WO2011054100A1 - Stem cell extracts and uses thereof for immune modulation - Google Patents

Stem cell extracts and uses thereof for immune modulation Download PDF

Info

Publication number
WO2011054100A1
WO2011054100A1 PCT/CA2010/001771 CA2010001771W WO2011054100A1 WO 2011054100 A1 WO2011054100 A1 WO 2011054100A1 CA 2010001771 W CA2010001771 W CA 2010001771W WO 2011054100 A1 WO2011054100 A1 WO 2011054100A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
stem cells
extracts
extract
Prior art date
Application number
PCT/CA2010/001771
Other languages
French (fr)
Inventor
Lisheng Wang
Kanishka Mohib
David Allan
Li Ll
Original Assignee
Lisheng Wang
Kanishka Mohib
David Allan
Li Ll
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lisheng Wang, Kanishka Mohib, David Allan, Li Ll filed Critical Lisheng Wang
Publication of WO2011054100A1 publication Critical patent/WO2011054100A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
    • A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0639—Dendritic cells, e.g. Langherhans cells in the epidermis
    • C12N5/064—Immunosuppressive dendritic cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0645—Macrophages, e.g. Kuepfer cells in the liver; Monocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0648—Splenocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/02—Coculture with; Conditioned medium produced by embryonic cells

