WO2011056124A1 - Her3 binding polypeptides - Google Patents

Her3 binding polypeptides Download PDF

Info

Publication number
WO2011056124A1
WO2011056124A1 PCT/SE2010/051164 SE2010051164W WO2011056124A1 WO 2011056124 A1 WO2011056124 A1 WO 2011056124A1 SE 2010051164 W SE2010051164 W SE 2010051164W WO 2011056124 A1 WO2011056124 A1 WO 2011056124A1
Authority
WO
WIPO (PCT)
Prior art keywords
her3
binding polypeptide
seq
her3 binding
polypeptide according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/SE2010/051164
Other languages
French (fr)
Inventor
Fredrik Frejd
Elin Gunneriusson
Nina Kronqvist
John LÖFBLOM
Stefan STÅHL
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Affibody AB
Original Assignee
Affibody AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Affibody AB filed Critical Affibody AB
Priority to JP2012536757A priority Critical patent/JP5960598B2/en
Priority to EP10775936.7A priority patent/EP2496598B1/en
Priority to US13/505,493 priority patent/US10208128B2/en
Publication of WO2011056124A1 publication Critical patent/WO2011056124A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/305Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
    • C07K14/31Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2318/00Antibody mimetics or scaffolds
    • C07K2318/20Antigen-binding scaffold molecules wherein the scaffold is not an immunoglobulin variable region or antibody mimetics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/31Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/705Fusion polypeptide containing domain for protein-protein interaction containing a protein-A fusion

