WO2011053636A1 - Procédés de traitement de troubles psychiatriques ou neurologiques avec des antagonistes mglur - Google Patents

Procédés de traitement de troubles psychiatriques ou neurologiques avec des antagonistes mglur Download PDF

Info

Publication number
WO2011053636A1
WO2011053636A1 PCT/US2010/054260 US2010054260W WO2011053636A1 WO 2011053636 A1 WO2011053636 A1 WO 2011053636A1 US 2010054260 W US2010054260 W US 2010054260W WO 2011053636 A1 WO2011053636 A1 WO 2011053636A1
Authority
WO
WIPO (PCT)
Prior art keywords
methyl
antagonist
disorder
disease
mglurl
Prior art date
Application number
PCT/US2010/054260
Other languages
English (en)
Inventor
Joseph Buxbaum
Takeshi Sakurai
Ozlem Bozdagi
Original Assignee
Mount Sinai School Of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mount Sinai School Of Medicine filed Critical Mount Sinai School Of Medicine
Priority to US13/504,847 priority Critical patent/US20130225623A1/en
Publication of WO2011053636A1 publication Critical patent/WO2011053636A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia

Definitions

  • the present invention is related to methods for treating a psychiatric or neurological disease or disorder using a composition containing an mGluR5 antagonist in combination with an mGluRl antagonist.
  • the methods of the invention are directed to treating a patient having a disease or disorder associated with a cytoplasmic FMRP interacting protein 1 (CYFIPl) gene change.
  • the disease or disorder is Fragile X syndrome (FXS), wherein the CYFIPl -binding protein called Fragile X mental retardation protein (FMRP) is directly involved, an autism spectrum disorder, schizophrenia, Prader-Willi syndrome, or Angelman syndrome.
  • the transmission of nerve impulses at the synapse is controlled by the interaction between a neurotransmitter released by a sending neuron and a surface receptor on a receiving neuron, causing excitation or inhibition of this receiving neuron.
  • the ability of the synapse to change in strength is known as synaptic plasticity.
  • L-Glutamate the most abundant neurotransmitter in the CNS, mediates the major excitatory pathway in mammals, and is referred to as an excitatory amino acid (EAA).
  • EAA excitatory amino acid
  • L-glutamate stimulates protein synthesis in neurons, which is required for several different forms of synaptic plasticity.
  • EAA receptors See Watkins & Evans, Annual Reviews in Pharmacology and Toxicology, 21 : 165 (1981), Monaghan, Bridges, and Cotman, Annual Reviews in Pharmacology and Toxicology, 29: 365 (1989); Watkins, Krogsgaard-Larsen, and Honore, Transactions in Pharmaceutical Science, 11 : 25 (1990).
  • EAA receptors are classified into two general types. Receptors that are directly coupled to the opening of cation channels in the cell membrane of the neurons are termed "ionotropic.” This type of receptor has been subdivided into at least three classes, which are defined by the depolarizing actions of the selective agonists N-methyl-D-aspartate (NMD A), a- amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA), and kainic acid (KA). Five kainate receptors, classified as either high affinity (KAl and KA2) or low affinity (GluR5, GluR6 and GluR7) kainate receptors have been identified. See Bleakman et al., Molecular Pharmacology, 1996, Vol. 49, No. 4, pp. 581-585.
  • the second general type of receptor is the G-protein or second messenger-linked
  • mGluRs metabotropic glutamate receptors
  • Group I receptors (mGluRl and mGluR5) have been shown to be coupled to stimulation of phospholipase C resulting in phosphoinositide hydrolysis and elevation of intracellular Ca ++ levels, and, in some expression systems, to modulation of ion channels, such as K + channels, Ca + channels, non-selective cation channels, or NMDA receptors.
  • Group II receptors mGluR2 and mGluR3
  • Group III receptors mGluRs 4, 6, 7, and 8
  • mGluRs2 and mGluR3 are negatively coupled to adenylcyclase and have been shown to couple to inhibition of cAMP formation when heterologously expressed in mammalian cells, and to G-protein-activated inward rectifying potassium channels in Xenopus oocytes and in unipolar brush cells in the cerebellum.