Definitions

  • the present invention relates to methods and compositions useful to modulate an immune response in a subject or induce immune tolerance. More specifically, the present invention relates to stem cell extracts and compositions useful, either separately or in a combination with other immunosuppressive drugs, for modulating a subject's immune response or for inducing immune tolerance.
  • immunosuppressive drugs remain the first choice of treatment for patients who receive organ or bone marrow transplantation and suffer from autoimmune diseases. Although these drugs have harmful side-effects, including infections and cancers, patients must take them for life. As opposed to immunosuppressive drugs, inducing true immune tolerance without bluntly suppressing a patient's immune system remains a desirable but elusive goal in clinic.
  • RA rheumatoid arthritis
  • GVHD Graft versus Host Disease
  • RA is an autoimmune disease of unknown etiology. RA leads to chronic inflammation in the joints and subsequent destruction of the cartilage and erosion of the bone. According to the Public Health Agency of Canada, arthritis and other rheumatic conditions affect around 4 million Canadians of all ages, with numbers expected to double by 2020. Arthritis is one of the most common causes of physical disability (pain, activity limitation) among Canadians. The burden of the disease on the health care system is estimated to be $18 billion annually - one of the largest cost drivers in the health care system today.
  • a variety of cells and cytokines are involved in the pathogenesis of RA. It is believed that antigen-presenting cells (APCs), such as dendritic cells (DCs), lead to T cell activation by presenting a particular major histocompatibility complex (MHC) phenotype and unknown auto-antigens that are carried and predisposed primarily by individuals. T cell activation requires co-stimulatory molecules, for instance CD80 (B7.1) and/or CD86 (B7.2). Once triggered, T cells activate other cells, especially B cells. These activated B cells then likely produce autoantibodies.
  • APCs antigen-presenting cells
  • DCs dendritic cells
  • MHC major histocompatibility complex
  • B7.2 co-stimulatory molecules
  • T cells also activate macrophages, which secrete a variety of proinflammatory cytokines, including tumor necrosis factor a (TNF-a), interleukin-1 (IL-1), and IL-6.
  • TNF-a tumor necrosis factor a
  • IL-1 interleukin-1
  • IL-6 interleukin-6
  • Autoantibodies once formed, may form immune complexes that in turn can augment macrophage activation.
  • targeted therapies using biological agents have been employed. For instance, blockade of co-stimulatory signals, depletion of B cells, inhibition of TNF-a, IL-1, and IL-6, or combined regimes.
  • none of combined regimes has demonstrated clinical advantages. Instead, the adverse events, especially the rates of infections, are increased. It suggests that the combination leads to the inhibition of both targets, albeit without a beneficial effect on the inflammatory response in RA.
  • GVHD is a frequent complication and a major cause of morbidity and mortality of allogeneic bone marrow transplantation.
  • Clinical GVHD has an acute form and a chronic form.
  • Acute GVHD is an alloimmune response, and predominately involves a T cell- mediated attack on the host. It is characterized by damage to the skin, liver and the gastrointestinal tract.
  • Chronic GVHD in contrast, is an autoimmune-like disorder
  • GVHD characterized by T cell activation and subsequent chronic B cell stimulation and autoantibody production.
  • GVHD develops as a result of donor T cells attacking recipient tissues.
  • immune treatment approximately 40% of patients still develop GVHD and have an increased risk of serious infection, relapsed disease, organ toxicity and mortality.
  • fetus antigens may skew maternal alloimmune response to immunological tolerance during pregnancy.
  • Many mechanisms may protect the fetus from the maternal immune system. For instance, expression of nonclassical MHC molecules (such as HLA-G), alloantigen shedding from the fetus, costimulatory molecule and programmed death ligand (PDL)-l, regulatory T cells (Tregs) and dendritic cells, T cell apoptosis, tryptophan catabolism by the enzyme indoleamine 2,3-dioxygenase, and the complement system.
  • nonclassical MHC molecules such as HLA-G
  • alloantigen shedding from the fetus costimulatory molecule and programmed death ligand (PDL)-l
  • PDL programmed death ligand
  • Regs regulatory T cells
  • dendritic cells T cell apoptosis
  • tryptophan catabolism by the enzyme indoleamine 2,3
  • Nonclassical MHC molecule HLA-G has a number of immunomodulatory functions. For instance, the absence of polymorphic MHC expression and expression of HLA-G on the surface of fetal-derived trophoblast cells seems important in preventing deleterious maternal immune responses against the fetus. HLA-G also inhibits both cytotoxic lymphocyte responses. Antigen-presenting cells transfected with HLA-G can prevent CD4+ T cell proliferation; and soluble HLA-G can induce CD8+ T cell apoptosis. The interaction of HLA- G with leukocyte immunoglobulin-like receptor expressed on dendritic cells can influence immune responses. Such interaction can reduce the expression of costimulatory molecules CD80 and CD86 in dendritic cells, facilitate the generation of CD4+CD25+ Tregs, and lead to the anergy of T cells.
  • Another key player in maternal- fetal tolerance may attribute to continual antigen shedding from fetal allogeneic trophoblast. These shed antigens are presented by maternal antigen presenting cells during normal pregnancy. Fetal cells and DNA routinely traffic into the maternal circulation during normal pregnancy, detectable in the maternal serum as early as the first trimester. During the third trimester of normal pregnancy, several grams of dying placental trophoblast are shed daily into the maternal circulation. The concentration of fetal DNA increases over the course of pregnancy and declines rapidly after delivery. [0011] In addition, regulatory T cells and the CD80 and CD86 family of costimulatory molecules appear to be essential for fetus-maternal tolerance.
  • T cell receptor TCR
  • Blockade of positive costimulatory signals such as CD80 and CD86 has been shown to inhibit maternal rejection of the allogeneic fetus in abortion-prone matings.
  • the programmed death- 1 receptor and its ligands, PDL1 (B7-H1) and PDL2 (B7-DC) seem to play an important role in peripheral tolerance.
  • PDL1 is present on all trophoblast populations, and PDL2 on the
  • compositions and methods for modulating a subject's immune response and/or inducing immune tolerance are provided.
  • compositions and methods may meet unmet therapeutic needs, provide improvements over known methods and therapeutics, or otherwise provide alternate treatment approaches.
  • the extracts, compositions and methods as described herein and throughout also may be important to induce desired effects in-vitro, as is demonstrated herein.
  • a stem cell extract having immune modulatory activity is prepared by culturing stem cells in a feeder- free cell culture system, collecting the stem cells and transferring them into a cell lysis buffer, lysing the stem cells in the cell lysis buffer to produce a lysate, and fractionating the lysate into soluble, insoluble fractions, microsome or multivesicular endosome, wherein the stem cell extract comprises the soluble, insoluble fraction, microsome or multivesicular endosome.
  • the invention further relates to compositions comprising the described stem cell extracts, and methods of using the compositions to treat and/or prevent a variety of medical conditions, for example, but not limited to autoimmune diseases, transplant rejections, Graft Versus Host Disease (GVHD), arthritis and the like. Further, the compositions may be employed to modulate the immune system and/or induce immune tolerance in subjects.
  • autoimmune diseases for example, but not limited to autoimmune diseases, transplant rejections, Graft Versus Host Disease (GVHD), arthritis and the like.
  • GVHD Graft Versus Host Disease
  • Also provided herein are methods of educating or programming a subject's immune cells comprising treating immune cells obtained from the subject in vitro with a stem cell extract or composition described herein in an amount effective to educate or program the immune cells.
  • the educated or programmed immune cells may be administered to the subject to correct an immune disorder, to induce or enhance immune tolerance, to prevent or alleviate transplant rejection, to treat allergies and/or hypersensitivity, or to treat or alleviate an autoimmune disease.
  • a method of expanding adult stem cells or progenitor cells comprising administering a stem cell extract or composition as described herein to the adult stem cells or progenitor cells in vitro, or directly to a subject in vivo, in an amount effective for expansion of the adult stem cells or progenitor cells in vitro or in vivo.
  • the invention additionally relates to methods of combination therapy. Such methods involve administering a stem cell extract or composition as described herein, together with an immunosuppressive drug, to the subject in effective amounts to treat the subject.
  • the treatment may be for inducing or enhancing immune tolerance, preventing or alleviating transplant rejection, modulating immune responses in the subject, treating or preventing allergies and/or hypersensitivity, or treating or preventing an autoimmune disease.
  • the stem cell extract or composition described herein may also be incorporated into a method for enhancing activity or increasing treatment efficacy of an immunosuppressive drug. Such methods comprise administering the stem cell extract or composition and an immunosuppressive drug.
  • the treatment will be for the therapeutic purpose of the immunosuppressive drug.
  • the above-described methods may be adapted for human or veterinary therapeutic purposes.
  • the subject may be a human or other mammal including, but not limited to horse, dog, cat, rat, or mouse.
  • the described compositions may also therefore comprise, without intending to be limiting in any way, stem cell extracts derived from human, horse, dog, cat, rat, mouse or other mammalian sources.
  • the methods and compositions described herein may be adapted for treatment of dog and/or cat autoimmune diseases or disorders.
  • a composition comprising a stem cell extract having immune modulatory activity, the extract prepared by culturing stem cells in a feeder-free cell culture system, collecting the stem cells and transferring into a cell lysis buffer, lysing the stem cells in the cell lysis buffer to produce a lysate, and fractionating the lysate into soluble and insoluble fractions, wherein the stem cell extract comprises the soluble or insoluble fraction.
  • composition comprising the stem cell extract as defined above, wherein the stem cells are of human, horse, dog, cat, rat, or mouse origin.
  • compositions comprising the stem cell extract as defined above, wherein the extract is prepared from stem cell sources selected from the group consisting of embryonic stem cells (ESCs), differentiated ESCs, ESC-derived trophoblasts, pluripotent stem cells, differentiated pluripotent stem cells, induced human pluripotent stem cells (iPS), mesenchymal stem cells (MSCs), or
  • stem cell sources selected from the group consisting of embryonic stem cells (ESCs), differentiated ESCs, ESC-derived trophoblasts, pluripotent stem cells, differentiated pluripotent stem cells, induced human pluripotent stem cells (iPS), mesenchymal stem cells (MSCs), or
  • the stem cells are human embryonic stem cells (hESCs).
  • the present invention also contemplates a composition as defined above, wherein the stem cells are treated with collagenase IV and washed with phosphate buffered saline (PBS) prior to cell lysis, and wherein the washed stem cells are lysed by sonication.
  • PBS phosphate buffered saline
  • compositions as defined above and an acceptable carrier or excipient comprising, a) an extract derived from day 3-7 embryonic stem cells, wherein the stem cells are undifferentiated stem cells, and; a-1) wherein the extract is prepared by sonication of the stem cells and clarified by centrifugation to remove cell membrane, mitochondria and nucleus, and wherein the extract is prepared in the absence of an exogenously added detergent; b) one or more salts or buffers; c) a calcium/magnesium chelating agent; d) a thiol reducing agent; e) one or more protease inhibitors, and; f ) optionally, L-arginine.
  • composition as defined above wherein the composition comprises L-arginine and the composition is sterile.
  • compositions as defined above wherein the composition is derived from day 5 embryonic stem cells expressing undifferentiated markers, such as SSEA-4, TRA-1-60, Tra-1-81 and OCT 3/4, Nanog, and AP markers.
  • undifferentiated markers such as SSEA-4, TRA-1-60, Tra-1-81 and OCT 3/4, Nanog, and AP markers.
  • composition as defined above wherein the embryonic stem cells are cultured on a feeder-free cell culture medium.
  • compositions as defined above wherein the extract comprises a microsomal fraction or a multivesicular endosome fraction of the embryonic stem cells comprising a stem cell extract and a pharmaceutically acceptable carrier or excipient.
  • a method of inducing or enhancing immune tolerance in a subject in need thereof comprising administering a stem cell extract or a composition as defined above to the subject in an amount effective to induce or enhance immune tolerance.
  • a method of preventing or alleviating transplant rejection in a subject in need thereof comprising administering a stem cell extract or composition as defined above to the subject in an amount effective to prevent or alleviate transplant rejection.
  • transplant is an allograft.
  • the method comprising administering a stem cell extract or composition as defined above to the subject in an amount effective to modulate an immune response to an allergen or antigen.
  • a method of treating or preventing an autoimmune disease comprising administering a stem cell extract or composition as defined above to the subject in an amount effective to ameliorate or prevent the autoimmune disease.
  • autoimmune disease is selected from the group consisting of graft-versus-host disease (GVHD), rheumatoid arthritis (RA), multiple sclerosis, systemic lupus erythematosus (SLE), Scleroderma, Sjogren's syndrome, Guillain-Barre syndrome, Type I diabetes, Graves disease, Celiac disease,
  • GVHD graft-versus-host disease
  • RA rheumatoid arthritis
  • SLE systemic lupus erythematosus
  • Scleroderma Sjogren's syndrome
  • Guillain-Barre syndrome Type I diabetes
  • Graves disease Celiac disease
  • stem cell extract is administered intravenously, intramuscularly, intraperitoneally, subcutaneously, intracardially, orally or nasally.
  • the allograft is co-transplanted together with the stem cell extract to induce or increase immune acceptance of the transplanted cells.
  • the allograft may comprise differentiated cells selected from the group consisting of neural cells, islet cells and muscle cells.
  • Also provided is a method of educating or programming a subject's immune cells comprising treating immune cells obtained from the subject in vitro with a stem cell extract or composition as described above in an amount effective to educate or program the immune cells.
  • a method of expansion of adult stem cells or progenitor cells comprising administering a stem cell extract or composition as defined above to the adult stem cells or progenitor cells in vitro, or directly to a subject in need thereof in vivo, in an amount effective for expansion of the adult stem cells or progenitor cells in vitro or in vivo.
  • the method comprising administering a stem cell extract or composition as defined above and the immunosuppressive drug to a subject in need thereof.
  • the immunosuppressive drug is selected from the group consisting of calcineurin inhibitors, mammalian target of rapamycin (mTOR) inhibitors, interferons, TNF binding proteins, IL-2 receptor antibodies, T-cell receptor antibodies, cytostatics,
  • the immunosuppressive drug may be selected from the group consisting of cyclosporin, tacrolimus, sirolimus, IFN- ⁇ , infliximab (RemicadeTM), etanercept (EnbrelTM), adalimumab (HumiraTM), basiliximab (SimulectTM), daclizumab (ZenapaxTM), OKT3 (muromonab), cyclophosphamide, nitrosoureas, platinum compounds, methotrexate, azathioprine, mercaptopurine, dactinomycin, anthracyclines, mitomycin C, bleomycin, mithramycin, hydrocortisone and combinations thereof.
  • the present invention also provides a method of treating a subject in a combination therapy, comprising administering a stem cell extract or composition as described herein and an immunosuppressive drug to the subject in effective amounts, wherein the treatment is for inducing or enhancing immune tolerance, preventing or alleviating transplant rejection, modulating immune responses in the subject, treating or preventing allergies and/or hypersensitivity, or treating or preventing an autoimmune disease.
  • stem cell extract or composition as described above wherein the stem cells are cultured on MatrigelTM coated plates for 3 to 7 days.
  • the stem cells are lysed by sonication, freeze-thaw, mechanical lysis using a pressure cell or detergent solubilization. Detergent solublization is less preferred. Sonication is more preferred.
  • the stem cell extract or composition as defined above may include cell lysis buffer that comprises a buffer, a salt, a chelating agent, a reducing agent and protease inhibitors.
  • cell lysis buffer that comprises a buffer, a salt, a chelating agent, a reducing agent and protease inhibitors.
  • the pH of the lysis buffer ranges from about 6.5 to 8.5.
  • buffer is selected from the group consisting of HEPES, Tris- HC1 and combinations thereof. Also contemplated is a stem cell extract or composition wherein the concentration of the buffer ranges from about lOmM to lOOmM. In another embodiment, the buffer comprises about physiological osmolality and pH.
  • the stem cell extract or composition as described above may comprise one or more salts comprising NaCl, MgCl 2 , KCl, LaCl 3 , CaCl 2 and combinations thereof.
  • concentration of the salt may range in some instances from about 0.1 mM to lOOOmM.
  • the present invention also contemplates the stem cell extract or composition as described above, wherein the reducing agent comprises one or more of dithiothreitol (DTT), dithioerythrol, 2-mercaptoethanol (2-ME), GSSG, GSH or glutathione and combinations thereof.
  • the concentration of the reducing agent ranges from about 0.1 mM to lOmM.
  • the present invention also contemplates the stem cell extract or composition as described above, wherein the chelating agent comprises ethylenediaminetetraacetic acid (EDTA), ethylene glycol tetraacetic acid (EGTA) or a combination thereof.
  • EDTA ethylenediaminetetraacetic acid
  • EGTA ethylene glycol tetraacetic acid
  • the present invention also contemplates the stem cell extract or composition as described above, wherein the concentration of the chelating agent ranges from about 0.1 mM to 200mM.
  • the present invention also contemplates the stem cell extract or composition as described above, wherein the protease inhibitors comprise leupeptin, serine proteases, cysteine proteases, metalloproteases, aspartic acid proteases and combinations thereof.
  • the present invention also contemplates the stem cell extract or composition as described above, wherein the concentrations of the protease inhibitors range from
  • the present invention also contemplates the stem cell extract or composition as described above, wherein the cell lysis buffer further comprises a protein stabilizer selected from the group consisting of L-arginine, glycerol, sucrose, ⁇ -lactamase, acetone acetamide, surfactants, TweenTM80, TweenTM20, TweenTM40, polymers, L-glutamine, L-lysine and combinations thereof.
  • a protein stabilizer selected from the group consisting of L-arginine, glycerol, sucrose, ⁇ -lactamase, acetone acetamide, surfactants, TweenTM80, TweenTM20, TweenTM40, polymers, L-glutamine, L-lysine and combinations thereof.
  • the present invention also contemplates the stem cell extract or composition as described above, wherein the concentration of the protein stabilizer is from about OmM to 500mM.
  • FIGURE 1 illustrates maintenance of undifferentiated human embryonic stem cells under the defined culture conditions in the presence of basic fibroblast growth factor but in the absence of serum, cytokines, feeder-cells and antibiotics.
  • Undifferentiated hESCs were maintained either under the feeder-free (Wang L, et al. Immunity 2004; 21 : 31-41) or defined culture conditions (Wang L, et al. Blood 2005;105:4598-4603).
  • the hESCs were characterized by Flow cytometry (a), immunocytochemistry (b, c) and teratoma formation (d-g).
  • Undifferentiated hESCs express surface markers SSEA-4, Tra-1-60, Tra-1-81, and intracellular marker Oct3/4 (a, first peak of each panel representing the isotype antibody control), Nanog (b, red; inset, isotype control), and E-cadherin (c, green) and AP (c, red).
  • SSEA-4 surface markers
  • Oct3/4 intracellular marker
  • Nanog b
  • inset isotype control
  • E-cadherin c, green
  • AP c, red
  • Haematoxylin and eosin staining of the teratoma sections revealed that the tumors were composed of a mixture of well-differentiated tissues representing all 3 embryonic germ layers, including ectoderm (d. neural rosette), mesoderm (e. cartilage, f. bone) and endoderm (g. gut-like glands with goblet cells). Bars, 10 um.
  • hESC human embryonic stem cells
  • hESC human embryonic stem cells
  • HI cell line human embryonic stem cells
  • H9 cell line human mixed lymphocyte reaction
  • One way mixed lymphocyte reactions were carried out with human peripheral blood mononuclear cells in the presence or absence of 3 ⁇ 1 (Allo+hESC 3, containing ⁇ 0.3 ⁇ g protein) or 2 ⁇ 1 (Allo+hESC 2, containing ⁇ 0 ⁇ g protein) of hESC-extracts or vehicle (Allo+lysis 3, Allo+lysis 2), respectively.
  • [3H]-thymidine was added on day 6 of incubation and the cells were allowed to proliferate for an additional 18 hours.
  • Mixed lymphocyte reactions treated with 3 ⁇ 1 of hESC extracts significantly inhibited cell proliferation in comparison to untreated cultures. Noticeably, cultures treated with 3 ⁇ 1 of vehicle also proliferated to a lesser degree. However,
  • FIGURE 3 shows that cell-extracts from human embryonic stem cells (hESC-extracts, either HI male line or H9 female line; center, blue box) but not from human embryonic fibroblast cells (right, red box) suppress human monocyte differentiation.
  • THP-1 human monocytic cells were pre-treated with 20 ⁇ 1 of hESC-extracts for 24 hours. Subsequently, macrophage maturation was induced with ⁇ g/mL of LPS for 18 hours. Quantitative PCR was utilized to detect expression levels of maturation markers B7.1 (CD80), B7.2 (CD86), CD1 lb, CD68, and MMP9 in comparison to controls.
  • results indicate that hESC-extracts (LPS+hESC) have the ability to hinder gene expression levels in comparison to the cells treated with vehicle control (LPS+lysis) and with human embryonic fibroblast cell line extracts.
  • FIGURE 4 shows that cell-extracts from human embryonic stem cells (hESC-extracts) suppress the differentiation and maturation of dendritic cells from monocytes, inhibiting the morphological change and co-stimulatory molecule CD80 expression.
  • Cell-extracts from human embryonic stem cells hESC-extracts
  • A Monocytes treated with vehicle showed a typical maturation morphology.
  • the cells also received either 3 ⁇ 1 of vehicle (Control - Lysis buffer alone), or hESC-extracts. Two days later, cells were fed with fresh media every 2 days containing cytokines and 1 ⁇ of vehicle or hESC-extracts for the first 6 days. On day 6, the cells also received 20 ng/mL of TNF-alpha in order to induce dendritic cell maturation. On day 8, cells were examined for CD80 (B7.1) expression by flow cytometry.
  • vehicle Control - Lysis buffer alone
  • hESC-extracts Two days later, cells were fed with fresh media every 2 days containing cytokines and 1 ⁇ of vehicle or hESC-extracts for the first 6 days. On day 6, the cells also received 20 ng/mL of TNF-alpha in order to induce dendritic cell maturation. On day 8, cells were examined for CD80 (B7.1) expression by flow cytometry.
  • FIGURE 5 shows that (A and B) cell-extracts from human embryonic stem cells (hESC- extracts) suppress the differentiation and maturation of dendritic cells from monocytes, inhibiting the expression of CD83 (DC maturation marker) and HLA-DR (antigen
  • hESC-extracts (white overlay) are capable of suppressing the expression of CD83 (A) and HLA-DR (B), as indicated by the decreased fluorescence intensity (shift to the left) and the lower percentage of positive cells.
  • Primary human monocytes were cultured with 500 IU/mL of GM-CSF and 500 IU/mL IL-4 in order to induce the differentiation of monocytes into dendritic cells.
  • the cells also received either 3 ⁇ 1 of vehicle (Control -Lysis buffer alone), or hESC-extracts. Two days later, cells were fed with fresh media every 2 days containing cytokines and 1.5 ⁇ 1 of vehicle or hESC-extracts for the first 6 days. On day 6, the cells also received 20 ng/mL of TNF- alpha in order to induce dendritic cell maturation. On day 8, cells were examined for the expression of CD83 (dendritic cell maturation marker) and HLA-DR (antigen presentation marker) by flow cytometry. For (C) and (D), primary human monocytes were cultured in media supplemented with 500U/mL of GM-CSF and IL-4 in order to induce differentiation into dendritic cells.
  • CD83 dendritic cell maturation marker
  • HLA-DR antigen presentation marker
  • the cells received either 3ul of H9 hESC extract (H9-Ext, 3ug/uL), human embryonic fibroblast cell MRC extract (MRC-5 Ext, 3ug uL), or vehicle at the first two days.
  • the media were then changed very two days with addition of fresh GM-CSF and IL-4 and either 1.5 of H9-Ext, MRC-Ext or vehicle for the next 4 days.
  • the cells were treated with 20ng/mL of TNF-a to induce dendritic cell maturation.
  • the cells were harvested, washed and treated with 5( ⁇ g/ml of mitomycin C.
  • FIGURE 6 illustrates that (A and B) hESC-extracts from different cell lines (either HI or H9 line) show similar potency in the suppression of CD80 (co-stimulatory molecule) expression, but that hESC-extracts containing a lower level of protein (or partially denatured) show a relatively lower potency (compared to Figure 4), and (C) water soluble hESC-extracts show immune modulatory potency different from water insoluble precipitates.
  • cell- extracts from different lines of human embryonic stem cells show identical suppressive potency to the expression of CD80 (B7.1) during human monocyte differentiation into dendritic cells.
  • the cells also received either 3 ⁇ 1 of vehicle (Control - Lysis buffer alone), or HI or H9 hESC-extracts. Subsequently, cells received fresh media every 2 days containing cytokine and 1 ⁇ of lysis-buffer or hESC-extracts for the first 6 days. On day 6, the cells also received 20ng mL of TNF-alpha in order to induce dendritic cell maturation. On day 8, cells were examined for CD80 expression by flow cytometry.
  • FIGURE 7 shows in vivo results illustrating the potential of STEM-pep to alleviate GVHD.
  • STEM-pep is capable of alleviating acute graft versus host disease, indicated by lower body weight loss (A) and less severe GVHD symptoms (B).
  • A body weight loss
  • B less severe GVHD symptoms
  • the body weight and onset of GVHD was monitored and scored blindly by the experienced animal technicians.
  • GVHD symptoms of each mouse were scored daily from 0 to 2 for each symptom including weight loss, inactivity, skin lesions, roughened coat, and hunching.
  • the total GVHD scores are combined to provide a clinical score from 0-10. Higher scores indicate more severity of GVHD.
  • Unresponsive mice or those unable to obtain food and water (loss of >30% of initial body weight) with severe GVHD symptoms were determined to be moribund and killed in accordance with Animal Care Committee Guidelines of the University of Ottawa.
  • FIGURE 8 illustrates the immune suppressive potential of cell-extracts from mesenchymal stem cells (MSC-extracts) through inhibition of mixed lymphocyte proliferation.
  • MSC mesenchymal stem cells
  • MSC-extracts ⁇ 0.3 g protein are also capable of inhibiting alloantigen-induced lymphocyte proliferation (one way mixed lymphocyte reaction), but with less potency than hESC-extracts (human embryonic stem cell extracts, ⁇ 0 ⁇ g protein).
  • hESC-extracts human embryonic stem cell extracts, ⁇ 0 ⁇ g protein.
  • FIGURE 9 illustrates (A) that human embryonic stem cell extracts (hESC EXT) induce FoxP3 expression in mixed lymphocyte reaction assays, and that the Programmed Death- 1 receptor and its Ligands, PDL-1 (B7-H1) and PDL-2 (B7-DC) are expressed in hESCs (B) and up- regulated after differentiation (towards trophoblast-like cells) in the presence of bone morphogenic protein 4 (BMP4) (C).
  • BMP4 bone morphogenic protein 4
  • A One way mixed lymphocyte reactions were carried out in the presence or absence of hESC-extracts. Cells were allowed to proliferate in response to alloantigen for 7 days and RNA was extracted from the cells in order to detect FoxP3 transcript using Q-PCR.
  • FoxP3 expression is increased 2-fold in the lymphocyte cultures treated with hESC-extracts (hESC EXT) in comparison to those treated with vehicle control. This indicates a possible polarization or induction of regulatory T cells.
  • FoxP3 primer sequences forward, cagcacattcccagagttcct (SEQ ID NO.l); reverse:
  • gcgtgtgaaccagtggtagat SEQ ID NO:2.
  • the conditions for Q-PCR reactions are: an initial hot start at 94 °C for 90 second (1 cycle); cycle 2 (40 cycles), 94 °C for 10 second, 60 °C for 30 second and 72 °C for 30 second.
  • FIGURE 10 shows the reprogramming of human blood leucocytes into induced pluripotent stem (iPS) cells with four transcription factors.
  • A provides a schematic drawing
  • the reprogrammed colony switches to anchorage-dependent growth. The colony attaches to the plate and shows typical morphology of human embryonic stem cells. Notice that some round-like floating cells are non-reprogrammed blood leukocytes.
  • C the reprogrammed colony proliferates after 5 days of culture, showing similar proliferative rate to that of human embryonic stem cells.
  • D and E the third passage of the reprogrammed colonies at day 1 and day 3 after reseeding.
  • reprogrammed cells are positive (red) for alkaline phosphatase staining. Alkaline phosphatase is one of the most reliable parameters used for the
  • FIGURE 1 1 shows (A) that ESC-extracts work synergistically with low dose of immunosuppressive drug cyclosporine (calcineurin inhibitor) to dramatically suppress mixed lymphocyte reaction, (B) that human ESC-extracts inhibit PMA-induced proliferation of purified T cells, and (C and D) that hESC and mESC-extracts work synergistically with Calcium channel inhibitors to suppress mixed lymphocyte reaction. (A) Current
  • immunosuppressive drugs used in the clinic are associated with various severe side-effects, such as organ toxicity, opportunistic infection and cancer.
  • ESC-extract can be used to reduce the dosage of immune suppressive drugs.
  • ESC-extracts were tested in combination with low dose of calcineurin inhibitor cyclosporin, a drug commonly used in the clinic to prevent organ rejection.
  • Mixed lymphocyte reactions were carried with 1 x 10 5 responder (CD1 mouse) and stimulator (B6 mouse) splenocytes and treated with either vehicle alone, vehicle in
  • hESC-extracts suppress mixed lymphocyte reaction in a synergistic manner by improving suppression by 100 fold and 10 fold compared to hESC-extract and SKF alone respectively.
  • R + S responder + stimulator.
  • D similar results obtained from mouse ESC-extracts.
  • R + S responder lymphocyte + stimulator lymphocyte.
  • B6 2 ⁇ 1 2 ⁇ 1 of ESC-extracts from B6 mouse ES cells. The data are representative of two independent experiments.
  • FIGURE 12 shows that bioactive components of ESC-extracts for immune modulation are, at least in part, proteinaceous - Proteinase K treatment abrogates the inhibitory effect of mESC- extract on mouse splenocyte proliferation.
  • the third panel (EXT-P : mouse ESC-extracts pretreated with Proteinase K) shows that the second peak is similar to control (first panel, R + S: responder splenocyte + stimulator splenocyte), indicating cell proliferation because dividing daughter cells have diluted the fluorescent density of the parent cells that had been pre-labeled with fluorescent dye.
  • mice-extracts treated with RNase A retain their immune inhibitory capacity in comparison to the untreated ESC-extracts (EXT-control).
  • Mouse ESC-extracts (EXT) were treated with O.lmg/ml of proteinase for 24 hours at 37 °C, or with lC ⁇ g/ml of RNAse A for 2 hours at 37 °C. Subsequently, the mouse ESC-extracts were used to inhibit the proliferation of B6 mouse splenocytes to Balb/c splenocytes in one-way mixed lymphocyte reaction.
  • Responder B6 splenocytes were suspended in RPMI medium at 1.0 x 10 6 /ml and treated with 5 ⁇ of carboxyfluorescein diacetate succinimidyl ester (CFSE) for 30 minutes at 37 °C. Following the incubation, responder cells were washed 3 times with serum free RPMI and seeded in 96 well U bottom plates with Balb/c splenocytes that had been pre-treated with 5( ⁇ g/ml of mitomycin C at a cell density of 2.0 x 10 6 cells for each. The cells were allowed to proliferate for 4 days and analyzed by flow cytometry. The data are representative of two independent experiments.
  • CFSE carboxyfluorescein diacetate succinimidyl ester
  • FIGURE 13 is a representative schematic illustration of the method of STEM-pep preparation from hESCs under sterilized conditions.
  • FIGURE 14 illustrates the results of two different cell lysis methods, sonication and freeze- thaw lysis, on stimulation index with mESCs.
  • FIGURE 15 shows results of modifying the lysis buffer.
  • A illustrates the non-specific effect caused by high concentrations of EDTA (100 mM EDTA; see boxed results at two vehicle volumes tested);
  • B illustrates a reduction in non-specific effect by reducing EDTA concentration in the lysis buffer from 100 mM to 1 mM (no apparent titratable effect at three V2 vehicle volumes tested), and raw test data from mouse ESC (mESC) extracts prepared in lysis buffer containing 1 mM EDTA and further including L-Arginine.
  • mESC mouse ESC
  • FIGURE 16 shows results that ESC-extracts inhibit allogeneic PBMC proliferation in mixed lymphocyte reactions.
  • MLR Mixed lymphocyte reactions
  • Tritiated thymidine was added on day 5 and the cells were cultured for an additional 16 to 18 h. Results are displayed as counts per minute (CPM) of. triplicate wells ⁇ SD. Results are representative of at least five separate experiments, b.
  • Cellular extracts prepared from B6 murine ESCs (mESC EXT. 1.75 ⁇ g (0.5 ⁇ 1-14 ⁇ g (4 ⁇ ) of proteins/200 ⁇ /well) were used in one-way MLR.
  • One hundred thousand C57BL/6 splenocytes were cultured together with lxlO 5 mitomycin-treated B6C3F1 splenoncytes.
  • Tritiated thymidine was added on day 3 of incubation and the cells were allowed to proliferate for an additional 16 to 18 h.
  • Cell proliferation is displayed as mean counts per minute (CPM) of triplicate wells ⁇ SD. Results are representative of at least five separate experiments, c.
  • the inhibitory effect of hESC-EXT on PBMC proliferation in MLR is not due to cell death.
  • Human PBMCs cultured as in (a) were harvested on day 6, washed with PBS, stained with 7AAD for 30 min and analyzed by flow cytometry. Results are representative of three separate experiments.
  • FIGURE 17 shows results that hESC-extracts inhibit monocyte-derived dendritic cell maturation.
  • Primary human monocytes were isolated by negative selection using magnetic beads. Subsequently, 5.0 x 10 5 monocytes were cultured in the presence of 500U/mL of GM- CSF and IL-4 in order to induce them to differentiate into dendritic cells.
  • the cells also received either 0.15 mg/mL (final concentration) of hESC extracts (hESC EXT), L-132 fibroblast extracts (Control EXT), or equivalent volume of vehicle on day 0.
  • Fresh media were added every 2 days containing fresh cytokines and 0.075 mg/mL of hESC EXT, L-132 EXT or vehicle on day 2, 4, and 6.
  • FIGURE 18 shows results that hESC extract-treated mDCs retain greater phagocytic function following maturation. Immature and TNF-a matured mDCs were cultured and collected on day 6 (a) and day 8 (b) respectively. The cells were washed twice with PBS containing 1% FBS and incubated with 1 mg/mL of dextran-FITC beads at 37°C or on ice for 90 min.
  • FIGURE 19 shows results that hESC extract-treated mDCs secrete lower levels of IL-12p40 following maturation.
  • Supernatants from mDCs treated with vehicle, hESC EXT, and fibroblast EXT were collected on day 6 and day 8. Subsequently, IL-12p40 levels were measured by ELISA assays. Results are representative of three separate experiments.
  • FIGURE 20 shows results that suggest IL-10 and TCF- ⁇ do not contribute to hESC extract- mediated immune modulation, a) Relative mRNA expression of IL-10 and TGF- ⁇ by hESCs as measured by QPCR.
  • FIGURE 21 shows microscopy results of experiments performed.
  • A-C Images represent ⁇ of soluble fractions from 3 different batches of hESC-extracts that were mixed with trypan blue (1 :1) and analyzed on hemocytometer (lOOx). All images were captured using Zeiss Invertoskop 40C.
  • D H9 cells prior to sonication (lOOx).hESC extracts used in all experiments were cell free. hESCs were harvested from cell culture plates with collagenase IV followed by cell dissociation buffer to obtain a single cell suspension. Subsequently, hESCs were washed twice with ice cold PBS and centrifuged at 400g for 6 minutes at 4 C.
  • the cells were re-suspended in lysis buffer (see materials and methods). At this point the cells were incubated on ice for 30 minutes and sonicated until the cells were completely lysed. The sonicated cells were centrifuged at 15000g for 15 minutes at 4°C to remove cell debris. The supernatant (soluble and cell-free fraction) was transferred to a new tube and used in all experiments.
  • FIG. 22 shows results suggesting hESC extract treated DCs supplemented with IL- 12p40 are poor stimulators of allogeneic T cells.
  • Primary human monocytes were isolated from peripheral blood mononuclear cells by negative selection using immunomagnetic beads. Subsequently, 5.0 x 10 5 monocytes were cultured in the presence of 500U/mL of GM-CSF and IL-4 in order to induce them to differentiate into dendritic cells. The cells also received either 0.15mg/mL (final concentration) of hESC extracts (hESC EXT) or equivalent volume of vehicle on day 0. Fresh media were added every 2 days containing fresh cytokines and 0.075mg/mL of hESC EXT or vehicle on day 2, 4, and 6.
  • TNF-alpha In addition to IL-4 and GM-CSF. Some cultures were also supplemented with lOng/ml of IL-12p40 in addition to the other cytokines during the maturation step. Immature cells that did not receive TNF-alpha were harvested on day 8 like their mature counterparts. mDCs were treated with mitomycin C and cultured with 1 x 10 5 purified CD3+ allogeneic T cells at a ratio of 1 :100. T cell proliferation was allowed to proceed for 3 days and tritiated thymidine was added for an additional 16 to 18 hours. Cell proliferation is displayed as mean counts per minute (CPM) of triplicate wells ⁇ SD.
  • CPM mean counts per minute
  • FIGURE 23 shows results of cell cycle analysis of one way MLR.
  • a decrease in the number of cells entering the S phase was observed after treatment with hESC extracts (A) in comparison to vehicle control (B).
  • One way MLR were carried out with PBMC obtained from healthy volunteers. One set of donor cells were treated with 50 ⁇ g/mL of mitomycin C to serve as stimulators while the second set of donor cells were used as responders. MLRs were carried out in the presence of hESC extracts (A) or vehicle control (B). MLRs were allowed to proceed for 7 days. Cells were harvested and fixed with 10% formalin in PBS for 15 minutes, permeabilized with 0.5% Triton X-100 in PBS for 15 minutes. The cells were incubated with 0.5mg/ml of RNAse A and 7AAD for 30 minutes and analyzed by flow cytometry. Data analysis was carried out with Multi Cycle AV software (Phoenix flow systems Inc.).
  • FIGURE 24A,B shows results suggesting that bioactive components of ES-extracts are largely enriched in microsomal fraction following fractionation of murine B6 ESC by ultra- centrifugation.
  • A Fractionation of B6 ESC extracts was carried out in order to identify the specific activity within known cellular compartments. Extract activity was tested as a whole lysate (whole) and fractionated into cytoplasmic lysate (normal, 15000g for 15min), the microsomal lysate (microsome, 50000g for lh), and the supernatant obtained from the microsomal lysate (Micro- Super).
  • FIGURE 25 shows biotinylation results that suggest unique ESC proteins interact with T cells. These specific proteins have molecular weights: ⁇ 30kDa, ⁇ 37kDa, ⁇ 50kDa, and 100kDa ⁇ 150kDa.
  • ESC-proteins from B6 mouse were labeled with NHS-PEG4-biotin labeling kit (Thermo-Fisher Scientific Inc.), resulting in the formation of an amide bond between this molecule and all proteins found in the ES-extracts (one protein may be biotinylated several times).
  • purified T cells activated with 5.0ng/ml of mitogen PMA (a specific stimulator of Protein Kinase C and T cell proliferation) were incubated with the biotin-labeled ESC-proteins overnight.
  • the T cells were harvested and washed four times (10 min for each) with PBS at 4°C to remove unbound proteins.
  • the T cells were subsequently lysed.
  • the lysate was used to carry out SDS-PAGE gel electrophoresis followed by transfer to a PVDF membrane.
  • the membrane was blocked with 5% BSA in PBS and subsequently probed with strepavidin conjugated to horse radish peroxidase (HRP) at 1 : 100 (Thermo-Fisher Scientific Inc.)
  • HRP horse radish peroxidase
  • FIGURE 26 shows results that MFG-E8 is highly expressed in undifferentiated ESC but not differentiated B6 ESC.
  • Line 1 undifferentiated B6 ESC lysate
  • Line 2 differentiated B6 ESC lysate
  • Line 4 mouse muscle progenitor C2C12 cell line (which does not show immune inhibitory capacity on T cells proliferation).
  • ESCs were differentiated in the absence of essential growth factor for one month. Undifferentiated ESC and differentiated ESC were lysed and analyzed by western blotting. The samples were ran on a 10% SDS-PAGE gel and transferred to a PVDF membrane. The membrane was probed with anti-MFG-E8 antibody at 1 : 100 followed by probing with secondary HRP conjugated antibody.
  • FIGURE 27 shows results suggesting that ESC-extracts directly inhibit PMA- stimulated T cell proliferation via inhibiting PKC-theta.
  • Purified mouse CD3+ T cells were incubated with 0.30mg/ml of ESC-extracts (B6 mouse) overnight and then the cells were stimulated with 50ng/ml of PMA for the indicated times.
  • PKC-theta activation was detected with rabbit polyclonal antibody specific for phosphorylation of the PKC-theta at threonine- 538 (Santa Cruz Biotechnology Inc.).
  • one or more of the components from the ESC-extracts may be a direct inhibitor of PKC-theta and contribute to inhibition of T cell proliferation.
  • FIGURE 28 shows results suggesting ESC-extracts polarize T helper responses towards a regulatory cell type.
  • One way mixed lymphocyte reaction was carried out using one million C57BL/6 splenocytes as responders and one million B6C3F1 splenocytes as stimulators. The cells were treated with 0.23mg/ml-0.30mg/ml of ESC-extracts or vehicle control. Cultures were allowed to proceed for 6h, 8h, and 24h and the cells were harvested and total RNA was isolated (Qiagen Inc.).
  • hESCs Human embryonic stem cells
  • hESCs are pluripotent stem cells that are isolated from the inner cell mass or blastocysts of the human embryo. They can be readily propagated to 10 9 cells in vitro without losing pluripotency and differentiated into almost all types of cells, including trophoblast cells.
  • the embryonic stem cells are cultured for 3-7 day, for example a three day, 4 day, 5 day, 6 day or a 7 day culture.
  • the cells are derived from a 5 -day culture.
  • the present inventors have shown that cell-extracts from hESCs have immune modulatory capacity, strongly repressing mixed lymphocyte reaction and development of costimulatory molecules.
  • the hESC extracts strongly inhibit alloantigen-induced lymphocyte proliferation and repress monocyte differentiation and maturation into DCs.
  • the hESC extracts are capable of blocking the expression of costimulatory molecule CD80 during the differentiation and maturation of human monocytes into DCs.
  • Such inhibitory activity was independent of the hESC lines and individual donors, since identical results were obtained when using hESC extracts from different hESC lines (Hl-male; H9-female; CA1- Canadian cell line, male), and peripheral blood mononuclear cells (PBMC) from different individuals.
  • PBMC peripheral blood mononuclear cells