Definitions

  • This invention relates to polypeptides which bind to Human Epidermal Growth Factor Receptor 3 (herein referred to as HER3) and to use of such polypeptides in imaging and therapy.
  • the invention also relates to bispecific ligands having binding affinity for both HER3 and HER2, or HER3 and EGFR.
  • the epidermal growth factor family of transmembrane tyrosine kinase receptors including EGFR (ErbB1 or HER1 ), ErbB2 (HER2), ErbB3 (ERBB3 or HER3) and ErbB4 (HER4) are involved in regulating key cellular functions (e.g. cell proliferation, survival, differentiation and migration) through a complex network of intracellular signaling pathways.
  • EGFR ErbB1 or HER1
  • HER2 ErbB2
  • ERBB3 or HER3 ErbB4
  • HER4 ErbB4
  • HER3 lacks tyrosine kinase activity and must therefore form heterodimers with other ErbB receptors (Citri et al, Exp Cell Res 284(1 ):54-65 (2003)), e.g. with HER2 to exert its signaling function.
  • the HER2-HER3 heterodimer is considered to be a potent oncogenic unit (Holbro et al, Proc Natl Acad Sci 100(15):8933-8 (2003)) and HER3 has recently gained increased attention as the preferred
  • HER3 is expressed in a number of human cancers, including breast (Bobrow et al, Eur J Cancer 33(1 1 ):1846-50 (1997)), ovarian and bladder cancer (Rajkumar et al, Clin Mol Pathol 49(4) (1996)), and play an important role in signaling in other cancers (Stove et al, Clin Exp Metastasis 21 (8):665-84 (2004)), including some lung cancers (Engelman et al, Proc Natl Acad Sci
  • HER3 expression has a prognostic value, since high levels of receptor expression are associated with significantly shorter survival time compared with patients that overexpress HER2 (Tanner et al, J Clin Oncol 24(26):4317-23 (2006), Reschke et al, Clin Cancer Res 14(16):5188-97 (2008)).
  • HER3 has indeed been suggested to be a key node in ligand-induced activation of the ErbB receptor-PI3K signaling axis
  • antibodies can also be employed as targeting agents in order to specifically direct a range of immunological defense mechanisms against the cancerous cells, as well as to achieve specific delivery of various imaging or therapeutic conjugates (e.g.
  • bispecific molecules targeting HER3 and another member of the EGF family has recently attracted some interest.
  • Such bispecific molecules could for example be utilized as targeting vehicles for increasing the specificity of targeting in molecular imaging applications and simultaneously targeting HER3 and another antigen expressed on tumors.
  • bispecific monoclonal antibodies which bind to two separate targets.
  • genes encoding the four required polypeptide chains are produced in a cell as many as 10 different combinations are possible, and only one combination represents the desired bispecific antibody. Therefore, the concept of bispecific binding has not been fully explored using antibodies. Instead, antibody fragments and other binding molecules have been more widely utilized for making bispecific binding molecules, including bispecific Z variants (Friedman et al, Biotechnol Appl Biochem 54:121 -31 (2009)). Description of the invention
  • a further object of the invention is to provide targeting agents with high specificity for lesions expressing both HER2 and HER3.
  • polypeptide comprising a HER3 binding motif, BM, which motif consists of the amino acid sequence selected from i) EX 2 X 3 X A X 6 X 7 EIW Xn LPNL Xi 6 Xi 7 Xi 8 QX2o X 2 iAFIX 25 X26LX 28 D, wherein, independently of each other,
  • X 2 is selected from R, K, L, W and V;
  • X 3 is selected from R, H, K, M, S, W, Y and V;
  • X 4 is selected from A, R, N, D, Q, E, G, H, I, L, K, M, S, T, W and V;
  • X 6 is selected from A, R, Q, M, S, T and Y
  • X 7 is selected from A, E, G, H, K, F, S, T, W, Y and V;
  • Xl 1 is selected from A, N, D, Q, E I, L and T;
  • Xl6 is selected from N and T;
  • Xl7 is selected from A, R, N, Q, K P, S, T and V;
  • Xl8 is selected from A, R, N, E, F, D, Q, G, H, I, L, K, S, T, W, Y and V;
  • X20 is selected from A, R and K
  • X21 is selected from A, R, N, G, H , S and V;
  • X25 is selected from A, R, E, G, I, K, S, T and V;
  • X26 is selected from S and K;
  • X28 is selected from A, D, Q, E, F, P, S, T, W and Y;
  • polypeptide binds to the extra-cellular domain of HER3
  • the polypeptides as described herein present good binding affinity for HER3 in that they bind well to HER3.
  • the above definition of a class of sequence related HER3 binding polypeptides is based on an analysis of a number of random polypeptide variants of a parent scaffold that were selected for their interaction with HER3 in selection experiments.
  • the identified HER3 binding motif, or "BM” corresponds to the target binding region of the parent scaffold, which region constitutes two alpha helices within a three-helical bundle protein domain.
  • the varied amino acid residues of the two BM helices constitute a binding surface for interaction with the constant Fc part of antibodies.
  • the Fc interaction capacity of the binding surface has been replaced with a capacity for interaction with HER3.
  • the function of any polypeptide is dependent on the tertiary structure of the polypeptide. It is therefore possible to make minor changes to the amino acid sequence of a polypeptide without largely affecting the tertiary structure and the function thereof.
  • the polypeptide comprises modified variants of the BM of i), which are such that the resulting sequence is at least 90 % identical to a sequence belonging to the class defined by i), such as at least 93 % identical, such as at least 97 % identical to a sequence belonging to the class defined by i).
  • minor changes may be made in all positions of the sequences of the HER3 binding polypeptides as disclosed herein.
  • minor changes may be made only in the non-variable positions, also denoted as scaffold amino acid residues.
  • changes are not allowed in the variable positions, i.e. positions denoted with an "X" (e.g. X2, X3, X4, ⁇ , XZ, X1 1 , X16, X17, X18, X20, X21 , X25, X26 and X28 of the above defined BM).
  • an amino acid residue belonging to a certain functional grouping of amino acid residues e.g.
  • hydrophobic, hydrophilic, polar etc) could be exchanged for another amino acid residue from the same functional group.
  • a comparison is made over the window corresponding to the shortest of the aligned sequences.
  • the shortest of the aligned sequences may in some instances be the target sequence, such as the 29 amino acid residue HER3 binding motif.
  • the query sequence may constitute the shortest of the aligned sequences.
  • the query sequence may for example consist of at least 10 amino acid residues, such as at least 20 amino acid residues. The amino acid residues at each position are compared, and the percentage of positions in the query sequence that have identical
  • Non-limiting examples of groups of amino acid residues are the hydrophobic group, comprising the amino acid residues Ala, Val, Phe, Pro, Leu, lie, Trp, Met and Cys; the basic group, comprising the amino acid residues Lys, Arg and His; the acidic group, comprising the amino acid residues Glu and Asp; the hydrophilic group, comprising the uncharged amino acid residues Gin, Asn, Ser, Thr and Tyr; and the natural group, comprising the amino acid residue Gly.
  • the amino acid residues at each position are compared, and the percentage of positions in the query sequence that have similar correspondences in the target sequence is reported as % similarity.
  • a sequence may be 70 % similar to another sequence; or it may be 70 % identical to another sequence; or it may be 70 % identical and 90 % similar to another sequence.
  • X 2 is selected from R, K and W.
  • X3 is selected from R, K, S and Y.
  • X4 is selected from A, R, N, Q, H, I, L, K, S, T and V.
  • Xe is selected from A, S, T and Y.
  • X 7 is selected from A, G, F, W, Y and V.
  • Xn is selected from Q and E.
  • Xi 7 is selected from R, Q, T and V.
  • Xis is selected from R, Q, G, H, I, L, S, T, W, Y and V.
  • X 2 0 is selected from R and K.
  • X 21 is selected from A and G.
  • X25 is selected from A, R, G, K and S.
  • X28 is selected from A, Q, E, F, S, W and Y.
  • X2 is selected from R and K.
  • X3 is selected from K and Y.
  • X4 is selected from A, R, N, Q, H, L, K, S, T and V.
  • Xe is selected from T and Y.
  • X 7 is selected from A, G, F, Y and V.
  • Xi 7 is selected from R, Q and V.
  • Xis is selected from R, Q, I, L, T, Y and V.
  • X25 is selected from A, G, K and S.
  • X28 is selected from A, Q, E, F, S and W.
  • the polypeptide comprises a HER3 binding motif, BM, which motif consists of the amino acid sequence selected from i) EX 2 X 3 X A YX 7 EIW Xn LPNL X16X17X18QX20 X21AFIX25 X26LX 28 D, wherein, independently of each other,
  • X2 is selected from K, R and W;
  • X3 is selected from K, R, and Y;
  • X 4 is selected from A, D, E, G, H, I, K, L, M, N, Q, R, S, T, V and W;
  • X 7 is selected from A, E, F, G, H, K, S, T, V, W and Y;
  • X11 is selected from E and Q;
  • X16 is selected from N and T;
  • Xi 7 is selected from R, T and V;
  • Xis is selected from R, T and V;
  • X20 is selected from K and R;
  • X21 is selected from A and G;
  • X25 is selected from A, G, K, R and S;
  • X26 is selected from S and K;
  • X 28 is selected from A, D, E, F, P, Q, S, T, W and Y;
  • X2X3 is selected from KY, RY, WK and WR.
  • Xn is Q.
  • X17X18 is selected from RV, RT, VR and RR.
  • X20 is K.
  • X21 is A.
  • X2X3 is selected from KY and RY.
  • X4 is selected from K, L, S and T.
  • X 7 is selected from F, G and Y.
  • Xi 7 Xis is selected from RV, RT and VR.
  • X25 is selected from A, G and S.
  • amino acid sequence i) fulfils at least one of the following four conditions I, II, III and IV:
  • X 2 X 3 is selected from KY and RY;
  • X 20 is K
  • the amino acid sequence i) may for example fulfill at least two, such as at least three or all, of the four conditions I, II, III and IV
  • HER3 binding variants As described in detail in the experimental section to follow, the selection of HER3 binding variants has led to the identification of individual HER3 binding motif (BM) sequences. These sequences constitute individual embodiments of HER3 binding polypeptides according to this aspect. The sequences of individual HER3 binding motifs are presented in Figure 1 and as SEQ ID NO:1 -334.
  • the SM sequence i) is selected from any one of SEQ ID NO:1 to SEQ ID NO:66, such as from any one of SEQ ID NO:22-66, such as from SEQ ID NO:23-25, SEQ ID NO:27-28, SEQ ID NO:32, SEQ ID NO:35-36, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44-45, SEQ ID NO:53-54 and SEQ ID NO:56.
  • the HER3 binding motif thus forms part of a three-helix bundle protein domain.
  • the BM may essentially constitute two alpha helices with an interconnecting loop, within said three-helix bundle protein domain.
  • the HER3 binding polypeptide of the invention may comprise an amino acid sequence selected from: i) K-[BM]-DPSQS X a X b LLX c EAKKL NDX d Q; wherein
  • [BM] is a HER3 binding motif as defined above;
  • X a is selected from A and S;
  • X b is selected from N and E;
  • X c is selected from A, S and C;
  • X d is selected from A and S;
  • amino acid sequence which has at least 80 % identity to any one of the sequences defined above.
  • Said amino acid sequence may have at least 82 %, such as at least 84 %, such as at least 86 %, such as at least 88 %, such as at least 90 %, such as at least 92 %, such as at least 94 %, such as at least 96 %, such as at least 98 % identity to any one of the sequences defined above.
  • amino acid sequence of the HER3 binding polypeptide as defined above is selected from SEQ ID NO:335-668, in particular from SEQ ID NO:335-400, such as from SEQ ID NO:356-400, such as from SEQ ID NO:357-359, SEQ ID NO:361 -362, SEQ ID NO:366,
  • said three-helix bundle protein domain is selected from domains of bacterial receptor proteins.
  • Non-limiting examples of such domains are the five different three-helical domains of Protein A from
  • Staphylococcus aureus such as domain B, and derivatives thereof.
  • the three-helical bundle protein domain is a variant of protein
  • HER3 binding polypeptide which comprises an amino acid sequence selected from:
  • [BM] is a HER3 binding motif as defined above and
  • X c is selected from S and C;
  • HER3 binding polypeptide which comprises an amino acid sequence selected from:
  • [BM] is a HER3 binding motif as defined above and
  • Xc is selected from A and C;
  • the HER3 binding polypeptides as defined above may for example have a sequence which is at least 82 %, at least 83 %, at least 85 %, at least 87 %, at least 89 %, at least 91 %, at least 92 % at least 94 %, at least 96 % or at least 98 % identical to the sequence described herein.
  • the HER3 binding motif may form part of a 58 amino acid polypeptide.
  • a polypeptide may e.g. comprise a sequence selected from any one of SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-10
  • SEQ ID NO:669-734 such as selected from SEQ ID NO:690-734, such as from SEQ ID NO:691 -693, SEQ ID NO:695-696, SEQ ID NO:700, SEQ ID NO:703-704, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:712-713, SEQ ID NO:721 , SEQ ID NO:722 and SEQ ID NO:724.
  • a HER3 binding polypeptide according to any aspect described herein may bind to HER3 such that the K D value of the interaction is at most 1 x 10 "6 M, or such as at most 1 x 10 "7 M, such as at most 1 x 10 "8 M.
  • the terms HER3 binding” and "binding affinity for HER3" as used in this specification refers to a property of a polypeptide which may be tested for example by the use of surface plasmon resonance technology, such as in a Biacore instrument (GE Healthcare).
  • HER3 binding affinity may e.g. be tested in an experiment in which HER3 is immobilized on a sensor chip of a Biacore instrument, and the sample containing the polypeptide to be tested is passed over the chip.
  • HER3 binding affinity may be tested in an on-cell experiment.
  • An on-cell experiment may for example be performed by incubating varying concentrations of labeled HER3 with cells displaying the polypeptide to be tested.
  • the cell populations may thereafter be analyzed in a flow cytometer, such as in a fluorescence activated cell-sorting system (FACS), and the mean
  • fluorescence intensity data may be determined. Mean fluorescence may subsequently be plotted against the HER3 concentrations and fitted to a one- site binding model in order to determine the apparent equilibrium dissociation constant, K D .
  • the HER3 or fragment thereof used in the K D determination may for example comprise the amino acid sequence represented by SEQ ID NO:1007 (HER3-ECD).
  • selection of HER3 binding variants may for example be achieved by phage display for selection of na ' fve variants of a protein scaffold optionally followed by affinity maturation and cell display for selection of affinity maturated HER3 binding variants. It is however understood that any selection system, whether phage-based, cell-based or other, may be used for selection of HER3 binding polypeptides.
  • an expression system for cell surface display of recombinant proteins on the Gram-positive bacterium Staphylococcus carnosus was used (Jonsson et al, Biotechnol Applied Biochem 54:93-103 (2009)).
  • the larger size of a cell however generally enables use of fluorescence-activated cell sorting (FACS) for high-throughput screening and selection from cell-displayed protein libraries.
  • FACS fluorescence-activated cell sorting
  • the HER3 binding polypeptides of the invention are relatively small, which, apart from rendering the HER3 binding polypeptides useful in a wide range of applications, may enable production using solid-phase peptide synthesis.
  • a solid-phase synthesis route may e.g. facilitate site-specific conjugation of non-biological groups such as chelators used for radiolabeling in molecular imaging.
  • a HER3 binding polypeptide according to any aspect may comprise further C terminal and/or N terminal amino acids.
  • Such a polypeptide should be comprehended as a polypeptide having additional amino acids residues at the very first and/or the very last position in the polypeptide chain, i.e. at the N- and/or C-terminus.
  • a HER3 binding polypeptide may comprise any suitable number of additional amino acid residues, for example at least one additional amino acid residue.
  • Each additional amino acid residue may individually or collectively be added in order to, for example, improve production, purification, stabilization in vivo or in vitro, coupling, or detection of the polypeptide.
  • Such additional amino acid residues may comprise one or more amino acid residues added for the purpose of chemical coupling.
  • One example of this is the addition of a cysteine residue.
  • Such additional amino acid residues may also provide a "tag" for purification or detection of the polypeptide such as a His6 tag or a "myc" (c-myc) tag or a "FLAG" tag for interaction with antibodies specific to the tag or immobilized metal affinity chromatography (IMAC) in the case of the His6-tag.
  • the further amino acids as discussed above may be coupled to the HER3 binding polypeptide by means of chemical conjugation (using known organic chemistry methods) or by any other means, such as expression of the HER3 binding polypeptide as a fusion protein.
  • the further amino acids as discussed above may for example comprise one or more polypeptide domain(s).
  • a further polypeptide domain may provide the HER3 binding polypeptide with another function, such as for example another binding function, or an enzymatic function, or a toxic function (e.g. an immunotoxin), or a fluorescent signaling function, or combinations thereof.
  • the further polypeptide domain(s) may comprise a half life extending moiety which increases half life of the HER3 binding polypeptide in vivo. As understood by the skilled person, increased, or extended, half life means slowed clearance of a particular molecule from blood.
  • a half life extending moiety may for example comprise a peptide or protein that will allow in vivo association to serum albumins.
  • the half life extending moiety may be an albumin binding moiety.
  • An albumin binding moiety may e.g. consist of a naturally occurring polypeptide, or an albumin binding fragment thereof, or an engineered polypeptide.
  • An engineered polypeptide may be derived from a naturally occurring starting polypeptide through subjecting it to protein engineering techniques, such as mutations and alterations in a site-directed or randomized approach, with a view to create novel or enhanced properties, such as binding affinity for a molecule such as albumin.
  • Such an engineered albumin binding polypeptide may for example be a variant of a protein scaffold, which variant has been selected for its specific binding affinity for albumin.
  • the protein scaffold may be selected from domains of streptococcal Protein G or derivatives thereof, such as for example domain GA1 , domain GA2 and domain GA3 of Protein G from Streptococcus strain G148, in particular domain GA3.
  • the further amino acids comprise an albumin binding domain (ABD) of streptococcal Protein G, or a derivative thereof.
  • ABD albumin binding domain
  • an albumin binding domain which may be comprised as a further polypeptide domain in the HER3 binding polypeptide of the invention is set out in SEQ ID NO:1005.
  • albumin binding domains are disclosed in WO2009/016043.
  • Such an ABD- extended polypeptide binds to serum albumin in vivo, and benefits from its longer half life, which increases the net half life of the polypeptide itself (see e.g. WO91/01743).
  • a HER3 binding polypeptide according to the invention comprises an albumin binding moiety as defined above
  • the overall size of the HER3 bindnig polypeptide is relatively small.
  • the albumin binding part of the HER3 binding polypeptide will associate non-covalently with serum albumin and the polypeptide may thereby benefit from decreased renal clearance and increased recirculation in epithelial cells. Tissue penetration may however still be fast due to extravasating properties of serum albumin.
  • a HER3 binding polypeptide comprising a half life extending moiety may not only display an extended half life in vivo, but also a reduced immunologic response in vivo, as compared to a polypeptide lacking a corresponding half life extending moiety (see e.g. WO2005/097202).
  • a further polypeptide domain may moreover provide the HER3 binding polypeptide with the same binding function.
  • a HER3 binding polypeptide comprising at least two HER3 binding polypeptide monomer units, the amino acid sequences of which may be the same or different.
  • Multimeric forms of the polypeptides may comprise a suitable number of domains, each having a HER3 binding motif, and each forming a "monomer" within the multimer. These domains may all have the same amino acid sequence, but alternatively, they may have different amino acid sequences.
  • the HER3 binding polypeptide of the invention may form homo- or heterodimers.
  • the further polypeptide domain(s) as described above may be joined to the HER3 binding polypeptide by covalent coupling using known organic chemistry methods.
  • the HER3 binding polypeptide comprising the further polypeptide domain(s) may be expressed as one or more fusion polypeptides, for example in a system for recombinant expression of polypeptides, or joined in any other fashion, either directly or via a linker, for example an amino acid linker.
  • the polypeptide binds to the same epitope as the naturally occurring HER3 ligands, or sufficiently close to it to block binding of the naturally occurring HER3 ligands, e.g. Neuregulins-1 and 2, to HER3.
  • the HER3 binding polypeptide may thus be used as a HER3 blocking agent and/or to inhibit HER3 mediated cell signaling in vivo.
  • a polynucleotide encoding a HER3 binding polypeptide as described above.
  • An expression vector comprising such a polynucleotide may enable production of a HER3 binding polypeptide, for example by expression in a host cell.
  • a HER3 binding polypeptide may be used as an alternative to conventional antibodies or low molecular weight substances in various medical, veterinary and diagnostic applications.
  • the skilled addressee will understand that the polypeptide of the invention may be useful in any method requiring affinity for HER3 of a reagent.
  • the HER3 binding polypeptide may be used as a detection reagent, a capture reagent or a separation reagent in such methods.
  • the HER3 binding polypeptide may be employed in diagnostics in order to reveal, diagnose and examine the presence of a disease characterized by HER3 expression on the cell surface in e.g. a mammalian subject.
  • HER3 expression may diagnostically be monitored in vivo by use of a polypeptide of the invention.
  • Diagnostic monitoring may for example be accomplished by delivery of diagnostic nuclides for assessment of HER3 expression by molecular imaging.
  • a HER3 binding polypeptide according to the invention may also be useful as a therapeutic or diagnostic agent in its own right or as a means for targeting other therapeutic or diagnostic agents, with direct (e.g. toxic molecules, including radionuclides such as yttrium-90, lutetium-177 and thorium-227, toxins, such as maytansinoid) or indirect (e.g. cancer vaccines,
  • the therapeutic effect may potentially be mediated by blocking the receptor interaction, or alternatively by using the HER3 binding polypeptide as a target for delivering a potent payload to a tumor cell.
  • a Iigand having binding affinity for HER3 and for HER2, comprising a HER3 binding polypeptide as defined above; a HER2-binding polypeptide; and a linking moiety for linking the HER3 binding polypeptide with the HER2 binding polypeptide.
  • a Iigand should be comprehended as an example of a bispecific heterodimer comprising two different binding functions: one binding function for HER3, provided by a polypeptide as disclosed above, and one binding function for HER2, provided by a HER2 binding polypeptide. It is to be understood that any HER3 binding polypeptide according to the invention may be comprised in the Iigand. The two binding functions are comprised in the Iigand as two separate monomer units.
  • Such a bispecific Iigand according to the invention may be useful in detecting, characterizing and/or diagnosing cancer that involves both HER3 and HER2. Detection, characterization and/or diagnosis may for example be accomplished by molecular imaging using gamma or positron emitting nuclides or by using near infrared fluorescent probes.
  • HER3 is a preferred heterodimerization partner for HER2, and critical for driving the proliferation of tumors characterized by over-expression of HER2.
  • HER2 lacks a known Iigand and is currently believed to be dependent on other receptors in the HER family for Iigand induced signaling.
  • a bispecific Iigand according to the invention may however be used not only for diagnostic but also for targeted therapeutic payload applications. Compounds used in payload applications include, among others, radionuclides, prodrug enzymes, cytokines, chemical toxic molecules, toxins and photosensitizers. For targeted payload applications, high discrimination between normal and diseased tissue is extremely important.
  • the ligand may preferentially locate to and accumulate only in lesions expressing both receptors
  • HER2 and HER3 binding functions may provide the ligand with two equally strong binding functions for their individual targets.
  • the binding affinity of the HER3 binding polypeptide for HER3 may be approximately of the same order as the binding affinity of the HER2 binding polypeptide for HER2.
  • the HER2 binding polypeptide may bind to HER2 such that the K D value of the interaction is at most
  • binding of the HER2 binding polypeptide to HER2 may be as strong or stronger than the corresponding binding of the HER3 binding polypeptide to HER3.
  • the K D value of the interaction between the HER2 binding polypeptide and HER2 is no more than the K D value of the interaction between the HER3 binding polypeptide and HER3.
  • the K D value of the interaction between the HER3 binding polypeptide and HER3 may for example be 5 times, 10 times or 100 times the K D value of the interaction between the HER2 binding polypeptide and HER2.
  • the HER2 binding polypeptide of the bispecific ligand is an engineered polypeptide.
  • the HER2 binding polypeptide may be an engineered polypeptide which is a variant of a protein scaffold, which variant has been selected for its specific binding affinity for HER2.
  • Non- limiting examples of a protein scaffold are selected from the group consisting of staphylococcal protein A, and domains and derivatives thereof.
  • the HER2 binding polypeptide is an engineered protein derived from domain B of Protein A from Staphylococcus aureus.
  • the engineered protein may in particular comprise a protein Z derivative, which is a variant of protein Z which is derived from said domain B of Protein A.
  • the engineered HER2 binding protein comprises an amino acid sequence selected from
  • LSEAK KLNDS Q corresponding to SEQ ID NO:1003; and ii) an amino acid sequence which has at least 80 % identity to the sequence defined in i).
