064800.XA CN102782155B (en) | 2009-12-24 | 2010-12-24 | Compositions and methods for microRNA expression profiling analysis in plasma of lung cancer |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNPCT/CN2009/075949 | 2009-12-24 | ||
| CN2009075949 | 2009-12-24 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011076144A1 true WO2011076144A1 (en) | 2011-06-30 |
Family
ID=44194965
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CN2010/080240 Ceased WO2011076144A1 (en) | 2009-12-24 | 2010-12-24 | Compositions and methods for microrna expession profiling in plasma of lung cancer |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN102782155B (en) |
| WO (1) | WO2011076144A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015012175A1 (en) * | 2013-07-22 | 2015-01-29 | 学校法人関西医科大学 | Diagnostic drug and therapeutic drug for small cell lung cancer |
| WO2015194610A1 (en) * | 2014-06-18 | 2015-12-23 | 東レ株式会社 | Kit or device for detecting lung cancer, and lung cancer detection method |
| US10654014B2 (en) | 2016-01-29 | 2020-05-19 | Nomura Micro Science Co., Ltd. | Functional water producing apparatus and functional water producing method |
| US11634778B2 (en) | 2017-06-29 | 2023-04-25 | Toray Industries, Inc. | Kit, device, and method for detecting lung cancer |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103484550B (en) * | 2013-09-30 | 2014-09-10 | 中国科学院上海微系统与信息技术研究所 | MicroRNA biological markers for early lung cancer diagnosis and application thereof |
| KR101673197B1 (en) * | 2014-11-12 | 2016-11-08 | 한국과학기술연구원 | microRNAs for identification of exposure to particulate matter 2.5(PM2.5) and the method of identification using thereof |
| CN104818334B (en) * | 2015-06-02 | 2018-05-25 | 固安博健生物技术有限公司 | Relevant Microrna is shifted with adenocarcinoma of lung |
| CN105821042B (en) * | 2016-04-14 | 2019-06-25 | 中国科学院北京基因组研究所 | The relevant miRNA of mesenchymal stem cells derived from human umbilical blood Genome stability and its application |
| CN106811543A (en) * | 2017-03-31 | 2017-06-09 | 四川大学华西医院 | A combined detection kit for lung cancer miRNA markers |
| CN107432876A (en) * | 2017-09-23 | 2017-12-05 | 唐山市人民医院 | The 5p of Diagnosis of Non-Small Cell Lung label microRNA 769 and the application in medicine and diagnostic kit |
| CN107916292A (en) * | 2017-12-29 | 2018-04-17 | 唐山市人民医院 | Predict 423 5p of brain metastasis molecular marked compound miR and the application in medicine and diagnostic kit |
| TWI758670B (en) * | 2018-12-24 | 2022-03-21 | 奎克生技光電股份有限公司 | Health risk assessment method |
| CN109837343B (en) * | 2019-02-22 | 2024-03-01 | 中国科学院北京基因组研究所 | Early lung adenocarcinoma specific exosome miRNA and application thereof |
| CN111041087B (en) * | 2019-12-10 | 2022-12-23 | 宁夏医科大学 | Coal dust lung biomarker and application thereof |
| CN112301130B (en) * | 2020-11-12 | 2021-11-30 | 苏州京脉生物科技有限公司 | Marker, kit and method for early detection of lung cancer |
| CN113621707A (en) * | 2021-08-31 | 2021-11-09 | 山东大学 | Application of hsa-miR-190b in the preparation of diagnostic and/or therapeutic tumor products |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101389770A (en) * | 2006-01-05 | 2009-03-18 | 俄亥俄州立大学研究基金会 | microRNA-based methods and compositions for the diagnosis and treatment of solid cancers |
| CN101400361A (en) * | 2006-01-05 | 2009-04-01 | 俄亥俄州立大学研究基金会 | micro-RNA based methods and compositions for diagnosis, prognosis and treatment of lung cancer |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101111768A (en) * | 2004-11-30 | 2008-01-23 | 维里德克斯有限责任公司 | lung cancer prognosis |
| CN101386848A (en) * | 2008-08-12 | 2009-03-18 | 南京大学 | Microribonucleic acid contained in cell microparticles and its preparation research method and application |
| EP2336353A1 (en) * | 2009-12-17 | 2011-06-22 | febit holding GmbH | miRNA fingerprints in the diagnosis of diseases |
-
2010
- 2010-12-24 WO PCT/CN2010/080240 patent/WO2011076144A1/en not_active Ceased
- 2010-12-24 CN CN201080064800.XA patent/CN102782155B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101389770A (en) * | 2006-01-05 | 2009-03-18 | 俄亥俄州立大学研究基金会 | microRNA-based methods and compositions for the diagnosis and treatment of solid cancers |
| CN101400361A (en) * | 2006-01-05 | 2009-04-01 | 俄亥俄州立大学研究基金会 | micro-RNA based methods and compositions for diagnosis, prognosis and treatment of lung cancer |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPWO2015012175A1 (en) * | 2013-07-22 | 2017-03-02 | 正仁 下條 | Diagnostic and therapeutic agents for small cell lung cancer |
| WO2015012175A1 (en) * | 2013-07-22 | 2015-01-29 | 学校法人関西医科大学 | Diagnostic drug and therapeutic drug for small cell lung cancer |
| JP2022009328A (en) * | 2014-06-18 | 2022-01-14 | 東レ株式会社 | Kit or device for detecting lung cancer, and lung cancer detection method |