  • the inventors have found that it is the protein/peptide components from the hESCs that, at least in part, play a key role in immune modulation. This was deduced from digestion and denaturation studies wherein (i) proteinase digestion, but not digestion with DNase, abolished bioactivity, and (ii) procedures known to denature proteins reduced biological activity of the hESC extract.
  • mice transplanted with allogeneic bone marrow cells and spleen cells pre-cultured with mouse ESC extract showed less severity or absence of GVHD.
  • hESC extracts can be used to treat or alleviate autoimmune diseases such as GVHD, RA (adult and juvenile forms), multiple sclerosis, systemic lupus erythematosus (SLE), Scleroderma, Sjogren's syndrome, Guillain-Barre syndrome, Type I diabetes, Graves disease, Celiac disease, Addison's disease, ulcerative colitis, psoriasis and Crohn's disease.
  • a soluble hESC extract having immune modulatory activity is provided herein.
  • the described extract preserves the immune modulatory capacity of intact hESCs, but circumvents the disadvantages of using whole stem cells in a cell-based therapy.
  • the use of a soluble hESC extract avoids the risk of tumor (teratoma) formation associated with transplantation of undifferentiated intact hESCs, and the logistic difficulties of preparing, transporting and storing live cells.
  • STEM-peptide Due to the activity of the protein/peptide components in the extract, these extracts are also referred to herein as "STEM-peptide” or “STEP -pep".
  • STEM-pep represents the peptides/proteins and other biological components extracted from the stem cells.
  • Stem cells utilized for preparation of cell extracts as described herein, or "STEM-pep" include but are not restricted to stem cells of human, horse, dog, cat, rat, or mouse origin.
  • Cell extracts as described herein may also be prepared from different stem cell sources, including but not limited to embryonic stem cells (ESCs), differentiated hESCs, hESC-derived trophoblasts, other pluripotent stem cells (derived from fetal origin or not, capable of generating all three germ layers), differentiated pluripotent stem cells with various growth factors, induced human pluripotent stem cells (iPS; reprogrammed human adult cells), mesenchymal stem cells (MSCs), or combinations thereof.
  • ESCs embryonic stem cells
  • differentiated hESCs differentiated hESCs
  • hESC-derived trophoblasts other pluripotent stem cells (derived from fetal origin or not, capable of generating all three germ layers)
  • pluripotent stem cells derived from fetal origin or not, capable of generating all three germ layers
  • differentiated pluripotent stem cells with various growth factors induced human pluripotent stem cells (iPS; reprogrammed human adult cells
  • MSCs me
  • such cell extracts may include extracts of hESCs in combination with an extract of a different stem cell source, such as differentiated hESCs, hESC-derived trophoblasts, other pluripotent stem cells (derived from fetal origin or not, capable of generating all three germ layers), differentiated pluripotent stem cells with various growth factors, induced human pluripotent stem cells (iPS; reprogrammed human adult cells), mesenchymal stem cells (MSCs), or combinations thereof.
  • a different stem cell source such as differentiated hESCs, hESC-derived trophoblasts, other pluripotent stem cells (derived from fetal origin or not, capable of generating all three germ layers), differentiated pluripotent stem cells with various growth factors, induced human pluripotent stem cells (iPS; reprogrammed human adult cells), mesenchymal stem cells (MSCs), or combinations thereof.
  • cell extracts described herein have been shown to be stable and retain activity over a period of several months, and are tolerant to at least 3-4 freeze-thaw cycles without significant loss of bioactivity.
  • pharmaceutical compositions comprising cell extracts as described herein can be prepared which have acceptable storage and stability properties.
  • the described pharmaceutical compositions may include the described active component, or cell extract, together with an acceptable carrier or excipient, or together with one or more separate active agents or drugs as part of a pharmaceutical combination.
  • the pharmaceutical compositions may be administered in a treatment regime with other drugs or pharmaceutical compositions, either separately or in a combined formulation or combination.
  • compositions will preferably be formulated with a vehicle pharmaceutically acceptable for administration to a subject, preferably a human, in need thereof.
  • vehicle pharmaceutically acceptable for administration to a subject, preferably a human, in need thereof.
  • Methods of formulation for such compositions are well known in the art and taught in standard reference texts such as Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985.
  • a composition may comprise a single compound, or a combination thereof.
  • compositions of the present invention may be administered alone or in combination with a second drug or agent.
  • Formulations expected to be useful in the present invention may include, but are not limited to, sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the
  • the composition preferably is sterile and fluid to the extent that easy syringability exists. It preferably is stable under the conditions of manufacture and storage and preferably is preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and oils (e.g. vegetable oil).
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including an agent in the composition that delays absorption, for example, aluminum monostearate or gelatin.
  • Sterile injectable solutions can be prepared by incorporating the composition in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization.
  • dispersions are prepared by incorporating the composition into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yield a powder, optionally plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Suspensions in addition to the active agent or cell extract as described herein, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, and mixtures thereof.
  • suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, and mixtures thereof.
  • compositions can be administered to a subject, preferably a mammal, more preferably a human, to treat and/or prevent disease.
  • the compositions may be administered by various routes including, but not limited to, intravenously, intramuscularly, intraperitoneally, subcutaneously, intracardially, orally and nasally.
  • the formulation and route of administration as well as the dose and frequency of administration can be selected routinely by those skilled in the art based upon the severity of the condition being treated, as well as patient-specific factors such as age, weight and the like.
  • the described cell extracts and compositions can be used to induce and/or enhance immune tolerance, to prevent or alleviate transplant rejection (including but not limited to allograft rejection), to modulate immune responses in subjects with allergies and/or hypersensitivity, or to treat or alleviate autoimmune diseases such as chronic GVH.D, RA, multiple sclerosis, systemic lupus erythematosus (SLE), and Crohn's disease.
  • transplant rejection including but not limited to allograft rejection
  • SLE systemic lupus erythematosus
  • allergies and/or hypersensitivity may refer to any allergy, including but not limited to food and environmental allergies, or a
  • hypersensitivity disease and may further refer to diseases or disorders such as asthma and anaphylaxis.
  • differentiated cells such as neural cells, islet cells, muscle cells and the like, from the same human embryonic stem cells and induced human pluripotent stem cells
  • differentiated cells can be co-transplanted together with a cell extract or composition as described herein to induce or increase immune acceptance of the transplanted cells.
  • the immune system can be primed with a cell extract or composition as described herein prior to injecting differentiated cells to reduce immune rejection.
  • a cell extract or composition as described herein can also be administered after transplantation of
  • the cell extracts and compositions described herein can also be administered in vitro to educate or program a subject's immune cells.
  • the educated or programmed immune cells treated in this way can then be returned back to the subject to correct an immune disorder, such as to induce and/or enhance immune tolerance, prevent or alleviate transplant rejection, modulate immune responses in subjects with allergies and/or hypersensitivity, or treat or alleviate an autoimmune disease.
  • the cell extracts described herein can also be administered in vitro to adult stem cells and/or progenitor cells, or directly to a subject in need thereof, for in vitro or in vivo expansion of the adult stem/progenitor cells.
  • cell extracts and compositions described herein can also be used as a broad immunosuppressive enhancer and significantly reduce the dosage and/or increase treatment efficacy of immunosuppressive drugs.
  • immunosuppressive drugs include: calcineurin inhibitors such as cyclosporin and tacrolimus; mammalian target of rapamycin (mTOR) inhibitors such as sirolimus; interferons such as
  • IFN- ⁇ TNF binding proteins such as infliximab (Remicade ), etanercept (Enbrel ), and adalimumab (HumiraTM); IL-2 receptor antibodies such as basiliximab (SimulectTM) and daclizumab (ZenapaxTM); T-cell receptor antibodies such as OKT3 (muromonab); cytostatics such as the alkylating agents (including cyclophosphamide, nitrosoureas, and platinum compounds), antimetabolites (including methotrexate, azathioprine and mercaptopurine), and cytotoxic antibiotics (including dactinomycin, anthracyclines, mitomycin C, bleomycin and mithramycin); and glucocorticoids such as prednisone, methylprednisolone and
  • Cis-platinum also known as cisplatin and commercially under the brand name PlatinolTM, is one non-limiting example of a platinum compound as described above.
  • PlatinolTM is one non-limiting example of a platinum compound as described above.
  • immunosuppressive drugs may comprise a single formulation with two or more active components, or two separately packaged compositions for use in a combination therapy.
  • Methods for treating a subject in a combination therapy comprising administering the cell extract or composition as described herein together with an immunosuppressive drug, for instance but not limited to one or more of the
  • immunosuppressive drugs described above.
  • Administration of the cell extract or composition and immunosuppressive drug may be simultaneous or sequential, and may be via the same or different administrative route.
  • the combination therapy may be for inducing and/or enhancing immune tolerance, preventing or alleviating transplant rejection, modulating immune responses in subjects with allergies and/or hypersensitivity, or treating or alleviating autoimmune diseases such as but without being limited to GVHD, RA, multiple sclerosis, systemic lupus erythematosus (SLE), and Crohn's disease.
  • the hESCs may be grown in a feeder-free cell culture system or chemically defined medium in the absence of proteins from non-human species, which has the advantage of avoiding xenogenic cells (such as mouse embryonic fibroblast cells)
  • the media used to grow the hESCs may, however, be conditioned by feeder cells, and in such embodiments would therefore contain xeno-derived proteins in the culture medium.
  • the cells are grown on MatrigelTM coated plates for 3 to 7 days. This incubation period may vary, however, depending on the cell lines and conditions used. Commonly used culturing techniques and reagents may be used in order to obtain sufficient cells for preparing a cell extract. Preferably, the medium will be changed every day when colonies achieve >50% confluence and every two days ⁇ 50% confluence. Further, short-term treatment of hESCs with GSK-3 inhibitor BIO alone or together with tyrosine kinase inhibitor PP2 and Genistein (6-12 hours depending on cell conditions) significantly improves culture quality and yields more live cells by 2 to 10-folds. [0093] A non-limiting example of a protocol for preparing a cell extract as defined herein is as follows:
  • PBS phosphate buffered saline
  • Collect supernatant which can be used fresh or flash frozen, e.g. in nitrogen, dry ice or the like, and stored at -80 °C to -20 °C for future use.
  • This step will fractionate micosome or multivesiclular endosome that contain the significant immune modulatory components.
  • Cell extracts prepared as described herein, for instance using the above-defined method can retain their activity for at least up to 3 months when stored at -80°C. This includes 2 to 4 cycles of freeze and thaw on ice.
  • cells may be lysed using methods other than sonication, such as by freeze-thaw, mechanical lysis using a pressure cell (e.g. FrenchTM press), detergent solubilization, and other cell lysis methods.
  • a pressure cell e.g. FrenchTM press
  • detergent solubilization e.g. detergent solubilization
  • cell lysis methods e.g. cell lysis methods
  • the cell extracts described herein may also be further separated and purified, for instance using but without being limited to techniques such as applied differential
  • the cell extracts may be separated by molecular weight size such as by size exclusion filtration, chromatography, dialysis or the like.
  • Molecular weight ranges may be selected, for example, including a broad size range of about 500 Da to about 500 kDa, and further including smaller increments including up to approximately 1,000 Da, 2,000 Da, 5,000 Da, 10 kDa, 20 kDa, 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, 100 kDa, 125 kDa, 150 kDa, 175 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, 450 kDa, and 500 kDa.
  • the extract or composition comprises components between 500Da and 500 kDa.
  • Other embodiments may comprise compositions of greater than 500D, greater than 1, 2, 5, 7.5, 10, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 kDa, or within the ranges defined by, for example, lkDa to 500 kDa, 5 kDa to 500 kDa, 7.5kDa to 500 kDa, 10 kDa to 500 kDa, or any range defined by any two of the values identified herein or any values therein between.
  • the extract clarification step can be undertaken using most known methods, including varied centrifugation speeds and run times.
  • the centrifugation may be carried out at speeds ranging from about 10,000 x g to 50,000 x g, for approximately 10 minutes to 60 minutes or even longer depending upon factors such as starting cell mass, specific centrifuge parameters and tubes used, and other factors known to those skilled in the art.
  • centrifugation of the cell extracts at 15,000 x g for about 15 minutes has been shown to work well and was chosen as literature indicates that these speeds will sediment cell membrane, mitochondria and nuclear fractions.
  • the lysis buffer as described above will typically include an aqueous solution of a buffer, a salt, a chelating agent, a reducing agent and protease inhibitors.
  • the pH of the lysis buffer may range from approximately 6.5 to 8.5, more preferably from 7.5 to 8.5. In a preferred embodiment, the pH of the lysis buffer is about 8.2.
  • the pH may be maintained using a physiologically acceptable buffer such as HEPES or Tris-HCl.
  • the concentration of the buffer in solution may range from
  • the buffer is HEPES at a concentration of about 50 mM.
  • the salt may be any physiologically acceptable salt such as NaCl, MgCl 2 , KC1, LaCl 3 , or CaCl 2 .
  • the concentration of the salt in solution may range from approximately O.lmM to lOOOmM, more preferably from ImM to lOOmM.
  • the salt is NaCl at a concentration of about 50 mM.
  • the selected reducing agent should also be acceptable for use in physiological conditions at the concentrations used, salt such as one or a combination of the following non- limiting examples: dithiothreitol (DTT), 2-mercaptoethanol (2 -ME), GSSG, GSH, or
  • the concentration of the reducing agent in solution may range from
  • the reducing agent is DTT at a concentration of about 1 mM.
  • a physiologically acceptable chelating agent is also preferable for use in the lysis buffer, such as one or a combination of ethylenediaminetetraacetic acid (EDTA) and ethylene glycol tetraacetic acid (EGTA).
  • EDTA ethylenediaminetetraacetic acid
  • EGTA ethylene glycol tetraacetic acid
  • the concentration of the chelating agent in solution may range from approximately O.lmM to 200mM, more preferably from ImM to lOOmM.
  • the chelating agent is EDTA at a concentration of up to about 100 mM, most preferably at a concentration of about 1 mM.
  • the protease inhibitors used in the lysis buffer will advantageously include a cocktail of protease inhibitors useful to inhibit proteolysis of a range of proteases.
  • protease inhibitor cocktails are commercially available and include, without limitation, Complete Protease Inhibitor Tablets available from Roche Diagnostics, and SigmaFastTM Protease Inhibitor Tablets available from Sigma-Aldrich.
  • one or more individual protease inhibitors can be selected and used based on the common knowledge and skill of those experienced in the art, including but not limited to leupeptin serine proteases, cysteine proteases, metalloproteases and aspartic acid proteases.
  • the concentration of the protease inhibitors in solution may range from approximately 0.1 uM to ImM, more preferably from 0.1 uM to 200uM.
  • a protein stabilizer is added to the above-described lysis buffer.
  • One or a combination of the following non-limiting examples including L-arginine, glycerol, sucrose (or other sugars), ⁇ -lactamase, acetone acetamide, surfactants, TweenTM80, TweenTM20, TweenTM40, polymers, L-glutamine, and L-lysine can be added to the lysis buffer to suppress protein aggregation in the cell extract.
  • L-arginine L-arginine, glycerol, sucrose (or other sugars), ⁇ -lactamase, acetone acetamide, surfactants, TweenTM80, TweenTM20, TweenTM40, polymers, L-glutamine, and L-lysine
  • the protein stabilizer is L-arginine at a concentration of up to about 500mM, most preferably at a concentration of about 50mM.
  • the term "effective amount” means that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal, or human that is being sought, for instance, by a researcher or clinician. Furthermore, the term “effective amount” means that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal, or human that is being sought, for instance, by a researcher or clinician. Furthermore, the term
  • terapéuticaally effective amount means any amount which, as compared to a corresponding subject who has not received such amount, results in improved treatment, healing, prevention, or amelioration of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder.
  • the term also includes within its scope amounts effective to enhance normal physiological function.
  • a "pharmaceutical agent” or “drug” refers to a chemical compound or composition capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject.
  • stem cell refers to a cell that is capable of differentiating into a number of final, differentiated cell types.
  • Stem cells may be totipotent, pluripotent and multipotent cells.
  • Totipotent stem cells typically have the capacity to develop into any cell type.
  • Totipotent stem cells are usually embryonic in origin.
  • Pluripotent stem cells include embryonic stem cells and induced pluripotent stem cells.
  • Embryonic stem cells are derived from the inner cell mass of an early embryo. The induced pluripotent stem cells are generated by programming adult cells with transcriptional factors. Pluripotent stem cells are capable of differentiating into almost any type of tissues.
  • Multipotent stem cells are derived from adult tissues, one of the following non-limiting examples, mesenchymal stromal/stem cells.
  • Pluripotent and multipotent stem cells can originate from various tissue or organ systems, including, but not limited to, blood, nerve, muscle, skin, gut, bone, kidney, liver, pancreas, thymus, and the like.
  • the stem cell is derived from an adult or neonatal tissue or organ.
  • proliferation and “expansion” as used interchangeably herein with reference to cells, refer to an increase in the number of cells of the same type by division.
  • differentiation refers to a developmental process whereby cells become specialized for a particular function, for example, where cells acquire one or more morphological characteristics and/or functions different from that of the initial cell type.
  • the term “differentiation” includes both lineage commitment and terminal differentiation processes. Differentiation may be assessed, for example, by monitoring the presence or absence of lineage markers, using immunohistochemistry, flow cytometry or other procedures known to a worker skilled in the art.
  • Differentiated progeny cells derived from progenitor cells may be, but are not necessarily, related to the same germ layer or tissue as the source tissue of the stem cells. For example, neural progenitor cells and muscle progenitor cells can differentiate into hematopoietic cell lineages.
  • Naturally occurring indicates that the object can be found in nature.
  • a naturally occurring polypeptide or polynucleotide sequence would be one that is present in an organism, and can be isolated from the organism and which has not been intentionally modified by man in the laboratory.
  • the term "about” refers to a +1-5% variation from the nominal value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to.
  • the stem cell extracts or compositions described herein and throughout do not comprise one or more compounds, for example, but not limited to a detergent such as, but not limited to cationic detergents, anionic detergents, ethoxylates, SDS, Tween, Triton (XI 00, XI 14 and others), and Brij, CHAPS, DOC, CBT, NP-40, glycosides (octyl-thioglucoside, maltosides and others), alcohols such as ethanol, methanol, propanol, t-butanol and others, certain reducing agents, for example, but not limited to beta-mercaptoethanol, dithiothreitol, dithioerythritol, exogenously added transgenes, vectors or nucleotide sequences to stem cells before, after or during culture, cytokines, antibiotics, antibacterial agents such as, but not limited to parabens, chloro
  • a detergent such as, but not limited to cationic detergents
  • Undifferentiated hESCs were maintained either under the feeder- free (Wang L, et al. Immunity 2004; 21 :31-41) or defined culture conditions (Wang L, et al. Blood
  • hESCs were characterized by Flow cytometry (a), immunocytochemistry (b, c) and teratoma formation (d-g).
  • Undifferentiated hESCs express surface markers SSEA-4, Tra-1-60, Tra-1-81, and intracellular marker Oct3/4 (a, first peak of each panel representing the isotype antibody control), Nanog (b, red; inset, isotype control), and E-cadherin (c, green) and AP (c, red).
  • Haematoxylin and eosin staining of the teratoma sections revealed that the tumors were composed of a mixture of well-differentiated tissues representing all 3 embryonic germ layers, including ectoderm (d. neural rosette), mesoderm (e. cartilage, f. bone) and endoderm (g. gutlike glands with goblet cells). Bars represent 10 ⁇ .
  • ectoderm d. neural rosette
  • mesoderm e. cartilage, f. bone
  • endoderm g. gutlike glands with goblet cells
  • Interleukin 1 receptor type I Absence NM_000877.1 0.304
  • Interleukin 2 receptor beta P NM_000878.1 0.046
  • Interleukin 5 receptor alpha Absence NM 000564.1 0.781
  • Interleukin 8 receptor alpha Absence NM_000634.1 0.534
  • Interleukin 10 receptor alpha Absence NM 001558.1 0.466
  • Interleukin 11 receptor alpha Absence NM_004512.1 0.601
  • Interleukin 12A natural killer cell stimulatory factor 1 Absence NM 000882.1 0.634
  • Interleukin 12B natural killer cell stimulatory factor 2 Absence N 002187.1 0.274
  • Interleukin 15 receptor alpha Absence NM 002189.1 0.666
  • Interleukin 18 (interferon-gamma-inducing factor) Absence NM 001562.1 0.304
  • Interleukin 20 receptor alpha Absence NM 014432.1 0.466
  • TGF-beta3 Human transforming growth factor-beta 3 Absence J03241.1 0.112
  • STEM-pep markedly suppresses the alloantigen- induced T cell proliferation in mixed lymphocyte reaction cultures.
  • Undesired T cell activation and proliferation is a key factor in transplant rejection and autoimmune diseases.
  • STEM-pep also significantly inhibits the differentiation and maturation of dendritic cells (DC) from monocytes.
  • DCs are central to mounting an effective adaptive immune response or tolerance depending on their maturation conditions.
  • Mature DCs high expression of CD80, CD86, HLA-DR and CD83
  • immature DC low expression of the aforementioned markers
  • STEM-pep prepared from hESCs was capable of suppressing the differentiation and maturation of DCs from human monocytes, which was indicated by reduced specific gene expression (Fig. 3), morphological changes (Fig. 4 A&B), non-expression of costimulatory molecule CD80 (Fig.
  • mice transplanted with allogeneic bone marrow cells and spleen cells that have been pre-treated with STEM-pep show reduced severity of GVHD based on the observations of reduced body weight loss (A) and overall GVDH scores (B) of treated mice.
  • STEM-pep derived from hESCs showed a stronger potency than cell-extracts from MSCs (Fig. 8 A), while differentiated human embryonic fibroblast cells did not show any effects (Fig. 3). This suggests that immunomodulatory potency of STEM-pep may associate with ontogeny: pluripotent cells (hESCs or induced pluripotent stem cells) > multipotent cells (MSCs) > unipotent cells (fibroblast cells).
  • hESC-extracts may modulate immune functions via mechanisms that mimic matemal-fetal tolerance. For instance, hESC- extracts induced FoxP3 gene expression in the mixed lymphocyte reaction (Fig. 9 A), suggesting a possible polarization and/or induction of regulatory T cells
  • CD4+CD25+FoxP3+ T lymphocytes Regulatory T lymphocytes can prevent or cure autoimmune diseases and allograft rejection, by restoring immune tolerance to self antigens or alloantigens.
  • hESCs express genes of programmed death receptor and its ligand, PDL-1 (B7-H1) and PDL-2 (B7-DC), and these genes are further up-regulated after differentiation into trophoblast-like cells with BMP4 (bone morphogenetic protein 4) (Fig. 9 B&C).
  • PDL-1 and PDL-2 have been shown to be crucial for maintaining immune tolerance.
  • the immune modulatory compound of STEM-pep may therefore include programmed death receptor, PDL-1 and PDL-2.
  • Human blood leucocytes can be reprogrammed into induced pluripotent stem (iPS) cells.
  • the strategy used for reprogramming the cells with four transcription factors is shown in Fig. 10 (A). Colonies of the treated iPS cells were observed over time using light microscopy. At 38 days post reprogramming (B), the reprogrammed colony switches to anchorage-dependent growing. The colony attaches to the plate and shows typical morphology of human embryonic stem cells. Some round-like floating cells can also be seen, which are non-reprogramrned blood leukocytes.
  • the reprogrammed colony proliferates after 5 days of culture, showing similar proliferative rate to that of human embryonic stem cells.
  • the third passage of the reprogrammed colonies can be seen (Fig. 10 D and E) at day 1 and day 3 after reseeding.
  • the reprogrammed cells are also shown to be positive (red, Fig. 10 F) for alkaline phosphatase staining, one of the most reliable parameters used for the characterization of undifferentiated human embryonic stem cells and induced pluripotent stem cells.
  • non- reprogrammed blood leukocytes show a typical sphere morphology and adhesion-independent proliferation, devoid of alkaline phosphatase staining (Fig. 10 G).
  • STEM-pep prepared from reprogrammed patient's iPS cells can therefore be achieved by using STEM-pep prepared from reprogrammed patient's iPS cells.
  • STEM-pep prepared from third party hESCs i.e. T cells, hESC and DCs are from three different individuals
  • STEM-pep prepared from iPS may specifically assist in reshaping a destructive alloimmune and autoimmune response to a state of anergy or tolerance, and alleviating transplantation rejection and autoimmune diseases.
  • STEM-Pep can be used to reduce the dosage of immune suppressive drugs.
  • ESC-extracts were tested in combination with low dose of calcineurin inhibitor cyclosporin, a drug commonly used in the clinic to prevent organ rejection.
  • Mixed lymphocyte reactions were carried with 1 x 10 5 responder (CD1 mouse) and stimulator (B6 mouse) splenocytes and treated with either vehicle alone, vehicle in combination with 20 ng/ml of cyclosporine, mouse ESC-extract (from B6 mouse) in combination with 20 ng/ml of cyclosporine or mouse ESC-extract alone.
  • MLR were allowed to proceed for 3 days and 3 H was added for an additional 16 to 18 hours.
  • Cell proliferation is displayed as mean counts per minute of triplicate wells ⁇ SD. Data are representative of two independent experiments.
  • immunosuppressive drugs see below, it can be used complementarily as an immune modulatory supplement and act synergistically to increase treatment efficacy.
  • Fig. 10 (B) human T cells were positively selected using anti-CD3 labeled magnetic beads. Subsequently 1.0 x 10 5 cells were stimulated with PMA (5.0ng/ml) or Ionomycin (2 ⁇ ) in the presence or absence of hESC-extract. The cells were allowed to proliferate for 3 days and pulsed with tritiated thymidine for an additional 16 to 18 hours. Cell proliferation is displayed as mean counts per minute of triplicate wells ⁇ SD. Results are representative of four independent experiments.
  • Fig. 10 (C) human embryonic stem cell-extracts are shown to inhibit human mixed lymphocyte reaction independent of calcium pathway, and to work synergistically with calcium channel inhibitors.
  • B6 2 ⁇ 1 2 ⁇ 1 of ESC-extracts from B6 mouse ES cells. These data are representative of two independent experiments.
  • Protein Kinase C is a determinant pathway in STEM-pep-regulated T cell suppression.
  • STEM-pep inhibits PMA-induced proliferation of purified CD3+ T cells (both human and mouse; Fig. 11 B).
  • PMA has been well defined as a specific stimulator of Protein Kinase C.
  • Protein Kinase C has been actively investigated in both pharmaceutical industry and academic laboratories as a validated drug target for treating immune disorders.
  • STEM-pep both from human and mouse ESCs also exerts its immune modulatory function independent of calcium and works synergistically with calcineurin inhibitory drugs.
  • calcineurin inhibitor cyclosporine Fig. 11 A
  • calcium channel inhibitors Fig. 11 C&D
  • STEM-pep dramatically suppresses mixed lymphocyte reaction.
  • an effective in vitro dosage to inhibit immune activation should be >0.075mg/ml. In general, higher concentrations may result in better inhibitory results.
  • hESC-extract To develop a culture system free of animal-components for clinical application of hESC-extract, we maintained hESCs in a chemically-defined medium (DF/12 culture medium supplemented with B27 components, 120ng/ml human basic fibroblast growth factor or other agents) with brief ( ⁇ 12 hours every 4 days) but not constant inhibition of tyrosine kinase and GSK-3 with two inhibitors. These two inhibitors are Genestine (or PP2) and 6- bromoindirubin-3'-oxime. Addition of these two inhibitors to the culture also enables the better maintenance of hESCs.
  • DF/12 culture medium supplemented with B27 components, 120ng/ml human basic fibroblast growth factor or other agents
  • tyrosine kinase and GSK-3 Two inhibitors.
  • These two inhibitors are Genestine (or PP2) and 6- bromoindirubin-3'-oxime. Addition of these two inhibitors to the culture also enables the better maintenance of
  • Variation of the culture conditions may also be useful to change the STEM-Pep composition and augment its immune modulatory capacity.
  • Supernatants can be prepared fresh for experiment, or flash frozen in nitrogen or dry ice and stored at -20 to-80 °C for future use. Sonication was carried out at 40 % power, 4 times for 10 seconds each. In between sonication the tubes were placed on ice for 15 to 20 seconds. Importantly, sonication should be carried out in a fashion which results in lysis of the cells and even nuclei of the cells without causing denaturation of cellular proteins.
  • the supernatant is also stable at -80 °C to -20 °C over months, and tolerates up to 3 -cycles of freeze- thaw without noticeable loss of bioactivities. With fewer freeze-thaw cycles, it can be stored even longer in the freezer.
  • the data shown in Figs. 2 and 3 were generated using supernatant fraction stored in a freezer for a period of 3 months and frozen- thawed for 3 times. Formation of precipitates after freeze-thaw was not observed. These properties make the water soluble components of STEM-pep suitable for potential clinical use via commonly available drug delivery systems.
  • the water insoluble precipitates seem to have immune modulatory potency different from the supernatant fraction. For instance, water insoluble precipitates exhibited greater potency in the inhibition of co-stimulatory molecule (CD80) expression during dendritic cell differentiation and maturation (Fig. 6C), while water soluble STEM-pep showed greater potency in the suppression of mixed lymphocyte reaction (Fig 2 and data not shown). Therefore, the two fractions may be used in specific disease or transplant states for the selective modulation of DC or T cell functions.
  • the above extraction protocol has been demonstrated to be effective, variations thereto are possible. For instance, different methods of cell lysis may be used. For instance, Fig.
  • mESC extract per milligram protein
  • the protein concentration in the experiments was normalized between the mESC sonication and mESC freeze-thaw extracts. However, approximately half the amount of extract was yielded using the freeze-thaw method when compared to lysis by sonication.
  • sonication procedure can yield 2-fold higher protein content than freeze-thaw technique, although with the addition of the same amount of protein both techniques show similar immune suppressive potential. Therefore, regardless of the method used, the extraction protocol should result in lysis, preferably but not limited to complete lysis of the whole cells including cell nuclei, without causing denaturation of cellular proteins.
  • the lysis buffer used in the above experiments typically includes, in aqueous solution, 50 mM HEPES, 50 mM NaCl, lOOmM EDTA, ImM DTT and protease inhibitors.
  • modifications to the lysis buffer can be made with improved results.
  • the lysis buffer could be further improved by adding L- arginine, which enhances the solubility and stability of the components of the stem cell extract.
  • L-arginine As seen in Fig. 15 (B), mESC extract prepared with this vehicle (V2) reduces the non-specific effect from EDTA and confirms that the specific effect of the stem cell extract is maintained in lysis buffer containing 1 mM EDTA and 50mM L-arginine by mixed lymphocyte reaction.
  • the concentration of L-arginine can broadly range from ImM to 1M. In a preferred embodiment, the pH will range between 6.5 to 8.5 where L-arginine has been observed to be most effective in preserving protein stability and preventing protein aggregation.
  • Addition of L-arginine is therefore desirable to increase protein solubility, and to reduce protein-protein interaction and dimer formation. It also stabilizes the STEM-pep preparation and preserves immune regulatory capacity. Reducing the calcium chelator concentration from 100 mM to 1 mM EDTA further reduces the non-specific interference from EDTA.
  • Human ESC lines HI and H9 were obtained from Wicell.
  • the CA1 cell line was a gift from Dr. Nagy (University of Toronto, Toronto Ontario, Canada).
  • Mouse ESC C57BL/6 cell line was obtained from ATCC.
  • Mouse strains C57BL/6, B6C3F1, Balb/c and CDl (10 to 12 weeks old) were obtained from Charles River Laboratories, Montreal Canada. All hESC lines were used with the approval of the local Ethics Board and the Stem Cell Oversight Committee of the Canadian Institutes for Health Research. Animals were maintained at the University of Ottawa (Ottawa Ontario, Canada) in accordance with the Canadian Council on Animal Care guidelines under protocols approved by the Animal Use Subcommittee at our Institution. [00147] Preparation of ESC Extracts
  • Matrigel (BD Biosciences Canada Inc., Mississauga ON) in mouse embryonic fibroblast (MEF) conditioned medium supplemented with 8.0ng/mL of human basic fibroblast growth factor (bFGF, Invitrogen Canada Inc., Burlington ON).
  • bFGF human basic fibroblast growth factor
  • hESCs were incubated at 37°C with 5.0% C0 2 (Wang, et al. Biophysical journal 98:2442-2451 ; Jezierski, et al. Stem cells 28:247- 257 both of which are hereby incorporated by reference in their entirity).
  • the cells were harvested by treatment with collagenase IV (Invitrogen) followed by cell dissociation buffer (Invitrogen) to obtain a single cell suspension.
  • hESCs were washed twice with ice cold PBS and centrifuged at 400g for 6 minutes at 4°C. After washing, the cells were re-suspended in lysis buffer, 50mM HEPES, 50mNaCl, 1.OmM EDTA, l.OmM DTT, 5 OmM L-arginine, pH 8.2.
  • the lysis buffer was supplemented with pan protease inhibitors at 1 :100, (4-(2-aminoethyl) benzenesulfonyl fluoride (AEBSF), pepstatinA, E-64, bestatin, leupeptin, and aprotinin) dissolved in DMSO, Sigma Aldrich Canada Ltd, Oakvile ON).
  • AEBSF 4-(2-aminoethyl) benzenesulfonyl fluoride
  • pepstatinA pepstatinA
  • E-64 bestatin
  • leupeptin leupeptin
  • aprotinin aprotinin
  • Mouse ES lines Jl and B6 were grown on mitomycin treated mouse embryonic fibroblast (MEF) cells in Dulbecco's modified eagle Medium (DMEM) containing 4.0mM L- glutamine, 1.0% non-essential amino acids, ⁇ . ⁇ 2-mercaptoethanol, l .OxlO 2 units of Penicillin, l .OxlO 2 units of Streptomycin and 15% FBS (Invitrogen Inc.) supplemented with l .OxlO 3 units/mL of LIF (Millipore Canada Ltd., Etobicoke ON) and incubated at 37°C with 5.0% C0 2 . Subsequently, the cells were cultured on 0.10% gelatin coated plates for two passages in order to eliminate MEF cells. Cell extraction was carried out as described for hESCs.
  • DMEM Dulbecco's modified eagle Medium
  • PBMCs were isolated from the buffy coat and washed 3 times with PBS.
  • One-way MLR were carried out with 1.0 x 10 5 PBMC responder and stimulator cells in 96 well U bottom plates using RPMI media (10% FBS, l .OxlO 2 units of Penicillin, l .OxlO 2 units of Streptomycin, 2.0mM L-glutamine).
  • the stimulator cells were pre-treated with 50 ⁇ g/mL of mitomycin C for 40 minutes at 37°C prior to MLR. The cells were allowed to proliferate for 5 days and 1. ⁇ tritiated thymidine (GE- Amersham Canada Inc., Baie D'Urfe Quebec) was added to the culture for an additional 16 to 18 hours. The cells were harvested on to 96 well filters-mats (Wallac Inc., Turku Finland) using a TomTec harvester. Tritium uptake was determined by liquid scintillation using a Wallac 1450 Microbeta Plus liquid scintillation counter (Wallac Inc.). Results are displayed as counts per minute (CPM) of triplicate wells ⁇ SD.
  • CPM counts per minute
  • Monocytes were isolated from peripheral blood by CD 14 negative selection using magnetic labeling based kits (StemCell Technologies Inc., Vancouver Canada) according to manufacturer protocols (Purity was >90% for CD 14 marker).
  • Five hundred thousand purified monocytes were cultured in 24 well plates with 0.50ml of RPMI medium containing 5.0x10 2 units/mL of granulocyte macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4) for 6 days to differentiate monocytes to immature DCs. On day 0, the cells also received either 0.15mg mL (final concentration) of HI hESC extract, L-132 fibroblast control extract, or equivalent volume of vehicle.
  • GM-CSF granulocyte macrophage colony-stimulating factor
  • IL-4 interleukin-4
  • the cells received 0.075mg/mL of hESC extract, L-132 (a fibroblast cell line) extract or vehicle.
  • the cells On day 6, in addition to GM-CSF and IL-4, the cells also received TNF-a (20ng/mL final concentration) to induce maturation.
  • Monocyte to dendritic cell maturation was carried out as described in the previous section.
  • Cells were harvested on day 6 or day 8 by vigorous pipetting followed by scraping with the pipette tip. The cells were washed twice with PBS and re-suspended in eppendorf tubes with PBS containing 1.0% FBS. At this point the cells received lmg/mL of dextran-FITC beads (40,000 MW) (Sigma Aldrich, Canada Ltd.) and placed at 37°C or on ice as a control for 90 minutes. At the end of incubation period the cells were washed twice with PBS containing 1.0% FBS and 0.10% sodium azide to inhibit further phagocytosis.
  • Purified T cells were obtained by positive selection using a magnetic labeling kit against CD3 (StemCell Technologies Inc.) according to manufacturer instructions (Purity was >95% for CD3 marker). Subsequently, 1.0 x 10 5 purified CD3+ cells were incubated with hESC extract-treated or fibroblast extract-treated DCs for 3 days. DCs were treated with 50 ⁇ £/ ⁇ ] ⁇ of mitomycin C for 40min prior to incubation with T cells. On day 3, ⁇ . ⁇ of tritium was added to the culture for an additional 16 to 1.8 hours and the cells were harvested and tritium uptake was determined as described for human MLR.
  • cDNA was synthesized using Qiagen QuantiTech Reverse Transcription kit (Qiagen) according to manufacturer instructions.
  • QPCR was carried out with iQ SYBR Green Supermix (Bio-Rad Laboratories Ltd.) and My iQ-iCycler (Bio-Rad Laboratories Inc.) using TGF- ⁇ forward primer 5 ' GC AAC AATTCCTGGCGAT ACC (SEQ ID NO:7), reverse 5'
  • AGTTCTTCTCCGTGGCTGA (SEQ ID NO:8) and IL-10 forward primer
  • Pan anti TGF- ⁇ antibody (R&D Systems Inc.) was added to hESC extract at a concentration of 20 ⁇ g/mL. The extracts were incubated with the antibody for two hours at 4°C. The extracts were subsequently used in one-way MLR and compared to extract treated with isotype antibody.
  • RNAse A 37°C, or with ⁇ g/mL of RNAse A for 2 hours at 37°C.
  • a murine MLR was performed in the presence or absence of proteinase K or RNAse treated ESC extract to compare the effect of these extracts on immune activation.
  • B6 splenocytes (responders) were suspended in serum free RPMI media at l .OxlO 6 cells/mL and stained with 5.0 ⁇ of carboxyfluorescein diacetate succinimidyl ester (CFSE) for 40 minutes at 37°C.
  • the labeled responders were washed 3 times with PBS and 1.0 x 10 5 cells were incubated with 1.0 x 10 5 Balb/c stimulators in triplicate.
  • MLR were allowed to proceed for 4 days and the triplicate wells were combined in one eppendorf tube and washed with PBS. CFSE dilution was detected by flow cytometry.
  • Fluorophore-conjugated antibodies against CD80, CD83, CD86, and HLA-DR were used. Cells were washed with PBS and incubated in 10% human serum for 15 minutes for the blocking step. Subsequently the cells were stained with the indicated antibodies for 30 minutes on ice and washed twice prior to analysis with Beckman Coulter FC500 flow cytometer (Beckman Coulter Canada Inc.).
  • ESCs derived from humans, mice or rats have been shown to inhibit the PBMC proliferation in one-way allogeneic MLR.
  • One-way allogeneic MLR were carried out with B6 splenocytes (responders) and B6C3F1 splenocytes (stimulators).
  • hESC extracts Inhibit the Maturation of Monocyte-derived Dendritic Cells (mDCs)
  • PBMCs contain both antigen-presenting cells (APC) and effector T cells
  • APC antigen-presenting cells
  • mDC maturation because they are well recognized as potent APC essential for the initiation of primary immune responses and MLR.
  • Monocytes were isolated from healthy donor PBMCs using negative selection in an effort to avoid activation of these cells. Subsequently, monocytes were grown in GM-CSF and IL-4 for 8 days with media change on days 2, 4, and 6 to replenish the two cytokines. Maturation was induced with TNF-a for the last 2 days.
  • monocytes also received vehicle, hESC-extracts or fibroblast extracts on days 0, 2, 4, and 6.
  • treatment with vehicle and fibroblast-extracts resulted in the up-regulation of mDC maturation markers CD80, CD83 and HLA-DR ( Figure 17a,b,c).
  • mDC treated with hESC extracts did not up-regulate these important maturation markers to the same extent as controls ( Figure 17a,b,c).
  • hESC extracts did not inhibit the surface expression of CD86, and in some cases even slightly increased CD86 expression ( Figure 17d).
  • IL-12p40 a monomer known to make functional IL-12 and IL-23.
  • IL-12p40 is produced at high levels by mature but not immature mDC to direct the development of Thl cells from naive T cells.
  • T cells incubated with hESC extract-treated mDC proliferated significanlty less when compared to control mDCs.
  • hESC extracts impair mDC maturation and renders them as inefficient T cell stimulators.
  • BMP4 initiates human embryonic stem cell differentiation to trophoblast. Nature biotechnology 20:1261-1264.
  • Kehat I D Kenyagin-Karsenti, M Snir, et al. (2001). Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes. J Clin Invest 108:407-414.
  • Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products. The Journal of experimental medicine 182:389-400.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Developmental Biology & Embryology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Reproductive Health (AREA)
  • Veterinary Medicine (AREA)
  • Gynecology & Obstetrics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)