  • Linking of the HER3 binding polypeptide and the HER2 binding polypeptide may for example be provided by a peptide linker comprising from 1 up to 45 amino acids.
  • a linking moiety may in particular be arranged for coupling the N- and/or C-terminals of the HER3 binding polypeptide and the HER2 binding polypeptide.
  • the linking thus provided may be selected from C- to C-terminal linking, C- to N-terminal linking or N- to C-terminal linking.
  • Coupling of the linking moiety to the HER3 binding polypeptide and the HER2 binding polypeptide may e.g. be accomplished by means of chemical conjugation (using known organic chemistry methods) or by any other means, such as expression of the ligand as a fusion protein.
  • the ligand may, as described above, further comprise a half life extending moiety for extension of ligand half life in vivo.
  • Half life extension may be accomplished by a number of different half life extending moieties, and non-limiting examples of such moieties are selected from albumin, albumin binding moieties as defined above in connection with the HER3 binding polypeptide, the Fc-part from IgG, and polymeric compounds such as polyethylene glycol (PEG).
  • Coupling of the ligand to serum albumin which is the most abundant protein in mammalian sera, may provide extension of ligand half life in vivo.
  • albumin binding moiety may be an engineered protein derived from domain GA3 of streptococcal Protein G, such as an albumin binding moiety comprising an amino acid sequence selected from
  • ILAAL P as set out in SEQ ID NO:1005;
  • the half life extending moiety may for example be connected to the remainder of the ligand by covalent coupling using known organic chemistry methods, or joined in any other fashion, directly or mediated by a linker comprising a number of amino acids.
  • the half life extending moiety is represented by albumin or an albumin binding moiety
  • the ligand may in itself be expressed as one or more fusion polypeptides in a system for recombinant expression of polypeptides.
  • the half life extending moiety is attached to the remainder of the ligand via a cysteine residue present in the ligand.
  • the half life extending moiety may be attached to a cysteine residue of the HER3 or the HER2 binding polypeptide, introduced at a site distant from the binding motif.
  • the half life extending moiety is attached to the remainder of the ligand via the linking moiety.
  • the linking moiety comprises a half life extending moiety as defined above.
  • albumin, albumin binding moieties or PEG may for example be employed for connecting the HER3 binding polypeptide with the HER2 binding polypeptide.
  • a ligand according to the invention may comprise further C terminal or N terminal amino acids.
  • Such further amino acids may, as described above as regards the HER3 binding polypeptide, individually or collectively be added in order to for example, improve production, purification, stabilization in vivo or in vitro, coupling, or detection of the polypeptide.
  • the further amino acids may constitute one or more polypeptide domain(s). The function of such a further polypeptide domain may be the same as, or different from, the functions already comprised in the ligand.
  • a further polypeptide domain may for example provide the ligand with another HER3 binding function and/or another HER2 binding function.
  • a bispecific ligand according to the invention may comprise multimers of HER3 binding functions and/or multimers of HER2 binding functions.
  • bispecific ligand comprising multimeric binding functions is a ligand comprising two HER3 binding polypeptides and two HER2 binding polypeptides.
  • a ligand as defined above may, in one embodiment, prevent dimerization of HER2 and HER3 in vivo. More specifically, the ligand may, e.g. by binding to HER2 and/or HER3 expressed on a cell surface in a mammalian subject, inhibit HER3 mediated signaling in the subject. Due to the bispecific nature of the ligand, it may bind to and block the two receptors in a position such that they are no longer able to exert signaling. As the skilled addressee will understand, a ligand according to the invention may
  • HER2 and/or HER3 accordingly be utilized for the treatment of conditions associated with expression, and in particular over-expression, of HER2 and/or HER3 on the cell surface.
  • HER3 can however also form heterodimers with EGFR, thus forming an active signaling unit activating the PI3K/Akt pathway (Engelman et al, Proc Natl Acad Sci 102(10):3788-93 (2005)). Indeed, HER3 is over-expressed in non-small cell lung cancer (NSCLC), apparently because of up-regulation of ErbB ligands (Fujimoto et al, Cancer Res 65(24):1 1478-85 (2005)), whereas HER3 is not expressed in normal lung epithelium.
  • NSCLC non-small cell lung cancer
  • a ligand having binding affinity for HER3 and for EGFR comprising a HER3 binding polypeptide as defined above; an EGFR binding polypeptide; and a linking moiety for linking the HER3 binding polypeptide with the EGFR binding polypeptide.
  • a bispecific ligand may target HER3 and EGFR and exert similar, or the same, modes of action as described above for the bispecific ligand binding to HER3 and HER2.
  • Examples of a bispecific ligand binding to HER3 and EGFR may comprise an EGFR binding polypeptide selected from
  • LSEAK KLNDS Q corresponding to SEQ ID NO:1004; and ii) an amino acid sequence which has at least 80 % identity to the
  • EGFR binding polypeptides that may be used in a HER3 and EGFR binding ligand are disclosed in WO2007/065635.
  • the HER3 binding polypeptide or bispecific ligand according to the invention may be used in targeting therapeutic or diagnostic agents to cells expressing HER3, both in vivo and in vitro, particularly to cells which over-express HER3.
  • a ligand according to the invention may be utilized in targeting cells that express, or over-express, HER3 and/or HER2, or HER3 and/or EGFR.
  • therapeutic agents are selected from cytotoxic payloads, such as radionuclides, small molecular drugs or toxins. Such therapeutic agents may be chemically conjugated or otherwise bound to the HER3 binding polypeptide or ligand.
  • a combination, a HER3 binding polypeptide or a ligand according to the invention may furthermore be used as a medicament in therapy, for example for the treatment of a HER3 related condition, such as a HER3 related condition in a mammal, such as a human subject, selected from cancer disease, such as colon cancer, endometrial cancer, gastric cancer, glioma, breast cancer, pancreas cancer, head and neck squamous carcinoma, lung cancer, melanoma, medulloblastoma, neuroepithelioma, ovarian cancer, Paget's disease, papillary thyroid cancer, prostate cancer, skin squamous cell carcinoma, transitional cell carcinoma and vestibular schwannoma.
  • a HER3 binding polypeptide or a ligand according to the invention for the manufacture of a medicament for treatment of a HER3 related condition, such as the HER3 related conditions mentioned above, is also within the scope of the present invention.
  • a method of treatment of a HER3 related condition comprising administering of a HER3 binding polypeptide, or ligand or combination as described above to a mammalian subject in need thereof. Consequently, in the method of treatment, the subject is treated with a HER3 binding polypeptide, a ligand or a combination according to the invention.
  • said HER3 related condition is selected from cancer disease, such as colon cancer, endometrial cancer, gastric cancer, glioma, breast cancer, pancreas cancer, head and neck squamous
  • carcinoma lung cancer, melanoma, medulloblastoma, neuroepithelioma, ovarian cancer, Paget's disease, papillary thyroid cancer, prostate cancer, skin squamous cell carcinoma, transitional cell carcinoma and vestibular schwannoma.
  • a method of treatment of a HER3 and/or HER2 related condition comprising administering of a ligand according to the invention to a mammalian subject in need thereof.
  • a HER3 binding polypeptide or a ligand according to the invention may be used in diagnosis, such as in the diagnosis of a HER3 or a HER3 and/or HER2 related condition.
  • a HER3 binding polypeptide according to the invention may be employed separately or in combination with a diagnostic agent. Such a combination may be used in the diagnosis of a HER3 related condition, for example in molecular imaging of cells over-expressing HER3.
  • Figure 1 is a listing of the amino acid sequences of examples of HER3 binding motifs comprised in HER3 binding polypeptides of the invention (SEQ ID NO:1 -334), examples of 49-mer HER3 binding polypeptides according to the invention (SEQ ID NO:335-668) and examples of 58-mer HER3 binding polypeptides according to the invention (SEQ ID NO:669-1002), an example of a HER2 binding polypeptide (SEQ ID NO:1003) comprised in a ligand according to the invention, an example of an albumin binding moiety (SEQ ID NO:1005) as may be comprised in one embodiment of a ligand according of the invention, an example of an EGFR binding polypeptide (SEQ ID NO:1004) which may be comprised in one embodiment of a ligand according to the invention, as well as the sequences of protein Z (SEQ ID NO:1006), and the sequences of the extracellular domain of HER3 (SEQ ID NO:1007), the extracellular
  • Figure 2A-Q show the result of a dot blot assay performed using periplasmic fractions from individual HER3 binding Z variants expressed as fusions to the HSA binding domain ABD.
  • the potential background binding to 21 control proteins as well as binding to HER3-ECD and HER3-Fc were analyzed. Proteins were dotted on the membrane in three rows from left to right in the following order;
  • Row 1 HSA, IgG, IgM, IgA, alpha-2 macroglobulin, fibrinogen, holo- transferrin, alpha-1 -antitrypsin,
  • Row 3 streptavidin, neutravidin, HER2-ECD, HER3-Fc, HER4-Fc, HER3-ECD and HER4-ECD.
  • the images show response of A) Z01748, B) Z01813, C) Z01814, D) Z01815, E) Z02009, F) Z01821 , G) Z02010, H) Z01824, I) Z01825, J)
  • Figure 3A-F show images from the immunofluorescence experiment described in Example 2.
  • HER3 positive AU566 cells A-D
  • HER2 positive and HER3 negative SKOV-3 cells E-F
  • FIG. 4 is a schematic representation of the staphylococcal display vector (A) used for cell display of HER3 binding polypeptides of the invention on the surface of S. carnosus (B).
  • the vector pSCZ1 (A) contains: i) a promoter and secretion signal (S) from a lipase gene (expressed on the surface of the related Staphylococcus hyicus), ii) a gene fragment encoding a propeptide (PP) from the same lipase gene, which has been demonstrated to be important for efficient translocation of recombinant proteins, iii) a cell-wall anchoring region (XM), originating from staphylococcal Protein A, iv) an albumin binding protein (ABP, Samuelson et al, J Bacteriology 177(6):1470- 1476, (1995)) from streptococcal Protein G introduced to provide surface expression level normalization of the target binding signal, v) a staphylococcal origin of replication
  • Figure 5 shows density plots as a result from flow-cytometric sortings of SC:ZHER3LIB- The plots show FL-4 channel fluorescence intensity
  • the density plots show the staphylococcal library before flow- cytometric sorting round 1 , 2, 3 and 4, respectively, with the regions used in gating outlined as a box in each plot.
  • Figure 6A-D show histogram representations of a cell-based flow cytometry assay where FACS isolated cells displaying Z variants in fusion to an albumin binding protein (ABP) were incubated with fluorescently labeled HER3-Fc and fluorescently labeled HSA.
  • the ratio of HER3 binding signal (MFI, FL-1 ) and HSA binding signal (MFI, FL-4) is on the y-axis. All FL-1/FL-4 ratios are normalized; A) with the FL-1 /FL-4 ratio of Z05405 and B-D) with the FL-1 /FL-4 ratio of a first generation binder (Z01753).
  • A-D show cell-based flow cytometry assay results of Z05403-Z05415
  • B) shows cell-based flow cytometry assay results of Z05416-Z0542
  • C) shows cell-based flow cytometry assay results of Z05427-Z05434
  • D) shows cell-based flow cytometry assay results of Z05435-Z05447.
  • Figure 7A-D show sensorgrams from surface plasmon resonance (SPR) kinetic analyses of four different Z variants in four different
  • the uppermost curve in each sensorgram corresponds to the highest concentration of injected Z variant
  • the second curve from the top corresponds to the second highest concentration
  • the third curve from the top corresponds to the third highest concentration etc.
  • Figure 8A-B show sensorgrams from SPR competition analyses of Z05417 with heregulin.
  • A) shows a sensorgram resulting from injections of HER3-Fc, alone and preincubated with 40-fold molar excess of Z05417, over a surface immobilized with human heregulin.
  • B) shows a sensorgram resulting from co-injection of Z05417 with heregulin over a surface
  • Z05417 was injected in duplicates in five different concentrations, 10 nM, 5 nM, 1 nM, 0.5 nM and 0 nM. The uppermost curve corresponds to the highest concentration of injected
  • the second curve from the top corresponds to the second highest concentration
  • the third curve from the top corresponds to the third highest concentration etc.
  • Figure 9 shows a diagram over the percentage of HER3
  • MCF-7 cells were stimulated with 5 nM heregulin in the absence of Z variants (100 % phosphorylation, filled bars) and in the presence of the HER3 binding Z variants Z05416 and Z05417 and the negative control Z01 155 (taq polymerase binding Z variant, striped bars) or with medium alone (open bars).
  • the diagram shows the percentage of HER3 phosphorylation in the presence of Z variants or medium compared to heregulin-induced HER3 phosphorylation (100 %).
  • Example 1 Selection and screening of HER3 binding polypeptides Material and methods
  • HER3-Fc Biotinylation of recombinant human HER3/Fc chimera (R&D Systems, #348-RB-050), here denoted HER3-Fc, was performed using the Biotin-XX Microscale Protein Labeling Kit (Invitrogen, #B30010) according to the supplier's recommendations.
  • the extracellular domain of HER3 (SEQ ID NO:1007), here denoted HER3-ECD, was biotinylated using EZ-LinkTM-Sulfo-NHS-LC-LC-Biotin (Pierce, #21338) according to the supplier's recommendations.
  • Human serum albumin HSA; Sigma, #A-3782
  • Alexa Fluor® 647 Alexa Fluor® 647
  • succinimidyl ester (Invitrogen, #A20006) according to the supplier's
  • the protein buffer was changed to PBS (10 mM
  • phosphate 137 mM NaCI, 2.68 mM KCI, pH 7.4
  • PBS PBS supplemented with 0.1 % Pluronic® F108 NF Surfactant (PBSP; BASF Corporation, #30085231 ) in order to remove any excess biotin or fluorophore.
  • Pluronic® F108 NF Surfactant PBSP; BASF Corporation, #30085231
  • Phage display selection of HER3 binding polypeptides A library of random variants of Z molecules displayed on bacteriophage, denoted Zlib2002, constructed in phagemid pAffi1/pAY00065 as described in Gronwall et al, J Biotechnol 128:162-183 (2007), was used to select HER3-ECD-binding polypeptides.
  • phage stocks from the phagemid library was prepared according to previously described procedures (Nord et al, Nat Biotech 15:772-777 (1997); Hansson et al, Immunotechnology 4:237-252 (1999)) using the helper phage M13K07 (New England Biolabs, #NO315S).
  • the Escherichia coli amber suppressor strain RR1AM15 was used for all cloning procedures and as host for phage production.
  • the phage selection was performed in solution using biotinylated HER3 protein and streptavidin-coated paramagnetic beads (Dynabeads® M- 280 Streptavidin, Dynal #1 12.06) for capture of bound phages.
  • phage selection was performed on solid phase using HER3-ECD immobilized on MaxiSorp immunotubes (Nunc). Unspecific binding of phage particles was minimized by pre-treatment of all tubes and beads with PBST 0.1 -gelatin (PBS supplemented with 0.1 % Tween-20 and 0.1 % gelatin). Selection was performed in four cycles. All selections were performed in PBST 0.1 -gelatin and in a volume of 1 ml.
  • RT room temperature
  • Phage stocks used in cycle 1 and 2 were pre-incubated with 0.1 mg strepavidin coated beads for 1 h to remove streptavidin binding phages.
  • phage particles from the Zlib2002 library were incubated with 100 nM of biotinylated HER3-ECD in PBST 0.1 -gelatin for 2 hours.
  • the subsequent selection cycles were divided into two selection tracks for which the target concentration was lowered to 50 (track 1 ) or 20 nM (track 2) for cycle 2, 20 (track 1 ) or 10 nM (track 2) for cycle 3 and 20 (track 1 ) or 5 nM (track 2) for cycle 4.
  • the bound phages were captured with streptavidin-coated M-280 Dynabeads®, allowing an
  • immunotubes were immobilized with 1 ml
  • HER3-ECD 10 pg/ml in 50 mM sodium carbonat buffer, pH 9.6 for 1 .5 h at RT and thereafter blocked with 3 ml PBST 0.1 -gelatin for 1 h at RT. Phage stock was added to the tube and incubated for 2 h.
  • washes were performed twice in cycle 1 , three times in cycle 2, six times in cycle 3 and 12 times in cycle 4.
  • the bound phage particles were eluted with 0.1 M glycine-HCI (pH 2.2) followed by immediate neutralization with 1 M Tris-HCI (pH 8).
  • the phage-containing eluate was used to infect log phase RR1AM15 cells and phagemid particles were rescued from infected cells using helper phage M13K07.
  • the selection process was monitored by titration of phage stocks before each selection round and after elution from target protein. Serial dilutions of phage solutions were used for infection of log phase RR1AM15 cells.
  • the Z variants were produced by inoculating single colonies, prepared as described above, in 1 ml TSB-YE medium (30 g/l TSB, 5 g/l yeast extract) supplemented with 100 g/ml ampicillin and 0.1 mM isopropyl- -D-1 - thiogalactopyranoside (IPTG) in deep-well plates (Nunc #278752).
  • TSB-YE medium 30 g/l TSB, 5 g/l yeast extract
  • IPTG isopropyl- -D-1 - thiogalactopyranoside
  • replica plates were made by transferring a small fraction of each culture to 96-well plates with 15 % glycerol for storage at -20 °C. Remaining cells were pelleted by centrifugation, re-suspended in 300 ⁇ PBST 0.05 (PBS supplemented with 0.05 % Tween 20) and frozen at -80 °C to release the periplasmic fraction of the cells. Frozen samples were thawed in a water bath and cells were pelleted by centrifugation.
  • the periplasmic supernatant contained the Z variants as fusions to the albumin binding domain from GA3 of Protein G from Streptococcus strain G148, expressed as AQHDEALE- [Z#####]-VDYV-[ABD]-YVPG (Gronwall et al, supra).
  • Z##### refers to individual Z variants.
  • Half area 96 well ELISA plates (Costar #3690) were coated with 50 ⁇ /well of coating buffer (50 mM sodium carbonate, pH 9.6) containing 6 g/ml human serum albumin (HSA, Sigma #A3782), and incubated over night (ON).
  • the HSA solution was poured off and the wells were blocked with 100 ⁇ of PBST 0.1 supplemented with 2 % non-fat dry milk solution (Semper AB) for 1 h at RT.
  • the blocking solution was discarded and 50 ⁇ of periplasmic solution was added to each well and incubated for 1 .5 h at RT under slow shaking.
  • the supernatants were poured off and the wells were washed 4 times with PBST 0.05.
  • HER3-Fc 50 ⁇ of HER3-Fc at a concentration of 0.5 g/ml in PBST 0.05 or biotinylated HER3-ECD at a concentration of 1 ⁇ g ml in PBS were added to each well. The plates were incubated for 1 .5 h at RT followed by wash 4x in PBST 0.05. In HER3-Fc plates, an antibody against human Fc (DAKO Cytomation, #P0214), labeled with horseradish peroxidase (HRP) and diluted 1 :4000 in PBST 0.05, was added to the wells and incubated for 1 h at RT.
  • HRP horseradish peroxidase
  • sequencing reactions were purified by binding to magnetic streptavidin coated beads using a Magnatrix 8000 (Magnetic Biosolution), and analyzed on ABI PRISM® 3100 Genetic Analyzer (PE Applied Biosystems). The sequencing results were imported and analyzed with an ALD LIMS NautilusTM 2003 R2 B3 software (Thermo Electronics Corp.).
  • Dot blot analysis The produced HER3 binding Z variants were tested for specificity by dot blot analysis against alpha-2 macroglobulin (MP
  • alpha-1 acid glycoprotein (RDI, #RDI-SCP- 153-1 ), alpha-1 antichymotrypsin (RDI, #RDI-SCP-159-0), alpha-1 -antitrypsin (RDI, #RDI-SCP-165-5), C3 complement (RDI, #RDI-SCP-150-0), C4 complement (RDI, #RDI-SCP-151 -0), fibrinogen (Enzyme research,
  • haptoglobulin RDI, #RDI-SCP-1 19-1 ), hemopexin (Agilent), holo- transferrin (Sigma, #T0665), human IgA (Bethyl, #P80-102), mouse IgE kappa (BD, #55079), human IgG (Sigma, #G4386), human IgM (Sigma, #18260), human serum albumin (HSA, Sigma, #A3782), neutravidin (Pierce, #31000), streptavidin (Pierce, #21 122), transthyretin (Sigma, #P1742), HER2- ECD (SEQ ID NO:1008), HER3-ECD (SEQ ID NO:1007), HER3-Fc (R&D Systems), HER4-ECD (SEQ ID NO:1009), HER4-Fc (R&D Systems).
  • the Z variants were produced in essentially the same manner as described under ELISA screening in order to obtain periplasmic supernatants containing soluble protein.
  • the supernatants were filtered using 0.45 ⁇ membranes.
  • Nitrocellulose membranes (Invitrogen) were dotted with 1 ⁇ of each protein at a concentration of 0.25 mg/ml, except for HER3-ECD and HER4- ECD that had a concentration of 0.29 mg/ml and 0.14 mg/ml, respectively.
  • the membranes were blocked ON in PBST 0.1 supplemented with 0.5 % casein (blocking solution) at 4 °C. After removal of the solution, the
  • the membranes were washed 3 times very briefly and 4 x 5 minutes in PBST 0.1 .
  • the Z variants were detected with a ABD fused hyperimmune polyclonal rabbit Ig against an epitope common for all Z variants (produced in house) diluted 1 :5000 in PBST blocking solution by incubation for 1 h at RT. After washing as above an antibody against rabbit IgG conjugated with HRP (DAKO Cytomation, #P0448), diluted 1 :5000 in blocking solution, was added to the membranes, followed by incubation of the membranes for 1 h at RT. The membranes were washed, rinsed in PBS and soaked with Supersignal (Pierce #34075). Light emissions were
  • Chemilmager 5500 (Alpha Innotech Corp.)
  • pAffi1 pAY00065 vectors A PCR was performed using different primer pairs and the resulting gene fragments were purified and hybridized in ligase buffer. The hybridized gene fragments were subcloned in the pAY00430 vector, providing an N-terminal His6 tag and a C-terminal cysteine (His6-(Z#####) 2 - Cys). The HER3 binding Z variants were subcloned as dimers and the constructs encoded by the expression vectors were MGSSHHHHHHLQ- [Z#####][Z#####]-VDC. A three parts ligation was used for insertion of both insert fragments into the vector at the same step.
  • Hybridized gene fragments and /Accl-digested and dephosphorylated expression vectors were ligated in ligase buffer and electroporated into electrocompetent E. coli TOP10 cells.
  • the transformed cells were spread on TBAB plates (30 g/l tryptose blood agar base) supplemented with 50 g/ml of kanamycin, followed by incubation at 37 °C overnight.
  • the colonies were screened using PCR and the lengths of the PCR fragments were verified on agarose gels. To verify the sequences, sequencing was performed as described above. Plasmid DNA stock was prepared from the sequenced clones and deposited in -80 °C.
  • E. coli BL21 (DE3) cells were transformed with the plasmids through
  • Phage display selection of HER3 binding polypeptides Four rounds of phage display selection were run against biotinylated or non-biotinylated human HER3-ECD. The four selection cycles were performed in solution with biotinylated target at two different target concentrations or on solid phase with non-biotinylated target. In solution, phage particle target complexes were captured onto streptavidin-coated beads. For each selection cycle, the number of washes was increased. The phage particle titers and yields were calculated after each selection cycle. The phage particle yield (phage particles out phage particles in) increased for the third or last cycle indicating an enrichment in target binding clones.
  • ELISA screening of Z variants The clones obtained after four cycles of selection were produced in 96-well plates and screened for HER3-ECD and HER3-Fc-binding activity in an ELISA. In total, 93 clones from each selection track were screened. The absorbance measurements showed that, independently of selection strategy, approximately 90 % of the clones were positive for HER3, defined as a response two times the signal for the negative control. A Z variant molecule binding to insulin was used in negative and positive control experiments. The positive control was detected with
  • Sequencing was performed for clones selected on the basis of having variying signal absorbance values against HER3-Fc in ELISA screening, thus obtaining many different representative binders for the sequencing. In total, 135 HER3 positive clones were sequenced. Half of the clones were found in several copies resulting in total 23 new clones whereof two were identified as background binders. Each variant was given a unique identification number #####, and individual variants are referred to as
  • Dot blot analysis The specificities of 16 of the sequenced unique HER3- bindning polypeptides (in the form AQHDEALE-[Z#####]-VDYV-[ABD]-YVPG) were tested using dot blot analysis. 23 different proteins were blotted onto nitrocellulose membranes. The 23 proteins included 16 highly abundant human serum proteins, HER2-ECD, HER3-ECD and HER3-Fc and HER4- ECD and HER4-Fc. All Z variant fusion proteins except Z01824 bound to human to HSA as well as HER3-ECD and HER3-Fc in a specific way. Thus, the specificity of the tested Z variants was satisfying (Figure 2).
  • Subcloning of Z variants 16 of the unique clones were chosen for subcloning in the expression vector pAY004308 as dimers. The cloning resulted in 15 dimers of HER3-bindning Z variants (dimers of Z01748, Z01749, Z01751 , Z01753, Z01814, Z01815, Z01817, Z01820, Z01821 , Z01826, Z01828, Z01830, Z02009, Z02010 and Z0201 1 ).
  • the HER3 binding Z variants were purified from cell pellets under denatured conditions on 1 .5 ml Ni-NTA Superflow Columns (Qiagen) and buffer was exchanged to PBS using PD-10 columns (GE Healthcare). Purified Z variants were aliquoted and stored at -80 °C.
  • Protein characterization The concentration of purified Z variants (in His6- (Z#####) 2 -Cys form) was determined by absorbance measurements at 280 nm. The purity was estimated by SDS-PAGE analysis on 10 wells 4-12 % NuPAGETM gels (Invitrogen) using Coomassie blue staining. To verify the identity and to determine the molecular weights of purified Z variants, LC/MS- analyses were performed on an Agilent 1 100 LC/MSD system (Agilent Technologies).
  • CD analysis The purified Z variants were thawed and diluted to 0.5 mg/ml in PBS. For each diluted Z variant, a CD spectrum at 250-195 nm was obtained at 20 °C. In addition, a variable temperature measurement (VTM) was performed to determine the melting temperature (Tm). In the VTM, the absorbance was measured at 220 nm while the temperature was raised from 20 to 90 °C, with a temperature slope of 5 °C/min. The CD measurements were performed on a Jasco J-810 spectropolarimeter (Jasco Scandinavia AB) using a cell with an optical path-length of 1 mm.
  • VTM variable temperature measurement