| US11519927B2 (en) | 2014-06-18 | 2022-12-06 | Toray Industries, Inc. | Lung cancer detection kit or device, and detection method |
| US10620228B2 (en) | 2014-06-18 | 2020-04-14 | Toray Industries, Inc. | Lung cancer detection kit or device, and detection method |
| US12405287B2 (en) | 2014-06-18 | 2025-09-02 | Toray Industries, Inc. | Lung cancer detection kit or device, and detection method |
| JP2020141678A (en) * | 2014-06-18 | 2020-09-10 | 東レ株式会社 | Lung cancer detection kit or device and detection method |
| JP6991433B2 (en) | 2014-06-18 | 2022-01-12 | 東レ株式会社 | Lung cancer detection kit or device and detection method |
| WO2015194610A1 (en) * | 2014-06-18 | 2015-12-23 | 東レ株式会社 | Kit or device for detecting lung cancer, and lung cancer detection method |
| JPWO2015194610A1 (en) * | 2014-06-18 | 2017-04-20 | 東レ株式会社 | Lung cancer detection kit or device and detection method |
| US12117462B2 (en) | 2014-06-18 | 2024-10-15 | Toray Industries, Inc. | Lung cancer detection kit or device, and detection method |
| JP7292653B2 (en) | 2014-06-18 | 2023-06-19 | 東レ株式会社 | Lung cancer detection kit or device and detection method |
| US10654014B2 (en) | 2016-01-29 | 2020-05-19 | Nomura Micro Science Co., Ltd. | Functional water producing apparatus and functional water producing method |
| US12043872B2 (en) | 2017-06-29 | 2024-07-23 | Toray Industries, Inc. | Kit, device, and method for detecting lung cancer |
| US11634778B2 (en) | 2017-06-29 | 2023-04-25 | Toray Industries, Inc. | Kit, device, and method for detecting lung cancer |
| US12460266B2 (en) | 2017-06-29 | 2025-11-04 | Toray Industries, Inc. | Kit, device, and method for detecting lung cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102782155B (en) | 2016-05-04 |
| CN102782155A (en) | 2012-11-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2011076144A1 (en) | Compositions and methods for microrna expession profiling in plasma of lung cancer | |
| CN102892897B (en) | Compositions and methods for microRNA expression profiling of lung cancer | |
| US9074206B2 (en) | Compositions and methods for micro-RNA expression profiling of colorectal cancer | |
| WO2011076142A1 (en) | Compositions and methods for microrna expession profiling in plasma of colorectal cancer | |
| WO2011076143A1 (en) | Compositions and methods for microrna expression profiling of lung cancer | |
| CN102985558B (en) | For composition and the method for the micro-RNA expression spectrum analysis of hepatocellular carcinoma | |
| CN103080334B (en) | For diagnosing microRNA biomarker and the method for early stage colorectal cancer and senior adenoma | |
| US9988690B2 (en) | Compositions and methods for prognosis of ovarian cancer | |
| CN102892898B (en) | For the diagnostic kit containing microRNA biomarker and the method for diagnosis of hepatoma | |
| US9243296B2 (en) | Compositions and methods for prognosis and treatment of prostate cancer | |
| CN102933719B (en) | Compositions and methods for microrna expession profiling in plasma of colorectal cancer | |
| CN104673883B (en) | For predicting the microRNA biomarker and detection method of early stage non-metastatic colorectal cancer prognosis | |
| WO2011076141A1 (en) | Diagnostic kits comprising microrna biomarkers and methods for diagnosis of hepatocellular cancer | |
| EP2196543A1 (en) | Compositions and methods for micro-rna expression profiling of hepatocellular cancer | |
| EP2596136B1 (en) | Marker consisting of plasma microrna and new method for diagnosis of hepatocellular carcinoma | |
| US9487781B2 (en) | Compositions and methods for treatment of ovarian cancer | |
| CN102770561B (en) | Tissue-based micro-RNA methods for diagnosis of different subtypes of lung cancer | |
| Lu et al. | Analysis of miR-221 and p27 expression in human gliomas | |
| CN102770560B (en) | For the microRNA biomarker based on blood plasma and the method for early detection colorectal cancer | |
| EP2196542A1 (en) | Compositions and methods for micro-rna expression profiling of colorectal cancer | |
| WO2011076147A1 (en) | Plasma-based micro-rna biomarkers and methods for early detection of colorectal cancer | |
| WO2011076145A1 (en) | Tissue-based micro-rna methods for diagnosis of different subtypes of lung cancer | |
| WO2010070637A2 (en) | Method for distinguishing between adrenal tumors | |
| CN118127152A (en) | Compositions and methods for intestinal exo-miRNA expression profiling |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080064800.X Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10838707 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10838707 Country of ref document: EP Kind code of ref document: A1 |