Abstract

Compositions and methods are described for modulating a subject's immune response and inducing immune tolerance. The composition comprises extracts of stem cells, for example, but not limited to human embryonic stem cells (hESCs), prepared by culturing the stem cells in a feeder-free cell culture system, collecting the stem cells, transferring the cells to a cell lysis buffer, lysing the stem cells in the cell lysis buffer to produce a lysate, and fractionating the lysate into soluble and insoluble fractions wherein the stem cell extract comprises the soluble or insoluble fraction. The extracts can be used to treat and/or prevent a variety of medical conditions, for example, but not limited to treating autoimmune diseases such as Graft Versus Host Disease (GVHD) or rheumatoid arthritis (RA), or to prevent transplant rejection.

Description

STEM CELL EXTRACTS AND USES THEREOF FOR IMMUNE MODULATION
FIELD OF INVENTION
[0001] The present invention relates to methods and compositions useful to modulate an immune response in a subject or induce immune tolerance. More specifically, the present invention relates to stem cell extracts and compositions useful, either separately or in a combination with other immunosuppressive drugs, for modulating a subject's immune response or for inducing immune tolerance.
BACKGROUND OF THE INVENTION
[0002] To date, immunosuppressive drugs remain the first choice of treatment for patients who receive organ or bone marrow transplantation and suffer from autoimmune diseases. Although these drugs have harmful side-effects, including infections and cancers, patients must take them for life. As opposed to immunosuppressive drugs, inducing true immune tolerance without bluntly suppressing a patient's immune system remains a desirable but elusive goal in clinic.
Immune disorders
[0003] Two examples are rheumatoid arthritis (RA) and Graft versus Host Disease (GVHD).
[0004] RA is an autoimmune disease of unknown etiology. RA leads to chronic inflammation in the joints and subsequent destruction of the cartilage and erosion of the bone. According to the Public Health Agency of Canada, arthritis and other rheumatic conditions affect around 4 million Canadians of all ages, with numbers expected to double by 2020. Arthritis is one of the most common causes of physical disability (pain, activity limitation) among Canadians. The burden of the disease on the health care system is estimated to be $18 billion annually - one of the largest cost drivers in the health care system today.
[0005] A variety of cells and cytokines are involved in the pathogenesis of RA. It is believed that antigen-presenting cells (APCs), such as dendritic cells (DCs), lead to T cell activation by presenting a particular major histocompatibility complex (MHC) phenotype and unknown auto-antigens that are carried and predisposed primarily by individuals. T cell activation requires co-stimulatory molecules, for instance CD80 (B7.1) and/or CD86 (B7.2). Once triggered, T cells activate other cells, especially B cells. These activated B cells then likely produce autoantibodies. T cells also activate macrophages, which secrete a variety of proinflammatory cytokines, including tumor necrosis factor a (TNF-a), interleukin-1 (IL-1), and IL-6. Autoantibodies, once formed, may form immune complexes that in turn can augment macrophage activation. Accordingly, in addition to immunosuppressive chemicals and steroids, targeted therapies using biological agents have been employed. For instance, blockade of co-stimulatory signals, depletion of B cells, inhibition of TNF-a, IL-1, and IL-6, or combined regimes. However, none of combined regimes has demonstrated clinical advantages. Instead, the adverse events, especially the rates of infections, are increased. It suggests that the combination leads to the inhibition of both targets, albeit without a beneficial effect on the inflammatory response in RA.
[0006] GVHD is a frequent complication and a major cause of morbidity and mortality of allogeneic bone marrow transplantation. Clinical GVHD has an acute form and a chronic form. Acute GVHD is an alloimmune response, and predominately involves a T cell- mediated attack on the host. It is characterized by damage to the skin, liver and the gastrointestinal tract. Chronic GVHD, in contrast, is an autoimmune-like disorder
characterized by T cell activation and subsequent chronic B cell stimulation and autoantibody production. GVHD, therefore, develops as a result of donor T cells attacking recipient tissues. Despite improvement and development of immune treatment, approximately 40% of patients still develop GVHD and have an increased risk of serious infection, relapsed disease, organ toxicity and mortality.
[0007] As such, how to induce subtle shifts in the immune system and train immune cells to accept tissues they are trying to destroy remains a clinically elusive goal.
Immune Tolerance [0008] True human immune tolerance has been achieved and exampled by maternal acceptance of the fetus. The fetus represents a foreign entity, which expresses semi- alloantigens (paternal alloantigens) or alloantigens (in ovum donation programs or surrogate mothers) to the maternal immune system. This "natural" allograft is normally accepted.
Proposed by Medawar 50 years ago, fetus antigens may skew maternal alloimmune response to immunological tolerance during pregnancy. Many mechanisms may protect the fetus from the maternal immune system. For instance, expression of nonclassical MHC molecules (such as HLA-G), alloantigen shedding from the fetus, costimulatory molecule and programmed death ligand (PDL)-l, regulatory T cells (Tregs) and dendritic cells, T cell apoptosis, tryptophan catabolism by the enzyme indoleamine 2,3-dioxygenase, and the complement system. A few key players in maternal-fetal tolerance are briefly described below.
[0009] Nonclassical MHC molecule HLA-G has a number of immunomodulatory functions. For instance, the absence of polymorphic MHC expression and expression of HLA-G on the surface of fetal-derived trophoblast cells seems important in preventing deleterious maternal immune responses against the fetus. HLA-G also inhibits both cytotoxic lymphocyte responses. Antigen-presenting cells transfected with HLA-G can prevent CD4+ T cell proliferation; and soluble HLA-G can induce CD8+ T cell apoptosis. The interaction of HLA- G with leukocyte immunoglobulin-like receptor expressed on dendritic cells can influence immune responses. Such interaction can reduce the expression of costimulatory molecules CD80 and CD86 in dendritic cells, facilitate the generation of CD4+CD25+ Tregs, and lead to the anergy of T cells.
[0010] Another key player in maternal- fetal tolerance may attribute to continual antigen shedding from fetal allogeneic trophoblast. These shed antigens are presented by maternal antigen presenting cells during normal pregnancy. Fetal cells and DNA routinely traffic into the maternal circulation during normal pregnancy, detectable in the maternal serum as early as the first trimester. During the third trimester of normal pregnancy, several grams of dying placental trophoblast are shed daily into the maternal circulation. The concentration of fetal DNA increases over the course of pregnancy and declines rapidly after delivery. [0011] In addition, regulatory T cells and the CD80 and CD86 family of costimulatory molecules appear to be essential for fetus-maternal tolerance. Systemic expansion of the maternal regulatory T cells during pregnancy suppresses both aggressive allogeneic rejection against the fetus as well as autoimmune responses. Optimal T cell activation for immune response requires the engagement of the T cell receptor (TCR) with a cognate MHC+ peptide complex and a "positive" T cell costimulatory signal. Blockade of positive costimulatory signals such as CD80 and CD86 has been shown to inhibit maternal rejection of the allogeneic fetus in abortion-prone matings. The programmed death- 1 receptor and its ligands, PDL1 (B7-H1) and PDL2 (B7-DC), seem to play an important role in peripheral tolerance. During pregnancy, PDL1 is present on all trophoblast populations, and PDL2 on the
syncytiotrophoblast in early pregnancy. PDL1 is necessary for maintaining fetomaternal tolerance. Collectively, maternal acceptance of the fetus is an unprecedented example of a true human immune tolerance.
[0012] Interestingly, concomitant with maternal-fetal tolerance, improvement and remission of RA and multiple sclerosis occurs in most patients during pregnancy, dependent upon the existence of fetal alloantigens. Pregnancy exerts a beneficial effect on the symptoms and signs of RA. Both retrospective and prospective studies have shown that about 75% (range 54 - 86%o) of patients experience improvement or even remission of arthritis during gestation. Improvement occurs for 50 - 76% of patients by the end of the first trimester, and is usually sustained throughout pregnancy. Symptoms of joint inflammation are either improved or completely suppressed rendering therapy unnecessary. Within 3 months after delivery, a relapse is observed in 90% of patients. Among the candidate factors studied, neither increased serum Cortisol concentrations, elevated levels of sex hormones, pregnancy-associated a-2 globulin, nor reversal of abnormalities in the percentage of IgG immunoglobulins lacking the terminal galactose emerged as a convincing explanation for improvement of RA during pregnancy. Shed trophoblast and apoptotic fetal cells in the maternal circulation may be crucial players in the remission of RA observed during pregnancy. The beneficial effect of pregnancy on RA may be a down-regulation of a Thl response and up-regulation of Tregs. Treg cells are the most studied in RA. Depletion and reconstitution experiments in mice have shown that CD4+CD25+ regulatory T cells can prevent or ameliorate autoimmune disease like collagen-induced arthritis or diabetes.
[0013] Similar to the observations from studying RA during pregnancy, large prospective studies have shown spontaneous remissions of multiple sclerosis in pregnant women, and then flare-ups following delivery.
[0014] In view of these compelling observations of autoimmune disease remission during pregnancy, the present inventors have sought to find new ways to modulate the immune system and induce immune tolerance.
SUMMARY OF THE INVENTION
[0015] It is accordingly an object of the invention to provide compositions and methods for modulating a subject's immune response and/or inducing immune tolerance. The
compositions and methods may meet unmet therapeutic needs, provide improvements over known methods and therapeutics, or otherwise provide alternate treatment approaches. The extracts, compositions and methods as described herein and throughout also may be important to induce desired effects in-vitro, as is demonstrated herein.
[0016] According to an aspect of the present invention there is provided a stem cell extract having immune modulatory activity. The stem cell extract is prepared by culturing stem cells in a feeder- free cell culture system, collecting the stem cells and transferring them into a cell lysis buffer, lysing the stem cells in the cell lysis buffer to produce a lysate, and fractionating the lysate into soluble, insoluble fractions, microsome or multivesicular endosome, wherein the stem cell extract comprises the soluble, insoluble fraction, microsome or multivesicular endosome.
[0017] The invention further relates to compositions comprising the described stem cell extracts, and methods of using the compositions to treat and/or prevent a variety of medical conditions, for example, but not limited to autoimmune diseases, transplant rejections, Graft Versus Host Disease (GVHD), arthritis and the like. Further, the compositions may be employed to modulate the immune system and/or induce immune tolerance in subjects.
[0018] Also provided herein are methods of educating or programming a subject's immune cells, comprising treating immune cells obtained from the subject in vitro with a stem cell extract or composition described herein in an amount effective to educate or program the immune cells. The educated or programmed immune cells may be administered to the subject to correct an immune disorder, to induce or enhance immune tolerance, to prevent or alleviate transplant rejection, to treat allergies and/or hypersensitivity, or to treat or alleviate an autoimmune disease.
[0019] There is further provided a method of expanding adult stem cells or progenitor cells, comprising administering a stem cell extract or composition as described herein to the adult stem cells or progenitor cells in vitro, or directly to a subject in vivo, in an amount effective for expansion of the adult stem cells or progenitor cells in vitro or in vivo.
[0020] The invention additionally relates to methods of combination therapy. Such methods involve administering a stem cell extract or composition as described herein, together with an immunosuppressive drug, to the subject in effective amounts to treat the subject. The treatment may be for inducing or enhancing immune tolerance, preventing or alleviating transplant rejection, modulating immune responses in the subject, treating or preventing allergies and/or hypersensitivity, or treating or preventing an autoimmune disease.
[0021] The stem cell extract or composition described herein may also be incorporated into a method for enhancing activity or increasing treatment efficacy of an immunosuppressive drug. Such methods comprise administering the stem cell extract or composition and an
immunosuppressive drug to a subject in need thereof. Typically in such methods, the treatment will be for the therapeutic purpose of the immunosuppressive drug.
[0022] The above-described methods may be adapted for human or veterinary therapeutic purposes. As such, the subject may be a human or other mammal including, but not limited to horse, dog, cat, rat, or mouse. The described compositions may also therefore comprise, without intending to be limiting in any way, stem cell extracts derived from human, horse, dog, cat, rat, mouse or other mammalian sources. In a non-limiting example of a veterinary application, the methods and compositions described herein may be adapted for treatment of dog and/or cat autoimmune diseases or disorders.
[0023] In an embodiment of the present invention, there is provided a composition comprising a stem cell extract having immune modulatory activity, the extract prepared by culturing stem cells in a feeder-free cell culture system, collecting the stem cells and transferring into a cell lysis buffer, lysing the stem cells in the cell lysis buffer to produce a lysate, and fractionating the lysate into soluble and insoluble fractions, wherein the stem cell extract comprises the soluble or insoluble fraction.
[0024] In a further embodiment of the present invention there is provided a composition comprising the stem cell extract as defined above, wherein the stem cells are of human, horse, dog, cat, rat, or mouse origin.
[0025] In a further embodiment of the present invention there is provided a composition comprising the stem cell extract as defined above, wherein the extract is prepared from stem cell sources selected from the group consisting of embryonic stem cells (ESCs), differentiated ESCs, ESC-derived trophoblasts, pluripotent stem cells, differentiated pluripotent stem cells, induced human pluripotent stem cells (iPS), mesenchymal stem cells (MSCs), or
combinations thereof. In a preferred embodiment the stem cells are human embryonic stem cells (hESCs).
[0026] The present invention also contemplates a composition as defined above, wherein the stem cells are treated with collagenase IV and washed with phosphate buffered saline (PBS) prior to cell lysis, and wherein the washed stem cells are lysed by sonication.
[0027] Also provided is a composition as defined above and an acceptable carrier or excipient. [0028] In a further embodiment of the present invention there is provided a composition as defined above comprising, a) an extract derived from day 3-7 embryonic stem cells, wherein the stem cells are undifferentiated stem cells, and; a-1) wherein the extract is prepared by sonication of the stem cells and clarified by centrifugation to remove cell membrane, mitochondria and nucleus, and wherein the extract is prepared in the absence of an exogenously added detergent; b) one or more salts or buffers; c) a calcium/magnesium chelating agent; d) a thiol reducing agent; e) one or more protease inhibitors, and; f ) optionally, L-arginine.
[0029] In a further embodiment there is a composition as defined above wherein the composition comprises L-arginine and the composition is sterile.
[0030] In a further embodiment there is a composition as defined above wherein the composition is derived from day 5 embryonic stem cells expressing undifferentiated markers, such as SSEA-4, TRA-1-60, Tra-1-81 and OCT 3/4, Nanog, and AP markers.
[0031] In a further embodiment there is a composition as defined above wherein the embryonic stem cells are cultured on a feeder-free cell culture medium.
[0032] In a further embodiment there is a composition as defined above wherein the extract comprises a microsomal fraction or a multivesicular endosome fraction of the embryonic stem cells. [0033] In a further embodiment there is a composition as defined above comprising a stem cell extract and a pharmaceutically acceptable carrier or excipient.
[0034] In a further non-limiting embodiment of the present invention, there is provided a method of inducing or enhancing immune tolerance in a subject in need thereof, the method comprising administering a stem cell extract or a composition as defined above to the subject in an amount effective to induce or enhance immune tolerance.
[0035] In a further embodiment there is provided a method of preventing or alleviating transplant rejection in a subject in need thereof, the method comprising administering a stem cell extract or composition as defined above to the subject in an amount effective to prevent or alleviate transplant rejection.
[0036] In a further embodiment, there is provided a method as defined above wherein the transplant is an allograft.
[0037] There is also provided a method of treating a subject with allergies and/or
hypersensitivity, the method comprising administering a stem cell extract or composition as defined above to the subject in an amount effective to modulate an immune response to an allergen or antigen.
[0038] There is also provided a method of treating or preventing an autoimmune disease, the method comprising administering a stem cell extract or composition as defined above to the subject in an amount effective to ameliorate or prevent the autoimmune disease.
[0039] Also provided is a method as described above, wherein the autoimmune disease is selected from the group consisting of graft-versus-host disease (GVHD), rheumatoid arthritis (RA), multiple sclerosis, systemic lupus erythematosus (SLE), Scleroderma, Sjogren's syndrome, Guillain-Barre syndrome, Type I diabetes, Graves disease, Celiac disease,
Addison's disease, ulcerative colitis, psoriasis and Crohn's disease. [0040] There is also provided a method as described above wherein the stem cell extract is administered intravenously, intramuscularly, intraperitoneally, subcutaneously, intracardially, orally or nasally.
[0041] Also contemplated by the present invention is a method as described above wherein the allograft is co-transplanted together with the stem cell extract to induce or increase immune acceptance of the transplanted cells. In a preferred embodiment which is not meant to be limiting in any manner, the allograft may comprise differentiated cells selected from the group consisting of neural cells, islet cells and muscle cells.
[0042] Also provided is a method of educating or programming a subject's immune cells, the method comprising treating immune cells obtained from the subject in vitro with a stem cell extract or composition as described above in an amount effective to educate or program the immune cells.
[0043] There is also provided a method as described above wherein the educated or programmed immune cells are administered to the subject to correct an immune disorder, to induce or enhance immune tolerance, to prevent or alleviate transplant rejection, to treat allergies and/or hypersensitivity, or to treat or alleviate an autoimmune disease.
[0044] There is also provided a method of expansion of adult stem cells or progenitor cells, the method comprising administering a stem cell extract or composition as defined above to the adult stem cells or progenitor cells in vitro, or directly to a subject in need thereof in vivo, in an amount effective for expansion of the adult stem cells or progenitor cells in vitro or in vivo.
[0045] There is also provided a method of enhancing activity or increasing treatment efficacy of an immunosuppressive drug, the method comprising administering a stem cell extract or composition as defined above and the immunosuppressive drug to a subject in need thereof. In a further embodiment, the immunosuppressive drug is selected from the group consisting of calcineurin inhibitors, mammalian target of rapamycin (mTOR) inhibitors, interferons, TNF binding proteins, IL-2 receptor antibodies, T-cell receptor antibodies, cytostatics,
glucocorticoids and combinations thereof. Alternatively, it is also contemplated that the immunosuppressive drug may be selected from the group consisting of cyclosporin, tacrolimus, sirolimus, IFN-β, infliximab (RemicadeTM), etanercept (EnbrelTM), adalimumab (HumiraTM), basiliximab (SimulectTM), daclizumab (ZenapaxTM), OKT3 (muromonab), cyclophosphamide, nitrosoureas, platinum compounds, methotrexate, azathioprine, mercaptopurine, dactinomycin, anthracyclines, mitomycin C, bleomycin, mithramycin, hydrocortisone and combinations thereof.
[0046] The present invention also provides a method of treating a subject in a combination therapy, comprising administering a stem cell extract or composition as described herein and an immunosuppressive drug to the subject in effective amounts, wherein the treatment is for inducing or enhancing immune tolerance, preventing or alleviating transplant rejection, modulating immune responses in the subject, treating or preventing allergies and/or hypersensitivity, or treating or preventing an autoimmune disease.
[0047] Also provided is a method as described above, wherein the administration of the stem cell extract or composition and immunosuppressive drug is simultaneous. Alternatively, the administration of the stem cell extract or composition and immunosuppressive drug is sequential.
[0048] There is also provided a stem cell extract or composition as described above wherein the stem cells are cultured on MatrigelTM coated plates for 3 to 7 days. In a further embodiment, the stem cells are lysed by sonication, freeze-thaw, mechanical lysis using a pressure cell or detergent solubilization. Detergent solublization is less preferred. Sonication is more preferred.
[0049] Also contemplated, the stem cell extract or composition as defined above may include cell lysis buffer that comprises a buffer, a salt, a chelating agent, a reducing agent and protease inhibitors. In a preferred embodiment the pH of the lysis buffer ranges from about 6.5 to 8.5.
In a more preferred embodiment buffer is selected from the group consisting of HEPES, Tris- HC1 and combinations thereof. Also contemplated is a stem cell extract or composition wherein the concentration of the buffer ranges from about lOmM to lOOmM. In another embodiment, the buffer comprises about physiological osmolality and pH.
[0050] In a further embodiment, which is not meant to be limiting in any manner, the stem cell extract or composition as described above may comprise one or more salts comprising NaCl, MgCl2, KCl, LaCl3, CaCl2 and combinations thereof. The concentration of the salt may range in some instances from about 0.1 mM to lOOOmM.
[0051] The present invention also contemplates the stem cell extract or composition as described above, wherein the reducing agent comprises one or more of dithiothreitol (DTT), dithioerythrol, 2-mercaptoethanol (2-ME), GSSG, GSH or glutathione and combinations thereof. Preferably, the concentration of the reducing agent ranges from about 0.1 mM to lOmM.
[0052] The present invention also contemplates the stem cell extract or composition as described above, wherein the chelating agent comprises ethylenediaminetetraacetic acid (EDTA), ethylene glycol tetraacetic acid (EGTA) or a combination thereof.
[0053] The present invention also contemplates the stem cell extract or composition as described above, wherein the concentration of the chelating agent ranges from about 0.1 mM to 200mM.
[0054] The present invention also contemplates the stem cell extract or composition as described above, wherein the protease inhibitors comprise leupeptin, serine proteases, cysteine proteases, metalloproteases, aspartic acid proteases and combinations thereof.
[0055] The present invention also contemplates the stem cell extract or composition as described above, wherein the concentrations of the protease inhibitors range from
approximately 0.1 μΜ to ImM. [0056] The present invention also contemplates the stem cell extract or composition as described above, wherein the cell lysis buffer further comprises a protein stabilizer selected from the group consisting of L-arginine, glycerol, sucrose, β-lactamase, acetone acetamide, surfactants, TweenTM80, TweenTM20, TweenTM40, polymers, L-glutamine, L-lysine and combinations thereof.
[0057] The present invention also contemplates the stem cell extract or composition as described above, wherein the concentration of the protein stabilizer is from about OmM to 500mM.
[0058] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the following claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0059] These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:
FIGURE 1 illustrates maintenance of undifferentiated human embryonic stem cells under the defined culture conditions in the presence of basic fibroblast growth factor but in the absence of serum, cytokines, feeder-cells and antibiotics. Undifferentiated hESCs were maintained either under the feeder-free (Wang L, et al. Immunity 2004; 21 : 31-41) or defined culture conditions (Wang L, et al. Blood 2005;105:4598-4603). The hESCs were characterized by Flow cytometry (a), immunocytochemistry (b, c) and teratoma formation (d-g).
Undifferentiated hESCs express surface markers SSEA-4, Tra-1-60, Tra-1-81, and intracellular marker Oct3/4 (a, first peak of each panel representing the isotype antibody control), Nanog (b, red; inset, isotype control), and E-cadherin (c, green) and AP (c, red). After injection of those hESCs into the testis capsule, all NOD/SCID mice produced teratomas 6 weeks post inoculation (n = 4). Haematoxylin and eosin staining of the teratoma sections revealed that the tumors were composed of a mixture of well-differentiated tissues representing all 3 embryonic germ layers, including ectoderm (d. neural rosette), mesoderm (e. cartilage, f. bone) and endoderm (g. gut-like glands with goblet cells). Bars, 10 um.
FIGURE 2 shows that cell-extracts from human embryonic stem cells (hESC) suppress human mixed lymphocyte reaction (n=3). Cell-extracts prepared from human embryonic stem cells (hESC, either HI cell line or H9 cell line) inhibit human allogeneic lymphocyte responses. One way mixed lymphocyte reactions were carried out with human peripheral blood mononuclear cells in the presence or absence of 3μ1 (Allo+hESC 3, containing ~0.3μg protein) or 2μ1 (Allo+hESC 2, containing ~0^g protein) of hESC-extracts or vehicle (Allo+lysis 3, Allo+lysis 2), respectively. [3H]-thymidine was added on day 6 of incubation and the cells were allowed to proliferate for an additional 18 hours. Mixed lymphocyte reactions treated with 3μ1 of hESC extracts significantly inhibited cell proliferation in comparison to untreated cultures. Noticeably, cultures treated with 3μ1 of vehicle also proliferated to a lesser degree. However, titration of both the extracts and vehicle
demonstrated that the extracts retained their ability to suppress cell proliferation whereas vehicle allows cells to proliferate at normal levels (Allo+hESC 2 vs. Allo+lysis 2). Cell proliferation is displayed as counts per minute.
FIGURE 3 shows that cell-extracts from human embryonic stem cells (hESC-extracts, either HI male line or H9 female line; center, blue box) but not from human embryonic fibroblast cells (right, red box) suppress human monocyte differentiation. THP-1 human monocytic cells were pre-treated with 20μ1 of hESC-extracts for 24 hours. Subsequently, macrophage maturation was induced with ^g/mL of LPS for 18 hours. Quantitative PCR was utilized to detect expression levels of maturation markers B7.1 (CD80), B7.2 (CD86), CD1 lb, CD68, and MMP9 in comparison to controls. Results indicate that hESC-extracts (LPS+hESC) have the ability to hinder gene expression levels in comparison to the cells treated with vehicle control (LPS+lysis) and with human embryonic fibroblast cell line extracts. Graph displays fold increase in gene expression in comparison to untreated control cells. FIGURE 4 shows that cell-extracts from human embryonic stem cells (hESC-extracts) suppress the differentiation and maturation of dendritic cells from monocytes, inhibiting the morphological change and co-stimulatory molecule CD80 expression. Cell-extracts from human embryonic stem cells (hESC-extracts) suppress the differentiation and maturation of dendritic cells from monocytes. (A) Monocytes treated with vehicle showed a typical maturation morphology. Cells became elongated, had numerous veils and formed many clusters (inset) on day 7. (B) In contrast, monocytes treated with hESC-extracts did not show elongated shapes or display typical veils of dendritic cells, and also formed fewer clusters in response to TNF-alpha (inset). These results indicate that hESC-extracts suppress monocyte to dendritic cell maturation at the morphological level. (C & D) Comparison of vehicle treated cells (grey), hESC-extracts (white overlay) were capable of suppressing B7.1 expression as indicated by a decreased fluorescence intensity (shift to left). Primary human monocytes were cultured with 500 IU/mL of GM-CSF and 500 IU/mL IL-4 in order to induce the
differentiation of monocytes into dendritic cells. The cells also received either 3μ1 of vehicle (Control - Lysis buffer alone), or hESC-extracts. Two days later, cells were fed with fresh media every 2 days containing cytokines and 1 μΐ of vehicle or hESC-extracts for the first 6 days. On day 6, the cells also received 20 ng/mL of TNF-alpha in order to induce dendritic cell maturation. On day 8, cells were examined for CD80 (B7.1) expression by flow cytometry.
FIGURE 5 shows that (A and B) cell-extracts from human embryonic stem cells (hESC- extracts) suppress the differentiation and maturation of dendritic cells from monocytes, inhibiting the expression of CD83 (DC maturation marker) and HLA-DR (antigen
presentation marker); and that (C and D) dendritic cells treated with cell-extracts prepared from human embryonic stem cells (H9 line, H9-Ext) become poor stimulators of allogenic T cells. In comparison to the vehicle control (lysis buffer treated cells, grey), hESC-extracts (white overlay) are capable of suppressing the expression of CD83 (A) and HLA-DR (B), as indicated by the decreased fluorescence intensity (shift to the left) and the lower percentage of positive cells. Primary human monocytes were cultured with 500 IU/mL of GM-CSF and 500 IU/mL IL-4 in order to induce the differentiation of monocytes into dendritic cells. The cells also received either 3μ1 of vehicle (Control -Lysis buffer alone), or hESC-extracts. Two days later, cells were fed with fresh media every 2 days containing cytokines and 1.5μ1 of vehicle or hESC-extracts for the first 6 days. On day 6, the cells also received 20 ng/mL of TNF- alpha in order to induce dendritic cell maturation. On day 8, cells were examined for the expression of CD83 (dendritic cell maturation marker) and HLA-DR (antigen presentation marker) by flow cytometry. For (C) and (D), primary human monocytes were cultured in media supplemented with 500U/mL of GM-CSF and IL-4 in order to induce differentiation into dendritic cells. The cells received either 3ul of H9 hESC extract (H9-Ext, 3ug/uL), human embryonic fibroblast cell MRC extract (MRC-5 Ext, 3ug uL), or vehicle at the first two days. The media were then changed very two days with addition of fresh GM-CSF and IL-4 and either 1.5 of H9-Ext, MRC-Ext or vehicle for the next 4 days. On day 6, the cells were treated with 20ng/mL of TNF-a to induce dendritic cell maturation. On day 8 the cells were harvested, washed and treated with 5(^g/ml of mitomycin C. Subsequently, the matured DCs were used to stimulate purified allogeneic CD3+ T cells (ratio of DC:T cell = 1 :50). (C) The images depict purified T cells, T cells stimulated with DC pre-treated with vehicle, H9- Ext, and MRC-5 Ext 24 hours post culture. 50x magnification in all images. (D) T cell proliferation capacity when exposure to DC pre-treated with vehicle, H9-Ext and MRC-5 fibroblast Ext. Data are representative of three independent experiments.
FIGURE 6 illustrates that (A and B) hESC-extracts from different cell lines (either HI or H9 line) show similar potency in the suppression of CD80 (co-stimulatory molecule) expression, but that hESC-extracts containing a lower level of protein (or partially denatured) show a relatively lower potency (compared to Figure 4), and (C) water soluble hESC-extracts show immune modulatory potency different from water insoluble precipitates. In (A) and (B), cell- extracts from different lines of human embryonic stem cells (either HI or H9 line) show identical suppressive potency to the expression of CD80 (B7.1) during human monocyte differentiation into dendritic cells. The results obtained with the H9 (female) hESC cell line closely mirrored those obtained with the HI (male) cell line, indicating that hESC-extracts have an innate ability to suppress dendritic cell maturation. The suppressive potency seems to associate with the protein concentrations. Here, hESC-extracts contain approximately 30% of the amount of proteins (or partially denatured by heavy sonication) in comparison to the hESC-extracts used in Figure 4. As a result, they also show a reduced potency in the inhibition of CD80 expression, as indicated by a decreased fluorescence intensity (shift to left). The experimental procedures were similar to Figure 4. Primary human monocytes were cultured with 500 IU/mL of GM-CSF and 500 IU/mL IL-4 in order to induce the
differentiation of monocytes into dendritic cells. The cells also received either 3μ1 of vehicle (Control - Lysis buffer alone), or HI or H9 hESC-extracts. Subsequently, cells received fresh media every 2 days containing cytokine and 1 μΐ of lysis-buffer or hESC-extracts for the first 6 days. On day 6, the cells also received 20ng mL of TNF-alpha in order to induce dendritic cell maturation. On day 8, cells were examined for CD80 expression by flow cytometry. In (C), water insoluble precipitates show a relatively greater potency in the inhibition of co- stimulatory molecule (CD80) expression during dendritic cell differentiation and maturation (6C), while water soluble STEM-pep showed a greater potency in the suppression of mixed lymphocyte reaction (Figure 2 and data not shown).