  • Immunofluorescence staining The HER3 positive human mammary gland cell line AU565 (ATCC, #CRL-2351 ) and HER3 negative human ovary carcinoma cell line SKOV-3 (Ecacc, #91091004) were cultured as recommended by the supplier. The day before assay, 25000 cells were added to each well of multi well slides (eight wells per slide, Histolab #ER-201 -1 B) and allowed to grow ON in a CO2 incubator to take on a flattened morphology. The slides were gently washed in PBS by adding droplets onto the slide with a Pasteur pipette.
  • AU565 cells were stained with 1 1 different HER3 specific Z variants; His6-(Z01748)2-Cys, His6- (Z01749) 2 -Cys, His 6 -(Z01751 ) 2 -Cys, His 6 -(Z01753) 2 -Cys, His 6 -(Z01814) 2 -Cys, His 6 -(Z01815) 2 -Cys, His 6 -(Z01817) 2 -Cys, His 6 -(Z01820) 2 -Cys, His 6 -(Z01828) 2 - Cys, His 6 -(Z01830) 2 -Cys and His 6 -(Z0201 1 ) 2 -Cys.
  • the second experiment was performed with His6-(Z01814) 2 -Cys and His6-(Z01820) 2 -Cys, and with (Z01 154 ) 2 as a negative control Z variant.
  • the staining was performed on slides with HER3 positive AU565 and HER3 negative SKOV-3 cells.
  • An anti- HER3 antibody from R&D Systems (#AF234) was included as a positive control in both experiments.
  • the Z variants were added to the wells at a concentration of 15 g/ml in PBS and all dilutions of reagents were made in PBS as well as all washes. After 1 hour of incubation at RT, the multiwell slides were gently washed as described above and goat anti-Affibody molecule Ig (Affibody AB, #20.1000.01 .0005) was added to each well at a concentration of 5 g/ml. After 45 minutes of incubation at RT, the slides were gently washed as described above and 5 g/ml of a chicken anti-goat Alexa Fluor488 (Invitrogen, #A21467) was added to each well.
  • a chicken anti-goat Alexa Fluor488 Invitrogen, #A21467
  • the staining was documented using a LEICA DMLA microscope equipped with a video camera for live imaging.
  • On-cell affinity ranking using flow cytometry The full gene sequences encoding Z variants Z01751 , Z01753, Z01814 and Z01820 were PCR amplified from their corresponding pAY00430 vector constructs and ligated to the staphylococcal display vector pSCZ1 (Kronqvist et al, Protein Eng Des Sel 21 :247-255 (2008)), previously digested with restriction enzymes Xho ⁇ and Sa/I (New England Biolabs).
  • the E. coli strain RR1AM15 was used as host for plasmid construction and preparation and the constructs were transformed to electrocompetent Staphylococcus carnosus TM300 (Gotz, Soc Appl Bacteriol Symp Ser.
  • Staphylococcal cells individually displaying the four different Z variants were inoculated to 10 ml TSB-YE supplemented with 20 g/ml chloramphenicol and grown ON at 37 °C and 150 rpm. From the cultures, 10 6 cells were washed with 1 ml PBSP.
  • the cells were pelleted by centrifugation (3500 x g, 4 °C, 6 min) and resuspended in 100 ⁇ of PBSP containing different concentrations of biotinylated HER3-Fc (5, 20, 50 and 100 nM; see Example 1 for biotinylation). Equilibrium binding was reached by incubation at RT for 1 h with gentle mixing.
  • the cells were washed once with 1 ml ice-cold PBSP, followed by incubation on ice in 100 ⁇ ice-cold PBSP containing 1 .25 g/ml Alexa Fluor® 488-conjugated strepavidin (Invitrogen, #S32354) and 225 nM Alexa Fluor® 647-conjugated HSA (see Example 1 ) for 40 min. Following one wash with 1 ml ice-cold PBSP, cells were resuspended in 300 ⁇ ice-cold PBSP prior to flow-cytometric analysis. The mean fluorescence intensity (MFI) was measured using a FACS Vantage SE (BD Biosciences) flow cytometer.
  • MFI mean fluorescence intensity
  • Immunofluorescence staining Immunofluorescence microscopy was employed for characterization of specificity and binding activity to native HER3 expressed on human cancer cells. Eleven clones, showing positive signals in the ELISA screening of Example 1 , were produced as dimers fused to an N-terminal His6-tag and a C-terminal cysteine. Each Z variant was incubated on HER3 positive AU565 cells (human mammary mammary gland cell line). An anti-HER3 antibody was used as positive control. The cells were fixed after the staining procedure. Of eleven binders, 6 gave a membrane bound staining pattern. The background was high for some Z variants and in some cases it was difficult to judge if they were specific or not.
  • HER3 specific molecules His 6 -(Z01814) 2 -Cys and His 6 -(Z01820) 2 -Cys were selected for additional analysis on both HER3 positive AU565 cells and HER2 positive- and HER3 negative SKOV-3 cells (human ovary carcinoma cell line). Distinct cell membrane staining was obtained on AU565 but not on SKOV-3 cells demonstrating selectivity of the Z variants for HER3 over HER2 ( Figure 3).
  • On-cell affinitv ranking using flow cvtometrv To further characterize the HER3 binding molecules and to verify functional expression on bacterial cells, four of the HER3 binding molecules showing specificity for HER3 in immunofluorescence staining were employed for an on-cell affinity ranking experiment using staphylococcal cell display and flow cytometry. Monomer constructs of the four variants were subcloned to the staphylococcal display vector for subsequent transformation to the staphylococcal host.
  • Example 3 Design and construction of a maturated librarv of HER3 binding Z variants
  • a maturated library was constructed.
  • the library was used for selections of HER3 binding polypeptides. Selections from maturated libraries are usually expected to result in binders with increased affinity (Orlova et al, Cancer Res 66(8):4339-48 (2006).
  • Traditional oligonucleotide synthesis techniques using mononucleotides and degenerate codons may however limit the design since staphylococcal strains are not able to suppress amber stop codons.
  • randomized double stranded linkers were instead generated by the Slonomics® technique which enables incorporation of randomized sets of trinucleotide building blocks using ligations and
  • the library was based on the sequences of the HER3 binding Z variants described in Examples 1 and 2.
  • 13 variable positions in the Z molecule scaffold were biased towards certain amino acid residues, according to a strategy based on the binding motifs of the Z variant sequences defined in SEQ ID NO:1 -21 .
  • a SlonoMax® library containing a mixture of 131 bp double stranded linkers, encoding partially randomized positions in helix 1 and 2 of the HER3 binding polypeptide, e.g.
  • the library was amplified using Phusion DNA polymerase (Finnzymes, #F530L) during 8 cycles of PCR and pooled products were purified with QIAquick PCR Purification Kit (QIAGEN) according to the supplier's recommendations.
  • the purified pool of randomized library fragments was digested with restriction enzymes Xho ⁇ and Nhe ⁇ (New England Biolabs) and purified using preparative gel electrophoresis on a 2 % agarose gel.
  • the E. coli strain RR1AM15 was used as host strain for plasmid production of the staphylococcal display vector pSCZ1 ( Figure 4A) with Jetstar Maxi Kit (Genomed, #220020).
  • the vector was digested with the same enzymes, Xho ⁇ and Nhe ⁇ , and purified using preparative gel electrophoresis on a 1 % agarose gel. Ligation of pSCZ1 with the randomized library fragments was performed at a 1 :4 molar ratio of vector to fragment using T4 DNA ligase (New England Biolabs, #M0202T). The ligation mixture was purified using QIAquick PCR Purification Kit according to the supplier's recommendations prior to transformation to electrocompetent E. coli DH5a cells (Invitrogen, #18263-012). Individual clones, plated directly after transformation as well as after ON amplification, were PCR amplified for sequence verification using BigDye Thermo Cycle Sequencing reactions and an ABI Prism 3700 instrument (PE Applied
  • Plasmids were prepared from ON cultures of E. coli using Jetstar Maxi Kit and transformed to electrocompetent S. carnosus as described previously (Lofblom et al, supra).
  • the staphylococcal-displayed library is hereinafter denoted SC:Z H ER3LIB-
  • MFI mean fluorescence intensity
  • the new library was designed based on a set of HER3 binding Z variants (SEQ ID NO:669-689) with verified binding properties (Example 1 and 2).
  • the theoretical size of the designed library was 7.4 x 10 8 Z variants.
  • the library of DNA fragments was cloned into the staphylococcal expression vector and transformed into S. carnosus to generate a cell-displayed library containing around 1 .3 x 10 7 individual clones. Sequence analysis of individual library members revealed a distribution of codons in accordance with the theoretical design and a low proportion of unexpected codons, multiple inserts and frame shifts.
  • Example 4 Selection, screening and characterization of Z variants from a staphylococcal surface display library
  • the cells were pelleted by centrifugation (3500 x g, 4 °C, 6 min) and resuspended in PBSP containing biotinylated HER3-Fc and incubated at RT with gentle mixing for 2 hours to reach equilibrium binding. The cells were thereafter washed with ice-cold PBSP followed by incubation in 1 ml PBSP containing 1 .25 g/ml Alexa Fluor® 488-conjugated streptavidin (Invitrogen) and 225 nM Alexa Fluor® 647-conjugated HSA for 1 hour on ice in the dark.
  • the cells were resuspended in ice-cold PBSP before sorting.
  • Cells were sorted using a FACSVantage SE (BD Biosciences) flow cytometer.
  • the sort gate was set to sort out the top fraction of Z variant displaying cells (typically 0.1 %) showing the highest Alexa Fluor® 488 to Alexa Fluor® 647 fluorescence intensity ratio.
  • the cells were sorted directly into 0.5 ml TSB-YE medium and thereafter inoculated to TSB containing 10 g/ml chloramphenicol and incubated at 37 °C for 16 hours in order to amplify isolated cells by growth for the next round of labeling and FACS. The procedure was repeated four times.
  • Sequencing of individual staphylococcal clones was performed after cell sorting cycle 3 and 4 as described in under Library construction in Example 3.
  • HER3-Fc was biotinylated and HSA conjugated with Alexa Fluor® 647 as described in Example 1 .
  • Staphylococcal cells displaying the different Z variants, respectively, were inoculated to 10 ml TSB-YE and 20 g/ml chloramphenicol and grown ON at 37 °C and 150 rpm. From the cultures, 10 6 cells were washed with 1 ml PBSP.
  • the cells were pelleted by centrifugation (3500 x g, 4 °C, 6 min) and resuspended in PBSP containing different concentrations of biotinylated HER3-FC (135, 90, 27, 9, 2.7, 0.9, 0.45, 0.22, 0.1 1 and 0.054 nM for Z05405, Z05413, Z05416 and Z05417; 670, 337, 1 10, 45, 18, 6.7, 2.2, 1 .1 , 0.37 and 0.27 nM for Z01820) spanning the estimated K D . Equilibrium binding was reached by incubation at RT for one hour with gentle mixing.
  • the cells were washed with 1 ml ice-cold PBSP, followed by incubation on ice in 100 ⁇ ice- cold PBSP containing 1 .25 g/ml Alexa Fluor® 488-conjugated streptavidin, (Invitrogen) and, in the ranking experiment, 225 nM Alexa Fluor® 647- conjugated HSA, for 40 min. Following a wash with 1 ml ice-cold PBSP, cells were resuspended in 300 ⁇ ice-cold PBSP prior to flow cytometric analysis. The mean fluorescence intensity (MFI) was measured using a FACS Vantage SE (BD Biosciences) flow cytometer.
  • MFI mean fluorescence intensity
  • Flow-cytometric sorting for isolation of improved Z variants For isolation of matured HER3 binding Z variants, the staphylococcal library was subjected to four rounds of fluorescence-activated cell sorting (FACS) with alternating rounds of amplification by cell growth.
  • FACS fluorescence-activated cell sorting
  • Selection stringency in terms of target concentration, sorting parameters and sorting gates was increased with each sorting round and typically, the top 0.1 % of the library, demonstrating highest target binding to surface expression ratio, was gated and isolated for amplification and subsequent rounds of sorting.
  • the visualization of the target-binding properties of the library in the flow cytometer revealed an enrichment of HER3-positive clones in each sorting round, and essentially only HER3-positive clones in the last round ( Figure 5). After up to four rounds of FACS, isolated cells were spread on semi-solid medium for sequencing and characterization of individual candidates.
  • On-cell affinity ranking On the basis of the sequencing results, the 45 clones that appeared more than once were subjected to a whole-cell ELISA assay in order to rank the variants with respect to affinity for HER3.
  • staphylococcal cells was included in the analysis for comparison. All 45 candidates were positive for HER3 binding in the assay and, moreover, 43 demonstrated a higher signal compared to the Z variant from Example 1 and 2 ( Figure 6A-D). The highest signals in the assay were seen with the four clones that appeared most frequently after sequencing, demonstrating quantitative isolation of Z variants in the flow-cytometric sorting.
  • Kn-determination The apparent equilibrium dissociation constant (K D ) was determined on-cell for four Z variants ( Figure 4B) and one HER3 binding Z variant from Example 1 and 2 (Z01820). Staphylococcal cells displaying the four variants and Z01820 were incubated in varying concentrations of labeled HER3-Fc spanning the estimated K D . The cell populations were analyzed in the flow cytometer and the mean fluorescence intensity data was
  • SPR Surface plasmon resonance analysis
  • HER3-Fc Human HER3-Fc (R&D Systems) and mouse HER3-Fc (R&D systems) were immobilized by NHS/ECD amine-coupling chemistry on a CM-5 sensor chip (GE Healthcare).
  • the immobilization was performed in 10 mM NaAc (pH 4.5) at a flow rate of 30 ⁇ /min and with receptor concentrations of 10 pg/ml, aiming for an immobilization level of 4000 RU.
  • PBSP was used as running buffer at a flow rate of 20 ⁇ /min (unless stated otherwise) and 5 mM NaOH for regeneration.
  • the dissociation equilibrium constant (K D ) of the four Z variants Z05405, Z05413, Z05416 and Z05417 was determined by SPR technology.
  • the affinity was determined from the association and dissociation rates of the Z variants using non-linear regression to a one-site binding model, resulting in dissociation constants of 1 .61 nM for Z05405, 0.78 nM for Z05413, 0.78 nM for Z05416 and 0.69 nM for Z05417 ( Figure 7, Table 4).
  • Table 4 all values are means of duplicates of each concentration performed on the same day.
  • Table 4 Affinities of five HER3 bindin Z variants for human/mouse HER3
  • Example 6 Competition assay for heregulin and HER3 binding Z variants
  • SPR SPR in a competition assay
  • HER3-Fc In a first assay, 2.5 nM HER3-Fc was pre-incubated with 100 nM of each of the four HER3 specific Z variants (40-fold molar excess) for 1 h at room temperature. Thereafter, 75 ⁇ of each mixture of HER3-Fc and Z variant was injected over a sensor chip surface with immobilized heregulin. Additionally, HER3-Fc not pre-incubated with Z variants was injected over the chip surface with immobilized heregulin.
  • MCF-7 (ACC1 15, DSMZ) breast carcinoma cells were cultured in RPMI medium (BE12-167F, Lonza) supplemented with L-glutamine (BE17-605E, Cambrex), non-essential amino acids (BE13-1 14E, Cambrex), sodium pyruvate (BE13-1 15E, Cambrex) and 10 % fetal bovine serum (FBS, 10108-165, Gibco).
  • RPMI medium BE12-167F, Lonza
  • L-glutamine BE17-605E, Cambrex
  • non-essential amino acids BE13-1 14E, Cambrex
  • sodium pyruvate (BE13-1 15E, Cambrex)
  • FBS 10108-165, Gibco
  • the day before stimulation 1 x 10 6 cells were seeded in 6 mm Petri dishes (430168, BD Biosciences) in 5 ml of the above medium.
  • HER3 binding Z variants Z05416 and Z05417 each comprising an N-terminal his-tag and a C-terminal cysteine (His6-Z05416-cys and His6-Z05417-cys), were added simultaneously with heregulin in 10 or 100 times molar excess.
  • a taq polymerase specific Z variant His6-Z01 155-cys was used as a negative control and was added according to the same procedure as described above.
  • orthovanadate (450243, Sigma) was added to each dish and the cells were detached using a cell scraper.
  • the cell solution was transferred to a 10 ml tube and the cells were pelleted by spinning in a pre-cooled centrifuge at 1000 rpm for 3 minutes.
  • the dry pellet was dissolved in 100 ⁇ ice cold lysing buffer (1 % NP-40 (Sigma 13021 ), 20 mM Tris (pH 8.0), 137 mM NaCI, 10 % glycerol, 2 mM EDTA, 1 mM activated sodium orthovanadate) to lyse the cells.
  • the lysate was incubated end-over-end at 4 °C for 30 minutes and centrifuged at 13000 rpm for 15 minutes. The supernatant was collected and stored at -80 °C until further analysis.
  • PHER3-ELISA The presence of phosphorylated HER3 protein (pHER3) in cell lysates was analyzed using a Duo-Set IC phospo ErbB3 sandwich ELISA (DYC-1769, R&D Systems).
  • 96 well half area plates (Costar 3690) were coated over night with 50 ⁇ /well of 2 g/ml capture antibody diluted in PBS. The next day, the plate was washed four times with PBS + 0.05% Tween (PBST) in an automated ELISA washer. The wells were blocked with PBS containing 1 % BSA (100 ⁇ /well) for 2 hours at RT and washed as previously described.
  • PBST PBS + 0.05% Tween
  • IC Diluent #12 1 % NP-40, 20 mM Tris (pH 8.0), 137 mM NaCI, 10 % glycerol, 2 mM EDTA, and 1 mM activated sodium orthovanadate
  • Positive controls provided by the manufacturer, were also added to the wells. The plate was subsequently incubated for 2 hours.
  • IC diluent #14 (20 mM Tris, 137 mM NaCI, 0.05 % Tween 20, 0.1 % BSA, pH 7.2 - 7.4), and the plate was incubated for another 2 hours. Following incubation, the plate was washed and 50 ⁇ /well of TMB (Immunopure, Termo Fisher Scientific) was added. The reaction was stopped after 20 minutes by addition of 50 ⁇ /well of 2 M H 2 SO 4 and the absorbance was measured at 450 nm using a Victor 3 ELISA plate reader.
  • the HER3-specific Z variants Z05416 and Z05417 were, together with the negative control (taq polymerase specific Z01 155), assessed for their ability to block heregulin-induced phosphorylation of HER3.
  • the relative content of pHER3 (%) was determined as the relation of blocked culture (OD-value obtained from a culture containing a Z variant) to heregulin-stinnulated culture (OD-value obtained from heregulin-stinnulated cultures).
  • Figure 9 shows that the HER3 binding variants Z05416 and Z05417 inhibited heregulin-induced phosphorylation in a dose dependent manner, whereas the taq polymerase binding variant Z01 155 did not have any effect.
  • Example 8 Bispecific Z variants binding to HER3 and HER2
  • HER3 is a preferred heterodimerization partner for HER2, and HER2 is dependent on other receptors in the HER family for ligand induced signaling.
  • a bispecific HER3 and HER2 targeting ligand (for example a HER3-HER2 binding Z variant), might block the receptor signal driving tumor growth on tumors expressing both receptors.
  • the bispecific molecules optionally comprising various linker lengths.
  • constructs are N-or C-terminal positioning of the HER3 binding polypeptide to the HER2 binding polypeptide.
  • a linker is introduced between the two binding polypeptides, it can comprise 1 -60 amino acid residues, such as 1 -45 amino acids.
  • the bispecific construct may be provided with a half life extension moiety, e.g. by albumin fusion, coupling to an albumin binding moiety or a molecule such as PEG, at the N- or C-terminal part of the molecule or within the linker region.
  • the half life extending moiety may in itself be utilized as a linker, or a spacer, between the two binding polypeptides.
  • a dimeric bispecific Z variant molecule is engineered as previously reported in Friedman et al, Biotechnol Appl Biochem, 54(2):121 -31 (2009). Although Friedman et al describes production of tetrameric Z variants specific for two members of the HER family, the construction of a HER3 and HER2 bispecific Z variant in principle follows the same protocol. A person skilled in the field will easily understand how to apply the procedure based on
  • a gene fragment encoding a HER3 binding variant is genetically fused in-frame with a gene fragment encoding a HER2 binding Z variant using a 40 aa peptide linker between the two binding polypeptides by following the procedure described by Jonsson, et al, supra.
  • the gene encoding the bispecific protein is constructed by cloning of vectors encoding the HER3-HER2 binding Z variants.
  • the HER3 binding Z variant is selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-734, such as selected from SEQ ID NO:690- 734, such as from SEQ ID NO:691 -693, SEQ ID NO:695-696, SEQ ID
  • the HER2 binding Z variant is selected from SEQ ID NO:1003.
  • the HER2 and the HER3 binding Z variants can have different affinities for the different receptors.
  • Constructs may also be made from vectors encoding Z variants having various affinity for the same receptor.
  • the vectors encoding the bispecific HER3-HER2 binding Z variants are cleaved using suitable endonucleases (e.g.
  • HER3 and HER2 binding polypeptides may individually form a monomeric unit or a multimeric unit, such as a dimer, trimer or tetramer, within the gene fragment.
  • a linker region e.g. GGGS or GGGGSGGGGLVGLGSGGGGS
  • the linker region can also contain an albumin gene or the gene for an albumin binding domain (ABD).
  • the ABD gene is amplified using PCR, and a linker encoding unit is introduced. This is followed by BamH ⁇ restriction digestion and ligation into the dimeric HER3-HER2 bispecific gene between the HER binding polypeptides. This is essentially conducted as described for creating trimeric TNF constructs by Jonsson et al, supra, however replacing the central TNF molecules described in Jonsson with an ABD.
  • the gene fragments encoding HER3-HER2 binding Z variants are amplified using suitable PCR primers that also introduce the desired linker regions and restriction sites for cloning of the bispecific molecule in various formats.
  • bispecific molecule Different formats of the bispecific molecule are for example N-or C-terminal positioning, various lengths of linkers between the binding Z variants and/or the ABD gene in between.
  • Another possibility for construction of genes encoding for the desired bispecific molecule is simply to purchase the fully synthetic gene from companies offering such services, such as e.g. Geneart AG.
  • the resulting gene fragments encoding the HER3 binding Z variant, the HER2 binding Z variant, the peptide linker and optionally ABD, are ligated into an expression vector, transformed into expression cells (e.g. E. coli). Proteins are expressed for example as described in Example 2. Expression vectors are used that encode an additional his-tag and/or a unique cysteine for labeling purposes, and the expressed protein is purified as for example described in Example 2. The methods used for protein expression and purification are standard methods known to the person skilled in the field.
  • HER3-Fc Human HER3-Fc
  • hHER2-Fc human HER2-Fc, both from R&D Systems
  • the bispecific HER3-HER2 molecule is diluted in a running buffer, HBS (10 mM Hepes, 150 mM NaCI, 3.4 mM EDTA and 0.005% surfactant P20, pH 7.4), before binding analysis is performed at 25 °C.
  • HBS running buffer
  • the bispecific HER3- HER2 molecule is injected at concentrations ranging from 125 nM to 2 ⁇ over all surfaces with a flow rate of 30 ⁇ /min.
  • a HER3 binding Z variant and a HER2 binding Z variant are also injected as controls.
  • the biological effect of binding bispecific Z variants to cells is tested by exposing cell cultures to various amounts, ranging from 0.05 nM up to 5000 nM, of the bispecific Z variants and analyzing cell growth rate and survival, and by analyzing phosphorylation patterns of important cell signaling pathways using western blot analysis, as described for a HER2 specific Z variant by Ekerljung et al (in Tumour Biol 27(4):201 -10 (2006) and in Biochem Biophys Res Commun 377(2):489-94 (2008)).
  • Cell lines that can be tested include MDA-MB-361 , NCI-N87, CALU-3 and SKOV-3. Also HER3
  • transduced BT-474 and ZR75-cells can be used.
  • the bispecific constructs are evaluated for tumor targeting and for biological effect in a tumor.
  • the bispecific HER3-HER2 binding Z variants are radiolabeled as previously described (Ahlgren et al, Bioconjug Chem 19(1 ):235-43 (2008)), and characterized for in vitro cellular uptake, retention and internalization using described methods (Steffen et al, Cancer Biother Radiopharm
  • Animals bearing xenografted tumors expressing HER3 and HER2 receptors are in a biodistribution study injected with the radiolabeled HER3-HER2 binding Z variants and monitored for tumor uptake and contrast to other organs.
  • HER3 and HER2 receptors e.g. MDA-MB-361 , NCI-N87, CALU-3 and SKOV-3
  • the distribution of the radioactivity in the xenografted mice is typically assessed at 1 , 2, 4,8, 24, 48 and 72 hours following injection of the radiolabeled bispecific HER3-HER2 binding Z variant.
  • the distribution of the radioactivity is typically assessed at 1 , 4, 12, 24, 48, 72, 168 and 332 hours following injection of the radiolabeled bispecific HER3-HER2 binding Z variant, essentially as described in Tolmachev et al (Cancer Res 67(6):2773-82 (2007)).
  • the uptake of the radiolabeled bispecific Z variants is compared to the uptake of HER2 and/or HER3 binding Z variants alone.
  • the bispecific variants may be suitable for targeted payload therapy.
  • Such therapy will utilize a potent effector function, e.g. radionuclides, toxic chemical molecules, toxins, cytokines or photosensitizers, fused or conjugated to the bispecific molecule.
  • the bispecific Z variants are furthermore characterized for intrinsic effect in vivo.
  • Mice are grafted with tumor cells expressing both receptors, or as control, only one or none of the receptors, and subjected to a single or multiple injections of the bispecific Z variants. Tumor growth is monitored over time and versus control groups, including a vehicle group receiving only the injection buffer but no active compound, i.e. the bispecific HER3-HER2 binding molecule.
  • Example 9 Z variants with bispecific binding to HER3 and EGFR
  • HER3 is a preferred
  • HER2 heterodimerization partner for HER2. It is however, in certain conditions, also an important dimerization partner for the EGF-receptor (EGFR or HER1 ).
  • EGFR EGF-receptor
  • HER1 EGF-receptor
  • Bispecific HER3 and EGFR binding Z variants are engineered essentially as described above in Example 8.
  • the resulting construct can be tested in cell lines expressing HER3 and EGFR receptors, such as A431 - cells, in a similar fashion as described in Example 8 for bispecific HER3 and HER2 binding Z variants.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Thedisclosure provides a HER3 binding polypeptide, comprising a HER3 binding motif, BM, which motif consists of the amino acid sequence selected from i) EX2X3X4A X6X7EIW X11LPNL X16X17X18QX20 X21AFIX25 X26LX28D, and ii) an amino acid sequence which has at least 90 % identity to the sequence defined in i), wherein the polypeptide binds to the extra-cellular domain of HER3. Also provided is a bispecific ligand having binding affinity for HER3 and for HER2, or for HER3 and for EGFR, and comprising a HER3. binding polypeptide as defined herein and a HER2 binding polypeptide or a EGFR binding polypeptide.