  • mGluR6 which is essentially only expressed in the retina
  • the mGluR5 are widely expressed throughout the central nervous system.
  • EAA receptors Both types appear not only to mediate normal synaptic transmission along excitatory pathways, but also participate in the modification of synaptic connections during development and throughout life. See, Schoepp, Bockaert, and Sladeczek, Trends in Pharmacological Science, 11 : 508 (1990); McDonald and Johnson, Brain Research Reviews, 15: 41 (1990).
  • CYFIP1 Cytoplasmic FMRP interacting protein 1
  • FMRP Frragile X mental retardation protein
  • CYFIPI has a direct role in a process that is disrupted in FXS, as CYFIPI interacts with FMRP (Schenck et al., 2001).
  • the focus on altered functioning of mGluR has been called the mGluR hypothesis in FXS and is reflected in enhanced hippocampal (mGluR-dependent) LTD ("mGluR-LTD") in Fmrl knockout mice with the later stages of LTD no longer showing the same requirement for protein synthesis (as the normal control on protein synthesis mediated by FMRP is lost).
  • CYFIPI can directly bind to the translation initiation factor eIF4E and, like FMRP, negatively regulates FMRP target mRNAs (Napoli et al., 2008). Stimulation of neurons was shown to cause the dissociation of CYFIPI from eIF4E at synapses, resulting in protein synthesis, thus providing a mechanism for the activity-dependent regulation of translation seen with FMRl and CYFIPI .
  • the present invention provides methods for treating a patient having a disease or disorder associated with a cytoplasmic FMRP interacting protein 1 (CYFIPI) gene change, which includes the steps of: identifying a patient in need of such treatment and administering to said patient an effective amount for treating said disease or disorder of a composition including an mGluR5 antagonist and an mGluRl antagonist.
  • CYFIPI cytoplasmic FMRP interacting protein 1
  • the present invention provides a medicament and/or other composition comprising an mGluR5 antagonist and/or an mGluRl antagonist for use in treating a disease or disorder associated with a cytoplasmic FMRP interacting protein 1 (CYFIP1) gene change, wherein the medicament and/or other composition is administered to a patient in an effective amount for treating said disease or disorder.
  • CYFIP1 cytoplasmic FMRP interacting protein 1
  • the invention provides methods for treating a neurological or psychiatric disease or disorder, which involves administering to a patient in need of such treatment an effective amount for treating said disease or disorder of a composition including an mGluR5 antagonist and an mGluRl antagonist.
  • the invention provides a medicament and/or other composition comprising an mGluR5 antagonist and or an mGluRl antagonist for use in treating a neurological or psychiatric disease or disorder, by administering the medicament and/or other composition to a patient in an effective amount for treating said disease or disorder.
  • the neurological or psychiatric disease is associated with a copy number variation in the 15ql 1.2 gene region.
  • a method for treating a patient having a disease or disorder associated with a copy number variation (CNV) in the 15ql 1.2 gene region involves the steps of: identifying a patient in need of such treatment and administering to said patient an effective amount for treating said disease or disorder of a composition including an mGluR5 antagonist in combination with an mGluRl antagonist.
  • CNV copy number variation
  • the invention provides a medicament and/or other composition comprising an mGluR5 antagonist and or an mGluRl antagonist for use in treatment of a disease or disorder with a copy number variation (CNV) in the 15ql l .2 gene region, by administering the medicament and/or other composition to a patient in an effective amount for treating said disease or disorder.
  • CNV copy number variation
  • the disease or disorder that may be treated by the methods and compositions of the present invention is selected from the group consisting of an autism spectrum diagnosis (ASD), Fragile X syndrome, schizophrenia, Prader- Willi syndrome, and Angelman syndrome.