FIGURE 7 shows in vivo results illustrating the potential of STEM-pep to alleviate GVHD. STEM-pep is capable of alleviating acute graft versus host disease, indicated by lower body weight loss (A) and less severe GVHD symptoms (B). These data are summarized from ongoing experiments. Donor bone marrow and spleen cells were harvested from C57BL/6 mice, mixed at a ratio of 1 :1 and cultured in RPMI medium in the presence of either vehicle control or mouse Jl embryonic stem cell extracts. In addition, recipient Balb/c spleenocytes were added in the cultures at a ratio of 1 : 10 (recipient cells:donor cells). Following 48 hours of in vitro culture, the cells were washed with PBS and resuspended in serum-free RPMI medium. Clumps were removed by passing the cells through a 27 gauge needle.
Subsequently, 40xl06 cells/mouse (in 300μί of RPMI medium) were injected into lethally irradiated Balb/c mice (n = 3 for each group). The body weight and onset of GVHD was monitored and scored blindly by the experienced animal technicians. GVHD symptoms of each mouse were scored daily from 0 to 2 for each symptom including weight loss, inactivity, skin lesions, roughened coat, and hunching. The total GVHD scores are combined to provide a clinical score from 0-10. Higher scores indicate more severity of GVHD. Unresponsive mice or those unable to obtain food and water (loss of >30% of initial body weight) with severe GVHD symptoms were determined to be moribund and killed in accordance with Animal Care Committee Guidelines of the University of Ottawa.
FIGURE 8 illustrates the immune suppressive potential of cell-extracts from mesenchymal stem cells (MSC-extracts) through inhibition of mixed lymphocyte proliferation. (A) Intact human mesenchymal stem cells (MSC) have been shown to suppress immune response.
Results here indicate that MSC-extracts (~0.3 g protein) are also capable of inhibiting alloantigen-induced lymphocyte proliferation (one way mixed lymphocyte reaction), but with less potency than hESC-extracts (human embryonic stem cell extracts, ~0^g protein). These data suggest that cell-extracts from pluripotent hESCs may have higher potency than those from multipotent MSC cells. In contrast, unipotent human embryonic fibroblast cells did not exhibit immune suppressive capacity (Figure 3). R + S: responder + stimulator in the mixed lymphocyte reaction. Cell cultures were treated with either 1 μΐ of vehicle control (the buffer solution used in cell-extracts), or Ιμΐ (total -0.3 μg of protein) of extracts obtained from human MSCs, or 1 μΐ (total -0.3 μg of protein) from hESCs (H9 line). The human mixed lymphocyte reactions were allowed to proceed for 6 days and [3H]-thymidine was added to the cultures for 16 hours (B and C). MSCs were negative for CD34 and CD45 staining (also negative for CD 14, data not shown), and positive for CD90 and CD 105. Analysis was performed using flow cytometry. (D and E) Typical MSC morphology and positive staining for CD 105 were observed by (D) light microscope (200X) and (E) immunohistochemistry (CD105+FITC). In addition, MSCs also exhibit a multipotency after further differentiation (data not shown).
FIGURE 9 illustrates (A) that human embryonic stem cell extracts (hESC EXT) induce FoxP3 expression in mixed lymphocyte reaction assays, and that the Programmed Death- 1 receptor and its Ligands, PDL-1 (B7-H1) and PDL-2 (B7-DC) are expressed in hESCs (B) and up- regulated after differentiation (towards trophoblast-like cells) in the presence of bone morphogenic protein 4 (BMP4) (C). (A) One way mixed lymphocyte reactions were carried out in the presence or absence of hESC-extracts. Cells were allowed to proliferate in response to alloantigen for 7 days and RNA was extracted from the cells in order to detect FoxP3 transcript using Q-PCR. Results show that FoxP3 expression is increased 2-fold in the lymphocyte cultures treated with hESC-extracts (hESC EXT) in comparison to those treated with vehicle control. This indicates a possible polarization or induction of regulatory T cells. FoxP3 primer sequences: forward, cagcacattcccagagttcct (SEQ ID NO.l); reverse:
gcgtgtgaaccagtggtagat (SEQ ID NO:2). The conditions for Q-PCR reactions are: an initial hot start at 94 °C for 90 second (1 cycle); cycle 2 (40 cycles), 94 °C for 10 second, 60 °C for 30 second and 72 °C for 30 second. (B and C) Primer sequences: PDL-1 forward:
tgtgcatggagaggaagacct (SEQ ID NO:3); reverse: accatagctagatcatgcagcg (SEQ ID NO:4). PDL-2 forward: cagcaatgtgaccctggaatg (SEQ ID NO:6); reverse: tcctccagcaaagtggctctt (SEQ ID NO:7). The conditions for Q-PCR are the same as described for (A).
FIGURE 10 shows the reprogramming of human blood leucocytes into induced pluripotent stem (iPS) cells with four transcription factors. (A) provides a schematic drawing
representing the strategy used for reprogramming cells from the human blood leukocytes. (B) the reprogrammed colony switches to anchorage-dependent growth. The colony attaches to the plate and shows typical morphology of human embryonic stem cells. Notice that some round-like floating cells are non-reprogrammed blood leukocytes. (C) the reprogrammed colony proliferates after 5 days of culture, showing similar proliferative rate to that of human embryonic stem cells. (D and E) the third passage of the reprogrammed colonies at day 1 and day 3 after reseeding. (F) reprogrammed cells are positive (red) for alkaline phosphatase staining. Alkaline phosphatase is one of the most reliable parameters used for the
characterization of undifferentiated human embryonic stem cells and induced pluripotent stem cells. (G) in contrast, under the same culture conditions, non-reprogrammed blood leukocytes show a typical sphere morphology and adhesion-independent proliferation, devoid of alkaline phosphatase staining. Bar = 20 μιη. FIGURE 1 1 shows (A) that ESC-extracts work synergistically with low dose of immunosuppressive drug cyclosporine (calcineurin inhibitor) to dramatically suppress mixed lymphocyte reaction, (B) that human ESC-extracts inhibit PMA-induced proliferation of purified T cells, and (C and D) that hESC and mESC-extracts work synergistically with Calcium channel inhibitors to suppress mixed lymphocyte reaction. (A) Current
immunosuppressive drugs used in the clinic are associated with various severe side-effects, such as organ toxicity, opportunistic infection and cancer. ESC-extract can be used to reduce the dosage of immune suppressive drugs. ESC-extracts were tested in combination with low dose of calcineurin inhibitor cyclosporin, a drug commonly used in the clinic to prevent organ rejection. Mixed lymphocyte reactions were carried with 1 x 105 responder (CD1 mouse) and stimulator (B6 mouse) splenocytes and treated with either vehicle alone, vehicle in
combination with 20ng/ml of cyclosporine, mouse ESC-extract (from B6 mouse) in combination with 20ng ml of cyclosporine or mouse ESC-extract alone. MLR were allowed to proceed for 3 days and 3H was added for an additional 16 to 18 hours. Cell proliferation is displayed as mean counts per minute of triplicate wells±SD. Data are representative of two independent experiments. (B) human T cells were positively selected using anti-CD3 labeled magnetic beads. Subsequently 1.0 x 105 cells were stimulated with PMA (5.0ng/ml) or Ionomycin (2 μΜ) in the presence or absence of hESC-extract. The cells were allowed to proliferate for 3 days and pulsed with tritiated thymidine for an additional 16 to 18 hours. Cell proliferation is displayed as mean counts per minute of triplicate wells±SD. Results are representative of four independent experiments. (C) human embryonic stem cell-extracts inhibit human mixed lymphocyte reaction independent of calcium pathway, and work synergistically with calcium channel inhibitors. Calcium channel inhibitors KN-95 and SKF were used alone or in combination with human embryonic stem cell extracts from H9 cell line (H9, 3μg proteins/μΐ). In combination with 20 μΜ of SKF, hESC-extracts suppress mixed lymphocyte reaction in a synergistic manner by improving suppression by 100 fold and 10 fold compared to hESC-extract and SKF alone respectively. These data suggest that ESC- extract can be used to compliment current clinical drugs through inhibiting calcium channel.
R + S: responder + stimulator. (D) similar results obtained from mouse ESC-extracts. R + S: responder lymphocyte + stimulator lymphocyte. B6 2μ1: 2μ1 of ESC-extracts from B6 mouse ES cells. The data are representative of two independent experiments.
FIGURE 12 shows that bioactive components of ESC-extracts for immune modulation are, at least in part, proteinaceous - Proteinase K treatment abrogates the inhibitory effect of mESC- extract on mouse splenocyte proliferation. The third panel (EXT-P : mouse ESC-extracts pretreated with Proteinase K) shows that the second peak is similar to control (first panel, R + S: responder splenocyte + stimulator splenocyte), indicating cell proliferation because dividing daughter cells have diluted the fluorescent density of the parent cells that had been pre-labeled with fluorescent dye. In contrast, ESC-extracts treated with RNase A (EXT- RNase) retain their immune inhibitory capacity in comparison to the untreated ESC-extracts (EXT-control). Mouse ESC-extracts (EXT) were treated with O.lmg/ml of proteinase for 24 hours at 37 °C, or with lC^g/ml of RNAse A for 2 hours at 37 °C. Subsequently, the mouse ESC-extracts were used to inhibit the proliferation of B6 mouse splenocytes to Balb/c splenocytes in one-way mixed lymphocyte reaction. Responder B6 splenocytes were suspended in RPMI medium at 1.0 x 106/ml and treated with 5μΜ of carboxyfluorescein diacetate succinimidyl ester (CFSE) for 30 minutes at 37 °C. Following the incubation, responder cells were washed 3 times with serum free RPMI and seeded in 96 well U bottom plates with Balb/c splenocytes that had been pre-treated with 5(^g/ml of mitomycin C at a cell density of 2.0 x 106 cells for each. The cells were allowed to proliferate for 4 days and analyzed by flow cytometry. The data are representative of two independent experiments.
FIGURE 13 is a representative schematic illustration of the method of STEM-pep preparation from hESCs under sterilized conditions.
FIGURE 14 illustrates the results of two different cell lysis methods, sonication and freeze- thaw lysis, on stimulation index with mESCs.
FIGURE 15 shows results of modifying the lysis buffer. (A) illustrates the non-specific effect caused by high concentrations of EDTA (100 mM EDTA; see boxed results at two vehicle volumes tested); (B) illustrates a reduction in non-specific effect by reducing EDTA concentration in the lysis buffer from 100 mM to 1 mM (no apparent titratable effect at three V2 vehicle volumes tested), and raw test data from mouse ESC (mESC) extracts prepared in lysis buffer containing 1 mM EDTA and further including L-Arginine.
FIGURE 16 shows results that ESC-extracts inhibit allogeneic PBMC proliferation in mixed lymphocyte reactions. A. One way mixed lymphocyte reactions (MLR) were carried out with 1 x 105 PMBC obtained from healthy volunteers. One set donor of cells were treated with 50 μg/mL of mitomycin C to serve as stimulators while the second set of donor cells were used as responders. MLRs were carried out in the presence of increasing amounts of hESC extracts (EXT) or control fibroblast EXT (Control EXT) or vehicle, and compared to untreated cultures (R+S); 3.5 μΐ and 7 μΐ EXT contained 12 μg and 24 μg of proteins/200 μΐ/well respectively. Tritiated thymidine was added on day 5 and the cells were cultured for an additional 16 to 18 h. Results are displayed as counts per minute (CPM) of. triplicate wells±SD. Results are representative of at least five separate experiments, b. Cellular extracts prepared from B6 murine ESCs (mESC EXT. 1.75 μg (0.5 μ1-14 μg (4 μΐ) of proteins/200 μΐ/well) were used in one-way MLR. One hundred thousand C57BL/6 splenocytes were cultured together with lxlO5 mitomycin-treated B6C3F1 splenoncytes. Tritiated thymidine was added on day 3 of incubation and the cells were allowed to proliferate for an additional 16 to 18 h. Cell proliferation is displayed as mean counts per minute (CPM) of triplicate wells ± SD. Results are representative of at least five separate experiments, c. The inhibitory effect of hESC-EXT on PBMC proliferation in MLR is not due to cell death. Human PBMCs cultured as in (a) were harvested on day 6, washed with PBS, stained with 7AAD for 30 min and analyzed by flow cytometry. Results are representative of three separate experiments.
FIGURE 17 shows results that hESC-extracts inhibit monocyte-derived dendritic cell maturation. Primary human monocytes were isolated by negative selection using magnetic beads. Subsequently, 5.0 x 105 monocytes were cultured in the presence of 500U/mL of GM- CSF and IL-4 in order to induce them to differentiate into dendritic cells. The cells also received either 0.15 mg/mL (final concentration) of hESC extracts (hESC EXT), L-132 fibroblast extracts (Control EXT), or equivalent volume of vehicle on day 0. Fresh media were added every 2 days containing fresh cytokines and 0.075 mg/mL of hESC EXT, L-132 EXT or vehicle on day 2, 4, and 6. On day 6, the cells also received 20 ng/mL of TNF-a in order to induce dendritic cell maturation. Cells were incubated for an additional two days, stained with specific antibodies and examined by flow cytometry for the surface expression of DC maturation markers CD80 (a), HLA-DR (b), CD83 (c). and CD86 (d) . Grey lines represent controls and filled histograms represent treated mDCs. Values within plots indicate mean fluorescent intensity. Results are representative of at least three separate experiments
FIGURE 18 shows results that hESC extract-treated mDCs retain greater phagocytic function following maturation. Immature and TNF-a matured mDCs were cultured and collected on day 6 (a) and day 8 (b) respectively. The cells were washed twice with PBS containing 1% FBS and incubated with 1 mg/mL of dextran-FITC beads at 37°C or on ice for 90 min.
Subsequently, the cells were washed twice with PBS containing 1% FBS and 0.1% sodium azide and analyzed by flow cytometry. Values within plots indicate mean fluorescent intensity. Results are representative of at least three separate experiments.
FIGURE 19 shows results that hESC extract-treated mDCs secrete lower levels of IL-12p40 following maturation. Supernatants from mDCs treated with vehicle, hESC EXT, and fibroblast EXT (as described in Figure 17) were collected on day 6 and day 8. Subsequently, IL-12p40 levels were measured by ELISA assays. Results are representative of three separate experiments.
FIGURE 20 shows results that suggest IL-10 and TCF-β do not contribute to hESC extract- mediated immune modulation, a) Relative mRNA expression of IL-10 and TGF-β by hESCs as measured by QPCR. B) One way allogeneic MLRs were carried out in the presence of hESC-EXT that have been treated with isotype control antibody or with a neutralizing antibody against TGF-β. Proliferation was allowed to proceed for 5 days and tritiated thymidine was added for an additional 16 to 18 h. Cell proliferation is displayed as mean counts per minute (CPM) of triplicate wells±SD. Results are representative of three separate experiments.
[0060] FIGURE 21 shows microscopy results of experiments performed. (A-C) Images represent ΙΟμΙ of soluble fractions from 3 different batches of hESC-extracts that were mixed with trypan blue (1 :1) and analyzed on hemocytometer (lOOx). All images were captured using Zeiss Invertoskop 40C. (D) H9 cells prior to sonication (lOOx).hESC extracts used in all experiments were cell free. hESCs were harvested from cell culture plates with collagenase IV followed by cell dissociation buffer to obtain a single cell suspension. Subsequently, hESCs were washed twice with ice cold PBS and centrifuged at 400g for 6 minutes at 4 C. After washing, the cells were re-suspended in lysis buffer (see materials and methods). At this point the cells were incubated on ice for 30 minutes and sonicated until the cells were completely lysed. The sonicated cells were centrifuged at 15000g for 15 minutes at 4°C to remove cell debris. The supernatant (soluble and cell-free fraction) was transferred to a new tube and used in all experiments.
[0061] Figure 22 shows results suggesting hESC extract treated DCs supplemented with IL- 12p40 are poor stimulators of allogeneic T cells. Primary human monocytes were isolated from peripheral blood mononuclear cells by negative selection using immunomagnetic beads. Subsequently, 5.0 x 105 monocytes were cultured in the presence of 500U/mL of GM-CSF and IL-4 in order to induce them to differentiate into dendritic cells. The cells also received either 0.15mg/mL (final concentration) of hESC extracts (hESC EXT) or equivalent volume of vehicle on day 0. Fresh media were added every 2 days containing fresh cytokines and 0.075mg/mL of hESC EXT or vehicle on day 2, 4, and 6. To induce maturation, on day 6 the cells received 20ng/mL of TNF-alpha in addition to IL-4 and GM-CSF. Some cultures were also supplemented with lOng/ml of IL-12p40 in addition to the other cytokines during the maturation step. Immature cells that did not receive TNF-alpha were harvested on day 8 like their mature counterparts. mDCs were treated with mitomycin C and cultured with 1 x 105 purified CD3+ allogeneic T cells at a ratio of 1 :100. T cell proliferation was allowed to proceed for 3 days and tritiated thymidine was added for an additional 16 to 18 hours. Cell proliferation is displayed as mean counts per minute (CPM) of triplicate wells ± SD.
[0062] FIGURE 23 shows results of cell cycle analysis of one way MLR. A decrease in the number of cells entering the S phase was observed after treatment with hESC extracts (A) in comparison to vehicle control (B). One way MLR were carried out with PBMC obtained from healthy volunteers. One set of donor cells were treated with 50μg/mL of mitomycin C to serve as stimulators while the second set of donor cells were used as responders. MLRs were carried out in the presence of hESC extracts (A) or vehicle control (B). MLRs were allowed to proceed for 7 days. Cells were harvested and fixed with 10% formalin in PBS for 15 minutes, permeabilized with 0.5% Triton X-100 in PBS for 15 minutes. The cells were incubated with 0.5mg/ml of RNAse A and 7AAD for 30 minutes and analyzed by flow cytometry. Data analysis was carried out with Multi Cycle AV software (Phoenix flow systems Inc.).
FIGURE 24A,B shows results suggesting that bioactive components of ES-extracts are largely enriched in microsomal fraction following fractionation of murine B6 ESC by ultra- centrifugation. A). Fractionation of B6 ESC extracts was carried out in order to identify the specific activity within known cellular compartments. Extract activity was tested as a whole lysate (whole) and fractionated into cytoplasmic lysate (normal, 15000g for 15min), the microsomal lysate (microsome, 50000g for lh), and the supernatant obtained from the microsomal lysate (Micro- Super). The data indicates that the activity of the ESC-extracts is concentrated within the microsomal fraction since it shows potent capacity to inhibit splenocyte proliferation. B). Analysis of the protein profile within the different fractions indicates that there are unique bands found within the mircrosomal fraction although there is also a large overlap with other fractions. It can be concluded that the bioactive immune modulatory components from ESC-extracts can be isolated and concentrated from a specific cellular fraction. [0063] FIGURE 25 shows biotinylation results that suggest unique ESC proteins interact with T cells. These specific proteins have molecular weights: ~30kDa, ~37kDa, ~50kDa, and 100kDa~150kDa. ESC-proteins from B6 mouse were labeled with NHS-PEG4-biotin labeling kit (Thermo-Fisher Scientific Inc.), resulting in the formation of an amide bond between this molecule and all proteins found in the ES-extracts (one protein may be biotinylated several times). Subsequently, purified T cells activated with 5.0ng/ml of mitogen PMA (a specific stimulator of Protein Kinase C and T cell proliferation) were incubated with the biotin-labeled ESC-proteins overnight. The T cells were harvested and washed four times (10 min for each) with PBS at 4°C to remove unbound proteins. The T cells were subsequently lysed. The lysate was used to carry out SDS-PAGE gel electrophoresis followed by transfer to a PVDF membrane. The membrane was blocked with 5% BSA in PBS and subsequently probed with strepavidin conjugated to horse radish peroxidase (HRP) at 1 : 100 (Thermo-Fisher Scientific Inc.) Biotinlyated proteins that were derived from ESC and directly interacted with T cell through surface binding or internalization were visualized with addition of substrate for the HRP enzyme. Examination of the blot indicates that there are unique bands associated with T cells treated with ESC-biotin labeled protein between the 25kDa and 37kDa markers, the 37kDa and 50kDa markers, the 50kDa and the lOOkDa and 150kDa markers compared to untreated controls (T cell lysate only) and C2C12 muscle pre-cursor stem cells (indicated by arrows).
[0064] FIGURE 26 shows results that MFG-E8 is highly expressed in undifferentiated ESC but not differentiated B6 ESC. Line 1 : undifferentiated B6 ESC lysate, Line 2: differentiated B6 ESC lysate, Line 4: mouse muscle progenitor C2C12 cell line (which does not show immune inhibitory capacity on T cells proliferation). ESCs were differentiated in the absence of essential growth factor for one month. Undifferentiated ESC and differentiated ESC were lysed and analyzed by western blotting. The samples were ran on a 10% SDS-PAGE gel and transferred to a PVDF membrane. The membrane was probed with anti-MFG-E8 antibody at 1 : 100 followed by probing with secondary HRP conjugated antibody. Bands were visualized by adding HRP substrate. [0065] FIGURE 27 shows results suggesting that ESC-extracts directly inhibit PMA- stimulated T cell proliferation via inhibiting PKC-theta. Purified mouse CD3+ T cells were incubated with 0.30mg/ml of ESC-extracts (B6 mouse) overnight and then the cells were stimulated with 50ng/ml of PMA for the indicated times. PKC-theta activation was detected with rabbit polyclonal antibody specific for phosphorylation of the PKC-theta at threonine- 538 (Santa Cruz Biotechnology Inc.). The data clearly shows that treatment of T cells with B6 ESC-extracts can inhibit the activation of PKC-theta and thereby prevent proper T cell activation and resultant proliferation. This inhibitory effect does not seem to stem from the degradation of PKC-theta but rather the prevention of phosphorylation as total PKC-theta levels stay stable through the time course shown. Moreover, the inhibitory effect of PKC-theta is evident when examining its down stream effector function displayed by degradation of ΙκΒ- α in vehicle treated T cells (V-0 to V-3: vehicle treatment for 0, 1 , 2, and 3 h respectively) compared to a lack of degradation by B6 ESC-extract treated T cells (Ex-0 to Ex-3: B6 ESC- extract treated T cells for 0, 1, 2, and 3 h respectively). Hence, without wishing to be limiting or bound by theory, one or more of the components from the ESC-extracts may be a direct inhibitor of PKC-theta and contribute to inhibition of T cell proliferation.
[0066] FIGURE 28 shows results suggesting ESC-extracts polarize T helper responses towards a regulatory cell type. One way mixed lymphocyte reaction was carried out using one million C57BL/6 splenocytes as responders and one million B6C3F1 splenocytes as stimulators. The cells were treated with 0.23mg/ml-0.30mg/ml of ESC-extracts or vehicle control. Cultures were allowed to proceed for 6h, 8h, and 24h and the cells were harvested and total RNA was isolated (Qiagen Inc.). Total RNA was used to synthesize cDNA and subsequently QPCR was carried out to determine relative levels of IL-2, IFN-gamma, IL-10, TGF-beta and FoxP3 at each time point. The data clearly demonstrate that ESC-extracts skew T helper responses toward a regulatory T cell type by increasing the expression of IL-10, TGF-beta and the transcription factor FoxP3 (specifically expressed by regulatory cells), while concurrently decreasing expression of IL-2 and IFN-gamma. Therefore, ESC-extracts could be a beneficial tool in improving the outcome of transplantation and autoimmune conditions. DETAILED DESCRIPTION
[0067] Human embryonic stem cells (hESCs) are pluripotent stem cells that are isolated from the inner cell mass or blastocysts of the human embryo. They can be readily propagated to 109 cells in vitro without losing pluripotency and differentiated into almost all types of cells, including trophoblast cells. In a preferred embodiment the embryonic stem cells are cultured for 3-7 day, for example a three day, 4 day, 5 day, 6 day or a 7 day culture. Preferably, the cells are derived from a 5 -day culture.
[0068] The present inventors have shown that cell-extracts from hESCs have immune modulatory capacity, strongly repressing mixed lymphocyte reaction and development of costimulatory molecules. The hESC extracts strongly inhibit alloantigen-induced lymphocyte proliferation and repress monocyte differentiation and maturation into DCs. Moreover, the hESC extracts are capable of blocking the expression of costimulatory molecule CD80 during the differentiation and maturation of human monocytes into DCs. Such inhibitory activity was independent of the hESC lines and individual donors, since identical results were obtained when using hESC extracts from different hESC lines (Hl-male; H9-female; CA1- Canadian cell line, male), and peripheral blood mononuclear cells (PBMC) from different individuals. In addition, the inventors have found that it is the protein/peptide components from the hESCs that, at least in part, play a key role in immune modulation. This was deduced from digestion and denaturation studies wherein (i) proteinase digestion, but not digestion with DNase, abolished bioactivity, and (ii) procedures known to denature proteins reduced biological activity of the hESC extract.
[0069] The present inventors have also shown in vivo using a mouse GVDH model that mice transplanted with allogeneic bone marrow cells and spleen cells pre-cultured with mouse ESC extract showed less severity or absence of GVHD. As such, both in vitro and in vivo data are provided which support the immune modulatory activity of the hESC extracts described herein, and which further shows that the hESC extracts can be used to treat or alleviate autoimmune diseases such as GVHD, RA (adult and juvenile forms), multiple sclerosis, systemic lupus erythematosus (SLE), Scleroderma, Sjogren's syndrome, Guillain-Barre syndrome, Type I diabetes, Graves disease, Celiac disease, Addison's disease, ulcerative colitis, psoriasis and Crohn's disease.
[0070] Accordingly, a soluble hESC extract having immune modulatory activity is provided herein. The described extract preserves the immune modulatory capacity of intact hESCs, but circumvents the disadvantages of using whole stem cells in a cell-based therapy. For instance, the use of a soluble hESC extract avoids the risk of tumor (teratoma) formation associated with transplantation of undifferentiated intact hESCs, and the logistic difficulties of preparing, transporting and storing live cells.
[0071] Due to the activity of the protein/peptide components in the extract, these extracts are also referred to herein as "STEM-peptide" or "STEP -pep". The term "STEM-pep" represents the peptides/proteins and other biological components extracted from the stem cells.
[0072] Stem cells utilized for preparation of cell extracts as described herein, or "STEM-pep", include but are not restricted to stem cells of human, horse, dog, cat, rat, or mouse origin.
[0073] Cell extracts as described herein may also be prepared from different stem cell sources, including but not limited to embryonic stem cells (ESCs), differentiated hESCs, hESC-derived trophoblasts, other pluripotent stem cells (derived from fetal origin or not, capable of generating all three germ layers), differentiated pluripotent stem cells with various growth factors, induced human pluripotent stem cells (iPS; reprogrammed human adult cells), mesenchymal stem cells (MSCs), or combinations thereof. It is also envisioned that such cell extracts may include extracts of hESCs in combination with an extract of a different stem cell source, such as differentiated hESCs, hESC-derived trophoblasts, other pluripotent stem cells (derived from fetal origin or not, capable of generating all three germ layers), differentiated pluripotent stem cells with various growth factors, induced human pluripotent stem cells (iPS; reprogrammed human adult cells), mesenchymal stem cells (MSCs), or combinations thereof.
[0074] The cell extracts described herein have been shown to be stable and retain activity over a period of several months, and are tolerant to at least 3-4 freeze-thaw cycles without significant loss of bioactivity. As a result, pharmaceutical compositions comprising cell extracts as described herein can be prepared which have acceptable storage and stability properties.
[0075] The described pharmaceutical compositions may include the described active component, or cell extract, together with an acceptable carrier or excipient, or together with one or more separate active agents or drugs as part of a pharmaceutical combination. In addition, the pharmaceutical compositions may be administered in a treatment regime with other drugs or pharmaceutical compositions, either separately or in a combined formulation or combination.
[0076] Such compositions will preferably be formulated with a vehicle pharmaceutically acceptable for administration to a subject, preferably a human, in need thereof. Methods of formulation for such compositions are well known in the art and taught in standard reference texts such as Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985. A composition may comprise a single compound, or a combination thereof.
[0077] Compositions of the present invention may be administered alone or in combination with a second drug or agent.
[0078] Formulations expected to be useful in the present invention, e.g., injectable formulations including intravenous formulations, may include, but are not limited to, sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the
extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the composition preferably is sterile and fluid to the extent that easy syringability exists. It preferably is stable under the conditions of manufacture and storage and preferably is preserved against the contaminating action of microorganisms such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and oils (e.g. vegetable oil). The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants.
[0079] Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In some cases, it will be preferable to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions can be brought about by including an agent in the composition that delays absorption, for example, aluminum monostearate or gelatin.
[0080] Sterile injectable solutions can be prepared by incorporating the composition in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the composition into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yield a powder, optionally plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0081] Suspensions, in addition to the active agent or cell extract as described herein, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, and mixtures thereof.
[0082] Accordingly, the described compositions can be administered to a subject, preferably a mammal, more preferably a human, to treat and/or prevent disease. The compositions may be administered by various routes including, but not limited to, intravenously, intramuscularly, intraperitoneally, subcutaneously, intracardially, orally and nasally. The formulation and route of administration as well as the dose and frequency of administration can be selected routinely by those skilled in the art based upon the severity of the condition being treated, as well as patient-specific factors such as age, weight and the like.
[0083] One skilled in the art recognizes that interspecies pharmacokinetic scaling can be used to study the underlining similarities (and differences) in drug disposition among species, to predict drug disposition in an untested species, to define pharmacokinetic equivalence in various species, and to design dosage regimens for experimental animal models, as discussed in Mordenti, Man versus Beast: Pharmacokinetic Scaling in Mammals, 1028, Journal of Pharmaceutical Sciences, Vol. 75, No. 1 1, November 1986.
[0084] The described cell extracts and compositions can be used to induce and/or enhance immune tolerance, to prevent or alleviate transplant rejection (including but not limited to allograft rejection), to modulate immune responses in subjects with allergies and/or hypersensitivity, or to treat or alleviate autoimmune diseases such as chronic GVH.D, RA, multiple sclerosis, systemic lupus erythematosus (SLE), and Crohn's disease.
[0085] Without wishing to be limiting in any way, allergies and/or hypersensitivity may refer to any allergy, including but not limited to food and environmental allergies, or a
hypersensitivity disease, and may further refer to diseases or disorders such as asthma and anaphylaxis.
[0086] As a non-limiting example of a use or method of using the cell extracts described herein for preventing or ameliorating transplant rejection, it is envisioned that differentiated cells, such as neural cells, islet cells, muscle cells and the like, from the same human embryonic stem cells and induced human pluripotent stem cells, can be co-transplanted together with a cell extract or composition as described herein to induce or increase immune acceptance of the transplanted cells. As a non-limiting example, the immune system can be primed with a cell extract or composition as described herein prior to injecting differentiated cells to reduce immune rejection. In a further non-limiting example, a cell extract or composition as described herein can also be administered after transplantation of
differentiated cells from pluripotent stem cells to reduce immune rejection. [0087] The cell extracts and compositions described herein can also be administered in vitro to educate or program a subject's immune cells. The educated or programmed immune cells treated in this way can then be returned back to the subject to correct an immune disorder, such as to induce and/or enhance immune tolerance, prevent or alleviate transplant rejection, modulate immune responses in subjects with allergies and/or hypersensitivity, or treat or alleviate an autoimmune disease.
[0088] The cell extracts described herein can also be administered in vitro to adult stem cells and/or progenitor cells, or directly to a subject in need thereof, for in vitro or in vivo expansion of the adult stem/progenitor cells.
[0089] In addition to the therapeutic purposes noted above, the cell extracts and compositions described herein can also be used as a broad immunosuppressive enhancer and significantly reduce the dosage and/or increase treatment efficacy of immunosuppressive drugs.
Accordingly, combinations of the cell extracts and compositions described herein with known immunosuppressive drugs are further provided. Non-limiting examples of such
immunosuppressive drugs include: calcineurin inhibitors such as cyclosporin and tacrolimus; mammalian target of rapamycin (mTOR) inhibitors such as sirolimus; interferons such as
IFN-β; TNF binding proteins such as infliximab (Remicade ), etanercept (Enbrel ), and adalimumab (Humira™); IL-2 receptor antibodies such as basiliximab (Simulect™) and daclizumab (Zenapax™); T-cell receptor antibodies such as OKT3 (muromonab); cytostatics such as the alkylating agents (including cyclophosphamide, nitrosoureas, and platinum compounds), antimetabolites (including methotrexate, azathioprine and mercaptopurine), and cytotoxic antibiotics (including dactinomycin, anthracyclines, mitomycin C, bleomycin and mithramycin); and glucocorticoids such as prednisone, methylprednisolone and