Description

HER 3 BINDING POLYPEPTIDES
Field of the invention
This invention relates to polypeptides which bind to Human Epidermal Growth Factor Receptor 3 (herein referred to as HER3) and to use of such polypeptides in imaging and therapy. The invention also relates to bispecific ligands having binding affinity for both HER3 and HER2, or HER3 and EGFR.
Background
The epidermal growth factor family of transmembrane tyrosine kinase receptors, including EGFR (ErbB1 or HER1 ), ErbB2 (HER2), ErbB3 (ERBB3 or HER3) and ErbB4 (HER4) are involved in regulating key cellular functions (e.g. cell proliferation, survival, differentiation and migration) through a complex network of intracellular signaling pathways. Today, it is well established that abnormal expression and signaling of these receptors are associated with development and progression of several types of cancer, making them important targets for development of novel cancer therapeutics. So far, the EGFR and HER2 receptors have been the most extensively studied, with several targeting agents approved by regulatory authorities for diagnosis or treatment of human cancers. HER3 lacks tyrosine kinase activity and must therefore form heterodimers with other ErbB receptors (Citri et al, Exp Cell Res 284(1 ):54-65 (2003)), e.g. with HER2 to exert its signaling function. The HER2-HER3 heterodimer is considered to be a potent oncogenic unit (Holbro et al, Proc Natl Acad Sci 100(15):8933-8 (2003)) and HER3 has recently gained increased attention as the preferred
heterodimerization partner for HER2. Dimerization with HER2 leads to activation of the PI3K/Akt pathway and promotion of tumor cell survival and proliferation (Hynes et al, Nat Rev Cancer 5(5):341 -54 (2005)). HER3 is expressed in a number of human cancers, including breast (Bobrow et al, Eur J Cancer 33(1 1 ):1846-50 (1997)), ovarian and bladder cancer (Rajkumar et al, Clin Mol Pathol 49(4) (1996)), and play an important role in signaling in other cancers (Stove et al, Clin Exp Metastasis 21 (8):665-84 (2004)), including some lung cancers (Engelman et al, Proc Natl Acad Sci
102(10):3788-93 (2005)) and prostate cancer (Gregory et al, Clin Cancer Res 1 1 (5):1704-12 (2005)). In addition, HER3 expression has a prognostic value, since high levels of receptor expression are associated with significantly shorter survival time compared with patients that overexpress HER2 (Tanner et al, J Clin Oncol 24(26):4317-23 (2006), Reschke et al, Clin Cancer Res 14(16):5188-97 (2008)). HER3 has indeed been suggested to be a key node in ligand-induced activation of the ErbB receptor-PI3K signaling axis
(Schoeberl et al, Sci Signal 2(77):ra 31 (2009)).
A relatively large fraction of the more recently approved therapies directed towards the EGFR and HER2 receptors is based on monoclonal antibodies. One of the reasons behind the success for this new class of biological agents in cancer therapy is that antibodies offer new and unique mechanisms of action previously unachievable using small chemical drugs. In addition to more traditional agonistic (e.g. stimulation of a cell surface receptor) and antagonistic (e.g. blocking of natural protein-protein
interactions) therapeutic effects, antibodies can also be employed as targeting agents in order to specifically direct a range of immunological defense mechanisms against the cancerous cells, as well as to achieve specific delivery of various imaging or therapeutic conjugates (e.g.
chemotherapeutic drugs, radionuclides and toxins). In contrast to the well investigated EGFR and HER2 receptor members of the ErbB-family, there are relatively few reports on the use of anti-HER3 antibodies.
Ullrich and co-workers have however reported that anti-HER3 monoclonal antibodies inhibit HER3 mediated signaling in cell models of breast cancer (van der Horst et al, Int J Cancer 1 15(4):519-27 (2005)), and there are currently two monoclonal anti-HER3 antibodies in Phase I clinical trials (AMG 888, Baselga et al, Nat Rev Cancer 9(7):463-75 (2009), and MM- 121 , Schoeberl et al, supra).
However, although several successful cancer therapy studies have been reported using full-length monoclonal antibodies, this class of agents is not always optimal for targeting solid tumors (neither for diagnostic nor for therapeutic pay-load purposes). Therapeutic effect is dependent on an efficient distribution of the drug throughout the tumor, and molecular imaging depends on a high ratio between tumor uptake and surrounding normal tissue. Since tumor penetration rate (including extravasation) is negatively associated with the size of the molecule, the relatively large IgG molecule inherently has poor tissue distribution and penetration capacity. Moreover, for molecular imaging, the extraordinarily long in vivo half-life of antibodies results in relatively high blood signals and thereby relatively poor tumor-to- blood contrasts.
Since HER3 may be expressed on the same tumor cell as other members of the EGF family, production of bispecific molecules targeting HER3 and another member of the EGF family has recently attracted some interest. Such bispecific molecules could for example be utilized as targeting vehicles for increasing the specificity of targeting in molecular imaging applications and simultaneously targeting HER3 and another antigen expressed on tumors.
It is however complicated to produce bispecific monoclonal antibodies which bind to two separate targets. When the genes encoding the four required polypeptide chains are produced in a cell as many as 10 different combinations are possible, and only one combination represents the desired bispecific antibody. Therefore, the concept of bispecific binding has not been fully explored using antibodies. Instead, antibody fragments and other binding molecules have been more widely utilized for making bispecific binding molecules, including bispecific Z variants (Friedman et al, Biotechnol Appl Biochem 54:121 -31 (2009)). Description of the invention
It is an object of the present invention to provide novel HER3 binding agents which for example may be used in targeting HER3 expressing cells, molecular imaging of such HER3 expressing cells and treatment of HER3 related conditions.
A further object of the invention is to provide targeting agents with high specificity for lesions expressing both HER2 and HER3.
According to one aspect, there is provided a HER3 binding
polypeptide, comprising a HER3 binding motif, BM, which motif consists of the amino acid sequence selected from i) EX2X3X A X6X7EIW Xn LPNL Xi6Xi7Xi8QX2o X2iAFIX25 X26LX28D, wherein, independently of each other,
X2 is selected from R, K, L, W and V;
X3 is selected from R, H, K, M, S, W, Y and V;
X4 is selected from A, R, N, D, Q, E, G, H, I, L, K, M, S, T, W and V;
X6 is selected from A, R, Q, M, S, T and Y; X7 is selected from A, E, G, H, K, F, S, T, W, Y and V;
Xl 1 is selected from A, N, D, Q, E I, L and T;
Xl6 is selected from N and T;
Xl7 is selected from A, R, N, Q, K P, S, T and V;
Xl8 is selected from A, R, N, E, F, D, Q, G, H, I, L, K, S, T, W, Y and V;
X20 is selected from A, R and K
X21 is selected from A, R, N, G, H , S and V;
X25 is selected from A, R, E, G, I, K, S, T and V;
X26 is selected from S and K;
X28 is selected from A, D, Q, E, F, P, S, T, W and Y;
and ii) an amino acid sequence which has at least 90 % identity to the sequence defined in i),
wherein the polypeptide binds to the extra-cellular domain of HER3
(HER3-ECD).
The polypeptides as described herein present good binding affinity for HER3 in that they bind well to HER3. The above definition of a class of sequence related HER3 binding polypeptides is based on an analysis of a number of random polypeptide variants of a parent scaffold that were selected for their interaction with HER3 in selection experiments. The identified HER3 binding motif, or "BM", corresponds to the target binding region of the parent scaffold, which region constitutes two alpha helices within a three-helical bundle protein domain. In the parent scaffold, the varied amino acid residues of the two BM helices constitute a binding surface for interaction with the constant Fc part of antibodies. By random variation of binding surface residues and subsequent selection of variants, the Fc interaction capacity of the binding surface has been replaced with a capacity for interaction with HER3.
As the skilled person will realize, the function of any polypeptide, such as the HER3 binding capacity of the polypeptides as defined herein, is dependent on the tertiary structure of the polypeptide. It is therefore possible to make minor changes to the amino acid sequence of a polypeptide without largely affecting the tertiary structure and the function thereof. Thus, in one embodiment, the polypeptide comprises modified variants of the BM of i), which are such that the resulting sequence is at least 90 % identical to a sequence belonging to the class defined by i), such as at least 93 % identical, such as at least 97 % identical to a sequence belonging to the class defined by i). In some embodiments, minor changes may be made in all positions of the sequences of the HER3 binding polypeptides as disclosed herein. In other embodiments, minor changes may be made only in the non-variable positions, also denoted as scaffold amino acid residues. In such cases, changes are not allowed in the variable positions, i.e. positions denoted with an "X" (e.g. X2, X3, X4, ΧΘ, XZ, X1 1 , X16, X17, X18, X20, X21 , X25, X26 and X28 of the above defined BM). For example, it is possible that an amino acid residue belonging to a certain functional grouping of amino acid residues (e.g.
hydrophobic, hydrophilic, polar etc) could be exchanged for another amino acid residue from the same functional group.
The term "% identity", as used throughout the specification and the appended claims, is calculated as follows. The query sequence is aligned to the target sequence using the CLUSTAL W algorithm (Thompson, J.D., Higgins, D.G. and Gibson, T.J., Nucleic Acids Research, 22: 4673-4680
(1994)). A comparison is made over the window corresponding to the shortest of the aligned sequences. The shortest of the aligned sequences may in some instances be the target sequence, such as the 29 amino acid residue HER3 binding motif. In other instances, the query sequence may constitute the shortest of the aligned sequences. The query sequence may for example consist of at least 10 amino acid residues, such as at least 20 amino acid residues. The amino acid residues at each position are compared, and the percentage of positions in the query sequence that have identical
correspondences in the target sequence is reported as % identity.
The term "% similarity", as used throughout the specification and the appended claims, is calculated in the following way. Sequence alignment and comparison are basically performed as described in relation to the % identity calculation. "Similarity" should however be interpreted as follows. Two amino acid residues are considered similar if they belong to the same group of amino acid residues. Non-limiting examples of groups of amino acid residues are the hydrophobic group, comprising the amino acid residues Ala, Val, Phe, Pro, Leu, lie, Trp, Met and Cys; the basic group, comprising the amino acid residues Lys, Arg and His; the acidic group, comprising the amino acid residues Glu and Asp; the hydrophilic group, comprising the uncharged amino acid residues Gin, Asn, Ser, Thr and Tyr; and the natural group, comprising the amino acid residue Gly. Thus, the amino acid residues at each position are compared, and the percentage of positions in the query sequence that have similar correspondences in the target sequence is reported as % similarity.
Throughout this description, alternative embodiments according to the invention fulfill, instead of the specified percentage of identity, the
corresponding percentage of similarity. Other alternative embodiments fulfill the specified percentage of identity as well as another, higher percentage of similarity, selected from the group of preferred percentages of identity for each sequence. For example, a sequence may be 70 % similar to another sequence; or it may be 70 % identical to another sequence; or it may be 70 % identical and 90 % similar to another sequence.
In one embodiment of the above disclosed polypeptide, X2 is selected from R, K and W.
In a further embodiment of the above disclosed polypeptide, X3 is selected from R, K, S and Y.
In a further embodiment of the above disclosed polypeptide, X4 is selected from A, R, N, Q, H, I, L, K, S, T and V.
In a further embodiment of the above disclosed polypeptide, Xe is selected from A, S, T and Y.
In a further embodiment of the above disclosed polypeptide, X7 is selected from A, G, F, W, Y and V.
In a further embodiment of the above disclosed polypeptide, Xn is selected from Q and E.
In a further embodiment of the above disclosed polypeptide, Xi7 is selected from R, Q, T and V.
In a further embodiment of the above disclosed polypeptide, Xis is selected from R, Q, G, H, I, L, S, T, W, Y and V.
In a further embodiment of the above disclosed polypeptide, X20 is selected from R and K.
In a further embodiment of the above disclosed polypeptide, X21 is selected from A and G.
In a further embodiment of the above disclosed polypeptide, X25 is selected from A, R, G, K and S.
In a further embodiment of the above disclosed polypeptide, X28 is selected from A, Q, E, F, S, W and Y.
In a further embodiment of the above disclosed polypeptide, X2 is selected from R and K. In a further embodiment of the above disclosed polypeptide, X3 is selected from K and Y.
In a further embodiment of the above disclosed polypeptide, X4 is selected from A, R, N, Q, H, L, K, S, T and V.
In a further embodiment of the above disclosed polypeptide, Xe is selected from T and Y.
In a further embodiment of the above disclosed polypeptide, X7 is selected from A, G, F, Y and V.
In a further embodiment of the above disclosed polypeptide, Xi7 is selected from R, Q and V.
In a further embodiment of the above disclosed polypeptide, Xis is selected from R, Q, I, L, T, Y and V.
In a further embodiment of the above disclosed polypeptide, X25 is selected from A, G, K and S.
In a further embodiment of the above disclosed polypeptide, X28 is selected from A, Q, E, F, S and W.
In one embodiment of the above disclosed HER3 binding polypeptide, the polypeptide comprises a HER3 binding motif, BM, which motif consists of the amino acid sequence selected from i) EX2X3X A YX7EIW Xn LPNL X16X17X18QX20 X21AFIX25 X26LX28D, wherein, independently of each other,
X2 is selected from K, R and W;
X3 is selected from K, R, and Y;
X4 is selected from A, D, E, G, H, I, K, L, M, N, Q, R, S, T, V and W;
X7 is selected from A, E, F, G, H, K, S, T, V, W and Y;
X11 is selected from E and Q;
X16 is selected from N and T;
Xi7 is selected from R, T and V;
Xis is selected from R, T and V;
X20 is selected from K and R;
X21 is selected from A and G;
X25 is selected from A, G, K, R and S;
X26 is selected from S and K;
X28 is selected from A, D, E, F, P, Q, S, T, W and Y;
and ii) an amino acid sequence which has at least 93 % identity to the sequence defined in i), wherein the polypeptide binds to the extra-cellular domain of HER3.
In a further embodiment of the above disclosed polypeptide, X2X3 is selected from KY, RY, WK and WR.
In a further embodiment of the above disclosed polypeptide, Xn is Q.
In a further embodiment of the above disclosed polypeptide, X17X18 is selected from RV, RT, VR and RR.
In a further embodiment of the above disclosed polypeptide, X20 is K.
In a further embodiment of the above disclosed polypeptide, X21 is A.
In a further embodiment of the above disclosed polypeptide, X2X3 is selected from KY and RY.
In a further embodiment of the above disclosed polypeptide, X4 is selected from K, L, S and T.
In a further embodiment of the above disclosed polypeptide, X7 is selected from F, G and Y.
In a further embodiment of the above disclosed polypeptide, Xi7Xis is selected from RV, RT and VR.
In a further embodiment of the above disclosed polypeptide, X25 is selected from A, G and S.
In yet a further embodiment of the above disclosed polypeptide, the amino acid sequence i) fulfils at least one of the following four conditions I, II, III and IV:
I) X2X3 is selected from KY and RY;
II) X is Q;
III) X20 is K;
IV) X21 is A.
The amino acid sequence i) may for example fulfill at least two, such as at least three or all, of the four conditions I, II, III and IV
As described in detail in the experimental section to follow, the selection of HER3 binding variants has led to the identification of individual HER3 binding motif (BM) sequences. These sequences constitute individual embodiments of HER3 binding polypeptides according to this aspect. The sequences of individual HER3 binding motifs are presented in Figure 1 and as SEQ ID NO:1 -334. In some embodiments of this aspect, the SM sequence i) is selected from any one of SEQ ID NO:1 to SEQ ID NO:66, such as from any one of SEQ ID NO:22-66, such as from SEQ ID NO:23-25, SEQ ID NO:27-28, SEQ ID NO:32, SEQ ID NO:35-36, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44-45, SEQ ID NO:53-54 and SEQ ID NO:56.
In particular embodiments, the HER3 binding motif (BM) thus forms part of a three-helix bundle protein domain. For example, the BM may essentially constitute two alpha helices with an interconnecting loop, within said three-helix bundle protein domain. In these embodiments, the HER3 binding polypeptide of the invention may comprise an amino acid sequence selected from: i) K-[BM]-DPSQS XaXbLLXc EAKKL NDXdQ; wherein
[BM] is a HER3 binding motif as defined above;
Xa is selected from A and S;
Xb is selected from N and E;
Xc is selected from A, S and C;
Xd is selected from A and S;
and
ii) an amino acid sequence which has at least 80 % identity to any one of the sequences defined above. Said amino acid sequence may have at least 82 %, such as at least 84 %, such as at least 86 %, such as at least 88 %, such as at least 90 %, such as at least 92 %, such as at least 94 %, such as at least 96 %, such as at least 98 % identity to any one of the sequences defined above.
In one embodiment of the HER3 binding polypeptide as described above, Xa is A; Xb is N; Xc is A and Xd is A.
In a further embodiment of the HER3 binding polypeptide as described above, Xa is A; Xb is N; Xc is C and Xd is A.
In a further embodiment of the HER3 binding polypeptide as described above, Xa is S; Xb is E; Xc is S and Xd is S.
In a further embodiment of the HER3 binding polypeptide as described above, Xa is S; Xb is E; Xc is C and Xd is S.
In yet a further embodiment, the amino acid sequence of the HER3 binding polypeptide as defined above is selected from SEQ ID NO:335-668, in particular from SEQ ID NO:335-400, such as from SEQ ID NO:356-400, such as from SEQ ID NO:357-359, SEQ ID NO:361 -362, SEQ ID NO:366,
SEQ ID NO:369-370, SEQ ID NO:374, SEQ ID NO:376, SEQ ID NO:378-379,
SEQ ID NO:387-388 and SEQ ID NO:390.
In particular embodiments, said three-helix bundle protein domain is selected from domains of bacterial receptor proteins. Non-limiting examples of such domains are the five different three-helical domains of Protein A from
Staphylococcus aureus, such as domain B, and derivatives thereof. In some embodiments, the three-helical bundle protein domain is a variant of protein
Z, which is derived from said domain B of staphylococcal Protein A.
Thus, in a further embodiment, there is provided a HER3 binding polypeptide which comprises an amino acid sequence selected from:
i) YAK-[BM]-DPSQS SELLXC EAKKL NDSQA P;
wherein [BM] is a HER3 binding motif as defined above and
Xc is selected from S and C; and
ii) an amino acid sequence which has at least 80 % identity to any one of the sequences defined in i) above.
Alternatively, there is provided a HER3 binding polypeptide which comprises an amino acid sequence selected from:
i) FNK-[BM]-DPSQS ANLLXC EAKKL NDAQA P;
wherein [BM] is a HER3 binding motif as defined above and
Xc is selected from A and C; and
ii) an amino acid sequence which has at least 80 % identity to any one of the sequences defined in i) above.
As discussed above, polypeptides comprising minor changes as compared to the above amino acid sequences are also within the scope of the present application. Thus, in some embodiments, the HER3 binding polypeptides as defined above may for example have a sequence which is at least 82 %, at least 83 %, at least 85 %, at least 87 %, at least 89 %, at least 91 %, at least 92 % at least 94 %, at least 96 % or at least 98 % identical to the sequence described herein.
In some embodiments and as disclosed in the Experimental section below, the HER3 binding motif may form part of a 58 amino acid polypeptide. Such a polypeptide may e.g. comprise a sequence selected from any one of SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID
NO:669-734, such as selected from SEQ ID NO:690-734, such as from SEQ ID NO:691 -693, SEQ ID NO:695-696, SEQ ID NO:700, SEQ ID NO:703-704, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:712-713, SEQ ID NO:721 , SEQ ID NO:722 and SEQ ID NO:724.
A HER3 binding polypeptide according to any aspect described herein may bind to HER3 such that the KD value of the interaction is at most 1 x 10"6 M, or such as at most 1 x 10"7 M, such as at most 1 x 10"8 M. The terms HER3 binding" and "binding affinity for HER3" as used in this specification refers to a property of a polypeptide which may be tested for example by the use of surface plasmon resonance technology, such as in a Biacore instrument (GE Healthcare). HER3 binding affinity may e.g. be tested in an experiment in which HER3 is immobilized on a sensor chip of a Biacore instrument, and the sample containing the polypeptide to be tested is passed over the chip. Alternatively, and as described in the Examples below, HER3 binding affinity may be tested in an on-cell experiment. An on-cell experiment may for example be performed by incubating varying concentrations of labeled HER3 with cells displaying the polypeptide to be tested. The cell populations may thereafter be analyzed in a flow cytometer, such as in a fluorescence activated cell-sorting system (FACS), and the mean
fluorescence intensity data may be determined. Mean fluorescence may subsequently be plotted against the HER3 concentrations and fitted to a one- site binding model in order to determine the apparent equilibrium dissociation constant, KD. The HER3 or fragment thereof used in the KD determination may for example comprise the amino acid sequence represented by SEQ ID NO:1007 (HER3-ECD).
As accounted for in the following Examples, selection of HER3 binding variants may for example be achieved by phage display for selection of na'fve variants of a protein scaffold optionally followed by affinity maturation and cell display for selection of affinity maturated HER3 binding variants. It is however understood that any selection system, whether phage-based, cell-based or other, may be used for selection of HER3 binding polypeptides. In the following Examples, an expression system for cell surface display of recombinant proteins on the Gram-positive bacterium Staphylococcus carnosus was used (Jonsson et al, Biotechnol Applied Biochem 54:93-103 (2009)). As compared to the size of a phage particle, the larger size of a cell however generally enables use of fluorescence-activated cell sorting (FACS) for high-throughput screening and selection from cell-displayed protein libraries. As compared to the IgG molecule, the HER3 binding polypeptides of the invention are relatively small, which, apart from rendering the HER3 binding polypeptides useful in a wide range of applications, may enable production using solid-phase peptide synthesis. A solid-phase synthesis route may e.g. facilitate site-specific conjugation of non-biological groups such as chelators used for radiolabeling in molecular imaging.
Thus, the skilled person will appreciate that various modifications and/or additions can be made to a HER3 binding polypeptide according to any aspect disclosed herein in order to tailor the polypeptide to a specific application without departing from the scope of the present invention. For example, a HER3 binding polypeptide according to any aspect may comprise further C terminal and/or N terminal amino acids. Such a polypeptide should be comprehended as a polypeptide having additional amino acids residues at the very first and/or the very last position in the polypeptide chain, i.e. at the N- and/or C-terminus. Thus, a HER3 binding polypeptide may comprise any suitable number of additional amino acid residues, for example at least one additional amino acid residue. Each additional amino acid residue may individually or collectively be added in order to, for example, improve production, purification, stabilization in vivo or in vitro, coupling, or detection of the polypeptide. Such additional amino acid residues may comprise one or more amino acid residues added for the purpose of chemical coupling. One example of this is the addition of a cysteine residue. Such additional amino acid residues may also provide a "tag" for purification or detection of the polypeptide such as a His6 tag or a "myc" (c-myc) tag or a "FLAG" tag for interaction with antibodies specific to the tag or immobilized metal affinity chromatography (IMAC) in the case of the His6-tag.
The further amino acids as discussed above may be coupled to the HER3 binding polypeptide by means of chemical conjugation (using known organic chemistry methods) or by any other means, such as expression of the HER3 binding polypeptide as a fusion protein.
The further amino acids as discussed above may for example comprise one or more polypeptide domain(s). A further polypeptide domain may provide the HER3 binding polypeptide with another function, such as for example another binding function, or an enzymatic function, or a toxic function (e.g. an immunotoxin), or a fluorescent signaling function, or combinations thereof. In some embodiments, the further polypeptide domain(s) may comprise a half life extending moiety which increases half life of the HER3 binding polypeptide in vivo. As understood by the skilled person, increased, or extended, half life means slowed clearance of a particular molecule from blood. A half life extending moiety may for example comprise a peptide or protein that will allow in vivo association to serum albumins. In particular, the half life extending moiety may be an albumin binding moiety. An albumin binding moiety may e.g. consist of a naturally occurring polypeptide, or an albumin binding fragment thereof, or an engineered polypeptide. An engineered polypeptide may be derived from a naturally occurring starting polypeptide through subjecting it to protein engineering techniques, such as mutations and alterations in a site-directed or randomized approach, with a view to create novel or enhanced properties, such as binding affinity for a molecule such as albumin.
Such an engineered albumin binding polypeptide may for example be a variant of a protein scaffold, which variant has been selected for its specific binding affinity for albumin. In a specific embodiment, the protein scaffold may be selected from domains of streptococcal Protein G or derivatives thereof, such as for example domain GA1 , domain GA2 and domain GA3 of Protein G from Streptococcus strain G148, in particular domain GA3. Accordingly, in one embodiment of the HER3 binding polypeptide, the further amino acids comprise an albumin binding domain (ABD) of streptococcal Protein G, or a derivative thereof. One example of an albumin binding domain which may be comprised as a further polypeptide domain in the HER3 binding polypeptide of the invention is set out in SEQ ID NO:1005. Other examples of suitable albumin binding domains are disclosed in WO2009/016043. Such an ABD- extended polypeptide binds to serum albumin in vivo, and benefits from its longer half life, which increases the net half life of the polypeptide itself (see e.g. WO91/01743).
When a HER3 binding polypeptide according to the invention comprises an albumin binding moiety as defined above, the overall size of the HER3 bindnig polypeptide is relatively small. When administered for example to a mammalian subject, such as a human subject, the albumin binding part of the HER3 binding polypeptide will associate non-covalently with serum albumin and the polypeptide may thereby benefit from decreased renal clearance and increased recirculation in epithelial cells. Tissue penetration may however still be fast due to extravasating properties of serum albumin. Furthermore, a HER3 binding polypeptide comprising a half life extending moiety may not only display an extended half life in vivo, but also a reduced immunologic response in vivo, as compared to a polypeptide lacking a corresponding half life extending moiety (see e.g. WO2005/097202).
A further polypeptide domain may moreover provide the HER3 binding polypeptide with the same binding function. Thus, in a further embodiment, there is provided a HER3 binding polypeptide comprising at least two HER3 binding polypeptide monomer units, the amino acid sequences of which may be the same or different. Multimeric forms of the polypeptides may comprise a suitable number of domains, each having a HER3 binding motif, and each forming a "monomer" within the multimer. These domains may all have the same amino acid sequence, but alternatively, they may have different amino acid sequences. In particular, the HER3 binding polypeptide of the invention may form homo- or heterodimers.
The further polypeptide domain(s) as described above may be joined to the HER3 binding polypeptide by covalent coupling using known organic chemistry methods. Alternatively, the HER3 binding polypeptide comprising the further polypeptide domain(s) may be expressed as one or more fusion polypeptides, for example in a system for recombinant expression of polypeptides, or joined in any other fashion, either directly or via a linker, for example an amino acid linker.
In one embodiment of the HER3 binding polypeptide, the polypeptide binds to the same epitope as the naturally occurring HER3 ligands, or sufficiently close to it to block binding of the naturally occurring HER3 ligands, e.g. Neuregulins-1 and 2, to HER3. The HER3 binding polypeptide may thus be used as a HER3 blocking agent and/or to inhibit HER3 mediated cell signaling in vivo.
In a further aspect, there is provided a polynucleotide encoding a HER3 binding polypeptide as described above. An expression vector comprising such a polynucleotide may enable production of a HER3 binding polypeptide, for example by expression in a host cell.
A HER3 binding polypeptide may be used as an alternative to conventional antibodies or low molecular weight substances in various medical, veterinary and diagnostic applications. The skilled addressee will understand that the polypeptide of the invention may be useful in any method requiring affinity for HER3 of a reagent. Thus, the HER3 binding polypeptide may be used as a detection reagent, a capture reagent or a separation reagent in such methods. In addition, the HER3 binding polypeptide may be employed in diagnostics in order to reveal, diagnose and examine the presence of a disease characterized by HER3 expression on the cell surface in e.g. a mammalian subject. Thus, HER3 expression may diagnostically be monitored in vivo by use of a polypeptide of the invention. Diagnostic monitoring may for example be accomplished by delivery of diagnostic nuclides for assessment of HER3 expression by molecular imaging. A HER3 binding polypeptide according to the invention may also be useful as a therapeutic or diagnostic agent in its own right or as a means for targeting other therapeutic or diagnostic agents, with direct (e.g. toxic molecules, including radionuclides such as yttrium-90, lutetium-177 and thorium-227, toxins, such as maytansinoid) or indirect (e.g. cancer vaccines,
immunostimulatory molecules) effects on the HER3 protein. The therapeutic effect may potentially be mediated by blocking the receptor interaction, or alternatively by using the HER3 binding polypeptide as a target for delivering a potent payload to a tumor cell.
In a further aspect, there is provided a Iigand having binding affinity for HER3 and for HER2, comprising a HER3 binding polypeptide as defined above; a HER2-binding polypeptide; and a linking moiety for linking the HER3 binding polypeptide with the HER2 binding polypeptide. Such a Iigand should be comprehended as an example of a bispecific heterodimer comprising two different binding functions: one binding function for HER3, provided by a polypeptide as disclosed above, and one binding function for HER2, provided by a HER2 binding polypeptide. It is to be understood that any HER3 binding polypeptide according to the invention may be comprised in the Iigand. The two binding functions are comprised in the Iigand as two separate monomer units.
Such a bispecific Iigand according to the invention may be useful in detecting, characterizing and/or diagnosing cancer that involves both HER3 and HER2. Detection, characterization and/or diagnosis may for example be accomplished by molecular imaging using gamma or positron emitting nuclides or by using near infrared fluorescent probes. As described above, HER3 is a preferred heterodimerization partner for HER2, and critical for driving the proliferation of tumors characterized by over-expression of HER2. HER2 lacks a known Iigand and is currently believed to be dependent on other receptors in the HER family for Iigand induced signaling. A bispecific Iigand according to the invention may however be used not only for diagnostic but also for targeted therapeutic payload applications. Compounds used in payload applications include, among others, radionuclides, prodrug enzymes, cytokines, chemical toxic molecules, toxins and photosensitizers. For targeted payload applications, high discrimination between normal and diseased tissue is extremely important.
By fine tuning the affinity of both binding polypeptides comprised in the bispecific ligand binding two different receptors, the ligand may preferentially locate to and accumulate only in lesions expressing both receptors
simultaneously. Accordingly, HER2 and HER3 binding functions may provide the ligand with two equally strong binding functions for their individual targets. Thus, the binding affinity of the HER3 binding polypeptide for HER3 may be approximately of the same order as the binding affinity of the HER2 binding polypeptide for HER2. In one embodiment, the HER2 binding polypeptide may bind to HER2 such that the KD value of the interaction is at most
1 x 10"6 M, such as at most 1 x 10"7 M, such as at most 1 x 10"8 M. In another embodiment, binding of the HER2 binding polypeptide to HER2 may be as strong or stronger than the corresponding binding of the HER3 binding polypeptide to HER3. Thus, the KD value of the interaction between the HER2 binding polypeptide and HER2 is no more than the KD value of the interaction between the HER3 binding polypeptide and HER3. The KD value of the interaction between the HER3 binding polypeptide and HER3 may for example be 5 times, 10 times or 100 times the KD value of the interaction between the HER2 binding polypeptide and HER2.
In one embodiment, the HER2 binding polypeptide of the bispecific ligand is an engineered polypeptide. The HER2 binding polypeptide may be an engineered polypeptide which is a variant of a protein scaffold, which variant has been selected for its specific binding affinity for HER2. Non- limiting examples of a protein scaffold are selected from the group consisting of staphylococcal protein A, and domains and derivatives thereof. In some embodiments, the HER2 binding polypeptide is an engineered protein derived from domain B of Protein A from Staphylococcus aureus. The engineered protein may in particular comprise a protein Z derivative, which is a variant of protein Z which is derived from said domain B of Protein A.
In some embodiments of the ligand, the engineered HER2 binding protein comprises an amino acid sequence selected from
i) YAKEM RNAYW EIALL PNLTN QQKRA FIRKL YDDPS QSSEL
LSEAK KLNDS Q, corresponding to SEQ ID NO:1003; and ii) an amino acid sequence which has at least 80 % identity to the sequence defined in i).