  • ASD autism spectrum diagnosis
  • Fragile X syndrome schizophrenia
  • Prader- Willi syndrome and Angelman syndrome.
  • the patient may be a human.
  • an mGluRl antagonist is a member selected from the group consisting of: LY367385, A 841720, LY 456236 hydrochloride, Bay 36- 7620 and CPCCOEt.
  • the mGlur5 antagonist is 2-methyl-6-
  • an mGluR5 antagonist of the invention is a member selected from the group consisting of 2-methyl-6-(phenylethynyl)-pyridine (MPEP), (E)-6- methyl-2-styryl-pyridine (SIB 1893), LY293558, 2-methyl-6-[(l E)-2-phenylethynyl] -pyridine, 6-methyl-2-(phenylazo)-3-pyridinol, (RS)-a-methyl-4-carboxyphenylglycine (MCPG), 3S,4aR,6S,8aRS-6-((((lH-tetrazole-5-yl)methyl)oxy)methyl)-l,2,3,4,4a,5,6,7,8,8a- decahydroisoquinoline-3-carboxylic acid, 3S,4aR,6S,8aR-6-((((lH-tetrazole-5- yl)methyl)oxy)methyl)methyl)
  • hydroisoquinoline-3-carboxylic acid [N-(3-chlorophenyl)-N'-(4,5-dihydro-l-methyl-4-oxo-lH- imidazole-2-yl)urea] (Fenobam), 3-((2-Methyl-l,3-thiazol-4-yl)ethynyl)pyridine hydrochloride (MTEP hydrochloride), and 3S,4aR,6S,8aR-6-(((4-carboxy)-phenyl)methyl)-l,2,3,4,4a,5,6,7,8, 8a-decahydroisoquinoline-3-carboxylic acid.
  • an mGluR5 antagonist of the invention is administered in a dose ranging from between about 0.0001 mg to about 100 mg per kilogram of body weight per day. In yet other aspects, an mGluRl antagonist of the invention is administered in a dose ranging from between about 0.0001 mg to about 100 mg per kilogram of body weight per day.
  • a CYFIP1 gene change is a member selected from the group consisting of a CYFIP1 duplication, a CYFIP1 deletion, a mutation in the CYFIP1 gene resulting in increased expression of CYFIP1, and a mutation in the CYFIP1 gene resulting in decreased expression of CYFIP1.
  • a pharmaceutical composition containing (a) an effective amount for treating a disease or disorder associated with a CYFIPI gene change of a composition including an mGluR5 antagonist and an mGluRl antagonist; and (b) a pharmaceutically acceptable carrier or diluent.
  • the present invention provides a pharmaceutical composition containing (a) an mGluR5 antagonist and an mGluRl antagonist in an effective amount for treating a disease or disorder associated with a copy number variation (CNV) in the 15ql l .2 gene region; and (b) a pharmaceutically acceptable carrier or diluent.
  • a pharmaceutical dosage form is provided as a pharmaceutical dosage form.
  • the pharmaceutical dosage form is a tablet or capsule.
  • compositions of the invention are administered intravenously.
  • the pharmaceutical composition is used to treat a disease or disorder selected from the group consisting of an autism spectrum diagnosis (ASD), Fragile X syndrome, schizophrenia, Prader-Willi syndrome, and Angelman syndrome.
  • ASD autism spectrum diagnosis
  • Fragile X syndrome schizophrenia
  • Prader-Willi syndrome and Angelman syndrome.
  • FIG. 1 shows a schematic of the 15ql 1.2 region.
  • FIG. 2A shows pedigrees from three families with a 15ql l .2 deletion (del) or duplication (dup). Squares indicate male family member, circles indicate female family members. Shapes representing family members identified as having an ASD are shaded.
  • FIG. 2B and FIG. 2C show results obtained from multiplex ligation-dependent amplification (MLPA) carried out across 15ql l .2. Examples from the patient with a 15ql l .2 deletion (Family 1)(FIG. 2B) and a patient with a 15ql l .2 duplication (Family 3) (FIG. 2C) are shown.