hydrocortisone. Cis-platinum, also known as cisplatin and commercially under the brand name Platinol™, is one non-limiting example of a platinum compound as described above. A combination of the cell extracts and compositions described herein with known
immunosuppressive drugs may comprise a single formulation with two or more active components, or two separately packaged compositions for use in a combination therapy. [0090] Methods for treating a subject in a combination therapy are further provided, comprising administering the cell extract or composition as described herein together with an immunosuppressive drug, for instance but not limited to one or more of the
immunosuppressive drugs described above. Administration of the cell extract or composition and immunosuppressive drug may be simultaneous or sequential, and may be via the same or different administrative route. The combination therapy may be for inducing and/or enhancing immune tolerance, preventing or alleviating transplant rejection, modulating immune responses in subjects with allergies and/or hypersensitivity, or treating or alleviating autoimmune diseases such as but without being limited to GVHD, RA, multiple sclerosis, systemic lupus erythematosus (SLE), and Crohn's disease.
[0091] In an embodiment, the hESCs may be grown in a feeder-free cell culture system or chemically defined medium in the absence of proteins from non-human species, which has the advantage of avoiding xenogenic cells (such as mouse embryonic fibroblast cells)
contaminating the culture and the possibility of severe immune responses in vivo against xeno-origin cells. The media used to grow the hESCs may, however, be conditioned by feeder cells, and in such embodiments would therefore contain xeno-derived proteins in the culture medium.
[0092] In one exemplary embodiment, which is provided for illustration purposes only, the cells are grown on Matrigel™ coated plates for 3 to 7 days. This incubation period may vary, however, depending on the cell lines and conditions used. Commonly used culturing techniques and reagents may be used in order to obtain sufficient cells for preparing a cell extract. Preferably, the medium will be changed every day when colonies achieve >50% confluence and every two days <50% confluence. Further, short-term treatment of hESCs with GSK-3 inhibitor BIO alone or together with tyrosine kinase inhibitor PP2 and Genistein (6-12 hours depending on cell conditions) significantly improves culture quality and yields more live cells by 2 to 10-folds. [0093] A non-limiting example of a protocol for preparing a cell extract as defined herein is as follows:
1) Treat cells (l~10xl06 cells) with 0.5 mL collagenase IV for 5 minutes.
2) Remove collagenase IV and wash cells twice with 1 - 2 mL of room temperature
phosphate buffered saline (PBS).
3) Add 0.5 mL of cell dissociation buffer (chelating agents from Invitrogen) or 4mM
EDTA for 5 minutes.
4) Suspend the cells in 2 mL ice cold PBS and wash by centrifuging at 400 x g, 6 minutes at 4 °C.
5) Re-suspend in 2mL of ice cold lysis buffer and wash again, centrifuging at 400 x g, 6 minutes at 4 °C.
6) Determine cell viability using trypan blue exclusion test according to known
procedures, (viability will typically be between 85% to 90%).
7) Re-suspend cells in 2 volumes of lysis buffer (described in further detail below) and leave on ice for 30 minutes.
8) Sonicate the cells at 40% power 4 times for 10 seconds each using a tip sonicator (2mm diameter). In between sonicating steps the tubes are placed on ice for 15 to 20 seconds.
9) Clear cell lysate by centrifuging at 15,000 x g for 15 minutes at 4 °C (this step will clear cell membrane, mitochondria and nuclear fractions which sediment at these speeds).
10) Collect supernatant, which can be used fresh or flash frozen, e.g. in nitrogen, dry ice or the like, and stored at -80 °C to -20 °C for future use.
11) If needed, a further centrifugation of the supernatant at 50,000 x g for 60 min at 4 °C.
This step will fractionate micosome or multivesiclular endosome that contain the significant immune modulatory components.
[0094] Cell extracts prepared as described herein, for instance using the above-defined method, can retain their activity for at least up to 3 months when stored at -80°C. This includes 2 to 4 cycles of freeze and thaw on ice.
[0095] Other cell extraction methods may also be used and are intended to be included herein. For instance, cells may be lysed using methods other than sonication, such as by freeze-thaw, mechanical lysis using a pressure cell (e.g. French™ press), detergent solubilization, and other cell lysis methods. [0096] The cell extracts described herein may also be further separated and purified, for instance using but without being limited to techniques such as applied differential
centrifugation, affinity column purification, size exclusion purification, particle exclusion filtration (or even exclusion of pieces of membrane) and the like. In a non-limiting embodiment of the invention, the cell extracts may be separated by molecular weight size such as by size exclusion filtration, chromatography, dialysis or the like. Molecular weight ranges may be selected, for example, including a broad size range of about 500 Da to about 500 kDa, and further including smaller increments including up to approximately 1,000 Da, 2,000 Da, 5,000 Da, 10 kDa, 20 kDa, 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, 100 kDa, 125 kDa, 150 kDa, 175 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, 450 kDa, and 500 kDa. Separation of molecular species may also be undertaken using intervening size increments between the stated ranges. In an embodiment of the present invention, which is not meant to be limiting in any manner, the extract or composition comprises components between 500Da and 500 kDa. Other embodiments may comprise compositions of greater than 500D, greater than 1, 2, 5, 7.5, 10, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 kDa, or within the ranges defined by, for example, lkDa to 500 kDa, 5 kDa to 500 kDa, 7.5kDa to 500 kDa, 10 kDa to 500 kDa, or any range defined by any two of the values identified herein or any values therein between.
[0097] The extract clarification step can be undertaken using most known methods, including varied centrifugation speeds and run times. For instance, the centrifugation may be carried out at speeds ranging from about 10,000 x g to 50,000 x g, for approximately 10 minutes to 60 minutes or even longer depending upon factors such as starting cell mass, specific centrifuge parameters and tubes used, and other factors known to those skilled in the art. However, centrifugation of the cell extracts at 15,000 x g for about 15 minutes has been shown to work well and was chosen as literature indicates that these speeds will sediment cell membrane, mitochondria and nuclear fractions.
[0098] The lysis buffer as described above will typically include an aqueous solution of a buffer, a salt, a chelating agent, a reducing agent and protease inhibitors. The pH of the lysis buffer may range from approximately 6.5 to 8.5, more preferably from 7.5 to 8.5. In a preferred embodiment, the pH of the lysis buffer is about 8.2. Without wishing to be limiting in any manner, the pH may be maintained using a physiologically acceptable buffer such as HEPES or Tris-HCl. The concentration of the buffer in solution may range from
approximately lOmM to lOOmM, more preferably from lOmM to 60mM. In a preferred embodiment, the buffer is HEPES at a concentration of about 50 mM. The salt may be any physiologically acceptable salt such as NaCl, MgCl2, KC1, LaCl3, or CaCl2. The concentration of the salt in solution may range from approximately O.lmM to lOOOmM, more preferably from ImM to lOOmM. In a preferred embodiment, the salt is NaCl at a concentration of about 50 mM. The selected reducing agent should also be acceptable for use in physiological conditions at the concentrations used, salt such as one or a combination of the following non- limiting examples: dithiothreitol (DTT), 2-mercaptoethanol (2 -ME), GSSG, GSH, or
Glutathione. The concentration of the reducing agent in solution may range from
approximately O.lmM to lOmM, more preferably from 0.5mM to 5mM. In a preferred embodiment, the reducing agent is DTT at a concentration of about 1 mM. A physiologically acceptable chelating agent is also preferable for use in the lysis buffer, such as one or a combination of ethylenediaminetetraacetic acid (EDTA) and ethylene glycol tetraacetic acid (EGTA). The concentration of the chelating agent in solution may range from approximately O.lmM to 200mM, more preferably from ImM to lOOmM. In an embodiment, the chelating agent is EDTA at a concentration of up to about 100 mM, most preferably at a concentration of about 1 mM. The protease inhibitors used in the lysis buffer will advantageously include a cocktail of protease inhibitors useful to inhibit proteolysis of a range of proteases. Such protease inhibitor cocktails are commercially available and include, without limitation, Complete Protease Inhibitor Tablets available from Roche Diagnostics, and SigmaFast™ Protease Inhibitor Tablets available from Sigma-Aldrich. Alternatively, it is also envisioned that one or more individual protease inhibitors can be selected and used based on the common knowledge and skill of those experienced in the art, including but not limited to leupeptin serine proteases, cysteine proteases, metalloproteases and aspartic acid proteases. The concentration of the protease inhibitors in solution may range from approximately 0.1 uM to ImM, more preferably from 0.1 uM to 200uM.
[0099] In a preferred embodiment, a protein stabilizer is added to the above-described lysis buffer. One or a combination of the following non-limiting examples including L-arginine, glycerol, sucrose (or other sugars), β-lactamase, acetone acetamide, surfactants, Tween™80, Tween™20, Tween™40, polymers, L-glutamine, and L-lysine, can be added to the lysis buffer to suppress protein aggregation in the cell extract. In an especially preferred
embodiment, the protein stabilizer is L-arginine at a concentration of up to about 500mM, most preferably at a concentration of about 50mM.
Definitions:
[00100] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[00101] The term "effective amount" means that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal, or human that is being sought, for instance, by a researcher or clinician. Furthermore, the term
"therapeutically effective amount" means any amount which, as compared to a corresponding subject who has not received such amount, results in improved treatment, healing, prevention, or amelioration of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder. The term also includes within its scope amounts effective to enhance normal physiological function.
[00102] A "pharmaceutical agent" or "drug" refers to a chemical compound or composition capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject.
[00103] The term "stem cell" as used herein refers to a cell that is capable of differentiating into a number of final, differentiated cell types. Stem cells may be totipotent, pluripotent and multipotent cells. Totipotent stem cells typically have the capacity to develop into any cell type. Totipotent stem cells are usually embryonic in origin. Pluripotent stem cells include embryonic stem cells and induced pluripotent stem cells. Embryonic stem cells are derived from the inner cell mass of an early embryo. The induced pluripotent stem cells are generated by programming adult cells with transcriptional factors. Pluripotent stem cells are capable of differentiating into almost any type of tissues. Multipotent stem cells are derived from adult tissues, one of the following non-limiting examples, mesenchymal stromal/stem cells. Pluripotent and multipotent stem cells can originate from various tissue or organ systems, including, but not limited to, blood, nerve, muscle, skin, gut, bone, kidney, liver, pancreas, thymus, and the like. In accordance with the present invention, the stem cell is derived from an adult or neonatal tissue or organ.
[00104] The terms "proliferation" and "expansion" as used interchangeably herein with reference to cells, refer to an increase in the number of cells of the same type by division.
[00105] The term "differentiation," as used herein, refers to a developmental process whereby cells become specialized for a particular function, for example, where cells acquire one or more morphological characteristics and/or functions different from that of the initial cell type. The term "differentiation" includes both lineage commitment and terminal differentiation processes. Differentiation may be assessed, for example, by monitoring the presence or absence of lineage markers, using immunohistochemistry, flow cytometry or other procedures known to a worker skilled in the art. Differentiated progeny cells derived from progenitor cells may be, but are not necessarily, related to the same germ layer or tissue as the source tissue of the stem cells. For example, neural progenitor cells and muscle progenitor cells can differentiate into hematopoietic cell lineages.
[00106] "Naturally occurring," as used herein in reference to an object, indicates that the object can be found in nature. For example, a naturally occurring polypeptide or polynucleotide sequence would be one that is present in an organism, and can be isolated from the organism and which has not been intentionally modified by man in the laboratory. [00107] As used herein, the term "about" refers to a +1-5% variation from the nominal value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to.
[00108] In an embodiment of the present invention it is also contemplated that the stem cell extracts or compositions described herein and throughout do not comprise one or more compounds, for example, but not limited to a detergent such as, but not limited to cationic detergents, anionic detergents, ethoxylates, SDS, Tween, Triton (XI 00, XI 14 and others), and Brij, CHAPS, DOC, CBT, NP-40, glycosides (octyl-thioglucoside, maltosides and others), alcohols such as ethanol, methanol, propanol, t-butanol and others, certain reducing agents, for example, but not limited to beta-mercaptoethanol, dithiothreitol, dithioerythritol, exogenously added transgenes, vectors or nucleotide sequences to stem cells before, after or during culture, cytokines, antibiotics, antibacterial agents such as, but not limited to parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like, solvents such as, but not limited to glycerol, propylene glycol, liquid polyethylene glycol and the like, oils, pentane, petroleum ether, hexane, heptane, diethyl amine, diethyl ether, triethyl amine, tert-butyl methyl ether, cyclohexane, tert-butyl alcohol, isopropanol, acetonitrile, ethanol, acetone, methanol, methyl isobutyl ketone, isobutyl alcohol, 1 -propanol, methyl ethyl ketone, 2-butanol, isoamyl alcohol, 1 -butanol, diethyl ketone, 1-octanol, p-xylene, m-xylene, toluene, dimethoxyethane, benzene, butyl acetate, 1-chlorobutane, tetrahydrofuran, ethyl acetate, o-xylene, hexamethylphosphorus triamide, 2-ethoxyethyl ether, N,N-dimethylacetamide, diethylene glycol dimethyl ether, N,N- dimethylformamide, 2-methoxyethanol, pyridine, propanoic acid, water, 2-methoxyethyl acetate, benzonitrile, 1 -Methyl-2-pyrrolidinone, hexamethylphosphoramide, 1 ,4-dioxane, acetic acid, acetic anhydride, dimethyl sulfoxide, chlorobenzene, deuterium oxide, ethylene glycol, diethylene glycol, propylene carbonate, formic acid, 1 ,2-dichloroethane, glycerine, carbon disulfide, 1 ,2-dichlorobenzene, methylene chloride, nitromethane, 2,2,2- trifluoroethanol, chloroform, 1 ,1 ,2-trichlorotrifluoroethane, carbon tetrachloride, and tetrachloroethylene, polyalcohols such as mannitol, sorbitol, and glycerol, sugars such as, but not limited to glucose, sucrose, enzymes inhibitors such as GSK inhibitor Bio, PP2, genestein, serine protease inhibitors, cysteine protease inhibitors, metalloprotease inhibitors, aspartic acid protease inhibitors, buffers such as Hepes, Tris-HCl, and BIS-TRIS, cell fractionation or density gradient media including, but not limited to Percol, Ficol, cesium chloride, sucrose, and glycerol, and antibodies.
[00109] Other chemistry terms employed herein are used according to conventional usage in the art, as exemplified by The McGraw Hill Dictionary of Chemical Terms (ed. Parker, S., 1985), McGraw Hill, San Francisco.
EXPERIMENTS:
Maintenance of undifferentiated human embryonic stem cells
[00110] Undifferentiated hESCs were maintained either under the feeder- free (Wang L, et al. Immunity 2004; 21 :31-41) or defined culture conditions (Wang L, et al. Blood
2005;105:4598-4603). As shown in Fig. 1, the hESCs were characterized by Flow cytometry (a), immunocytochemistry (b, c) and teratoma formation (d-g). Undifferentiated hESCs express surface markers SSEA-4, Tra-1-60, Tra-1-81, and intracellular marker Oct3/4 (a, first peak of each panel representing the isotype antibody control), Nanog (b, red; inset, isotype control), and E-cadherin (c, green) and AP (c, red). After injection of those hESCs into the testis capsule, all NOD/SCID mice produced teratomas 6 weeks post inoculation (n = 4). Haematoxylin and eosin staining of the teratoma sections revealed that the tumors were composed of a mixture of well-differentiated tissues representing all 3 embryonic germ layers, including ectoderm (d. neural rosette), mesoderm (e. cartilage, f. bone) and endoderm (g. gutlike glands with goblet cells). Bars represent 10 μπι.
[001 11 ] Since the hESCs are maintained in the absence of cytokines, serum, feeder- cells and antibiotics, the immune modulation observed of the STEM-pep extract is unlikely to be caused by these exogenous "contaminants". The immune modulation of STEM-pep is also unlikely to be caused by endogenous cytokines (in particular IL-10 and TGF-β, known to suppress immune cells) from hESC-extracts because hESCs lack cytokine gene expression (see Table 1). Even using the most sensitive quantitative PCR, IL-10 gene expression was not detected in the hESCs.
Table 1. Cytokine gene expression of undifferentiated human embryonic stem cells
Genes Expression GB p values
Interleukin 1-alpha Absence M 15329.1 0.726
Interleukin 1-beta Absence M 15330 0.398
Interleukin 1-beta Absence NM 000576.1 0.432
Interleukin 1 receptor, type I Absence NM_000877.1 0.304
Interleukin 1 receptor, type II Absence NM_004633.1 0.829 lnterleukin-1 receptor accessory protein Absence AF167343.1 0.696
Interleukin 1 receptor accessory protein Absence NM 002182.1 0.666
Interleukin 1 receptor accessory protein-like 2 Absence NMJ317416.1 0.366 lnterleukin-1 super-family 1 Absence NM_014440.1 0.568
Soluble interleukin-1 receptor accessory protein Absence AF167343.1 0.696
Interleukin 1-beta converting enzyme isoform epsilon Absence U 3700.1 0.981
Interleukin 1 receptor-like 1 Absence NM_003856.1 0.726
Interleukin 1 receptor-like 2 Absence NM_003854.1 0.601 lnterleukin-1 receptor antagonist homolog 1 Absence AF216693 0.726
Interleukin 2 Absence NM_000586.1 0.696 lnterleukin-2 receptor Absence K03122.1 0.304
Interleukin 2 receptor, alpha Absence NM 000417.1 0.726
Interleukin 2 receptor, beta P NM_000878.1 0.046
Interleukin 2 receptor, gamma Absence NM_000206.1 0.171
Interleukin 3 Absence NM_000588.1 0.905
Interleukin 3 receptor, alpha (low affinity) Absence NM 002183.1 0.976
Interleukin 4 Absence NM_000589.1 0.568
Interleukin 4 receptor Absence NM_000418.1 0.171
Interleukin 5 Absence NM_000879.1 0.534
Interleukin 5 receptor, alpha Absence NM 000564.1 0.781
Interleukin 5 receptor alpha-subunit Absence M96651.1 0.171
Interleukin 6 receptor Absence NM_000565.1 0.399
Interleukin 7 Absence NM_000880.1 0.870
Interleukin 7 receptor Absence NM_002185.1 0.500
Interleukin 8 Absence NM_000584.1 0.870
Interleukin 8 receptor, alpha Absence NM_000634.1 0.534
Interleukin 8 receptor, beta Absence NM 001557.1 0.696
Interleukin 9 Absence NM_000590.1 0.399
Interleukin 9 receptor Absence NMJ 02186.1 0.829
Interleukin 10 Absence NM_000572.1 0.246
Interleukin 10 receptor, alpha Absence NM 001558.1 0.466
Interleukin 11 Absence NM_000641.1 0.726
Interleukin 11 Absence M57765.1 0.601
Interleukin 11 receptor, alpha Absence NM_004512.1 0.601
Interleukin 12A (natural killer cell stimulatory factor 1) Absence NM 000882.1 0.634
Note: Total RNA was extracted from three different batches of undifferentiated human embryonic stem cells using the QIAGEN RNAeasy kit and was amplified using aRNA kit (Ambion). Antisense RNA was used for hybridizing human HGU133AB arrays (Affymetrix, Inc.). GeneSpring 6.0 was used for data analysis. Genes that were flag-passed in at least one of the populations and significantly (p < 0.05) differentially expressed were considered presence. Absence = not significantly expressed, P = presence. Table 1. Cytokine gene expression of undifferentiated human embryonic stem cells (continue)
Genes Expression GB p values
Interleukin 12B (natural killer cell stimulatory factor 2) Absence N 002187.1 0.274
Interleukin 12 receptor, beta 1 Absence NM_005535.1 0.666
Interleukin 12 receptor, beta 2 Absence NM 001559.1 0.696
Interleukin 13 Absence NM 002188.1 0.666
Interleukin 13 receptor, alpha 2 Absence NM_000640.1 0.976
Interleukin 15 Absence NM 000585.1 0.466
Interleukin 15 receptor, alpha Absence NM 002189.1 0.666
Interleukin 16 Absence NM_004513.1 0.056
Interleukin 17 Absence NM 002190.1 0.399
Interleukin 17 receptor P NM 014339.1 0.019
Interleukin 17B Absence NM 014443.1 0.970
Interleukin 17B receptor Absence NM 018725.1 0.195
Interleukin 17E Absence NM 022789.1 0.568
Interleukin 18 (interferon-gamma-inducing factor) Absence NM 001562.1 0.304
Interleukin 18 receptor 1 Absence NM_003855.1 0.634
Interleukin 18 receptor accessory protein Absence NM 003853.1 0.274
Interleukin 18 binding protein Absence NM 005699.1 0.534
Interleukin 19 Absence NM_013371.1 0.568
Interleukin 20 receptor, alpha Absence NM 014432.1 0.466
Interleukin 21 Absence NM 021803.1 0.366
Interleukin 21 receptor Absence NM_021798.1 0.829
Interleukin 22 Absence NM 020525.1 0.195
Interleukin 22 receptor Absence NM 021258.1 0.081
Interferon, alpha 1 Absence NMJD24013.1 0.944
Interferon, alpha 4 Absence NM 014354.1 0.568
Interferon, alpha 5 Absence NM 002169.1 0.274
Interferon, alpha 6 Absence NM 021002.1 0.726
Interferon, alpha 8 Absence NM_002170.1 0.726
Interferon, alpha 10 Absence NM 002171.1 0.195
Interferon, alpha 13 Absence NM 006900.2 0.432
Interferon, alpha 14 Absence NM_002172.1 0.246
Interferon (alpha, beta and omega) receptor 1 Absence NM 000629.1 0.304
Interferon (alpha, beta and omega) receptor 2 Absence NM 000874.1 0.195
Interferon, beta 1 Absence NM_002176.1 0.976
Interferon-gamma Absence M29383.1 0.366
Interferon gamma receptor 1 P NM 000234.1 0.046
Interferon gamma receptor 2 P NM 005534.1 0.019
Interferon, omega 1 Absence NM 002177.1 0.666
Transforming growth factor-beta Absence M60316.1 0.246
Transforming growth factor, beta 2 (TGF-beta2 Absence NM_003238.1 0.245
Human transforming growth factor-beta 3 (TGF-beta3) Absence J03241.1 0.112
Tumor necrosis factor alpha Absence NM 021980.1 0.171
Granulocyte-colony stimulating factor Absence NM_000759.1 0.996
Granulocyte-colony stimulating factor receptor Absence NM 000760.1 0.500
Macrop age-colony stimulating factor Absence NM 000757.1 0.366
Granulocyte-Macrophage-colony stimulating factor Absence M11734.1 0.399
Granulocyte-Macrophage-colony stimulating factor Absence AV7561 1/BC00 0.304 receptor 2635.1 Immune-modulatory capacity of cell extracts in vitro:
[00112] As can be seen from Fig. 2, STEM-pep markedly suppresses the alloantigen- induced T cell proliferation in mixed lymphocyte reaction cultures. Undesired T cell activation and proliferation is a key factor in transplant rejection and autoimmune diseases.
[00113] STEM-pep also significantly inhibits the differentiation and maturation of dendritic cells (DC) from monocytes. DCs are central to mounting an effective adaptive immune response or tolerance depending on their maturation conditions. Mature DCs (high expression of CD80, CD86, HLA-DR and CD83) induce a full T cell response, leading to both cytotoxic and humoral immune activation. In contrast, immature DC (low expression of the aforementioned markers) induces T cell anergy and immune tolerance. STEM-pep prepared from hESCs was capable of suppressing the differentiation and maturation of DCs from human monocytes, which was indicated by reduced specific gene expression (Fig. 3), morphological changes (Fig. 4 A&B), non-expression of costimulatory molecule CD80 (Fig. 4 C&D), and poor expression of maturation marker CD83 and antigen presentation molecule HLA-DR (Fig. 5 A&B). Importantly, these DCs educated by STEM-pep become poor stimulators of allogeneic T cells (Fig. 5 C&D). These results suggest that inhibition of dendritic cell maturation by STEM-pep will skew the immune response towards a status of low response or tolerance.
[00114] It was further confirmed that immune regulatory activity of hESC-extracts is not caused by TGF-β because TGF-β neutralizing antibody did not show any effect on the immune modulation of hESC-extracts. Moreover, as a control, human embryonic fibroblast cells did not show any immune modulatory potency and induced the differentiation and maturation of dendritic cells instead (Fig 3).
[00115] Immune modulatory capacity of STEM-pep was also shown to be independent of hESC lines and individual donors. Identical results were obtained when using cell-extracts from different hESC lines (HI -male, H9-female) and various donors' peripheral blood mononuclear cells (PBMC) (Fig. 6 A&B). These results suggest that STE -pep from different hESC lines can be used in different individuals for immune modulation.
In vivo studies in a mouse model of GVHD:
[00116] In vivo studies suggest that STEM-pep alleviates GVHD. As demonstrated in Fig. 7, mice transplanted with allogeneic bone marrow cells and spleen cells that have been pre-treated with STEM-pep show reduced severity of GVHD based on the observations of reduced body weight loss (A) and overall GVDH scores (B) of treated mice.
[001 17] Using STEM-pep to improve immune tolerance following allogeneic blood and marrow transplantation has great potential for significant clinical benefit in these vulnerable patients with leukemia, lymphoma and bone marrow failure syndromes. Improvements in immune modulation to treat graft versus host disease, in particular, could limit the use of immunosuppressive medications that are otherwise required. Calcineurin inhibitors and corticosteroids are associated with numerous damaging side effects which limits their utility in the treatment of GVHD, and thus alternate treatments such as with the cell extracts and compositions described herein, alone or in combination with other drugs, are particularly desirable.
Immune suppressive potential of MSC extracts:
[00118] STEM-pep derived from hESCs showed a stronger potency than cell-extracts from MSCs (Fig. 8 A), while differentiated human embryonic fibroblast cells did not show any effects (Fig. 3). This suggests that immunomodulatory potency of STEM-pep may associate with ontogeny: pluripotent cells (hESCs or induced pluripotent stem cells) > multipotent cells (MSCs) > unipotent cells (fibroblast cells).
Mechanism of immune function modulation:
[00119] Given inherent similarities between hESCs (derived from 5-day human embryo/fetus) and fetal antigens, it was hypothesized that hESC-extracts may modulate immune functions via mechanisms that mimic matemal-fetal tolerance. For instance, hESC- extracts induced FoxP3 gene expression in the mixed lymphocyte reaction (Fig. 9 A), suggesting a possible polarization and/or induction of regulatory T cells
(CD4+CD25+FoxP3+ T lymphocytes). Regulatory T lymphocytes can prevent or cure autoimmune diseases and allograft rejection, by restoring immune tolerance to self antigens or alloantigens.
[00120] Further, hESCs express genes of programmed death receptor and its ligand, PDL-1 (B7-H1) and PDL-2 (B7-DC), and these genes are further up-regulated after differentiation into trophoblast-like cells with BMP4 (bone morphogenetic protein 4) (Fig. 9 B&C). PDL-1 and PDL-2 have been shown to be crucial for maintaining immune tolerance. The immune modulatory compound of STEM-pep may therefore include programmed death receptor, PDL-1 and PDL-2.
Personalized tailoring of immune modulation:
[00121 ] Human blood leucocytes can be reprogrammed into induced pluripotent stem (iPS) cells. The strategy used for reprogramming the cells with four transcription factors is shown in Fig. 10 (A). Colonies of the treated iPS cells were observed over time using light microscopy. At 38 days post reprogramming (B), the reprogrammed colony switches to anchorage-dependent growing. The colony attaches to the plate and shows typical morphology of human embryonic stem cells. Some round-like floating cells can also be seen, which are non-reprogramrned blood leukocytes. At 43 days post reprogramming (C), the reprogrammed colony proliferates after 5 days of culture, showing similar proliferative rate to that of human embryonic stem cells. The third passage of the reprogrammed colonies can be seen (Fig. 10 D and E) at day 1 and day 3 after reseeding. The reprogrammed cells are also shown to be positive (red, Fig. 10 F) for alkaline phosphatase staining, one of the most reliable parameters used for the characterization of undifferentiated human embryonic stem cells and induced pluripotent stem cells. In contrast, under the same culture conditions, non- reprogrammed blood leukocytes show a typical sphere morphology and adhesion-independent proliferation, devoid of alkaline phosphatase staining (Fig. 10 G).
[00122] Specific patient-tailored immune modulation can therefore be achieved by using STEM-pep prepared from reprogrammed patient's iPS cells. This is particularly advantageous since, while STEM-pep prepared from third party hESCs (i.e. T cells, hESC and DCs are from three different individuals) may induce non-specific immune suppression or modulation, STEM-pep prepared from iPS (either from donor or recipient) may specifically assist in reshaping a destructive alloimmune and autoimmune response to a state of anergy or tolerance, and alleviating transplantation rejection and autoimmune diseases.
Enhancer effects with immunosuppressive drugs
[00123] Current immunosuppressive drugs used in the clinic are associated with various severe side-effects, such as organ toxicity, opportunistic infection and cancer. As shown in Fig. 1 1 A, STEM-Pep can be used to reduce the dosage of immune suppressive drugs.
[00124] ESC-extracts were tested in combination with low dose of calcineurin inhibitor cyclosporin, a drug commonly used in the clinic to prevent organ rejection. Mixed lymphocyte reactions were carried with 1 x 105 responder (CD1 mouse) and stimulator (B6 mouse) splenocytes and treated with either vehicle alone, vehicle in combination with 20 ng/ml of cyclosporine, mouse ESC-extract (from B6 mouse) in combination with 20 ng/ml of cyclosporine or mouse ESC-extract alone. MLR were allowed to proceed for 3 days and 3H was added for an additional 16 to 18 hours. Cell proliferation is displayed as mean counts per minute of triplicate wells ± SD. Data are representative of two independent experiments.
[00125] These studies suggest that STEM-pep can be used as a broad
immunosuppressive enhancer. High dose immunoablative therapy followed by autologous hematopoietic stem cell transplantation is gaining acceptance in the treatment of advanced refractory autoimmune diseases such as multiple sclerosis, systemic lupus erythematosus and Crohn's disease. However, the treatment is associated with transplant-related toxicity and the risk of death, which could be obviated through the use of STEM-pep. Because STEM-pep exerts its immune modulatory function through different mechanisms from
immunosuppressive drugs (see below), it can be used complementarily as an immune modulatory supplement and act synergistically to increase treatment efficacy.
Potential signaling pathways for immune modulation of STEM-pep
[00126] In the experiments shown in Fig. 10 (B), human T cells were positively selected using anti-CD3 labeled magnetic beads. Subsequently 1.0 x 105 cells were stimulated with PMA (5.0ng/ml) or Ionomycin (2 μΜ) in the presence or absence of hESC-extract. The cells were allowed to proliferate for 3 days and pulsed with tritiated thymidine for an additional 16 to 18 hours. Cell proliferation is displayed as mean counts per minute of triplicate wells ± SD. Results are representative of four independent experiments. In Fig. 10 (C) human embryonic stem cell-extracts are shown to inhibit human mixed lymphocyte reaction independent of calcium pathway, and to work synergistically with calcium channel inhibitors. Calcium channel inhibitors KN-95 and SKF were used alone or in combination with human embryonic stem cell extracts from H9 cell line (H9, 3 g proteins/μΐ). In combination with 20 μΜ of SKF, hESC-extracts suppress mixed lymphocyte reaction in a synergistic manner by improving suppression by 100 fold and 10 fold compared to hESC-extract and SKF alone respectively. These data suggest that ESC-extract can be used to compliment current clinical drugs through inhibiting calcium channel. R + S: responder + stimulator. In Fig. 10 (D) similar results obtained from mouse ESC-extracts. R + S:
responder lymphocyte + stimulator lymphocyte. B6 2μ1: 2μ1 of ESC-extracts from B6 mouse ES cells. These data are representative of two independent experiments.
[00127] Of many potential signaling pathways, it was found that Protein Kinase C is a determinant pathway in STEM-pep-regulated T cell suppression. As noted, STEM-pep inhibits PMA-induced proliferation of purified CD3+ T cells (both human and mouse; Fig. 11 B). PMA has been well defined as a specific stimulator of Protein Kinase C. Protein Kinase C has been actively investigated in both pharmaceutical industry and academic laboratories as a validated drug target for treating immune disorders.
[00128] STEM-pep (both from human and mouse ESCs) also exerts its immune modulatory function independent of calcium and works synergistically with calcineurin inhibitory drugs. In combination with the calcineurin inhibitor cyclosporine (Fig. 11 A) or calcium channel inhibitors (Fig. 11 C&D), STEM-pep dramatically suppresses mixed lymphocyte reaction. These results suggest that STEM-pep can be used complementarily with calcium inhibitory drugs to regulate immune cells.
Bioactive components of STEM-pep
[00129] In the above experiments, it was observed that the immune modulatory capacity of STEP -Pep was directly proportional to the protein/peptide concentration of STEM-pep (e.g. see Fig. 4 vs. Fig. 6). The most effective concentration of the extracts to suppress mixed lymphocyte reactions was between 0.075mg/ml and 0.30mg/ml of STEM-pep (final concentration in MLR assays regardless of starting concentration). Although <
0.075mg/ml of concentrations still exhibit inhibitory effects in MLR, higher concentrations further inhibit MLR. Therefore, yet without wishing to be limiting in any way, an effective in vitro dosage to inhibit immune activation should be >0.075mg/ml. In general, higher concentrations may result in better inhibitory results.
[00130] To further explore the nature of the bioactive components in the STEM-Pep extracts, digestion experiments were undertaken using proteinase K and RNAse. As shown in Fig. 12, treatment of STEM-Pep extracts with proteinase K but not RNase abrogates immune modulatory activity. This suggests that the bioactive component(s) of the extracts are, at least in part, peptide-based or proteinaceous.