Linking of the HER3 binding polypeptide and the HER2 binding polypeptide may for example be provided by a peptide linker comprising from 1 up to 45 amino acids. A linking moiety may in particular be arranged for coupling the N- and/or C-terminals of the HER3 binding polypeptide and the HER2 binding polypeptide. The linking thus provided may be selected from C- to C-terminal linking, C- to N-terminal linking or N- to C-terminal linking.
Coupling of the linking moiety to the HER3 binding polypeptide and the HER2 binding polypeptide may e.g. be accomplished by means of chemical conjugation (using known organic chemistry methods) or by any other means, such as expression of the ligand as a fusion protein.
The ligand may, as described above, further comprise a half life extending moiety for extension of ligand half life in vivo. Half life extension may be accomplished by a number of different half life extending moieties, and non-limiting examples of such moieties are selected from albumin, albumin binding moieties as defined above in connection with the HER3 binding polypeptide, the Fc-part from IgG, and polymeric compounds such as polyethylene glycol (PEG). Coupling of the ligand to serum albumin, which is the most abundant protein in mammalian sera, may provide extension of ligand half life in vivo.
In particular, the albumin binding moiety may be an engineered protein derived from domain GA3 of streptococcal Protein G, such as an albumin binding moiety comprising an amino acid sequence selected from
i) LAEAK VLANR ELDKY GVSDF YKRLI NKAKT VEGVE ALKLH
ILAAL P; as set out in SEQ ID NO:1005; and
ii) an amino acid sequence which has at least 80 % identity to the
sequence defined in i).
The half life extending moiety may for example be connected to the remainder of the ligand by covalent coupling using known organic chemistry methods, or joined in any other fashion, directly or mediated by a linker comprising a number of amino acids. When the half life extending moiety is represented by albumin or an albumin binding moiety, the ligand may in itself be expressed as one or more fusion polypeptides in a system for recombinant expression of polypeptides. In one embodiment, the half life extending moiety is attached to the remainder of the ligand via a cysteine residue present in the ligand. In particular, the half life extending moiety may be attached to a cysteine residue of the HER3 or the HER2 binding polypeptide, introduced at a site distant from the binding motif. In another embodiment, the half life extending moiety is attached to the remainder of the ligand via the linking moiety.
In a specific embodiment, the linking moiety comprises a half life extending moiety as defined above. Thus, albumin, albumin binding moieties or PEG may for example be employed for connecting the HER3 binding polypeptide with the HER2 binding polypeptide.
In some embodiments, a ligand according to the invention may comprise further C terminal or N terminal amino acids. Such further amino acids may, as described above as regards the HER3 binding polypeptide, individually or collectively be added in order to for example, improve production, purification, stabilization in vivo or in vitro, coupling, or detection of the polypeptide. In certain embodiments, the further amino acids may constitute one or more polypeptide domain(s). The function of such a further polypeptide domain may be the same as, or different from, the functions already comprised in the ligand. A further polypeptide domain may for example provide the ligand with another HER3 binding function and/or another HER2 binding function. Thus, a bispecific ligand according to the invention may comprise multimers of HER3 binding functions and/or multimers of HER2 binding functions. One example of bispecific ligand comprising multimeric binding functions is a ligand comprising two HER3 binding polypeptides and two HER2 binding polypeptides.
A ligand as defined above may, in one embodiment, prevent dimerization of HER2 and HER3 in vivo. More specifically, the ligand may, e.g. by binding to HER2 and/or HER3 expressed on a cell surface in a mammalian subject, inhibit HER3 mediated signaling in the subject. Due to the bispecific nature of the ligand, it may bind to and block the two receptors in a position such that they are no longer able to exert signaling. As the skilled addressee will understand, a ligand according to the invention may
accordingly be utilized for the treatment of conditions associated with expression, and in particular over-expression, of HER2 and/or HER3 on the cell surface.
HER3 can however also form heterodimers with EGFR, thus forming an active signaling unit activating the PI3K/Akt pathway (Engelman et al, Proc Natl Acad Sci 102(10):3788-93 (2005)). Indeed, HER3 is over-expressed in non-small cell lung cancer (NSCLC), apparently because of up-regulation of ErbB ligands (Fujimoto et al, Cancer Res 65(24):1 1478-85 (2005)), whereas HER3 is not expressed in normal lung epithelium. Thus, in a related aspect, there is provided a ligand having binding affinity for HER3 and for EGFR, comprising a HER3 binding polypeptide as defined above; an EGFR binding polypeptide; and a linking moiety for linking the HER3 binding polypeptide with the EGFR binding polypeptide. It should be understood that features described in the above aspects of the invention are also applicable to this aspect of the invention. In particular, such a bispecific ligand may target HER3 and EGFR and exert similar, or the same, modes of action as described above for the bispecific ligand binding to HER3 and HER2.
Examples of a bispecific ligand binding to HER3 and EGFR may comprise an EGFR binding polypeptide selected from
i) YAKEM WIAWE EIRNL PNLNG WQMTA FIAKL LDDPS QSSEL
LSEAK KLNDS Q, corresponding to SEQ ID NO:1004; and ii) an amino acid sequence which has at least 80 % identity to the
sequence defined in i).
Other examples of EGFR binding polypeptides that may be used in a HER3 and EGFR binding ligand are disclosed in WO2007/065635.
In other embodiments, the HER3 binding polypeptide or bispecific ligand according to the invention may be used in targeting therapeutic or diagnostic agents to cells expressing HER3, both in vivo and in vitro, particularly to cells which over-express HER3. As discussed above, a ligand according to the invention may be utilized in targeting cells that express, or over-express, HER3 and/or HER2, or HER3 and/or EGFR. In a related aspect, there is thus provided a combination of a HER3 binding polypeptide as defined herein, or a ligand as defined above, and a therapeutic agent. Non-limiting examples of therapeutic agents are selected from cytotoxic payloads, such as radionuclides, small molecular drugs or toxins. Such therapeutic agents may be chemically conjugated or otherwise bound to the HER3 binding polypeptide or ligand.
A combination, a HER3 binding polypeptide or a ligand according to the invention, may furthermore be used as a medicament in therapy, for example for the treatment of a HER3 related condition, such as a HER3 related condition in a mammal, such as a human subject, selected from cancer disease, such as colon cancer, endometrial cancer, gastric cancer, glioma, breast cancer, pancreas cancer, head and neck squamous carcinoma, lung cancer, melanoma, medulloblastoma, neuroepithelioma, ovarian cancer, Paget's disease, papillary thyroid cancer, prostate cancer, skin squamous cell carcinoma, transitional cell carcinoma and vestibular schwannoma. Thus, use of a HER3 binding polypeptide or a ligand according to the invention for the manufacture of a medicament for treatment of a HER3 related condition, such as the HER3 related conditions mentioned above, is also within the scope of the present invention.
In a related aspect, there is provided a method of treatment of a HER3 related condition, comprising administering of a HER3 binding polypeptide, or ligand or combination as described above to a mammalian subject in need thereof. Consequently, in the method of treatment, the subject is treated with a HER3 binding polypeptide, a ligand or a combination according to the invention. In a more specific embodiment of said method, the binding of the HER3 binding polypeptide, the ligand or the combination to a HER3
expressed on a cell surface in the subject inhibits receptor activation. Said binding may for example inhibit HER3 mediated signaling. In one embodiment of the method of treatment, said HER3 related condition is selected from cancer disease, such as colon cancer, endometrial cancer, gastric cancer, glioma, breast cancer, pancreas cancer, head and neck squamous
carcinoma, lung cancer, melanoma, medulloblastoma, neuroepithelioma, ovarian cancer, Paget's disease, papillary thyroid cancer, prostate cancer, skin squamous cell carcinoma, transitional cell carcinoma and vestibular schwannoma.
In another embodiment, there is provided a method of treatment of a HER3 and/or HER2 related condition, comprising administering of a ligand according to the invention to a mammalian subject in need thereof.
As understood by the skilled person and as discussed above, a HER3 binding polypeptide or a ligand according to the invention may be used in diagnosis, such as in the diagnosis of a HER3 or a HER3 and/or HER2 related condition. A HER3 binding polypeptide according to the invention may be employed separately or in combination with a diagnostic agent. Such a combination may be used in the diagnosis of a HER3 related condition, for example in molecular imaging of cells over-expressing HER3.
The invention will now be further illustrated by the following non-limiting Examples. Brief description of the figures
Figure 1 is a listing of the amino acid sequences of examples of HER3 binding motifs comprised in HER3 binding polypeptides of the invention (SEQ ID NO:1 -334), examples of 49-mer HER3 binding polypeptides according to the invention (SEQ ID NO:335-668) and examples of 58-mer HER3 binding polypeptides according to the invention (SEQ ID NO:669-1002), an example of a HER2 binding polypeptide (SEQ ID NO:1003) comprised in a ligand according to the invention, an example of an albumin binding moiety (SEQ ID NO:1005) as may be comprised in one embodiment of a ligand according of the invention, an example of an EGFR binding polypeptide (SEQ ID NO:1004) which may be comprised in one embodiment of a ligand according to the invention, as well as the sequences of protein Z (SEQ ID NO:1006), and the sequences of the extracellular domain of HER3 (SEQ ID NO:1007), the extracellular domain of HER2 (SEQ ID NO:1008) and the extracellular domain of HER4 (SEQ ID NO:1009).
Figure 2A-Q show the result of a dot blot assay performed using periplasmic fractions from individual HER3 binding Z variants expressed as fusions to the HSA binding domain ABD. The potential background binding to 21 control proteins as well as binding to HER3-ECD and HER3-Fc were analyzed. Proteins were dotted on the membrane in three rows from left to right in the following order;
Row 1 : HSA, IgG, IgM, IgA, alpha-2 macroglobulin, fibrinogen, holo- transferrin, alpha-1 -antitrypsin,
Row 2: C3, haptoglobulin, alpha-1 acid glycoprotein, alpha-1
antichymotrypsin, C4, mouse IgE kappa, hemopexin, transthyretin,
Row 3: streptavidin, neutravidin, HER2-ECD, HER3-Fc, HER4-Fc, HER3-ECD and HER4-ECD.
The images show response of A) Z01748, B) Z01813, C) Z01814, D) Z01815, E) Z02009, F) Z01821 , G) Z02010, H) Z01824, I) Z01825, J)
Z01817, K) Z01818, L) Z01820, M) Z01826, N) Z01828, O) Z0201 1 , P)
Z01830, and Q) the product from pAY01247, which expresses only ABD, as a negative control.
Figure 3A-F show images from the immunofluorescence experiment described in Example 2. HER3 positive AU566 cells (A-D) and HER2 positive and HER3 negative SKOV-3 cells (E-F) were stained with HER3 specific Z variants or controls according to the following: A) His6-(Z01814)2-cys, B) His6- (Z01820)2-cys, C) anti-HER3 antibody (positive control), D) (Z01 154)2
(negative control Z variant), E) His6-(Z01814)2-cys, F) His6-(Z01820)2-cys.
Figure 4 is a schematic representation of the staphylococcal display vector (A) used for cell display of HER3 binding polypeptides of the invention on the surface of S. carnosus (B). The vector pSCZ1 (A) contains: i) a promoter and secretion signal (S) from a lipase gene (expressed on the surface of the related Staphylococcus hyicus), ii) a gene fragment encoding a propeptide (PP) from the same lipase gene, which has been demonstrated to be important for efficient translocation of recombinant proteins, iii) a cell-wall anchoring region (XM), originating from staphylococcal Protein A, iv) an albumin binding protein (ABP, Samuelson et al, J Bacteriology 177(6):1470- 1476, (1995)) from streptococcal Protein G introduced to provide surface expression level normalization of the target binding signal, v) a staphylococcal origin of replication and chloramphenicol acetyl transferase gene (Cmlr) for stable replication and expression in staphylococci, and vi) an origin of replication for E. coli (OriE) as well as a β-lactamase gene (Bla), facilitating subcloning work in E. coli.
Figure 5 shows density plots as a result from flow-cytometric sortings of SC:ZHER3LIB- The plots show FL-4 channel fluorescence intensity
corresponding to surface expression level (monitored via HSA binding) on the x-axis and FL-1 channel fluorescence corresponding to HER3 binding on the y-axis. The density plots show the staphylococcal library before flow- cytometric sorting round 1 , 2, 3 and 4, respectively, with the regions used in gating outlined as a box in each plot.
Figure 6A-D show histogram representations of a cell-based flow cytometry assay where FACS isolated cells displaying Z variants in fusion to an albumin binding protein (ABP) were incubated with fluorescently labeled HER3-Fc and fluorescently labeled HSA. The ratio of HER3 binding signal (MFI, FL-1 ) and HSA binding signal (MFI, FL-4) is on the y-axis. All FL-1/FL-4 ratios are normalized; A) with the FL-1 /FL-4 ratio of Z05405 and B-D) with the FL-1 /FL-4 ratio of a first generation binder (Z01753). 45 individual clones were analyzed in 4 separate assays (A-D) where Z05405 and Z05409 were included in all assays for comparison. A) shows cell-based flow cytometry assay results of Z05403-Z05415, B) shows cell-based flow cytometry assay results of Z05416-Z05426, C) shows cell-based flow cytometry assay results of Z05427-Z05434 and D) shows cell-based flow cytometry assay results of Z05435-Z05447. Figure 7A-D show sensorgrams from surface plasmon resonance (SPR) kinetic analyses of four different Z variants in four different
concentrations. The uppermost curve in each sensorgram corresponds to the highest concentration of injected Z variant, the second curve from the top corresponds to the second highest concentration, the third curve from the top corresponds to the third highest concentration etc. The Z variants Z05405 (A) in concentrations of 46, 15, 1 .5 and 1 .5 nM, Z05413 (B), in concentrations of 57, 19, 6.3 and 1 .9 nM, Z05416 (C), in concentrations of 67, 22, 7.5 and 2.2 nM and Z05417 (D), in concentrations of 59, 20, 6.5 and 2 nM, were injected over a surface immobilized with human HER3-Fc and dissociation constants based on kon and k0ff were determined.
Figure 8A-B show sensorgrams from SPR competition analyses of Z05417 with heregulin. A) shows a sensorgram resulting from injections of HER3-Fc, alone and preincubated with 40-fold molar excess of Z05417, over a surface immobilized with human heregulin. B) shows a sensorgram resulting from co-injection of Z05417 with heregulin over a surface
immobilized with human HER3-Fc. Z05417 was injected in duplicates in five different concentrations, 10 nM, 5 nM, 1 nM, 0.5 nM and 0 nM. The uppermost curve corresponds to the highest concentration of injected
Z05417, the second curve from the top corresponds to the second highest concentration, the third curve from the top corresponds to the third highest concentration etc.
Figure 9 shows a diagram over the percentage of HER3
phosphorylation in the absence and presence of HER3 binding Z variants. MCF-7 cells were stimulated with 5 nM heregulin in the absence of Z variants (100 % phosphorylation, filled bars) and in the presence of the HER3 binding Z variants Z05416 and Z05417 and the negative control Z01 155 (taq polymerase binding Z variant, striped bars) or with medium alone (open bars).The diagram shows the percentage of HER3 phosphorylation in the presence of Z variants or medium compared to heregulin-induced HER3 phosphorylation (100 %). Examples
Example 1 : Selection and screening of HER3 binding polypeptides Material and methods
Labeling of HER3 and HSA: Biotinylation of recombinant human HER3/Fc chimera (R&D Systems, #348-RB-050), here denoted HER3-Fc, was performed using the Biotin-XX Microscale Protein Labeling Kit (Invitrogen, #B30010) according to the supplier's recommendations. The extracellular domain of HER3 (SEQ ID NO:1007), here denoted HER3-ECD, was biotinylated using EZ-Link™-Sulfo-NHS-LC-LC-Biotin (Pierce, #21338) according to the supplier's recommendations. Human serum albumin (HSA; Sigma, #A-3782) was fluorescently labeled using Alexa Fluor® 647
succinimidyl ester (Invitrogen, #A20006) according to the supplier's
recommendations. The protein buffer was changed to PBS (10 mM
phosphate, 137 mM NaCI, 2.68 mM KCI, pH 7.4) or PBS supplemented with 0.1 % Pluronic® F108 NF Surfactant (PBSP; BASF Corporation, #30085231 ) in order to remove any excess biotin or fluorophore.
Phage display selection of HER3 binding polypeptides: A library of random variants of Z molecules displayed on bacteriophage, denoted Zlib2002, constructed in phagemid pAffi1/pAY00065 as described in Gronwall et al, J Biotechnol 128:162-183 (2007), was used to select HER3-ECD-binding polypeptides. Preparation of phage stocks from the phagemid library, as well as between rounds of selection, was performed according to previously described procedures (Nord et al, Nat Biotech 15:772-777 (1997); Hansson et al, Immunotechnology 4:237-252 (1999)) using the helper phage M13K07 (New England Biolabs, #NO315S). The Escherichia coli amber suppressor strain RR1AM15 (Ruther, Nucleic Acids Res 10:5765-5772, 1982) was used for all cloning procedures and as host for phage production.
The phage selection was performed in solution using biotinylated HER3 protein and streptavidin-coated paramagnetic beads (Dynabeads® M- 280 Streptavidin, Dynal #1 12.06) for capture of bound phages. In addition, phage selection was performed on solid phase using HER3-ECD immobilized on MaxiSorp immunotubes (Nunc). Unspecific binding of phage particles was minimized by pre-treatment of all tubes and beads with PBST 0.1 -gelatin (PBS supplemented with 0.1 % Tween-20 and 0.1 % gelatin). Selection was performed in four cycles. All selections were performed in PBST 0.1 -gelatin and in a volume of 1 ml.
For the selection performed in solution, four cycles of selection were performed at room temperature (RT) using different concentrations of biotinylated recombinant HER3-ECD as target protein. Phage stocks used in cycle 1 and 2 were pre-incubated with 0.1 mg strepavidin coated beads for 1 h to remove streptavidin binding phages. In cycle 1 , phage particles from the Zlib2002 library were incubated with 100 nM of biotinylated HER3-ECD in PBST 0.1 -gelatin for 2 hours. The subsequent selection cycles were divided into two selection tracks for which the target concentration was lowered to 50 (track 1 ) or 20 nM (track 2) for cycle 2, 20 (track 1 ) or 10 nM (track 2) for cycle 3 and 20 (track 1 ) or 5 nM (track 2) for cycle 4. The bound phages were captured with streptavidin-coated M-280 Dynabeads®, allowing an
immobilization of 4 g of HER3-ECD per milligram of beads.
For selection on solid phase, immunotubes were immobilized with 1 ml
HER3-ECD, 10 pg/ml in 50 mM sodium carbonat buffer, pH 9.6 for 1 .5 h at RT and thereafter blocked with 3 ml PBST 0.1 -gelatin for 1 h at RT. Phage stock was added to the tube and incubated for 2 h.
For both selection strategies, the number of washes with PBST 0.1 - gelatin was increased between rounds in order to increase selection stringency. Therefore, washes were performed twice in cycle 1 , three times in cycle 2, six times in cycle 3 and 12 times in cycle 4. The bound phage particles were eluted with 0.1 M glycine-HCI (pH 2.2) followed by immediate neutralization with 1 M Tris-HCI (pH 8). The phage-containing eluate was used to infect log phase RR1AM15 cells and phagemid particles were rescued from infected cells using helper phage M13K07. The selection process was monitored by titration of phage stocks before each selection round and after elution from target protein. Serial dilutions of phage solutions were used for infection of log phase RR1AM15 cells.
ELISA screening of Z variants: To test if the Z variant molecules could indeed interact with HER3, two different ELISA were performed, one using
biotinylated HER3-ECD and the second using HER3-Fc as target protein. The Z variants were produced by inoculating single colonies, prepared as described above, in 1 ml TSB-YE medium (30 g/l TSB, 5 g/l yeast extract) supplemented with 100 g/ml ampicillin and 0.1 mM isopropyl- -D-1 - thiogalactopyranoside (IPTG) in deep-well plates (Nunc #278752). As a negative control, an insulin-binding Z variant (Z00801 ) was inoculated and grown in each plate. The plates were incubated for 18-24 h at 37 °C. After incubation, replica plates were made by transferring a small fraction of each culture to 96-well plates with 15 % glycerol for storage at -20 °C. Remaining cells were pelleted by centrifugation, re-suspended in 300 μΙ PBST 0.05 (PBS supplemented with 0.05 % Tween 20) and frozen at -80 °C to release the periplasmic fraction of the cells. Frozen samples were thawed in a water bath and cells were pelleted by centrifugation. The periplasmic supernatant contained the Z variants as fusions to the albumin binding domain from GA3 of Protein G from Streptococcus strain G148, expressed as AQHDEALE- [Z#####]-VDYV-[ABD]-YVPG (Gronwall et al, supra). Z##### refers to individual Z variants.
Half area 96 well ELISA plates (Costar #3690) were coated with 50 μΙ/well of coating buffer (50 mM sodium carbonate, pH 9.6) containing 6 g/ml human serum albumin (HSA, Sigma #A3782), and incubated over night (ON). The HSA solution was poured off and the wells were blocked with 100 μΙ of PBST 0.1 supplemented with 2 % non-fat dry milk solution (Semper AB) for 1 h at RT. The blocking solution was discarded and 50 μΙ of periplasmic solution was added to each well and incubated for 1 .5 h at RT under slow shaking. The supernatants were poured off and the wells were washed 4 times with PBST 0.05. 50 μΙ of HER3-Fc at a concentration of 0.5 g/ml in PBST 0.05 or biotinylated HER3-ECD at a concentration of 1 μg ml in PBS were added to each well. The plates were incubated for 1 .5 h at RT followed by wash 4x in PBST 0.05. In HER3-Fc plates, an antibody against human Fc (DAKO Cytomation, #P0214), labeled with horseradish peroxidase (HRP) and diluted 1 :4000 in PBST 0.05, was added to the wells and incubated for 1 h at RT. In the plates with biotinylated HER3-ECD, streptavidin conjugated with HRP (DAKO, #P0397) was added to each well diluted 1 :5000 in PBST 0.05. After washing as described above, 50 μΙ ImmunoPure TMB substrate (Pierce #34021 ) was added to the wells and the plates were treated according to the manufacturer's recommendations. All steps from blocking to reading were performed in a Tecan Genesis Freedom 200 robot (Tecan Group LTD). Absorbance of the wells was read at 450 nm in an ELISA reader Tecan Ultra 384 (Tecan) and evaluated with Magellan v. 5.0 software (Tecan).
Sequencing: Based on the ELISA screening, a part of all clones regarded as positive were picked for sequencing. PCR fragments were amplified from single colonies using a standard PCR program and the primers AFFI-21 (5'- tgcttccggctcgtatgttgtgtg) and AFFI-22 (5'-cggaaccagagccaccaccgg). Sequencing of amplified fragments was performed using the biotinylated oligonucleotide AFFI-72 (5'-biotin-cggaaccagagccaccaccgg) and a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), used in accordance with the
manufacturer's protocol. The sequencing reactions were purified by binding to magnetic streptavidin coated beads using a Magnatrix 8000 (Magnetic Biosolution), and analyzed on ABI PRISM® 3100 Genetic Analyzer (PE Applied Biosystems). The sequencing results were imported and analyzed with an ALD LIMS Nautilus™ 2003 R2 B3 software (Thermo Electronics Corp.).
Dot blot analysis: The produced HER3 binding Z variants were tested for specificity by dot blot analysis against alpha-2 macroglobulin (MP
biomedicals/Cappel, #55833), alpha-1 acid glycoprotein (RDI, #RDI-SCP- 153-1 ), alpha-1 antichymotrypsin (RDI, #RDI-SCP-159-0), alpha-1 -antitrypsin (RDI, #RDI-SCP-165-5), C3 complement (RDI, #RDI-SCP-150-0), C4 complement (RDI, #RDI-SCP-151 -0), fibrinogen (Enzyme research,
#031015E), haptoglobulin (RDI, #RDI-SCP-1 19-1 ), hemopexin (Agilent), holo- transferrin (Sigma, #T0665), human IgA (Bethyl, #P80-102), mouse IgE kappa (BD, #55079), human IgG (Sigma, #G4386), human IgM (Sigma, #18260), human serum albumin (HSA, Sigma, #A3782), neutravidin (Pierce, #31000), streptavidin (Pierce, #21 122), transthyretin (Sigma, #P1742), HER2- ECD (SEQ ID NO:1008), HER3-ECD (SEQ ID NO:1007), HER3-Fc (R&D Systems), HER4-ECD (SEQ ID NO:1009), HER4-Fc (R&D Systems).
The Z variants were produced in essentially the same manner as described under ELISA screening in order to obtain periplasmic supernatants containing soluble protein. The supernatants were filtered using 0.45 μιτι membranes.
Nitrocellulose membranes (Invitrogen) were dotted with 1 μΙ of each protein at a concentration of 0.25 mg/ml, except for HER3-ECD and HER4- ECD that had a concentration of 0.29 mg/ml and 0.14 mg/ml, respectively. The membranes were blocked ON in PBST 0.1 supplemented with 0.5 % casein (blocking solution) at 4 °C. After removal of the solution, the
membranes were incubated for 1 h with periplasmic supernatants
supplemented with 0.5 % casein. The membranes were washed 3 times very briefly and 4 x 5 minutes in PBST 0.1 . The Z variants were detected with a ABD fused hyperimmune polyclonal rabbit Ig against an epitope common for all Z variants (produced in house) diluted 1 :5000 in PBST blocking solution by incubation for 1 h at RT. After washing as above an antibody against rabbit IgG conjugated with HRP (DAKO Cytomation, #P0448), diluted 1 :5000 in blocking solution, was added to the membranes, followed by incubation of the membranes for 1 h at RT. The membranes were washed, rinsed in PBS and soaked with Supersignal (Pierce #34075). Light emissions were
photographed with a Chemilmager 5500 (Alpha Innotech Corp.)
Subcloning of Z variants: Dimeric Z variants were amplified from
pAffi1 pAY00065 vectors. A PCR was performed using different primer pairs and the resulting gene fragments were purified and hybridized in ligase buffer. The hybridized gene fragments were subcloned in the pAY00430 vector, providing an N-terminal His6 tag and a C-terminal cysteine (His6-(Z#####)2- Cys). The HER3 binding Z variants were subcloned as dimers and the constructs encoded by the expression vectors were MGSSHHHHHHLQ- [Z#####][Z#####]-VDC. A three parts ligation was used for insertion of both insert fragments into the vector at the same step. Hybridized gene fragments and /Accl-digested and dephosphorylated expression vectors were ligated in ligase buffer and electroporated into electrocompetent E. coli TOP10 cells. The transformed cells were spread on TBAB plates (30 g/l tryptose blood agar base) supplemented with 50 g/ml of kanamycin, followed by incubation at 37 °C overnight. The colonies were screened using PCR and the lengths of the PCR fragments were verified on agarose gels. To verify the sequences, sequencing was performed as described above. Plasmid DNA stock was prepared from the sequenced clones and deposited in -80 °C. In addition, E. coli BL21 (DE3) cells were transformed with the plasmids through
electroporation.
Results
Phage display selection of HER3 binding polypeptides: Four rounds of phage display selection were run against biotinylated or non-biotinylated human HER3-ECD. The four selection cycles were performed in solution with biotinylated target at two different target concentrations or on solid phase with non-biotinylated target. In solution, phage particle target complexes were captured onto streptavidin-coated beads. For each selection cycle, the number of washes was increased. The phage particle titers and yields were calculated after each selection cycle. The phage particle yield (phage particles out phage particles in) increased for the third or last cycle indicating an enrichment in target binding clones.
ELISA screening of Z variants: The clones obtained after four cycles of selection were produced in 96-well plates and screened for HER3-ECD and HER3-Fc-binding activity in an ELISA. In total, 93 clones from each selection track were screened. The absorbance measurements showed that, independently of selection strategy, approximately 90 % of the clones were positive for HER3, defined as a response two times the signal for the negative control. A Z variant molecule binding to insulin was used in negative and positive control experiments. The positive control was detected with
biotinylated insulin and for the negative control the target protein was omitted. Sequencing: Sequencing was performed for clones selected on the basis of having variying signal absorbance values against HER3-Fc in ELISA screening, thus obtaining many different representative binders for the sequencing. In total, 135 HER3 positive clones were sequenced. Half of the clones were found in several copies resulting in total 23 new clones whereof two were identified as background binders. Each variant was given a unique identification number #####, and individual variants are referred to as
Z#####. The amino acid sequences of the 58-mer Z variants are listed in Figure 1 and in the sequence listing as SEQ ID NO:669-689. The deduced HER3 binding motifs of these Z variants are listed in Figure 1 and in the sequence listing as SEQ ID NO:1 -21 . The amino acid sequences of the 49- mer polypeptides predicted to constitute the complete three-helix bundle within each of these Z variants are listed in Figure 1 and in the sequence listing as SEQ ID NO:335-355.
Dot blot analysis: The specificities of 16 of the sequenced unique HER3- bindning polypeptides (in the form AQHDEALE-[Z#####]-VDYV-[ABD]-YVPG) were tested using dot blot analysis. 23 different proteins were blotted onto nitrocellulose membranes. The 23 proteins included 16 highly abundant human serum proteins, HER2-ECD, HER3-ECD and HER3-Fc and HER4- ECD and HER4-Fc. All Z variant fusion proteins except Z01824 bound to human to HSA as well as HER3-ECD and HER3-Fc in a specific way. Thus, the specificity of the tested Z variants was satisfying (Figure 2).
Subcloning of Z variants: 16 of the unique clones were chosen for subcloning in the expression vector pAY004308 as dimers. The cloning resulted in 15 dimers of HER3-bindning Z variants (dimers of Z01748, Z01749, Z01751 , Z01753, Z01814, Z01815, Z01817, Z01820, Z01821 , Z01826, Z01828, Z01830, Z02009, Z02010 and Z0201 1 ).
Example 2: Production and characterization of Z variants Materials and methods
Protein expression and purification: Transformed E. coli BL21 (DE3) cultures as subcloned in Example 1 were grown in TSB-YE to an optical density of approximately 1 . The protein expression was then induced by addition of 1 M IPTG to a final concentration of 0.5 mM. Cultures were harvested 5 h after induction by centrifugation. The supernatants were discarded and the cell pellets were collected and stored at -20 °C.
The HER3 binding Z variants were purified from cell pellets under denatured conditions on 1 .5 ml Ni-NTA Superflow Columns (Qiagen) and buffer was exchanged to PBS using PD-10 columns (GE Healthcare). Purified Z variants were aliquoted and stored at -80 °C.
Protein characterization: The concentration of purified Z variants (in His6- (Z#####)2-Cys form) was determined by absorbance measurements at 280 nm. The purity was estimated by SDS-PAGE analysis on 10 wells 4-12 % NuPAGE™ gels (Invitrogen) using Coomassie blue staining. To verify the identity and to determine the molecular weights of purified Z variants, LC/MS- analyses were performed on an Agilent 1 100 LC/MSD system (Agilent Technologies).
CD analysis: The purified Z variants were thawed and diluted to 0.5 mg/ml in PBS. For each diluted Z variant, a CD spectrum at 250-195 nm was obtained at 20 °C. In addition, a variable temperature measurement (VTM) was performed to determine the melting temperature (Tm). In the VTM, the absorbance was measured at 220 nm while the temperature was raised from 20 to 90 °C, with a temperature slope of 5 °C/min. The CD measurements were performed on a Jasco J-810 spectropolarimeter (Jasco Scandinavia AB) using a cell with an optical path-length of 1 mm.
Immunofluorescence staining: The HER3 positive human mammary gland cell line AU565 (ATCC, #CRL-2351 ) and HER3 negative human ovary carcinoma cell line SKOV-3 (Ecacc, #91091004) were cultured as recommended by the supplier. The day before assay, 25000 cells were added to each well of multi well slides (eight wells per slide, Histolab #ER-201 -1 B) and allowed to grow ON in a CO2 incubator to take on a flattened morphology. The slides were gently washed in PBS by adding droplets onto the slide with a Pasteur pipette.
Two experiments were performed. In the first, AU565 cells were stained with 1 1 different HER3 specific Z variants; His6-(Z01748)2-Cys, His6- (Z01749)2-Cys, His6-(Z01751 )2-Cys, His6-(Z01753)2-Cys, His6-(Z01814)2-Cys, His6-(Z01815)2-Cys, His6-(Z01817)2-Cys, His6-(Z01820)2-Cys, His6-(Z01828)2- Cys, His6-(Z01830)2-Cys and His6-(Z0201 1 )2-Cys. The second experiment was performed with His6-(Z01814)2-Cys and His6-(Z01820)2-Cys, and with (Z01 154 )2 as a negative control Z variant. The staining was performed on slides with HER3 positive AU565 and HER3 negative SKOV-3 cells. An anti- HER3 antibody from R&D Systems (#AF234) was included as a positive control in both experiments.
In both experiments, the Z variants were added to the wells at a concentration of 15 g/ml in PBS and all dilutions of reagents were made in PBS as well as all washes. After 1 hour of incubation at RT, the multiwell slides were gently washed as described above and goat anti-Affibody molecule Ig (Affibody AB, #20.1000.01 .0005) was added to each well at a concentration of 5 g/ml. After 45 minutes of incubation at RT, the slides were gently washed as described above and 5 g/ml of a chicken anti-goat Alexa Fluor488 (Invitrogen, #A21467) was added to each well. After an additional 45 minutes of incubation, the slides were gently washed. The positive control, goat anti-HER3 antibody was used at a concentration of 15 g/ml followed by 5 g/ml of chicken anti-goat Alexa Fluor488. After completed staining, the cells were fixed in 3 % formaldehyde (Sigma, #1365) in PBS for 10 minutes at RT. Slides were then rinsed twice, dried and mounted with anti-fading solution containing DAPI (4',6-diamidine-2-phenyl indole, Vector laboratories,
#1-11200). The staining was documented using a LEICA DMLA microscope equipped with a video camera for live imaging.
On-cell affinity ranking using flow cytometry: The full gene sequences encoding Z variants Z01751 , Z01753, Z01814 and Z01820 were PCR amplified from their corresponding pAY00430 vector constructs and ligated to the staphylococcal display vector pSCZ1 (Kronqvist et al, Protein Eng Des Sel 21 :247-255 (2008)), previously digested with restriction enzymes Xho\ and Sa/I (New England Biolabs). The E. coli strain RR1AM15 was used as host for plasmid construction and preparation and the constructs were transformed to electrocompetent Staphylococcus carnosus TM300 (Gotz, Soc Appl Bacteriol Symp Ser. 19:49-53 (1990)) according to a previously described protocol (Lofblom et al, J Appl Microbiol 102:736-747 (2007)). Staphylococcal cells individually displaying the four different Z variants were inoculated to 10 ml TSB-YE supplemented with 20 g/ml chloramphenicol and grown ON at 37 °C and 150 rpm. From the cultures, 106 cells were washed with 1 ml PBSP. The cells were pelleted by centrifugation (3500 x g, 4 °C, 6 min) and resuspended in 100 μΙ of PBSP containing different concentrations of biotinylated HER3-Fc (5, 20, 50 and 100 nM; see Example 1 for biotinylation). Equilibrium binding was reached by incubation at RT for 1 h with gentle mixing. The cells were washed once with 1 ml ice-cold PBSP, followed by incubation on ice in 100 μΙ ice-cold PBSP containing 1 .25 g/ml Alexa Fluor® 488-conjugated strepavidin (Invitrogen, #S32354) and 225 nM Alexa Fluor® 647-conjugated HSA (see Example 1 ) for 40 min. Following one wash with 1 ml ice-cold PBSP, cells were resuspended in 300 μΙ ice-cold PBSP prior to flow-cytometric analysis. The mean fluorescence intensity (MFI) was measured using a FACS Vantage SE (BD Biosciences) flow cytometer.
Results Protein expression and purification: The 15 dimeric Z variant molecules (in His6-(Z#####)2-Cys form) yielded acceptable production levels of soluble product and the purity of produced batches was estimated to exceed 90 % by SDS-PAGE analysis, except for two Z variants (His6-(Z01826)2-Cys and His6- (Z02009)2-Cys) that did not meet that criteria. The LC/MS analysis verified the correct molecular weight for all pure Z variant molecules.
CD analysis: The CD spectrums showed that the Z variant molecules had a-helical structures at 20 °C. This result was also verified in the variable temperature measurements where the melting temperatures (Tm) were determined (Table 1 ). Table 1 . Melting temperatures for the Z variants
Figure imgf000034_0001
Immunofluorescence staining: Immunofluorescence microscopy was employed for characterization of specificity and binding activity to native HER3 expressed on human cancer cells. Eleven clones, showing positive signals in the ELISA screening of Example 1 , were produced as dimers fused to an N-terminal His6-tag and a C-terminal cysteine. Each Z variant was incubated on HER3 positive AU565 cells (human mammary mammary gland cell line). An anti-HER3 antibody was used as positive control. The cells were fixed after the staining procedure. Of eleven binders, 6 gave a membrane bound staining pattern. The background was high for some Z variants and in some cases it was difficult to judge if they were specific or not. Two of the HER3 specific molecules, His6-(Z01814)2-Cys and His6-(Z01820)2-Cys were selected for additional analysis on both HER3 positive AU565 cells and HER2 positive- and HER3 negative SKOV-3 cells (human ovary carcinoma cell line). Distinct cell membrane staining was obtained on AU565 but not on SKOV-3 cells demonstrating selectivity of the Z variants for HER3 over HER2 (Figure 3).
On-cell affinitv ranking using flow cvtometrv: To further characterize the HER3 binding molecules and to verify functional expression on bacterial cells, four of the HER3 binding molecules showing specificity for HER3 in immunofluorescence staining were employed for an on-cell affinity ranking experiment using staphylococcal cell display and flow cytometry. Monomer constructs of the four variants were subcloned to the staphylococcal display vector for subsequent transformation to the staphylococcal host.
Staphylococcal cells displaying the four Z variants, respectively, were incubated with four concentrations of biotinylated HER3-Fc ranging from 5- 100 nM. Cells were analyzed using flow cytometry, revealing efficient expression on the cell surface and specific binding to HER3 for all four variants with no significant difference in relative affinity among the clones (data not shown). Biotinylated HER2 was used as negative control in the experiments and no cross-specificity was observed, confirming the results from the dot blot made with periplasmic supernatants in Example 1 and the immunofluorescence staining in this Example. Example 3: Design and construction of a maturated librarv of HER3 binding Z variants
In this Example, a maturated library was constructed. The library was used for selections of HER3 binding polypeptides. Selections from maturated libraries are usually expected to result in binders with increased affinity (Orlova et al, Cancer Res 66(8):4339-48 (2006). Traditional oligonucleotide synthesis techniques using mononucleotides and degenerate codons may however limit the design since staphylococcal strains are not able to suppress amber stop codons. In this study, randomized double stranded linkers were instead generated by the Slonomics® technique which enables incorporation of randomized sets of trinucleotide building blocks using ligations and
restrictions of the subsequently built up double stranded DNA.
Materials and Methods
Librarv design: The library was based on the sequences of the HER3 binding Z variants described in Examples 1 and 2. In the new library, 13 variable positions in the Z molecule scaffold were biased towards certain amino acid residues, according to a strategy based on the binding motifs of the Z variant sequences defined in SEQ ID NO:1 -21 . A SlonoMax® library containing a mixture of 131 bp double stranded linkers, encoding partially randomized positions in helix 1 and 2 of the HER3 binding polypeptide, e.g. 5'-GAA NNN NNN NNN GCG NNN NNN GAG ATC TGG NNN TTA CCT AAC TTA AAC NNN NNN CAA NNN NNN GCC TTC ATC NNN AGT TTA NNN GAT GAC CCA AGC CAA AGC GCT AAC TT-3' (randomized codons are illustrated as NNN) flanked with restriction sites Xho\ and Nhe\, was ordered from Sloning BioTechnology GmbH. The theoretical distributions of amino acid residues in the new library for the 13 variable Z positions are given in Table 3:
Table 3: Library design
Figure imgf000036_0001
Library construction and cloning: The library was amplified using Phusion DNA polymerase (Finnzymes, #F530L) during 8 cycles of PCR and pooled products were purified with QIAquick PCR Purification Kit (QIAGEN) according to the supplier's recommendations. The purified pool of randomized library fragments was digested with restriction enzymes Xho\ and Nhe\ (New England Biolabs) and purified using preparative gel electrophoresis on a 2 % agarose gel. The E. coli strain RR1AM15 was used as host strain for plasmid production of the staphylococcal display vector pSCZ1 (Figure 4A) with Jetstar Maxi Kit (Genomed, #220020).
The vector was digested with the same enzymes, Xho\ and Nhe\, and purified using preparative gel electrophoresis on a 1 % agarose gel. Ligation of pSCZ1 with the randomized library fragments was performed at a 1 :4 molar ratio of vector to fragment using T4 DNA ligase (New England Biolabs, #M0202T). The ligation mixture was purified using QIAquick PCR Purification Kit according to the supplier's recommendations prior to transformation to electrocompetent E. coli DH5a cells (Invitrogen, #18263-012). Individual clones, plated directly after transformation as well as after ON amplification, were PCR amplified for sequence verification using BigDye Thermo Cycle Sequencing reactions and an ABI Prism 3700 instrument (PE Applied
Biosystems). Plasmids were prepared from ON cultures of E. coli using Jetstar Maxi Kit and transformed to electrocompetent S. carnosus as described previously (Lofblom et al, supra). The staphylococcal-displayed library is hereinafter denoted SC:ZHER3LIB-
Library quality analysis: An aliquot of SC:ZHER3LIB (at least ten times the library size, i.e. more than 1 .3 x 108) was inoculated to 100 ml TSB-YE with 20 g/ml chloramphenicol and grown ON at 37 °C and 150 rpm. After 16 hours, 107 cells were washed once with 1 ml PBSP. The cells were pelleted by
centrifugation (3500 x g, 4 °C, 6 min) and resuspended in PBSP containing 225 nM Alexa Fluor® 647-conjugated HSA and incubated for 1 hour at RT in the dark. Following one wash with 1 ml ice-cold PBSP, cells were
resuspended in 300 μΙ ice-cold PBSP prior to flow-cytometric analysis. The mean fluorescence intensity (MFI) was measured using a FACS Vantage SE (BD Biosciences) flow cytometer.
Results
Library construction and cloning: The new library was designed based on a set of HER3 binding Z variants (SEQ ID NO:669-689) with verified binding properties (Example 1 and 2). The theoretical size of the designed library was 7.4 x 108 Z variants. The library of DNA fragments was cloned into the staphylococcal expression vector and transformed into S. carnosus to generate a cell-displayed library containing around 1 .3 x 107 individual clones. Sequence analysis of individual library members revealed a distribution of codons in accordance with the theoretical design and a low proportion of unexpected codons, multiple inserts and frame shifts.
Library quality analysis: In order to verify that the Z variant maturation library was functionally displayed on the bacterial surface, staphylococcal cells from the library were incubated with fluorescently labeled HSA and analyzed using flow cytometry. The result showed that around 72 % of the library expressed full-length proteins with functional ABP fusions on the cell surface (data not shown). A maturated library of HER3 binding polypeptides was thus
successfully constructed. Example 4: Selection, screening and characterization of Z variants from a staphylococcal surface display library
Materials and Methods Cell labeling and staphylococcal cell sorting using FACS: An aliquot of Sc:Z HER3LIB (at least ten times the library size, i.e. more than 1 .3 x 108) was inoculated to 100 ml TSB-YE with 20 g/ml chloramphenicol and grown ON at 37 °C and 150 rpm. After 16 hours, cells (at least four times the subsequent sampling number) were washed with 1 ml PBSP. The cells were pelleted by centrifugation (3500 x g, 4 °C, 6 min) and resuspended in PBSP containing biotinylated HER3-Fc and incubated at RT with gentle mixing for 2 hours to reach equilibrium binding. The cells were thereafter washed with ice-cold PBSP followed by incubation in 1 ml PBSP containing 1 .25 g/ml Alexa Fluor® 488-conjugated streptavidin (Invitrogen) and 225 nM Alexa Fluor® 647-conjugated HSA for 1 hour on ice in the dark. After a final washing step in 1 ml of ice-cold PBSP, the cells were resuspended in ice-cold PBSP before sorting. Cells were sorted using a FACSVantage SE (BD Biosciences) flow cytometer. The sort gate was set to sort out the top fraction of Z variant displaying cells (typically 0.1 %) showing the highest Alexa Fluor® 488 to Alexa Fluor® 647 fluorescence intensity ratio. The cells were sorted directly into 0.5 ml TSB-YE medium and thereafter inoculated to TSB containing 10 g/ml chloramphenicol and incubated at 37 °C for 16 hours in order to amplify isolated cells by growth for the next round of labeling and FACS. The procedure was repeated four times.
Sequencing: Sequencing of individual staphylococcal clones was performed after cell sorting cycle 3 and 4 as described in under Library construction in Example 3.
On-cell affinity ranking and Kn determination: HER3-Fc was biotinylated and HSA conjugated with Alexa Fluor® 647 as described in Example 1 .
Staphylococcal cells displaying the different Z variants, respectively, were inoculated to 10 ml TSB-YE and 20 g/ml chloramphenicol and grown ON at 37 °C and 150 rpm. From the cultures, 106 cells were washed with 1 ml PBSP. The cells were pelleted by centrifugation (3500 x g, 4 °C, 6 min) and resuspended in PBSP containing different concentrations of biotinylated HER3-FC (135, 90, 27, 9, 2.7, 0.9, 0.45, 0.22, 0.1 1 and 0.054 nM for Z05405, Z05413, Z05416 and Z05417; 670, 337, 1 10, 45, 18, 6.7, 2.2, 1 .1 , 0.37 and 0.27 nM for Z01820) spanning the estimated KD. Equilibrium binding was reached by incubation at RT for one hour with gentle mixing. The cells were washed with 1 ml ice-cold PBSP, followed by incubation on ice in 100 μΙ ice- cold PBSP containing 1 .25 g/ml Alexa Fluor® 488-conjugated streptavidin, (Invitrogen) and, in the ranking experiment, 225 nM Alexa Fluor® 647- conjugated HSA, for 40 min. Following a wash with 1 ml ice-cold PBSP, cells were resuspended in 300 μΙ ice-cold PBSP prior to flow cytometric analysis. The mean fluorescence intensity (MFI) was measured using a FACS Vantage SE (BD Biosciences) flow cytometer.
Results
Flow-cytometric sorting for isolation of improved Z variants: For isolation of matured HER3 binding Z variants, the staphylococcal library was subjected to four rounds of fluorescence-activated cell sorting (FACS) with alternating rounds of amplification by cell growth.
Briefly cells were incubated with biotinylated HER3-Fc at
concentrations around 10-fold lower compared to the estimated KD of the Z variants from Example 1 and 2. Cells were thereafter washed and incubated with fluorescently labeled streptavidin for subsequent fluorescence-mediated detection of cell-bound HER3 as well as fluorescently labeled HSA for monitoring of surface expression levels. The incubation of secondary reagents and HSA was performed on ice in order to reduce the dissociation rate of bound HER3. After an additional washing, the labeled cell library was screened and sorted in a flow cytometer. Selection stringency in terms of target concentration, sorting parameters and sorting gates was increased with each sorting round and typically, the top 0.1 % of the library, demonstrating highest target binding to surface expression ratio, was gated and isolated for amplification and subsequent rounds of sorting. The visualization of the target-binding properties of the library in the flow cytometer revealed an enrichment of HER3-positive clones in each sorting round, and essentially only HER3-positive clones in the last round (Figure 5). After up to four rounds of FACS, isolated cells were spread on semi-solid medium for sequencing and characterization of individual candidates.
Sequencing: 576 individual clones were sequenced resulting in 443 readable sequences, out of which 45 clones appeared more than once in the same sorting round (SEQ ID NO:690-734). Each variant was given a unique identification number #####, and individual variants are referred to as
Z#####. The amino acid sequences of the 58-mer Z variants are listed in Figure 1 and in the sequence listing as SEQ ID NO:690-1002. The deduced HER3 binding motifs of these Z variants are listed in Figure 1 and in the sequence listing as SEQ ID NO:22-334. The amino acid sequences of the 49- mer polypeptides predicted to constitute the complete three-helix bundle within each of these Z variants are listed in Figure 1 and in the sequence listing as SEQ ID NO:356-668.
On-cell affinity ranking: On the basis of the sequencing results, the 45 clones that appeared more than once were subjected to a whole-cell ELISA assay in order to rank the variants with respect to affinity for HER3. The
staphylococcal cell populations were analyzed using flow cytometry and one Z variant from Example 1 and 2 (Z01753) surface displayed on
staphylococcal cells was included in the analysis for comparison. All 45 candidates were positive for HER3 binding in the assay and, moreover, 43 demonstrated a higher signal compared to the Z variant from Example 1 and 2 (Figure 6A-D). The highest signals in the assay were seen with the four clones that appeared most frequently after sequencing, demonstrating quantitative isolation of Z variants in the flow-cytometric sorting.
Kn-determination: The apparent equilibrium dissociation constant (KD) was determined on-cell for four Z variants (Figure 4B) and one HER3 binding Z variant from Example 1 and 2 (Z01820). Staphylococcal cells displaying the four variants and Z01820 were incubated in varying concentrations of labeled HER3-Fc spanning the estimated KD. The cell populations were analyzed in the flow cytometer and the mean fluorescence intensity data was
subsequently plotted against the HER3-Fc concentrations and fitted to a one- site binding model in order to determine the KD. All four maturated Z variants demonstrated low nanomolar apparent KD. The strongest binder
demonstrated a 15-fold improvement in affinity for HER3-Fc compared to the Z variant from Example 1 and 2 (Table 3).
Table 3. Affinities of HER3-Fc binding Z variants on cell using flow cytometry
Z variant KD (on-cell analysis, nM, mean ± SD)
Z05405 2.7 ± 0.6
Z05413 2.3 ± 0.7
Z05416 3.1 ± 0.6
Z05417 3.2 ± 0.2
Z01820 33.7 ± 1 .3 Example 5: Surface plasmon resonance Kn determination of Z variants
Materials and Methods
Surface plasmon resonance analysis: Surface plasmon resonance (SPR) analysis was performed for the HER3 binding Z variants Z05405, Z05413, Z05416 and Z05417 on a BIAcore™ 2000 instrument (GE Healthcare).
Human HER3-Fc (R&D Systems) and mouse HER3-Fc (R&D systems) were immobilized by NHS/ECD amine-coupling chemistry on a CM-5 sensor chip (GE Healthcare). The immobilization was performed in 10 mM NaAc (pH 4.5) at a flow rate of 30 μΙ/min and with receptor concentrations of 10 pg/ml, aiming for an immobilization level of 4000 RU. PBSP was used as running buffer at a flow rate of 20 μΙ/min (unless stated otherwise) and 5 mM NaOH for regeneration.
For determination of the kinetics, 250 μΙ of four different concentrations (1 .5-67 nM diluted in PBSP) of the four HER3 binding Z variants were injected over HER3-Fc immobilized on the CM-5 chip surface. The surfaces were regenerated by four injections of 15 μΙ of 5 mM NaOH and extensive washing with running buffer. Each sample was measured in duplicates and the response from the blank surface was subtracted from the response from each Z variant at each concentration. The obtained sensorgrams were fitted to a one-site binding model for determination of KD values based on mean association (kon) and dissociation rates (k0ff).
Control experiments: To verify that the Z variants were not selected for affinity to the Fc part of HER3-Fc, each Z variant (50 nM) was incubated with a 10- fold molar excess of human polyclonal IgG (500 nM) for 1 h at room
temperature prior to injection of 100 μΙ of each sample (in the above concentrations) over HER3-Fc immobilized on the biosensor chip surface. In an additional control experiment, the Z variants were injected over HER3- ECD immobilized on the sensor chip surface.
Results
Surface plasmon resonance analysis: The dissociation equilibrium constant (KD) of the four Z variants Z05405, Z05413, Z05416 and Z05417 was determined by SPR technology. The affinity was determined from the association and dissociation rates of the Z variants using non-linear regression to a one-site binding model, resulting in dissociation constants of 1 .61 nM for Z05405, 0.78 nM for Z05413, 0.78 nM for Z05416 and 0.69 nM for Z05417 (Figure 7, Table 4). In Table 4, all values are means of duplicates of each concentration performed on the same day.
Table 4: Affinities of five HER3 bindin Z variants for human/mouse HER3
Figure imgf000042_0001
Control experiments: Since the analysis of the HER3 binding Z variants was performed with HER3 fused to the human IgG Fc-region, two control experiments were performed in order to verify that the Z variants were not selected for affinity to the Fc part of HER3-Fc. No difference in response could be observed between Z variants pre-incubated with IgG and the samples containing only Z variants (data not shown). Moreover, the Z variants injected over a surface with HER3-ECD showed specific binding for all four variants (data not shown). Taken together, the two experiments clearly demonstrate that Fc is not part of the Z variants' binding site on HER3-Fc.
Example 6: Competition assay for heregulin and HER3 binding Z variants In this Example, the ability of HER3 binding Z variants to block binding of the ligand heregulin to HER3 was investigated by SPR in a competition assay.
Materials and Method
Competition between the natural ligand heregulin (HRGI -βΙ , EGF-like domain, R&D Systems) and the four HER3 specific Z variants Z05405, Z05413, Z05416 and Z05417 was analyzed using SPR in two different assays.
In a first assay, 2.5 nM HER3-Fc was pre-incubated with 100 nM of each of the four HER3 specific Z variants (40-fold molar excess) for 1 h at room temperature. Thereafter, 75 μΙ of each mixture of HER3-Fc and Z variant was injected over a sensor chip surface with immobilized heregulin. Additionally, HER3-Fc not pre-incubated with Z variants was injected over the chip surface with immobilized heregulin.
In a second assay, 100 μΙ of each Z variant at five different
concentrations (0-10 nM) was injected over the sensor chip surface with immobilized HER3, immediately followed by injection of 100 μΙ of 250 nM heregulin (using the BIAcore COINJECT command). All samples were injected in duplicates and an HER2 specific Z variant was injected using the same setup as a negative control. The surfaces were regenerated with two injections of 5 mM NaOH and extensive washing with running buffer.
Results
Competition of the HER3 specific Z variants Z05405, Z05413, Z05416 and Z05417 with the natural HER3 ligand heregulin for HER3 was
investigated by SPR technology.
The results of the first assay, using heregulin immobilized on the chip surface, showed a nearly complete reduction in response level when injecting HER3-Fc pre-incubated with Z variants compared to injecting HER3-Fc not pre-incubated with Z variants (Figure 8A).
The results of the second assay, using HER3-Fc immobilized on the chip surface, indicated a concentration-dependent competition with the interaction between the HER3 receptor and its natural ligand (Figure 8B). The same pattern was observed for mouse HER3-Fc (data not shown). No competition between the negative control and heregulin could be observed for either human or mouse HER3 (data not shown).
The results demonstrate that the HER3 specific Z variants interact with the same binding site on HER3 as the natural ligand heregulin and can hence compete with the binding between the ligand and the receptor in vitro. This effect may be exploited in future therapeutic in vivo applications. Example 7: Inhibition of heregulin-induced HER3 phosphorylation in vitro
In this Example, the ability of HER3 binding Z variants to prevent heregulin- induced HER3 phosphorylation was investigated in a cell assay.
Materials and Methods
Stimulation: MCF-7 (ACC1 15, DSMZ) breast carcinoma cells were cultured in RPMI medium (BE12-167F, Lonza) supplemented with L-glutamine (BE17-605E, Cambrex), non-essential amino acids (BE13-1 14E, Cambrex), sodium pyruvate (BE13-1 15E, Cambrex) and 10 % fetal bovine serum (FBS, 10108-165, Gibco). The day before stimulation, 1 x 106 cells were seeded in 6 mm Petri dishes (430168, BD Biosciences) in 5 ml of the above medium.
One hour prior to stimulation, the medium was changed to a medium consisiting of RPMI + L-glutamine + 2 % dialyzed FBS (26400-036, Gibco). Phosphorylation of HER3 was induced with 5 nM heregulin (HRGI -β, 396- HB, R&D systems). HER3 binding Z variants Z05416 and Z05417, each comprising an N-terminal his-tag and a C-terminal cysteine (His6-Z05416-cys and His6-Z05417-cys), were added simultaneously with heregulin in 10 or 100 times molar excess. A taq polymerase specific Z variant (His6-Z01 155-cys) was used as a negative control and was added according to the same procedure as described above.
Following incubation for 10 minutes at 37 °C, cellular processes were stopped by placing the petri dishes on ice and by subsequent washing with ice-cold PBS. After washing, 2 ml PBS containing 1 mM activated
orthovanadate (450243, Sigma) was added to each dish and the cells were detached using a cell scraper. The cell solution was transferred to a 10 ml tube and the cells were pelleted by spinning in a pre-cooled centrifuge at 1000 rpm for 3 minutes. The dry pellet was dissolved in 100 μΙ ice cold lysing buffer (1 % NP-40 (Sigma 13021 ), 20 mM Tris (pH 8.0), 137 mM NaCI, 10 % glycerol, 2 mM EDTA, 1 mM activated sodium orthovanadate) to lyse the cells. The lysate was incubated end-over-end at 4 °C for 30 minutes and centrifuged at 13000 rpm for 15 minutes. The supernatant was collected and stored at -80 °C until further analysis.
PHER3-ELISA: The presence of phosphorylated HER3 protein (pHER3) in cell lysates was analyzed using a Duo-Set IC phospo ErbB3 sandwich ELISA (DYC-1769, R&D Systems).
96 well half area plates (Costar 3690) were coated over night with 50 μΙ/well of 2 g/ml capture antibody diluted in PBS. The next day, the plate was washed four times with PBS + 0.05% Tween (PBST) in an automated ELISA washer. The wells were blocked with PBS containing 1 % BSA (100 μΙ/well) for 2 hours at RT and washed as previously described.
50 μΙ/well of cell lysates, diluted two or four times in IC Diluent #12 (1 % NP-40, 20 mM Tris (pH 8.0), 137 mM NaCI, 10 % glycerol, 2 mM EDTA, and 1 mM activated sodium orthovanadate), were added. Positive controls, provided by the manufacturer, were also added to the wells. The plate was subsequently incubated for 2 hours.
After washing, 50 μΙ/well of detection antibody was added, diluted according to manufacturer protocol in IC diluent #14 (20 mM Tris, 137 mM NaCI, 0.05 % Tween 20, 0.1 % BSA, pH 7.2 - 7.4), and the plate was incubated for another 2 hours. Following incubation, the plate was washed and 50 μΙ/well of TMB (Immunopure, Termo Fisher Scientific) was added. The reaction was stopped after 20 minutes by addition of 50 μΙ/well of 2 M H2SO4 and the absorbance was measured at 450 nm using a Victor3 ELISA plate reader.
Results
The HER3-specific Z variants Z05416 and Z05417 were, together with the negative control (taq polymerase specific Z01 155), assessed for their ability to block heregulin-induced phosphorylation of HER3. The relative content of pHER3 (%) was determined as the relation of blocked culture (OD-value obtained from a culture containing a Z variant) to heregulin-stinnulated culture (OD-value obtained from heregulin-stinnulated cultures). Figure 9 shows that the HER3 binding variants Z05416 and Z05417 inhibited heregulin-induced phosphorylation in a dose dependent manner, whereas the taq polymerase binding variant Z01 155 did not have any effect.
Example 8: Bispecific Z variants binding to HER3 and HER2
As described in the Background section, HER3 is a preferred heterodimerization partner for HER2, and HER2 is dependent on other receptors in the HER family for ligand induced signaling. A bispecific HER3 and HER2 targeting ligand (for example a HER3-HER2 binding Z variant), might block the receptor signal driving tumor growth on tumors expressing both receptors.
Different molecular constructs for the bispecific molecules, optionally comprising various linker lengths, are contemplated. Examples of constructs are N-or C-terminal positioning of the HER3 binding polypeptide to the HER2 binding polypeptide. If a linker is introduced between the two binding polypeptides, it can comprise 1 -60 amino acid residues, such as 1 -45 amino acids. In addition, the bispecific construct may be provided with a half life extension moiety, e.g. by albumin fusion, coupling to an albumin binding moiety or a molecule such as PEG, at the N- or C-terminal part of the molecule or within the linker region. Alternatively, the half life extending moiety may in itself be utilized as a linker, or a spacer, between the two binding polypeptides. Material and Methods
A dimeric bispecific Z variant molecule is engineered as previously reported in Friedman et al, Biotechnol Appl Biochem, 54(2):121 -31 (2009). Although Friedman et al describes production of tetrameric Z variants specific for two members of the HER family, the construction of a HER3 and HER2 bispecific Z variant in principle follows the same protocol. A person skilled in the field will easily understand how to apply the procedure based on
Friedman et al. For construction of a heterodimeric Z variant binding to HER3 and HER2, a gene fragment encoding a HER3 binding variant is genetically fused in-frame with a gene fragment encoding a HER2 binding Z variant using a 40 aa peptide linker between the two binding polypeptides by following the procedure described by Jonsson, et al, supra.
The gene encoding the bispecific protein is constructed by cloning of vectors encoding the HER3-HER2 binding Z variants. The HER3 binding Z variant is selected from SEQ ID NO:669-1002, in particular a sequence selected from SEQ ID NO:669-734, such as selected from SEQ ID NO:690- 734, such as from SEQ ID NO:691 -693, SEQ ID NO:695-696, SEQ ID
NO:700, SEQ ID NO:703-704, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:712-713, SEQ ID NO:721 , SEQ ID NO:722 and SEQ ID NO:724, and the HER2 binding Z variant is selected from SEQ ID NO:1003. The HER2 and the HER3 binding Z variants can have different affinities for the different receptors. Constructs may also be made from vectors encoding Z variants having various affinity for the same receptor. The vectors encoding the bispecific HER3-HER2 binding Z variants are cleaved using suitable endonucleases (e.g. Sfi\, Acc\, Pst\, BamH\, New England Biolabs) and the gene fragments encoding HER3-HER2 specific Z variants are recovered and ligated to form the gene encoding the bispecific molecule. The HER3 and HER2 binding polypeptides may individually form a monomeric unit or a multimeric unit, such as a dimer, trimer or tetramer, within the gene fragment.
For introduction of a peptide linker, multiples of gene fragments encoding a linker region (e.g. GGGS or GGGGSGGGGLVGLGSGGGGS) are introduced to create constructs with different linker lengths. The linker region can also contain an albumin gene or the gene for an albumin binding domain (ABD). Here, the ABD gene is amplified using PCR, and a linker encoding unit is introduced. This is followed by BamH\ restriction digestion and ligation into the dimeric HER3-HER2 bispecific gene between the HER binding polypeptides. This is essentially conducted as described for creating trimeric TNF constructs by Jonsson et al, supra, however replacing the central TNF molecules described in Jonsson with an ABD. Alternatively, the gene fragments encoding HER3-HER2 binding Z variants are amplified using suitable PCR primers that also introduce the desired linker regions and restriction sites for cloning of the bispecific molecule in various formats.
Different formats of the bispecific molecule are for example N-or C-terminal positioning, various lengths of linkers between the binding Z variants and/or the ABD gene in between. Another possibility for construction of genes encoding for the desired bispecific molecule is simply to purchase the fully synthetic gene from companies offering such services, such as e.g. Geneart AG.
The resulting gene fragments encoding the HER3 binding Z variant, the HER2 binding Z variant, the peptide linker and optionally ABD, are ligated into an expression vector, transformed into expression cells (e.g. E. coli). Proteins are expressed for example as described in Example 2. Expression vectors are used that encode an additional his-tag and/or a unique cysteine for labeling purposes, and the expressed protein is purified as for example described in Example 2. The methods used for protein expression and purification are standard methods known to the person skilled in the field.
The resulting bispecific proteins are then tested for simultaneous binding in vitro, as described in Friedman et al, supra, by using Biosensor analysis (Biacore, GE Healthcare). Human HER3-Fc (hHER3-Fc) and human HER2-Fc (hHER2-Fc, both from R&D Systems) are immobilized by amine coupling on the carboxylated dextran layer of a CM5 sensor chip (GE
Healthcare), according to the manufacturer's instructions. Another flow-cell surface is activated and de-activated as a reference surface. The bispecific HER3-HER2 molecule is diluted in a running buffer, HBS (10 mM Hepes, 150 mM NaCI, 3.4 mM EDTA and 0.005% surfactant P20, pH 7.4), before binding analysis is performed at 25 °C. In a first experiment, the bispecific HER3- HER2 molecule is injected at concentrations ranging from 125 nM to 2 μΜ over all surfaces with a flow rate of 30 μΙ/min. A HER3 binding Z variant and a HER2 binding Z variant are also injected as controls. After each injection the flow cells are regenerated by the injection of 10 ml of 10 mM HCI. In a second experiment, 5 μΜ HER3-HER2 molecule is injected over flow-cell surfaces having immobilized hHER3-Fc or hHER2-Fc (R&D
Systems) by amine coupling on the carboxylated dextran layer of a CM5 sensor chip. Following a short dissociation time of 1 min, 1 15 nM hHER3-Fc and hHER2-Fc (diluted in the running buffer) is injected and the ability of the bispecific molecules to simultaneously bind both their targets is monitored.
By incubating a fluorescently labeled bispecific HER3-HER2 molecule with cells expressing either HER3 and not HER2, or HER2 and not HER3, binding ability of the HER3-HER2 molecule on live cells is monitored using fluorescence microscopy and flow cytometry analysis, as described in
Friedman et al, supra. Differences in specificity are investigated at the same time, to find out if different constructs, having different affinities for their respective receptors, will differentiate between different receptor expression levels on cells.
The biological effect of binding bispecific Z variants to cells is tested by exposing cell cultures to various amounts, ranging from 0.05 nM up to 5000 nM, of the bispecific Z variants and analyzing cell growth rate and survival, and by analyzing phosphorylation patterns of important cell signaling pathways using western blot analysis, as described for a HER2 specific Z variant by Ekerljung et al (in Tumour Biol 27(4):201 -10 (2006) and in Biochem Biophys Res Commun 377(2):489-94 (2008)). Cell lines that can be tested include MDA-MB-361 , NCI-N87, CALU-3 and SKOV-3. Also HER3
transduced BT-474 and ZR75-cells can be used.
To test the effect of the HER3-HER2 Z variants in vivo, the bispecific constructs are evaluated for tumor targeting and for biological effect in a tumor. The bispecific HER3-HER2 binding Z variants are radiolabeled as previously described (Ahlgren et al, Bioconjug Chem 19(1 ):235-43 (2008)), and characterized for in vitro cellular uptake, retention and internalization using described methods (Steffen et al, Cancer Biother Radiopharm
20(3):239-48(2005)). Animals bearing xenografted tumors expressing HER3 and HER2 receptors (e.g. MDA-MB-361 , NCI-N87, CALU-3 and SKOV-3) are in a biodistribution study injected with the radiolabeled HER3-HER2 binding Z variants and monitored for tumor uptake and contrast to other organs. For constructs not having a half life extending moiety, the distribution of the radioactivity in the xenografted mice is typically assessed at 1 , 2, 4,8, 24, 48 and 72 hours following injection of the radiolabeled bispecific HER3-HER2 binding Z variant. For constructs having a half life extending moiety, the distribution of the radioactivity is typically assessed at 1 , 4, 12, 24, 48, 72, 168 and 332 hours following injection of the radiolabeled bispecific HER3-HER2 binding Z variant, essentially as described in Tolmachev et al (Cancer Res 67(6):2773-82 (2007)). The uptake of the radiolabeled bispecific Z variants is compared to the uptake of HER2 and/or HER3 binding Z variants alone. In cases where the bispecific Z variants have superior uptake and retention and/or specificity in tumors in vivo as compared to the monospecific counterparts, the bispecific variants may be suitable for targeted payload therapy. Such therapy will utilize a potent effector function, e.g. radionuclides, toxic chemical molecules, toxins, cytokines or photosensitizers, fused or conjugated to the bispecific molecule.
The bispecific Z variants are furthermore characterized for intrinsic effect in vivo. Mice are grafted with tumor cells expressing both receptors, or as control, only one or none of the receptors, and subjected to a single or multiple injections of the bispecific Z variants. Tumor growth is monitored over time and versus control groups, including a vehicle group receiving only the injection buffer but no active compound, i.e. the bispecific HER3-HER2 binding molecule. Example 9: Z variants with bispecific binding to HER3 and EGFR
As described in the introduction, HER3 is a preferred
heterodimerization partner for HER2. It is however, in certain conditions, also an important dimerization partner for the EGF-receptor (EGFR or HER1 ). By using a bispecific HER3 and EGFR targeting ligand, tumors expressing both receptors will be targeted, and the tumor driving receptor signaling may be blocked.
Bispecific HER3 and EGFR binding Z variants are engineered essentially as described above in Example 8. The resulting construct can be tested in cell lines expressing HER3 and EGFR receptors, such as A431 - cells, in a similar fashion as described in Example 8 for bispecific HER3 and HER2 binding Z variants.