Cell culture conditions [00131 ] To develop a culture system free of animal-components for clinical application of hESC-extract, we maintained hESCs in a chemically-defined medium (DF/12 culture medium supplemented with B27 components, 120ng/ml human basic fibroblast growth factor or other agents) with brief (<12 hours every 4 days) but not constant inhibition of tyrosine kinase and GSK-3 with two inhibitors. These two inhibitors are Genestine (or PP2) and 6- bromoindirubin-3'-oxime. Addition of these two inhibitors to the culture also enables the better maintenance of hESCs.
[00132] Variation of the culture conditions (such as serum withdrawal, exposure to some cytokines and growth factors) may also be useful to change the STEM-Pep composition and augment its immune modulatory capacity.
Cell extraction methods:
[00133] As discussed in more detail above, various protocols for preparing stem cell extracts are possible. However, in the current experiments cell extracts were prepared according to the schematic protocol outlined in Fig. 13 and further described as follows:
1) Treat cells with 0.5 mL collagenase IV for 5min.
2) Remove collagenase IV and wash cells twice with 1-2 mL of room temperature PBS.
3) Add 0.5 mL of cell dissociation buffer (chelating agents from Invitrogen) for 5 minutes.
4) Suspend the cells with 2 mL ice cold PBS and wash by spinning 400 x g, 6 minutes at 4 °C.
5) Re-suspend in 2 mL of ice cold lysis buffer and wash again, 400 x g, 6 minutes at 4°C.
6) Determine viability of the cells at this stage using trypan blue. (Usually viability is 85% to 90%).
7) Resuspend cells in 2 volumes of lysis buffer (containing protease inhibitors) and leave on ice for 30 minutes. 8) Sonicate the cells with tip sonicator (2 mm diameter).
9) Clear lysate by centrifuging at 15,000 x g for 15 minutes at 4 °C (to clear cell membrane, mitochondria and nuclear fractions which sediment at these speeds).
[00134] Supernatants can be prepared fresh for experiment, or flash frozen in nitrogen or dry ice and stored at -20 to-80 °C for future use. Sonication was carried out at 40 % power, 4 times for 10 seconds each. In between sonication the tubes were placed on ice for 15 to 20 seconds. Importantly, sonication should be carried out in a fashion which results in lysis of the cells and even nuclei of the cells without causing denaturation of cellular proteins.
[00135] Water soluble components in the supernatant fractions, which are mainly derived from the cytoplasmic components of the cells, contain the immune modulatory capacity. This is evident, for instance, from the results of Fig. 2-4 in which the water soluble supernatant was used. These water soluble components also strongly suppress dendritic cell maturation and lymphocyte proliferation as demonstrated in Fig 3.
[00136] The supernatant is also stable at -80 °C to -20 °C over months, and tolerates up to 3 -cycles of freeze- thaw without noticeable loss of bioactivities. With fewer freeze-thaw cycles, it can be stored even longer in the freezer. The data shown in Figs. 2 and 3 were generated using supernatant fraction stored in a freezer for a period of 3 months and frozen- thawed for 3 times. Formation of precipitates after freeze-thaw was not observed. These properties make the water soluble components of STEM-pep suitable for potential clinical use via commonly available drug delivery systems.
[00137] The water insoluble precipitates seem to have immune modulatory potency different from the supernatant fraction. For instance, water insoluble precipitates exhibited greater potency in the inhibition of co-stimulatory molecule (CD80) expression during dendritic cell differentiation and maturation (Fig. 6C), while water soluble STEM-pep showed greater potency in the suppression of mixed lymphocyte reaction (Fig 2 and data not shown). Therefore, the two fractions may be used in specific disease or transplant states for the selective modulation of DC or T cell functions. [00138] While the above extraction protocol has been demonstrated to be effective, variations thereto are possible. For instance, different methods of cell lysis may be used. For instance, Fig. 14 shows that the immune suppressive potential of mESC extract (per milligram protein) prepared by sonication is approximately the same as mESC extract prepared using freeze-thaw lysis. The protein concentration in the experiments was normalized between the mESC sonication and mESC freeze-thaw extracts. However, approximately half the amount of extract was yielded using the freeze-thaw method when compared to lysis by sonication. These results indicate that sonication procedure can yield 2-fold higher protein content than freeze-thaw technique, although with the addition of the same amount of protein both techniques show similar immune suppressive potential. Therefore, regardless of the method used, the extraction protocol should result in lysis, preferably but not limited to complete lysis of the whole cells including cell nuclei, without causing denaturation of cellular proteins.
Lysis Buffer Variations:
[00139] The lysis buffer used in the above experiments typically includes, in aqueous solution, 50 mM HEPES, 50 mM NaCl, lOOmM EDTA, ImM DTT and protease inhibitors. However, as shown in Fig. 15, modifications to the lysis buffer can be made with improved results.
[00140] For instance, a non-specific effect was found in the above described buffer formulation that can be seen between the two volumes of vehicle tested in Fig. 15 (A), and also in Fig. 2. This non-specific effect was essentially eliminated by adjusting the
concentration of the chelating agent, EDTA, from 100 mM to 1 mM. The reduced nonspecific effect can be seen from the three vehicle volumes (V2) tested in Fig. 15 (B), which exhibit no apparent titratable effect at the volumes tested.
[00141] It was also found that the lysis buffer could be further improved by adding L- arginine, which enhances the solubility and stability of the components of the stem cell extract. Using the above-described lysis buffer, with 1 mM EDTA instead of 100 mM EDTA to reduce the non-specific effect, the specific effect of the stem cell extract was more pronounced when L-arginine was added to the lysis buffer. As seen in Fig. 15 (B), mESC extract prepared with this vehicle (V2) reduces the non-specific effect from EDTA and confirms that the specific effect of the stem cell extract is maintained in lysis buffer containing 1 mM EDTA and 50mM L-arginine by mixed lymphocyte reaction. The concentration of L-arginine can broadly range from ImM to 1M. In a preferred embodiment, the pH will range between 6.5 to 8.5 where L-arginine has been observed to be most effective in preserving protein stability and preventing protein aggregation.
[00142] Addition of L-arginine is therefore desirable to increase protein solubility, and to reduce protein-protein interaction and dimer formation. It also stabilizes the STEM-pep preparation and preserves immune regulatory capacity. Reducing the calcium chelator concentration from 100 mM to 1 mM EDTA further reduces the non-specific interference from EDTA.
[00143] Example: Human Embryonic Stem Cell Extracts Inhibit Differentiation and Function of Monocyte Derived Dendritic Cells
[00144] The results obtained from experiments shown in the following Example is illustrated by Figures 16-on.
[00145] Cells and Mice
[00146] Human ESC lines HI and H9 were obtained from Wicell. The CA1 cell line was a gift from Dr. Nagy (University of Toronto, Toronto Ontario, Canada). Mouse ESC C57BL/6 cell line was obtained from ATCC. Mouse strains C57BL/6, B6C3F1, Balb/c and CDl (10 to 12 weeks old) were obtained from Charles River Laboratories, Montreal Canada. All hESC lines were used with the approval of the local Ethics Board and the Stem Cell Oversight Committee of the Canadian Institutes for Health Research. Animals were maintained at the University of Ottawa (Ottawa Ontario, Canada) in accordance with the Canadian Council on Animal Care guidelines under protocols approved by the Animal Use Subcommittee at our Institution. [00147] Preparation of ESC Extracts
[00148] Human ESC lines HI, H9, and CA1 were cultured on plates coated with
Matrigel (BD Biosciences Canada Inc., Mississauga ON) in mouse embryonic fibroblast (MEF) conditioned medium supplemented with 8.0ng/mL of human basic fibroblast growth factor (bFGF, Invitrogen Canada Inc., Burlington ON). hESCs were incubated at 37°C with 5.0% C02 (Wang, et al. Biophysical journal 98:2442-2451 ; Jezierski, et al. Stem cells 28:247- 257 both of which are hereby incorporated by reference in their entirity). Upon reaching confluence, the cells were harvested by treatment with collagenase IV (Invitrogen) followed by cell dissociation buffer (Invitrogen) to obtain a single cell suspension. Subsequently, hESCs were washed twice with ice cold PBS and centrifuged at 400g for 6 minutes at 4°C. After washing, the cells were re-suspended in lysis buffer, 50mM HEPES, 50mNaCl, 1.OmM EDTA, l.OmM DTT, 5 OmM L-arginine, pH 8.2. The lysis buffer was supplemented with pan protease inhibitors at 1 :100, (4-(2-aminoethyl) benzenesulfonyl fluoride (AEBSF), pepstatinA, E-64, bestatin, leupeptin, and aprotinin) dissolved in DMSO, Sigma Aldrich Canada Ltd, Oakvile ON). At this point the cells were incubated on ice for 30 minutes and sonicated until the cells were completely lysed. The sonicated cells were centrifuged at 15000g for 15 minutes at 4°C to remove cell membrane, mitochondrial and nuclear fractions. The soluble cell-free fraction was separated from the insoluble fraction and both stored at -80°C. Protein concentration was determined using Bio-Rad Protein assay kit (Bio-Rad Laboratories Ltd. Mississauga ON).
[00149] Mouse ESC extraction
[00150] Mouse ES lines Jl and B6 were grown on mitomycin treated mouse embryonic fibroblast (MEF) cells in Dulbecco's modified eagle Medium (DMEM) containing 4.0mM L- glutamine, 1.0% non-essential amino acids, Ο.ΙΟμΜ 2-mercaptoethanol, l .OxlO2 units of Penicillin, l .OxlO2 units of Streptomycin and 15% FBS (Invitrogen Inc.) supplemented with l .OxlO3 units/mL of LIF (Millipore Canada Ltd., Etobicoke ON) and incubated at 37°C with 5.0% C02. Subsequently, the cells were cultured on 0.10% gelatin coated plates for two passages in order to eliminate MEF cells. Cell extraction was carried out as described for hESCs.
[00151] Mixed Lymphocyte Reaction (MLR)
[00152] Healthy volunteers' donor blood was collected in heparin-coated tubes (BD
Biosciences Inc.) and mixed 1 :1 with Ca+ and Mg+ free PBS. Subsequently, the blood was gently layered on top of Ficoll Paque (BD Biosciences Inc.) and tubes were spun at 400g for 30 minutes at room temperature with the brakes off. PBMCs were isolated from the buffy coat and washed 3 times with PBS. One-way MLR were carried out with 1.0 x 105 PBMC responder and stimulator cells in 96 well U bottom plates using RPMI media (10% FBS, l .OxlO2 units of Penicillin, l .OxlO2 units of Streptomycin, 2.0mM L-glutamine). The stimulator cells were pre-treated with 50μg/mL of mitomycin C for 40 minutes at 37°C prior to MLR. The cells were allowed to proliferate for 5 days and 1.Ομθϊ tritiated thymidine (GE- Amersham Canada Inc., Baie D'Urfe Quebec) was added to the culture for an additional 16 to 18 hours. The cells were harvested on to 96 well filters-mats (Wallac Inc., Turku Finland) using a TomTec harvester. Tritium uptake was determined by liquid scintillation using a Wallac 1450 Microbeta Plus liquid scintillation counter (Wallac Inc.). Results are displayed as counts per minute (CPM) of triplicate wells ± SD.
[00153] Mouse MLR
[00154] Mouse spleens were removed aseptically and gently homogenized with the frosted ends of two sterile microscope slides and passed through a 45 μηι mesh filter. The cells were washed twice with PBS and red blood cells were removed by Ficoll centrifugation or ACK red blood cell lysis buffer (Cederlane Laboratories Ltd. Burlington ON). One-way MRL were carried out with 1.0 x 105 splenocytes from both responder and stimulator cells in 96 well U bottom plates. Stimulator cells were pre-treated with 50μg/mL of mitomycin C for 40 minutes at 37°C prior to MLR. The cells were allowed to proliferate for 3 days and tritium uptake was determined as described for human MLR. Results are displayed as counts per minute (CPM) of triplicate wells ± SD. [00155] Monocyte to Dendritic Cell Maturation
[00156] Monocytes were isolated from peripheral blood by CD 14 negative selection using magnetic labeling based kits (StemCell Technologies Inc., Vancouver Canada) according to manufacturer protocols (Purity was >90% for CD 14 marker). Five hundred thousand purified monocytes were cultured in 24 well plates with 0.50ml of RPMI medium containing 5.0x102 units/mL of granulocyte macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4) for 6 days to differentiate monocytes to immature DCs. On day 0, the cells also received either 0.15mg mL (final concentration) of HI hESC extract, L-132 fibroblast control extract, or equivalent volume of vehicle. Media was changed on days 2, 4, and 6 by removing 0.20ml of spent media and adding 0.30ml new medium with fresh GM- CSF and IL-4. Along with the media change, the cells received 0.075mg/mL of hESC extract, L-132 (a fibroblast cell line) extract or vehicle. On day 6, in addition to GM-CSF and IL-4, the cells also received TNF-a (20ng/mL final concentration) to induce maturation.
[00157] Phagocytosis Assay
[00158] Monocyte to dendritic cell maturation was carried out as described in the previous section. Cells were harvested on day 6 or day 8 by vigorous pipetting followed by scraping with the pipette tip. The cells were washed twice with PBS and re-suspended in eppendorf tubes with PBS containing 1.0% FBS. At this point the cells received lmg/mL of dextran-FITC beads (40,000 MW) (Sigma Aldrich, Canada Ltd.) and placed at 37°C or on ice as a control for 90 minutes. At the end of incubation period the cells were washed twice with PBS containing 1.0% FBS and 0.10% sodium azide to inhibit further phagocytosis.
Subsequently, the cells were analyzed with Beckman Coulter FC500 flow cytometer
(Beckman Coulter Canada Inc. Mississauga ON).
[00159] Allogeneic T Cell Proliferation Induced by ESC extract-treated DCs
[00160] Purified T cells were obtained by positive selection using a magnetic labeling kit against CD3 (StemCell Technologies Inc.) according to manufacturer instructions (Purity was >95% for CD3 marker). Subsequently, 1.0 x 105 purified CD3+ cells were incubated with hESC extract-treated or fibroblast extract-treated DCs for 3 days. DCs were treated with 50μ£/πι]^ of mitomycin C for 40min prior to incubation with T cells. On day 3, Ι.ΟμΟί of tritium was added to the culture for an additional 16 to 1.8 hours and the cells were harvested and tritium uptake was determined as described for human MLR.
[00161] QPCR
[00162] RNA was isolated using Qiagen RNeasy Mini Kit (Qiagen Canada Inc.
Mississauga ON) according to manufacturer instructions. Subsequently, cDNA was synthesized using Qiagen QuantiTech Reverse Transcription kit (Qiagen) according to manufacturer instructions. QPCR was carried out with iQ SYBR Green Supermix (Bio-Rad Laboratories Ltd.) and My iQ-iCycler (Bio-Rad Laboratories Inc.) using TGF-β forward primer 5 ' GC AAC AATTCCTGGCGAT ACC (SEQ ID NO:7), reverse 5'
AGTTCTTCTCCGTGGCTGA (SEQ ID NO:8) and IL-10 forward primer
5'CACCGGACTCCTTTAACAACAA (SEQ ID NO:9) and reverse primer
5 ' GAGATGCCTC AGC AGAGTG (SEQ ID NO: 10).
[00163] TGF-β Neutralization of hESC extract
[00164] Pan anti TGF-β antibody (R&D Systems Inc.) was added to hESC extract at a concentration of 20μg/mL. The extracts were incubated with the antibody for two hours at 4°C. The extracts were subsequently used in one-way MLR and compared to extract treated with isotype antibody.
[00165] Proteinase K and RNAse A Treatment of ESC extract
[00166] ESC extracts were treated with 0.1 Omg/mL of proteinase K for 24 hours at
37°C, or with ^g/mL of RNAse A for 2 hours at 37°C. A murine MLR was performed in the presence or absence of proteinase K or RNAse treated ESC extract to compare the effect of these extracts on immune activation. B6 splenocytes (responders) were suspended in serum free RPMI media at l .OxlO6 cells/mL and stained with 5.0μΜ of carboxyfluorescein diacetate succinimidyl ester (CFSE) for 40 minutes at 37°C. The labeled responders were washed 3 times with PBS and 1.0 x 105 cells were incubated with 1.0 x 105 Balb/c stimulators in triplicate. MLR were allowed to proceed for 4 days and the triplicate wells were combined in one eppendorf tube and washed with PBS. CFSE dilution was detected by flow cytometry.
[00167] Flow Cytometry Analysis
[00168] Fluorophore-conjugated antibodies against CD80, CD83, CD86, and HLA-DR (BD Bioscience Inc.) were used. Cells were washed with PBS and incubated in 10% human serum for 15 minutes for the blocking step. Subsequently the cells were stained with the indicated antibodies for 30 minutes on ice and washed twice prior to analysis with Beckman Coulter FC500 flow cytometer (Beckman Coulter Canada Inc.).
[00169] IL- 12p40 ELISA assay
[00170] Supematants during monocyte to dendritic cell differentiation and maturation were collected on day 6 and day 8 and stored at -20°C. IL-12p40 was detected using two separate monoclonal antibodies (mAb) specific for different epitopes. Plates were coated overnight at 4°C with the first antibody (R&D Systems Inc., Minneapolis MN), 4^g/mL, in coating buffer (0.040 M Ν¾0Ο3, 0.060 M NaHC03, pH 9.6). The plates were washed 6 times with washing buffer (0.050% Tween 20 in PBS). Blocking was carried out with 10% FCS in PBS for 2 hours in room temperature followed by 6 washes. Samples were diluted 1 :5 in RPMI and ΙΟΟμΙ was added to each well. Incubation was allowed to proceed for two hours at room temperature and the plates were washed 6 times. The second biotinylated mAb anti-IL- 12p40 antibody (Biosource-Invitrogen Canada Inc., Burlington ON) was added at 0.35μg/mL for two hours at room temperature. Once again the plates were washed 6 times and streptavidin peroxidase conjugate (l ^g/mL in PBS containing 10% FCS, Jackson
ImmunoResearch Laboratories Inc., West Grove PA) was added for 30 minutes. The plates were washed 6 times and o-phenylenediamine (Sigma- Aldrich) was added for 30 minutes at room temperature in the dark. The reaction was stopped using 1.ON HC1 and absorbance was measured at 450nm. Sensitivity of assay was 16 pg/mL. Standard curve was prepared with rIL-12p40 (R&D Systems Inc.).
[00171] Detection of human IL-10 and TGF-β by quantative Flowcytomix assay
[00172] Supernatants during monocyte to dendritic cell differentiation and maturation were collected on day 6 and day 8 and stored at -20°C. Subsequently 25 μΐ of supernatant from each indicated treatments was used to detect IL-10 or TGF-β using detection kits (Bender Medsystems Inc., San Diego CA) according to manufacturers' instructions. IL-10 sensitivity is 1.9pg/mL and TGF-β sensitivity lOpg/mL. Detection was carried out using Beckman Coulter FC500 flow cytometer. Flowcytomix Pro 2.3 software was used to analyse results.
[00173] Statistical Analysis
[00174] Statistical significance was determined using a Student's t-test, ANOVA or chi-square wherever appropriate. Results were considered significant when P < 0.05.
[00175] RESULTS
[00176] Human and Murine ESC Extract Inhibit Allogeneic Immune Response
[00177] ESCs derived from humans, mice or rats have been shown to inhibit the PBMC proliferation in one-way allogeneic MLR. We sought to determine whether cellular extracts derived from ESCs retain these immune modulatory properties. The addition of soluble hESC extract to the MLR significantly suppressed the PBMC proliferation compared to vehicle control (p = 0.0005, Figure 16a). These results were reproduced using murine C57BL/6- derived ESC extracts. One-way allogeneic MLR were carried out with B6 splenocytes (responders) and B6C3F1 splenocytes (stimulators). Similar to hESC extracts, mESC extracts were able to prevent proliferation of splenocytes in a dose dependent manner compared to vehicle controls (p = 0.01, Figure 16b). Notably, the inhibitory effect was not due to cell death since PBMCs treated with hESC extracts on day 6 of one-way MLR showed a similar amount of dead cells compared to those treated with vehicle control (Figure 16c). However, cell cycle analysis following MLR demonstrated fewer cells entering S phase and an increase in the number of cells entering G2/M phase after treatment with hESC extracts, suggesting a block in the cell cycle at G2. Hence, these findings suggest that cellular extracts from both human and mouse ESCs retain the immune modulatory properties of whole cells. Importantly, the above results were also reproducible using different hESC lines (HI, H9, and CA1) and different mESC lines (Jl and C57BL/6) as well as combinations of different PBMCs prepared from various healthy donors and mouse strains (data shown in different figures). It suggests that the immune modulatory properties of ESC extracts are not restricted to a given species, ESC cell line and individual PBMCs. In addition to fibroblast extracts we tested extracts obtained from a variety of different cell types including PBMC and purified T cells and did not find a suppressive effect on MLR assays (data not shown).
[00178] hESC extracts Inhibit the Maturation of Monocyte-derived Dendritic Cells (mDCs)
[00179] Since PBMCs contain both antigen-presenting cells (APC) and effector T cells, we attempted to identify which cell type was affected by ESC extracts during immune activation. We specifically chose to study mDC maturation because they are well recognized as potent APC essential for the initiation of primary immune responses and MLR. Monocytes were isolated from healthy donor PBMCs using negative selection in an effort to avoid activation of these cells. Subsequently, monocytes were grown in GM-CSF and IL-4 for 8 days with media change on days 2, 4, and 6 to replenish the two cytokines. Maturation was induced with TNF-a for the last 2 days. Simultaneously, monocytes also received vehicle, hESC-extracts or fibroblast extracts on days 0, 2, 4, and 6. As shown in Figure 17, treatment with vehicle and fibroblast-extracts resulted in the up-regulation of mDC maturation markers CD80, CD83 and HLA-DR (Figure 17a,b,c). In contrast, mDC treated with hESC extracts did not up-regulate these important maturation markers to the same extent as controls (Figure 17a,b,c). However, we found hESC extracts did not inhibit the surface expression of CD86, and in some cases even slightly increased CD86 expression (Figure 17d). Collectively, our results indicate that hESC extracts may modulate immune activation by inhibiting mDC maturation.
[00180] hESC extract-treated mDCs Retain Phagocytic Function after TNF-a
Treatment
[00181 ] In an attempt to decipher the effect of hESC extracts on the mDC function, we examined phagocytosis on both day 6 and 8, representing immature and mature states of mDC respectively. mDCs treated with hESC extracts and incubated with dextran beads on day 6 exhibited a high phagocytic function, indicative of immature mDCs (Figure 18) . Comparison of phagocytosis to vehicle or control extracts revealed that hESC extract-treated immature DC had a greater capacity to phagocytose the beads. More significantly, analysis of phagocytosis on day 8, TNF-a treatment for 2 days, revealed a much greater phagocytic function for these mDCs treated with hESC extracts than controls. These data suggest that hESC extracts cause mDC to remain in an immature state even after induction of maturation with TNF-a.
[00182] hESC extract-treated mDCs Secrete Lower Levels of IL- 12p40
[00183] In order to further substantiate the above findings we investigated the secretion of IL-12p40, a monomer known to make functional IL-12 and IL-23. IL-12p40 is produced at high levels by mature but not immature mDC to direct the development of Thl cells from naive T cells. We collected supernatants on day 6 and day 8 of monocyte culture and examined the secretion of IL-12p40 by quantitative ELISA assays. On day 6 of culture, very little or no IL-12p40 was detected in any of the supernatants (Figure 19). However, upon maturation with TNF-a (day 8 supernatants), monocyte treated with either vehicle or control extracts throughout the culutre process were found to secrete high levels of IL-12p40. In contrast, supernatants from monocyte cultures treated with hESC extracts contained 8 to 10- fold less IL-12p40. These data futher support the notion that hESC extracts inhibit the full maturation of mDCs. [00184] hESC extracts-treated mDCs Are Poor Stimulators of Allogeneic T Cells
[00185] The maturation state of DCs at the time of antigen presentation have an enormous impact on whether naive T cells become activated, undergo anergy, or become regulatory cells. In an immature state, DCs remain in an antigen-processing mode and express low levels of HLA-DR and co-stimulatory molecules. As a result, they are relatively poor T cell activators. To determine whether hESC extracts-treated mDCs influence effective T cell activation, we incubated TNF-a matured mDCs with purified allogeneic T cells. T cells incubated with mDCs treated with vehicle or fibroblast-extracts showed a strong proliferative response to the allogeneic APC. In contrast, T cells incubated with hESC extract-treated mDC proliferated significanlty less when compared to control mDCs. Hence, hESC extracts impair mDC maturation and renders them as inefficient T cell stimulators.
[00186] IL- 10 and TGF-β Do Not Contribute to hESC extract-mediated Immune Modulation
[00187] To decipher the active component contributing to hESC extracts-mediated immune modulation, we analyzed publicly available microarray databases and found that expression of most cytokines were absent in hESCs. We further determined the expression of IL-10 and TGF-β by sensitive QPCR assays because these two cytokines are well known for their inhibitory effects on immune activation. Examination of hESC lines CA1 and H9 by QPCR revealed a complete absence of IL-10 gene expression and only minor expression of TGF-β mRNA (Figure 20a). Furthermore, assessment of hESC extracts using quantitative Flowcytomix assays did not reveal production of IL-10 nor TGF-β protein above the background levels (data not shown). To completely rule out the role of TGF-β in hESC extract-mediated immune modulation, hESC extracts were treated with 20μg/mL of pan TGF- β neutralizing antibodies. Subsequently, MLR were carried out using TGF-β neutralized and non-neutralized hESC extracts. The results indicated the neutralizing TGF-β antibodies did not have an impact on the hESC extract-mediated MLR inhibition (Figure 20b). In addition, we examined the induction of IL-10 and TGF-β in mDC supernatants treated with vehicle control, hESC extracts, or fibroblast extracts and did not find differences (data not shown). Therefore, hESC extract-mediated immune modulation cannot be attributed to IL-10 and TGF-β and possibly involve other known and novel factors.
[00188] One or more currently preferred embodiments have been described by way of example. It will be apparent to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as defined in the claims.
[00189] References
1. Thomson JA, J Itskovitz-Eldor, SS Shapiro, et al. (1998). Embryonic stem cell lines derived from human blastocysts. Science 282: 1145-1147.
2. Xu RH, X Chen, DS Li, et al. (2002). BMP4 initiates human embryonic stem cell differentiation to trophoblast. Nature biotechnology 20:1261-1264.
3. Carpenter MK, MS Inokuma, J Denham, T Mujtaba, CP Chiu and MS Rao. (2001). Enrichment of neurons and neural precursors from human embryonic stem cells. Experimental neurology 172:383-397.
4. Kaufman DS, ET Hanson, RL Lewis, R Auerbach and JA Thomson. (2001). Hematopoietic colony- forming cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 98:10716-10721.
5. Rambhatla L, CP Chiu, P Kundu, Y Peng and MK Carpenter. (2003). Generation of hepatocyte-like cells from human embryonic stem cells. Cell transplantation 12:1-11.
6. Itskovitz-Eldor J, M Schuldiner, D Karsenti, et al. (2000). Differentiation of human embryonic stem cells into embryoid bodies compromising the three embryonic germ layers. Mol Med 6:88-95.
7. Schuldiner M, O Yanuka, J Itskovitz-Eldor, DA Melton and N Benvenisty. (2000). Effects of eight growth factors on the differentiation of cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 97:11307-11312.
8. Schuldiner M, R Eiges, A Eden, et al. (2001). Induced neuronal differentiation of human embryonic stem cells. Brain research 913:201-205.
9. Reubinoff BE, P Itsykson, T Turetsky, et al. (2001). Neural progenitors from human embryonic stem cells. Nature biotechnology 19:1134-1140.
10. Levenberg S, JS Golub, M Amit, J Itskovitz-Eldor and R Langer. (2002). Endothelial cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 99:4391-4396.
11. Kehat I, D Kenyagin-Karsenti, M Snir, et al. (2001). Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes. J Clin Invest 108:407-414.
12. Martin CH, PS Woll, Z Ni, JC Zuniga-Pflucker and DS Kaufman. (2008). Differences in lymphocyte developmental potential between human embryonic stem cell and umbilical cord blood-derived hematopoietic progenitor cells. Blood 112:2730-2737.
13. Drukker M, G Katz, A Urbach, et al. (2002). Characterization of the expression of MHC proteins in human embryonic stem cells. Proc Natl Acad Sci U S A 99:9864-9869.
14. Li L, ML Baroja, A Majumdar, et al. (2004). Human embryonic stem cells possess immune-privileged properties. Stem Cells 22:448-456.
15. Fandrich F, X Lin, GX Chai, et al. (2002). Preimplantation-stage stem cells induce long-term allogeneic graft acceptance without supplementary host conditioning. Nat Med 8: 171-178.
16. Koch CA, P Geraldes and JL Piatt. (2008). Immunosuppression by embryonic stem cells. Stem Cells 26:89-98.
17. Drukker M, H Katchman, G Katz, et al. (2006). Human embryonic stem cells and their differentiated derivatives are less susceptible to immune rejection than adult cells. Stem Cells 24:221-229.
18. Koch KS, KH Son, R Maehr, et al. (2006). Immune-privileged embryonic Swiss mouse STO and STO cell-derived progenitor cells: major histocompatibility complex and cell differentiation antigen expression patterns resemble those of human embryonic stem cell lines. Immunology 119:98-115.
19. Magliocca JF, IK Held and JS Odorico. (2006). Undifferentiated murine embryonic stem cells cannot induce portal tolerance but may possess immune privilege secondary to reduced major histocompatibility complex antigen expression. Stem cells and development 15:707-717.
20. Robertson NJ, FA Brook, RL Gardner, SP Cobbold, H Waldmann and PJ Fairchild. (2007). Embryonic stem cell-derived tissues are immunogenic but their inherent immune privilege promotes the induction of tolerance. Proc Natl Acad Sci U S A 104:20920-20925.
21. Menard C, AA Hagege, O Agbulut, et al. (2005). Transplantation of cardiac-committed mouse embryonic stem cells to infarcted sheep myocardium: a preclinical study. Lancet 366:1005-1012.
22. Zhang M, B Joseph, S Gupta, et al. (2005). Embryonic mouse STO cell-derived xenografts express hepatocytic functions in the livers of nonimmunosuppressed adult rats. Stem cells 23:186-199.
23. Zhan X, G Dravid, Z Ye, et al. (2004). Functional antigen-presenting leucocytes derived from human embryonic stem cells in vitro. Lancet 364:163-171.
24. Dressel R, J Nolte, L Eisner, et al. (2010). Pluripotent stem cells are highly susceptible targets for syngeneic, allogeneic, and xenogeneic natural killer cells. Faseb J 24:1-14.
25. Berstine EG, ML Hooper, S Grandchamp and B Ephrussi. (1973). Alkaline phosphatase activity in mouse teratoma. Proc Natl Acad Sci U S A 70:3899-3903.
26. Kleinsmith LJ and GB Pierce, Jr. (1964). Multipotentiality of Single Embryonal Carcinoma Cells. Cancer research 24:1544-1551.
27. Solter D, N Skreb and I Damjanov. (1970). Extrauterine growth of mouse egg-cylinders results in malignant teratoma. Nature 227:503-504.
28. Stevens LC. (1970). The development of transplantable teratocarcinomas from intratesticular grafts of pre- and postimplantation mouse embryos. Developmental biology 21:364-382.
29. Amariglio N, A Hirshberg, BW Scheithauer, et al. (2009). Donor-derived brain tumor following neural stem cell transplantation in an ataxia telangiectasia patient. PLoS medicine 6:e 1000029.
30. International, Society, For, Stem, Cell and Research. Guidelines for the Conduct of Human Embryonic Stem Cell Research. (2006). ISSCR Publications.
31. International, Society, For, Stem, Cell and Research. Guidelines for the Clinical Translation of Stem Cells. (2008). ISSCR Publications.
32. Bluestone JA, AW Thomson, EM Shevach and HL Weiner. (2007). What does the future hold for cell- based tolerogenic therapy? Nature Rev Immunol 7:650-654.
33. Li L, BH Wang, S Wang, et al. Individual cell movement, asymmetric colony expansion, rho-associated kinase, and e-cadherin impact the clonogenicity of human embryonic stem cells. Biophysical journal 98:2442- 2451.
34. Li L, S Wang, A Jezierski, et al. A unique interplay between Rapl and E-cadherin in the endocytic pathway regulates self-renewal of human embryonic stem cells. Stem cells 28:247-257.
35. Beyth S, Z Borovsky, D Mevorach, et al. (2005). Human mesenchymal stem cells alter antigen- presenting cell maturation and induce T-cell unresponsiveness. Blood 105:2214-2219.
36. Sallusto F, M Cella, C Danieli and A Lanzavecchia. (1995). Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products. The Journal of experimental medicine 182:389-400.
37. Macatonia SE, NA Hosken, M Litton, et al. (1995). Dendritic cells produce IL-12 and direct the development of Thl cells from naive CD4+ T cells. J Immunol 154:5071-5079.
38. Lutz MB and G Schuler. (2002). Immature, semi-mature and fully mature dendritic cells: which signals induce tolerance or immunity? Trends in immunology 23:445-449.
39. Schwartz RH, DL Mueller, MK Jenkins and H Quill. (1989). T-cell clonal anergy. Cold Spring Harbor symposia on quantitative biology 54 Pt 2:605-610.
40. Zheng Y, CN Manzotti, M Liu, F Burke, KI Mead and DM Sansom. (2004). CD86 and CD80 differentially modulate the suppressive function of human regulatory T cells. J Immunol 172:2778-2784.
41. Yachimovich-Cohen N, S Even-Ram, Y Shufaro, J Rachmilewitz and B Reubinoff. (2009). Human Embryonic Stem Cells Suppress T Cell Responses via Arginase I-Dependent Mechanism. J Immunol: 1300-1308.
42. Nakagawa M, M Koyanagi, K Tanabe, et al. (2008). Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nature biotechnology 26: 101-106.
43. Yu J, MA Vodyanik, K Smuga-Otto, et al. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science 318:1917-1920.
44. Takahashi K, Tanabe, M Ohnuki, et al. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131 :861-872.
45. Yachimovich-Cohen N, S Even-Ram, Y Shufaro, J Rachmilewitz and B Reubinoff. (2009). Human Embryonic Stem Cells Suppress T Cell Responses via Arginase I-Dependent Mechanism. J Immunol.
46. Wang W. (2005). Protein aggregation and its inhibition in biopharmaceutics. Int J Pharm 289: 1-30.
47. Reddy KR, H Lilie, R Rudolph and C Lange. (2005). L-Arginine increases the solubility of unfolded species of hen egg white lysozyme. Protein Sci 14:929-935.
48. Tian R, S Wang, F Elisma, L LI, L Wang and D Figeys. (2010). Rare cell proteomic reactor applied to SILAC based quantitative proteomic study of human embryonic stem cell differentiation. Mol Cell Proteonomics.
All citations are herein incorporated by reference.