Claims

Claims
1 . HER3 binding polypeptide, comprising a HER3 binding motif, BM, which motif consists of the amino acid sequence selected from i) EX2X3X A YX7EIW XnLPNL X16X17X18QX20 X21AFIX25 X26LX28D, wherein, independently of each other,
X2 is selected from K, R and W;
X3 is selected from K, R, and Y;
X4 is selected from A, D, E, G, H, I, K, L, M, N, Q, R, S, T, V and W;
X7 is selected from A, E, F, G, H, K, S, T, V, W and Y;
X11 is selected from E and Q;
X16 is selected from N and T;
Xi7 is selected from R, T and V;
X18 is selected from R, T and V;
X20 is selected from K and R;
X21 is selected from A and G;
X25 is selected from A, G, K, R and S;
X26 is selected from S and K;
X28 is selected from A, D, E, F, P, Q, S, T, W and Y;
and ii) an amino acid sequence which has at least 93 % identity to the sequence defined in i), wherein the polypeptide binds to the extra-cellular domain of HER3.
2. HER3 binding polypeptide according to any preceding claim, wherein X2X3 is selected from KY, RY, WK and WR.
3. HER3 binding polypeptide according to any preceding claim, wherein X is selected from A, H, I, K, L, N, Q, R, S, T and V.
4. HER3 binding polypeptide according to any preceding claim, wherein X7 is selected from A, F, G, V, W and Y.
5. HER3 binding polypeptide according to any preceding claim, wherein X is Q.
6. HER3 binding polypeptide according to any preceding claim, wherein X17X18 is selected from RV, RT, VR and RR.
7. HER3 binding polypeptide according to any preceding claim, wherein X2o is K.
8. HER3 binding polypeptide according to any preceding claim, wherein X2i is A.
9. HER3 binding polypeptide according to any preceding claim, wherein X25 is selected from A, G, K and S.
10. HER3 binding polypeptide according to any preceding claim, wherein X28 is selected from A, E, F, Q, S, W and Y.
1 1 . HER3 binding polypeptide according to claim 2, wherein X2X3 is selected from KY and RY.
12. HER3 binding polypeptide according to claim 3, wherein X is selected from K, L, S and T.
13. HER3 binding polypeptide according to claim 4, wherein X7 is selected from F, G and Y.
14. HER3 binding polypeptide according to claim 6, wherein Xi7Xis is selected from RV, RT and VR.
15. HER3 binding polypeptide according to claim 9, wherein X25 is selected from A, G and S.
16. HER3 binding polypeptide according to claim 10, wherein X28 is selected from A, E, F, Q, S and W.
17. HER3 binding polypeptide according to any preceding claim, wherein the amino acid sequence i) fulfills at least one of the following four conditions I, II, III and IV: I) X2X3 is selected from KY and RY;
II) X is Q;
III) X20 is K;
IV) X21 is A.
18. HER3 binding polypeptide according to claim 17, which fulfills at least two of the four conditions I, II, III and IV.
19. HER3 binding polypeptide according to claim 18, which fulfills at least three of the four conditions I, II, III and IV.
20. HER3 binding polypeptide according to claim 19, which fulfills all of the four conditions I, II, III and IV.
21 . HER3 binding polypeptide according to any preceding claim, wherein the amino acid sequence is selected from any one of SEQ ID NO:1 -334.
22. HER3 binding polypeptide according to claim 21 , wherein the amino acid sequence is selected from any one of SEQ ID NO:1 -66.
23. HER3 binding polypeptide according to claim 22, wherein the amino acid sequence is selected from any one of SEQ ID NO:23-25, SEQ ID NO:27-28, SEQ ID NO:32, SEQ ID NO:35-36, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44-45, SEQ ID NO:53-54 and SEQ ID NO:56.
24. HER3 binding polypeptide according to any preceding claim, in which said HER3 binding motif forms part of a three-helix bundle protein domain.
25. HER3 binding polypeptide according to claim 24, in which said HER3 binding motif essentially forms part of two alpha helices with an
interconnecting loop, within said three-helix bundle protein domain.
26. HER3 binding polypeptide according to claim 24-25, in which said three- helix bundle protein domain is selected from domains of Protein A from Staphylococcus aureus and derivatives thereof.
27. HER3 binding polypeptide according to any preceding claim, which comprises an amino acid sequence selected from: i) K-[BM]-DPSQS XaXbLLXc EAKKL NDXdQ; wherein
[BM] is a HER3 binding motif as defined in any one of claims 1 -23;
Xa is selected from A and S;
Xb is selected from N and E;
Xc is selected from A, S and C;
Xd is selected from A and S;
and
ii) an amino acid sequence which has at least 94 % identity to any one of the sequences defined above.
28. HER3 binding polypeptide according to claim 27, wherein Xa is A; Xb is N;
Figure imgf000053_0001
29. HER3 binding polypeptide according to claim 27, wherein Xa is A; Xb is N;
Figure imgf000053_0002
30. HER3 binding polypeptide according to claim 27, wherein Xa is S; Xb is E;
Figure imgf000053_0003
31 . HER3 binding polypeptide according to claim 27, wherein Xa is S; Xb is E;
Figure imgf000053_0004
32. HER3 binding polypeptide according to any one of claims 27-31 , wherein the amino acid sequence is selected from any one of SEQ ID NO:335-668.
33. HER3 binding polypeptide according to claim 32, wherein the amino acid sequence is selected from any one of SEQ ID NO:335-400.
34. HER3 binding polypeptide according to claim 33, wherein the amino acid sequence is selected from any one of SEQ ID NO:357-359, SEQ ID NO:361 - 362, SEQ ID NO:366, SEQ ID NO:369-370, SEQ ID NO:374, SEQ ID
NO:376, SEQ ID NO:378-379, SEQ ID NO:387-388 and SEQ ID NO:390.
35. HER3 binding polypeptide according to any one of claims 1 -26, which comprises an amino acid sequence selected from:
i) YAK-[BM]-DPSQS SELLXC EAKKL NDSQA P;
wherein [BM] is a HER3 binding motif as defined in any one of claims 1 -23 and Xc is selected from S and C; and
ii) an amino acid sequence which has at least 94 % identity to any one of the sequences defined above.
36. HER3 binding polypeptide according to any one of claims 1 -26, which comprises an amino acid sequence selected from:
i) FNK-[BM]-DPSQS ANLLXC EAKKL NDAQA P;
wherein [BM] is a HER3 binding motif as defined in any one of claims 1 -23 and Xc is selected from A and C; and
ii) an amino acid sequence which has at least 94 % identity to any one of the sequences defined above.
37. HER3 binding polypeptide according to any one of claims 1 -26, wherein the amino acid sequence is selected from SEQ ID NO:669-1002.
38. HER3 binding polypeptide according to claim 37, wherein the amino acid sequence is selected from SEQ ID NO:669-734.
39. HER3 binding polypeptide according to claim 38, wherein the amino acid sequence is selected from SEQ ID NO:691 -693, SEQ ID NO:695-696, SEQ ID NO:700, SEQ ID NO:703-704, SEQ ID NO:708, SEQ ID NO:710, SEQ ID NO:712-713, SEQ ID NO:721 , SEQ ID NO:722 and SEQ ID NO:724.
40. HER3 binding polypeptide according to any preceding claim, wherein the HER3 binding polypeptide binds to HER3 such that the KD value of the interaction is at most 1 x 10"6 M, such as at most 1 x 10"7 M, such as at most 1 x 10"8 M.
41 . HER3 binding polypeptide according to any preceding claim comprising further C terminal and/or N terminal amino acids.
42. HER3 binding polypeptide according to claim 41 , in which each further C terminal and/or N terminal amino acid improves production, purification, stabilization in vivo or in vitro, coupling, or detection of the polypeptide.
43. HER3 binding polypeptide according to any preceding claim in multimeric form, comprising at least two HER3 binding polypeptide monomer units, the amino acid sequences of which may be the same or different.
44. HER3 binding polypeptide according to claim 43, in dimeric form.
45. HER3 binding polypeptide according to any preceding claim, which blocks binding of an naturally occurring HER3 ligand to HER3.
46. HER3 binding polypeptide according to claim 45, which inhibits HER3 mediated signaling in vivo.
47. Polynucleotide encoding a polypeptide according to any preceding claim.
48. Expression vector comprising a polynucleotide according to claim 47.
49. Host cell comprising an expression vector according to claim 48.
50. Ligand having binding affinity for HER3 and for HER2, comprising a HER3 binding polypeptide according to any one of claims 1 -46; a HER2-binding polypeptide; and a linking moiety for linking the HER3 binding polypeptide with the HER2 binding polypeptide.
51 . Ligand according to claim 50, wherein the HER2 binding polypeptide binds to HER2 such that the KD value of the interaction is at most 1 x 10"6 M, such as at most 1 x 10"7 M, such as at most 1 x 10"8 M.
52. Ligand according to any one of claims 50-51 , wherein the HER2 binding polypeptide is an engineered protein derived from domain B of Protein A from Staphylococcus aureus.
53. Ligand according to claim 52, wherein the engineered protein comprises a protein Z derivative.
54. Ligand according to claim 53, wherein the engineered protein comprises an amino acid sequence selected from
i) YAKEM RNAYW EIALL PNLTN QQKRA FIRKL YDDPS QSSEL LSEAK KLNDS Q; and
ii) an amino acid sequence which has at least 80 % identity to the sequence defined in i).
55. Ligand according to any one of claims 50-54, wherein the linking moiety is a peptide comprising from 1 up to 45 amino acids.
56. Ligand according to any one of claims 50-55, further comprising a half life extending moiety for extension of ligand half life in vivo.
57. Ligand according to claim 56, wherein the half life extending moiety is albumin.
58. Ligand according to claim 56, wherein the half life extending moiety is an albumin binding moiety.
59. Ligand according to claim 58, wherein the albumin binding moiety is an engineered protein derived from domain GA3 of streptococcal Protein G.
60. Ligand according to clam 59, wherein the albumin binding moiety comprises an amino acid sequence selected from i) LAEAK VLANR ELDKY GVSDF YKRLI NKAKT VEGVE ALKLH ILAAL P; and ii) an amino acid sequence which has at least 80 % identity to the sequence defined in i).
61 . Ligand according to claim 56, wherein the half life extending moiety is polyethylene glycol.
62. Ligand according to any one of claims 56-61 , wherein the half life extending moiety is attached to the remainder of the ligand via at least one cysteine residue present in the ligand.
63. Ligand according to any one of claims 56-62, wherein the half life extending moiety is attached to the remainder of the ligand via the linking moiety.
64. Ligand according to any one of claims 50-62, wherein the linking moiety comprises a half life extending moiety as defined in any one of claims 56-60.
65. Ligand according to any one of claims 50-60 or 64 which is a fusion polypeptide.
66. Ligand according to any one of claims 50-65, which prevents dimerization of HER2 and HER3 in vivo.
67. Ligand according to claim 66, which inhibits HER3 mediated signaling in vivo.
68. Ligand having binding affinity for HER3 and for EGFR, comprising a HER3 binding polypeptide according to any one of claims 1 -46; an EGFR- binding polypeptide; and a linking moiety for linking the HER3 binding polypeptide with the EGFR binding polypeptide.
69. Combination of a HER3 binding polypeptide according to any one of claims 1 -46 or a ligand according to any one of claims 50-68 with a
therapeutic agent.
70. HER3 binding polypeptide according to any one of claims 1 -46, ligand according to any one of claims 50-68 or combination according to claim 69 for use in therapy.
71 . HER3 binding polypeptide according to any one of claims 1 -46, a ligand according to any one of claims 50-68 or a combination according to claim 69 for treatment of a HER3 related condition.
72. HER3 binding polypeptide according to any one of claims 1 -46, a ligand according to any one of claims 50-68 or a combination according to claim 69 for treatment of a HER3 related condition selected from cancer disease, such as colon cancer, endometrial cancer, gastric cancer, glioma, breast cancer, pancreas cancer, head and neck squamous carcinoma, lung cancer, melanoma, medulloblastoma, neuroepithelioma, ovarian cancer, Paget's disease, papillary thyroid cancer, prostate cancer, skin squamous cell carcinoma, transitional cell carcinoma and vestibular schwannoma.
73. Method of treatment of a HER3 related condition, comprising
administering a HER3 binding polypeptide according to any one of claims 1 -46, a ligand according to any one of claims 50-68 or a combination according to claim 69 to a mammalian subject in need thereof.
74. Method of treatment according to claim 73, in which binding of the HER3 binding polypeptide, the ligand or the combination to a HER3 expressed on a cell surface in the subject inhibits HER3 mediated signaling.
75. Method according to any one of claims 73-74, wherein said HER3 related condition is selected from cancer disease, such as colon cancer, endometrial cancer, gastric cancer, glioma, breast cancer, pancreas cancer, head and neck squamous carcinoma, lung cancer, melanoma, medulloblastoma, neuroepithelioma, ovarian cancer, Paget's disease, papillary thyroid cancer, prostate cancer, skin squamous cell carcinoma, transitional cell carcinoma and vestibular schwannoma.
PCT/SE2010/051164 2009-11-04 2010-10-27 Her3 binding polypeptides Ceased WO2011056124A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2012536757A JP5960598B2 (en) 2009-11-04 2010-10-27 HER3 binding polypeptide
EP10775936.7A EP2496598B1 (en) 2009-11-04 2010-10-27 Her3 binding polypeptides
US13/505,493 US10208128B2 (en) 2009-11-04 2010-10-27 HER3 binding polypeptides

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP09175025 2009-11-04
EP09175025.7 2009-11-04

Publications (1)

Publication Number Publication Date
WO2011056124A1 true WO2011056124A1 (en) 2011-05-12

Family

ID=43302000

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SE2010/051164 Ceased WO2011056124A1 (en) 2009-11-04 2010-10-27 Her3 binding polypeptides

Country Status (4)

Country Link
US (1) US10208128B2 (en)
EP (1) EP2496598B1 (en)
JP (1) JP5960598B2 (en)
WO (1) WO2011056124A1 (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014053586A1 (en) 2012-10-05 2014-04-10 Affibody Ab Her3 binding polypeptides
WO2014064237A1 (en) * 2012-10-25 2014-05-01 Affibody Ab Abd binding polypeptide
WO2014096163A1 (en) * 2012-12-19 2014-06-26 Affibody Ab New polypeptides
WO2014140366A1 (en) * 2013-03-15 2014-09-18 Affibody Ab New polypeptides
US8859737B2 (en) 2009-12-22 2014-10-14 Roche Glycart Ag Anti-HER3 antibodies and uses thereof
US9180185B2 (en) 2013-01-11 2015-11-10 Hoffman-La Roche Inc. Combination therapy of anti-HER3 antibodies
WO2015173248A1 (en) * 2014-05-14 2015-11-19 F. Hoffmann-La Roche Ag Her3/her2 bispecific antibodies binding to the beta-hairpin of her3 and domain ii of her2
WO2016042083A1 (en) * 2014-09-17 2016-03-24 Affibody Ab New polypeptides
US9745340B2 (en) 2012-10-25 2017-08-29 Affibody Ab Method for the separation of proteins containing an albumin-binding
RU2714156C2 (en) * 2013-08-28 2020-02-12 Аффибоди Аб C5-binding polypeptides
WO2024034685A1 (en) 2022-08-10 2024-02-15 興和株式会社 Affibody micelle drug conjugate
WO2024213587A1 (en) * 2023-04-11 2024-10-17 Antaros Tracer Ab Drug delivery systems
WO2024227930A1 (en) * 2023-05-04 2024-11-07 Affibody Ab New polypeptide
WO2025120217A3 (en) * 2023-12-06 2025-08-14 Oncopeptides Innovation 1 Ab Cd16a-binding polypeptide
JP2025542406A (en) * 2022-12-30 2025-12-25 アブクロン・インコーポレイテッド Affibodies that specifically bind to CD137 and uses thereof

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2190863B1 (en) 2007-07-31 2015-09-02 Affibody AB New albumin binding compositions, methods and uses
US20120165650A1 (en) * 2010-12-22 2012-06-28 General Electric Company Her2 binders
ES2758994T3 (en) 2010-11-05 2020-05-07 Zymeworks Inc Stable heterodimeric antibody design with mutations in the Fc domain
AU2012222833B2 (en) 2011-03-03 2017-03-16 Zymeworks Inc. Multivalent heteromultimer scaffold design and constructs
BR112014010580B1 (en) 2011-11-04 2021-01-12 Zymeworks, Inc. isolated heteromultimeric fc construct, composition, use of an isolated heteromultimeric fc construct, nucleic acid composition and method for expressing the isolated heteromultimeric fc construct
US9499634B2 (en) 2012-06-25 2016-11-22 Zymeworks Inc. Process and methods for efficient manufacturing of highly pure asymmetric antibodies in mammalian cells
WO2014012082A2 (en) 2012-07-13 2014-01-16 Zymeworks Inc. Multivalent heteromultimer scaffold design an constructs
US9914785B2 (en) 2012-11-28 2018-03-13 Zymeworks Inc. Engineered immunoglobulin heavy chain-light chain pairs and uses thereof
AU2014357292B2 (en) 2013-11-27 2020-06-25 Zymeworks Bc Inc. Bispecific antigen-binding constructs targeting HER2
WO2015130173A1 (en) 2014-02-28 2015-09-03 Merus B.V. Antibody that binds erbb-2 and erbb-3
JP6771385B2 (en) 2014-02-28 2020-10-21 メルス ナムローゼ フェンノートシャップ Bispecific antibody and pharmaceutical composition
CA3138083A1 (en) * 2014-12-22 2016-06-30 Systimmune, Inc. Bispecific tetravalent antibodies and methods of making and using thereof
US12428483B2 (en) * 2014-12-22 2025-09-30 Systimmune, Inc. Bispecific tetravalent antibodies and methods of making and using thereof
EP3322735A4 (en) 2015-07-15 2019-03-13 Zymeworks Inc. BISPECIFIC ANTIGEN-BINDING CONSTRUCTS CONJUGATED TO A MEDICINAL PRODUCT
SMT202100230T1 (en) 2015-10-23 2021-07-12 Fundacio Inst De Recerca Biomedica Irb Barcelona Binding molecules that inhibit cancer growth
IL269656B2 (en) 2017-03-31 2024-06-01 Merus Nv Erbb-2 and erbb3 binding bispecific antibodies for use in the treatment of cells that have an nrg1 fusion gene
JP7296891B2 (en) 2017-05-17 2023-06-23 メルス ナムローゼ フェンノートシャップ Combining ErbB-2/ErbB-3 bispecific antibodies with endocrine therapy for breast cancer
SG11202001050PA (en) 2017-08-09 2020-03-30 Merus Nv Antibodies that bind egfr and cmet

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991001743A1 (en) 1989-08-01 1991-02-21 Cemu Bioteknik Ab Stabilized protein or peptide conjugates
WO2005003156A1 (en) * 2003-07-04 2005-01-13 Affibody Ab Polypeptides having binding affinity for her2
WO2005097202A2 (en) 2004-04-06 2005-10-20 Affibody Ab Use of serum albumin binding peptides conjugates for the preparation of a medicament
WO2007065635A1 (en) 2005-12-05 2007-06-14 Affibody Ab Polypeptides
WO2008100624A2 (en) * 2007-02-16 2008-08-21 Merrimack Pharmaceuticals, Inc. Antibodies against erbb3 and uses thereof
WO2009019117A1 (en) * 2007-08-03 2009-02-12 Affibody Ab Igf-1r binding polypeptides and their use

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7332580B2 (en) * 2002-04-05 2008-02-19 The Regents Of The University Of California Bispecific single chain Fv antibody molecules and methods of use thereof
US7332585B2 (en) * 2002-04-05 2008-02-19 The Regents Of The California University Bispecific single chain Fv antibody molecules and methods of use thereof
US8008453B2 (en) * 2005-08-12 2011-08-30 Amgen Inc. Modified Fc molecules
EP2072525A1 (en) 2007-12-21 2009-06-24 Affibody AB New polypeptides having affinity for HER2
JP6440618B2 (en) 2012-10-05 2018-12-19 アフィボディ・アーベー HER3 binding polypeptide
EP3200823B1 (en) * 2014-10-02 2022-11-23 City of Hope Multivalent meditopes, meditope-binding antibodies and uses thereof

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991001743A1 (en) 1989-08-01 1991-02-21 Cemu Bioteknik Ab Stabilized protein or peptide conjugates
WO2005003156A1 (en) * 2003-07-04 2005-01-13 Affibody Ab Polypeptides having binding affinity for her2
WO2005097202A2 (en) 2004-04-06 2005-10-20 Affibody Ab Use of serum albumin binding peptides conjugates for the preparation of a medicament
WO2007065635A1 (en) 2005-12-05 2007-06-14 Affibody Ab Polypeptides
WO2008100624A2 (en) * 2007-02-16 2008-08-21 Merrimack Pharmaceuticals, Inc. Antibodies against erbb3 and uses thereof
WO2009019117A1 (en) * 2007-08-03 2009-02-12 Affibody Ab Igf-1r binding polypeptides and their use

Non-Patent Citations (36)

* Cited by examiner, † Cited by third party
Title
AHLGREN ET AL., BIOCONJUG CHEM, vol. 19, no. 1, 2008, pages 235 - 43
BASELGA ET AL., NAT REV CANCER, vol. 9, no. 7, 2009, pages 463 - 75
BIOCHEM BIOPHYS RES COMMUN, vol. 377, no. 2, 2008, pages 489 - 94
BOBROW ET AL., EUR J CANCER, vol. 33, no. 11, 1997, pages 1846 - 50
CITRI ET AL., EXP CELL RES, vol. 284, no. 1, 2003, pages 54 - 65
EKERLJUNG ET AL., TUMOUR BIOL, vol. 27, no. 4, 2006, pages 201 - 10
ENGELMAN ET AL., PROC NATL ACAD SCI, vol. 102, no. 10, 2005, pages 3788 - 93
FRIEDMAN ET AL., BIOTECHNOL APPL BIOCHEM, vol. 54, 2009, pages 121 - 31
FRIEDMAN ET AL., BIOTECHNOL APPL BIOCHEM, vol. 54, no. 2, 2009, pages 121 - 31
FRIEDMAN ET AL: "Directed Evolution to Low Nanomolar Affinity of a Tumor-Targeting Epidermal Growth Factor Receptor-Binding Affibody Molecule", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 376, no. 5, 4 January 2008 (2008-01-04), pages 1388 - 1402, XP022483411, ISSN: 0022-2836, DOI: DOI:10.1016/J.JMB.2007.12.060 *
FUJIMOTO ET AL., CANCER RES, vol. 65, no. 24, 2005, pages 11478 - 85
GREGORY ET AL., CLIN CANCER RES, vol. 11, no. 5, 2005, pages 1704 - 12
GRÖNWALL C ET AL: "Engineered affinity proteins-Generation and applications", JOURNAL OF BIOTECHNOLOGY, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 140, no. 3-4, 25 March 2009 (2009-03-25), pages 254 - 269, XP026073227, ISSN: 0168-1656, [retrieved on 20090202], DOI: DOI:10.1016/J.JBIOTEC.2009.01.014 *
GRÖNWALL ET AL., J BIOTECHNOL, vol. 128, 2007, pages 162 - 183
HANSSON ET AL., IMMUNOTECHNOLOGY, vol. 4, 1999, pages 237 - 252
HOLBRO ET AL., PROC NATL ACAD SCI, vol. 100, no. 15, 2003, pages 8933 - 8
HYNES ET AL., NAT REV CANCER, vol. 5, no. 5, 2005, pages 341 - 54
JONSSON ET AL., BIOTECHNOL APPLIED BIOCHEM, vol. 54, 2009, pages 93 - 103
KRONQVIST ET AL., PROTEIN ENG DES SEL, vol. 21, 2008, pages 247 - 255
L6FBLOM ET AL., J APPL MICROBIOL, vol. 102, 2007, pages 736 - 747
NORD ET AL., NAT BIOTECH, vol. 15, 1997, pages 772 - 777
NORD KARIN ET AL: "A combinatorial library of an alpha-helical bacterial receptor domain", PROTEIN ENGINEERING, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 8, no. 6, 1 January 1995 (1995-01-01), pages 601 - 608, XP002190390, ISSN: 0269-2139 *
ORLOVA ANNA ET AL: "Update: affibody molecules for molecular imaging and therapy for cancer", CANCER BIOTHERAPY AND RADIOPHARMACEUTICALS, LIEBERT, US, vol. 22, no. 5, 1 October 2007 (2007-10-01), pages 573 - 584, XP002488606, DOI: DOI:10.1089/CBR.2006.004-U *
ORLOVA ET AL., CANCER RES, vol. 66, no. 8, 2006, pages 4339 - 48
RAJKUMAR ET AL., CLIN MOL PATHOL, vol. 49, no. 4, 1996
RESCHKE ET AL., CLIN CANCER RES, vol. 14, no. 16, 2008, pages 5188 - 97
RÜTHER, NUCLEIC ACIDS RES, vol. 10, 1982, pages 5765 - 5772
SAMUELSON ET AL., J BACTERIOLOGY, vol. 177, no. 6, 1995, pages 1470 - 1476
SCHOEBERL ET AL., SCI SIGNAL, vol. 2, no. 77, 2009, pages RA 31
SOC APPL BACTERIOL SYMP SER., vol. 19, 1990, pages 49 - 53
STEFFEN ET AL., CANCER BIOTHER RADIOPHARM, vol. 20, no. 3, 2005, pages 239 - 48
STOVE ET AL., CLIN EXP METASTASIS, vol. 21, no. 8, 2004, pages 665 - 84
TANNER ET AL., J CLIN ONCOL, vol. 24, no. 26, 2006, pages 4317 - 23
THOMPSON, J.D.; HIGGINS, D.G.; GIBSON, T.J., NUCLEIC ACIDS RESEARCH, vol. 22, 1994, pages 4673 - 4680
TOLMACHEV ET AL., CANCER RES, vol. 67, no. 6, 2007, pages 2773 - 82
VAN DER HORST ET AL., INT J CANCER, vol. 115, no. 4, 2005, pages 519 - 27

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8859737B2 (en) 2009-12-22 2014-10-14 Roche Glycart Ag Anti-HER3 antibodies and uses thereof
US10196456B2 (en) 2009-12-22 2019-02-05 Roche Glycart Ag Anti-HER3 antibodies and uses thereof
US9611331B2 (en) 2009-12-22 2017-04-04 Roche Glycart Ag Anti-HER3 antibodies and uses thereof
CN104768976B (en) * 2012-10-05 2020-09-22 阿菲博迪公司 HER3-binding peptides
KR102191655B1 (en) * 2012-10-05 2020-12-16 애피바디 에이비 Her3 binding polypeptides
CN104768976A (en) * 2012-10-05 2015-07-08 阿菲博迪公司 HER3 binding polypeptides
KR20150083840A (en) * 2012-10-05 2015-07-20 애피바디 에이비 Her3 binding polypeptides
US9745350B2 (en) 2012-10-05 2017-08-29 Affibody Ab HER3 binding polypeptides
JP2015533121A (en) * 2012-10-05 2015-11-19 アフィボディ・アーベー HER3 binding polypeptide
WO2014053586A1 (en) 2012-10-05 2014-04-10 Affibody Ab Her3 binding polypeptides
US9745340B2 (en) 2012-10-25 2017-08-29 Affibody Ab Method for the separation of proteins containing an albumin-binding
US10011641B2 (en) 2012-10-25 2018-07-03 Affibody Ab ABD binding polypeptide
WO2014064237A1 (en) * 2012-10-25 2014-05-01 Affibody Ab Abd binding polypeptide
WO2014096163A1 (en) * 2012-12-19 2014-06-26 Affibody Ab New polypeptides
US20160289337A1 (en) * 2012-12-19 2016-10-06 Affibody Ab New polypeptides
JP2016503045A (en) * 2012-12-19 2016-02-01 アフィボディ・アーベー Novel polypeptide
US9957330B2 (en) 2012-12-19 2018-05-01 Affibody Ab Polypeptides
US9180185B2 (en) 2013-01-11 2015-11-10 Hoffman-La Roche Inc. Combination therapy of anti-HER3 antibodies
US10562955B2 (en) 2013-03-15 2020-02-18 Affibody Ab Polypeptides
US9975943B2 (en) 2013-03-15 2018-05-22 Affibody Ab Polypeptides
WO2014140366A1 (en) * 2013-03-15 2014-09-18 Affibody Ab New polypeptides
AU2014230018B2 (en) * 2013-03-15 2018-02-22 Affibody Ab New polypeptides
RU2714156C2 (en) * 2013-08-28 2020-02-12 Аффибоди Аб C5-binding polypeptides
USRE49495E1 (en) 2013-08-28 2023-04-18 Affibody Ab Binding polypeptides having a mutated scaffold
US10808038B2 (en) 2014-05-14 2020-10-20 Hoffmann-La Roche Inc. HER3/HER2 bispecific antibodies binding to the beta-hairpin of HER3 and domain II of HER2
WO2015173248A1 (en) * 2014-05-14 2015-11-19 F. Hoffmann-La Roche Ag Her3/her2 bispecific antibodies binding to the beta-hairpin of her3 and domain ii of her2
US10323066B2 (en) 2014-09-17 2019-06-18 Affibody Ab Neonatal Fc receptor binding dimer and methods of use
WO2016042083A1 (en) * 2014-09-17 2016-03-24 Affibody Ab New polypeptides
RU2725442C2 (en) * 2014-09-17 2020-07-02 Аффибоди Аб Novel polypeptides
EP3597661A1 (en) * 2014-09-17 2020-01-22 Affibody AB New polypeptides
KR20170054440A (en) * 2014-09-17 2017-05-17 애피바디 에이비 New polypeptides
CN107074972A (en) * 2014-09-17 2017-08-18 阿菲博迪公司 New polypeptide
KR102236830B1 (en) 2014-09-17 2021-04-06 애피바디 에이비 New polypeptides
JP2017533885A (en) * 2014-09-17 2017-11-16 アフィボディ アクティエボラーグ Novel polypeptide
WO2024034685A1 (en) 2022-08-10 2024-02-15 興和株式会社 Affibody micelle drug conjugate
JP2025542406A (en) * 2022-12-30 2025-12-25 アブクロン・インコーポレイテッド Affibodies that specifically bind to CD137 and uses thereof
WO2024213587A1 (en) * 2023-04-11 2024-10-17 Antaros Tracer Ab Drug delivery systems
WO2024227930A1 (en) * 2023-05-04 2024-11-07 Affibody Ab New polypeptide
WO2025120217A3 (en) * 2023-12-06 2025-08-14 Oncopeptides Innovation 1 Ab Cd16a-binding polypeptide

Also Published As

Publication number Publication date
US10208128B2 (en) 2019-02-19
JP2013509861A (en) 2013-03-21
EP2496598B1 (en) 2017-08-02
EP2496598A1 (en) 2012-09-12
US20120270801A1 (en) 2012-10-25
JP5960598B2 (en) 2016-08-02

Similar Documents

Publication Publication Date Title
EP2496598B1 (en) Her3 binding polypeptides
EP2231860B1 (en) Polypeptide derived from protein a and able to bind pdgf
US8598113B2 (en) Polypeptides
KR102290592B1 (en) Binding proteins comprising at least two repeat domains against her2
Kronqvist et al. Combining phage and staphylococcal surface display for generation of ErbB3-specific Affibody molecules
EP2183275B1 (en) Igf-1r binding polypeptides and their use
AU2016295024B2 (en) Her2 binding proteins based on di-ubiquitin muteins
AU2013336646B2 (en) ABD binding polypeptide
CN104768976B (en) HER3-binding peptides
US9187535B2 (en) Polypeptide derived from protein A and able to bind PDGF
WO2014076179A1 (en) New polypeptide
WO2014076177A1 (en) New polypeptide
CA3184995A1 (en) Serum stable binding proteins for human her2 for theranostic applications
EP3325514B1 (en) Her2 binding proteins based on di-ubiquitin muteins
Nilvebrant et al. Engineering of Bispecific Affinity Proteins with High Affinity for
HK1125657A (en) Polypeptides

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10775936

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2012536757

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2010775936

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010775936

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13505493

Country of ref document: US