Claims

WHAT IS CLAIMED IS:
1. A stem cell extract having immune modulatory activity, said extract prepared by
- culturing stem cells in a feeder-free cell culture system;
- collecting said stem cells and transferring into a cell lysis buffer;
- lysing said stem cells in said cell lysis buffer to produce a lysate; and
- fractionating said lysate into soluble and insoluble fractions,
wherein the stem cell extract comprises said soluble or insoluble fraction.
2. The stem cell extract according to claim 1, wherein the stem cell extract comprises said soluble fraction.
3. The stem cell extract according to claim 1, wherein the stem cells are of human, horse, dog, cat, rat, or mouse origin.
4. The stem cell extract according to claim 1 , wherein at least part of the immune modulatory activity is from protein, polypeptide or peptide components in the extract, or combinations thereof.
5. The stem cell extract according to claim 1 , wherein the extract is prepared from stem cell sources selected from the group consisting of embryonic stem cells (ESCs), differentiated ESCs, ESC-derived trophoblasts, pluripotent stem cells, differentiated pluripotent stem cells, induced human pluripotent stem cells (iPS), mesenchymal stem cells (MSCs), or combinations thereof.
6. The stem cell extract according to claim 1, wherein the stem cells are human embryonic stem cells (hESCs).
7. The stem cell extract according to claim 1, wherein the stem cells are treated with
collagenase IV and washed with phosphate buffered saline (PBS) prior to cell lysis, and wherein the washed stem cells are lysed by sonication.
8. A composition comprising a stem cell extract as defined in claim 1 and an acceptable carrier or excipient.
9. A composition comprising, a) an extract derived from day 3-7 embryonic stem cells, wherein said stem cells are undifferentiated stem cells, and; a-1) wherein said extract is prepared by sonication of said stem cells and clarified by centrifugation to remove cell membrane, mitochondria and nucleus, and wherein said extract is prepared in the absence of an exogenously added detergent; b) one or more salts or buffers; c) a calcium/magnesium chelating agent; d) a thiol reducing agent; e) one or more protease inhibitors, and; f ) optionally, L-arginine.
10. The composition as defined by claim 9, wherein said composition comprises L-arginine and said composition is sterile.
11. The composition as defined by claim 9 wherein said composition is derived from day 5 embryonic stem cells expressing SSEA-4, TRA- 1-60, Tra- 1-81 and OCT 3/4, Nanog, and AP markers.
12. The composition as defined by claim 9 wherein said embryonic stem cells are cultured on a feeder-free cell culture medium.
13. The composition of claim 9, wherein said extract comprises the microsomal fraction of the embryonic stem cells.
PCT/CA2010/001771 2009-11-05 2010-11-05 Stem cell extracts and uses thereof for immune modulation WO2011054100A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US25830009P 2009-11-05 2009-11-05
US61/258,300 2009-11-05

Publications (1)

Publication Number Publication Date
WO2011054100A1 true WO2011054100A1 (en) 2011-05-12

Family

ID=43969526

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2010/001771 WO2011054100A1 (en) 2009-11-05 2010-11-05 Stem cell extracts and uses thereof for immune modulation

Country Status (1)

Country Link
WO (1) WO2011054100A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012068170A3 (en) * 2010-11-15 2012-07-26 Jau-Nan Lee Generation of neural stem cells from human trophoblast stem cells
US8497120B2 (en) 2005-02-24 2013-07-30 Jau-Nan Lee Human trophoblast stem cells and use thereof
US9457053B2 (en) 2012-11-30 2016-10-04 Accelerated Biosciences Corp. Methods of differentiating stem cells by modulating MIR-124
US9808490B2 (en) 2014-11-26 2017-11-07 Accelerated Biosciences Corp. Induced hepatocytes and uses thereof
US10363285B2 (en) * 2015-04-01 2019-07-30 Sanbio, Inc. Methods and compositions for stimulation of cell proliferation and provision of biologically active mixtures of FGF2 isoforms
CN116531485A (en) * 2023-04-11 2023-08-04 陕西朗泰生物科技有限公司 Preparation method of human anti-aging cell substance

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AMIT, A. ET AL.: "Feeder layer- and serum-free culture of human embryonic stem cells.", BIOLOGY OF REPRODUCTION., vol. 70, 2003, pages 837 - 845 *
MOHIB, K. ET AL.: "Human embryonic stem cell extracts inhibit the differentiation and function of monocle-derived dendritic cells.", STEM CELL REVIEWS., vol. 6, 2010, pages 611 - 21 *
RAJASINGH, J. ET AL.: "Cell-Free embryonic stem cell extract mediated derivation of multipotent stem cells from NIH3T3 fibroblasts for functional and anatomical ischemic tissue repair.", CIRC. RES., vol. 102, 2008, pages 107 - 117 *
TARANGER, C. K. ET AL.: "Induction of dedifferentiation, genomewide, transcriptional programming and epigenetic reprogramming by extracts of carcinoma and embryonic stem cells", MOL. BIOL. CELL., vol. 16, 2005, pages 5719 - 5735 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9927426B2 (en) 2005-02-24 2018-03-27 Accelerated Biosciences Corp. Methods of treating diseases with human trophoblast stem cells
US8497120B2 (en) 2005-02-24 2013-07-30 Jau-Nan Lee Human trophoblast stem cells and use thereof
US10983111B2 (en) 2005-02-24 2021-04-20 Accelerated Biosciences Corp. Human trophoblast stem cells and uses thereof
US9335322B2 (en) 2005-02-24 2016-05-10 Accelerated Biosciences Corporation Human trophoblast stem cells and methods of therapeutic screening
US10746728B2 (en) 2005-02-24 2020-08-18 Accelerated Biosciences Corp. Human trophoblast stem cells and uses thereof
GB2502704B (en) * 2010-11-15 2019-12-04 Accelerated Biosciences Corp Generation of neural stem cells from human trophoblast stem cells
US9574173B2 (en) 2010-11-15 2017-02-21 Accelerated Biosciences Corp. Generation of neural stem cells from human trophoblast stem cells
US11891623B2 (en) 2010-11-15 2024-02-06 Accelerated Biosciences Corp. Generation of neural stem cells from human trophoblast stem cells
WO2012068170A3 (en) * 2010-11-15 2012-07-26 Jau-Nan Lee Generation of neural stem cells from human trophoblast stem cells
US11254911B2 (en) 2010-11-15 2022-02-22 Accelerated Biosciences Corp. Generation of neural stem cells from human trophoblast stem cells
GB2502704A (en) * 2010-11-15 2013-12-04 Jau-Nan Lee Generation of neural stem cells from human trophoblast stem cells
US11028366B2 (en) 2012-11-30 2021-06-08 Accelerated Biosciences Corp. Methods of differentiating stem cells by modulating MIR-124
US10294458B2 (en) 2012-11-30 2019-05-21 Accelerated Biosciences Corp. Methods of differentiating stem cells by modulating miR-124
US9457053B2 (en) 2012-11-30 2016-10-04 Accelerated Biosciences Corp. Methods of differentiating stem cells by modulating MIR-124
US11026979B2 (en) 2014-11-26 2021-06-08 Accelerated Biosciences Corp. Human hepatocytes and uses thereof
US9808490B2 (en) 2014-11-26 2017-11-07 Accelerated Biosciences Corp. Induced hepatocytes and uses thereof
US10765704B2 (en) 2014-11-26 2020-09-08 Accelerated Biosciences Corp. Induced hepatocytes and uses thereof
US11406685B2 (en) 2015-04-01 2022-08-09 Sanbio, Inc. Methods and compositions for stimulation of cell proliferation and provision of biologically active mixtures of FGF2 isoforms
US10363285B2 (en) * 2015-04-01 2019-07-30 Sanbio, Inc. Methods and compositions for stimulation of cell proliferation and provision of biologically active mixtures of FGF2 isoforms
CN116531485A (en) * 2023-04-11 2023-08-04 陕西朗泰生物科技有限公司 Preparation method of human anti-aging cell substance

Similar Documents

Publication Publication Date Title
Gao et al. Effects of mesenchymal stem cells from human induced pluripotent stem cells on differentiation, maturation, and function of dendritic cells
JP6526130B2 (en) Mesenchymal stromal cells and related uses
Erkers et al. Decidual stromal cells promote regulatory T cells and suppress alloreactivity in a cell contact-dependent manner
Park et al. Bone morphogenetic protein 4 promotes mammalian oogonial stem cell differentiation via Smad1/5/8 signaling
Shokri et al. Human menstrual blood-derived stromal/stem cells modulate functional features of natural killer cells
KR20180100250A (en) Treatment of immune-related diseases and disorders using amnion derived adherent cells
Liu et al. Human placenta‐derived adherent cells induce tolerogenic immune responses
WO2011054100A1 (en) Stem cell extracts and uses thereof for immune modulation
JP2004521877A (en) Pluripotent stem cell allograft tolerization
Mohib et al. Human embryonic stem cell-extracts inhibit the differentiation and function of monocyte-derived dendritic cells
AU2019256723A1 (en) Method for differentiation of ocular cells and use thereof
AU2015363088A1 (en) Treatment of retinal degeneration using progenitor cells
WO2018220489A2 (en) Methods of obtaining cells from human postpartum umbilical cord arterial tissue
CA2964229C (en) Tolerogenic dendritic cells, methods of producing the same, and uses thereof
Cismaru et al. Isolation and characterization of a fetal-maternal microchimeric stem cell population in maternal hair follicles long after parturition
Mohib et al. Embryonic stem cell-derived factors inhibit T effector activation and induce T regulatory cells by suppressing PKC-θ activation
Urrutia et al. Overexpression of Glutamate Decarboxylase in mesenchymal stem cells enhances their immunosuppressive properties and increases GABA and nitric oxide levels
Wu et al. Comparative global immune-related gene profiling of somatic cells, human pluripotent stem cells and their derivatives: implication for human lymphocyte proliferation
US20160158293A1 (en) Treatment of Ocular Conditions Using Progenitor Cells
Kyurkchiev et al. Stem cells in the reproductive system
EP2598632A1 (en) Isolation of pluri potent stem cells from amniotic fluid and use thereof in the treatment or prevention of autoimmune diseases
WO2018114469A1 (en) In vitro cellular co-culture method to induce immunological tolerance
JP2022551103A (en) Bone marrow mesenchymal stem cell-derived cell population and its preparation method
US20220202868A1 (en) Improved stem cell populations for allogeneic therapy
Qarin The immunogenicity of embryonic stem cell-derived midbrain dopaminergic progenitors and its implications as a therapy to treat patients with Parkinson’s Disease

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10827764

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10827764

Country of ref document: EP

Kind code of ref document: A1