  • FIG. 3 A shows the genomic structure of CYFIP1 to scale with larger horizontal boxes representing exons, and the first (ATG) and last (Stop) coding exons indicated. The site of the gene-trap insertion (identified as LTR-flanked TRAPPING CASSETTE) in intron 1 (5' to the first coding exon), is indicated.
  • FIG. 3B shows an immunoblot of brain samples from wild-type and Cyfipl heterozygous mice using anti-Cyfipl antibody.
  • FIG. 4 shows the field EPSP slope in hippocampal slices from wild type (Wt)
  • FIG. 5A shows average field EPSP slope normalized to baseline, before and after
  • LTP induction LTP is induced with 100 Hz tetanic stimulation for 1 second in hippocampal slices from wild-type (Wt) or Cyfipl heterozygous (Het) mice. Onset of stimulation is indicated by arrows.
  • FIG. 5B shows average field EPSP slope normalized to baseline, before and after
  • LTP induction LTP is induced with high frequency stimulation (4 trains of 100 Hz,l s stimulation separated by 5 min) in hippocampal slices from wild-type (Wt) or Cyfipl heterozygous (Het) mice. Onset of stimulation is indicated by arrows.
  • FIG. 5C shows average field EPSP slope normalized to baseline, before and after
  • LTP induction LTP is induced with threshold levels of theta burst stimulation in hippocampal slices from wild-type (Wt) or Cyfipl heterozygous (Het) mice. Onset of stimulation is indicated by arrows.
  • FIG. 6 shows average field EPSP slope normalized to baseline, before and after
  • LTD induction is induced with paired-pulse low frequency stimulation (PP-LFS) in hippocampal slices from wild type (Wt) and Cyfipl heterozygous (Het) mice. Onset of stimulation is indicated by the arrow.
  • PP-LFS paired-pulse low frequency stimulation
  • Wt wild type
  • Het Cyfipl heterozygous mice
  • Onset of stimulation is indicated by the arrow.
  • Representative EPSP traces were recorded before stimulation (1) or 60 min after stimulation (2) in wild-type and heterozygous animals (calibration bars represent 10 msec on the horizontal axis and 0.5 mV on the vertical axis).
  • FIG. 7A-7B are field EPSP slopes of LTD induced by paired-pulse low frequency stimulation (PP-LFS) in wild-type (A) or Cyfipl heterozygous (B) mice, in the absence (open symbols) or presence (filled symbols) of the protein synthesis inhibitor cycloheximide (Cyclohex, 60 ⁇ ) (C,D). Onset of stimulation is indicated by arrows.
  • PP-LFS paired-pulse low frequency stimulation
  • FIG. 7C-7D are field EPSP slopes of LTP induced by high frequency stimulation
  • FIG. 8A shows field EPSP slopes of LTD induced by DHPG (50 ⁇ for 5 minutes, indicated by the short horizontal bar) in hippocampal slices from wild-type (Wt) and Cyfipl heterozygous (Het) mice.
  • FIG. 8B and 8C show two field EPSP slopes of LTD induced by DHPG (50 ⁇ for 5 minutes, indicated by the short horizontal bar) in hippocampal slices from wild-type (Wt, 8B) and Cyfipl heterozygous (Het, 8C) mice in the absence (open symbols) or presence (closed symbols) of cycloheximide (Cyclohex, 60 ⁇ , indicated by the long horizontal bar).
  • FIG. 9 shows field EPSP slopes of LTD induced by DHPG (50 ⁇ , indicated by the short horizontal bar) in hippocampal slices from wild-type (WT, upper panel) or Cyfipl heterozygous (Het, lower panel) mice, in the absence (open symbols) or presence (filled symbols) of rapamycin (20 nM, indicated by the long horizontal bar).
  • FIG. 10 shows field EPSP slopes of LTD induced by DHPG (50 ⁇ , indicated by the short horizontal bar) in hippocampal slices from wild-type (open symbols) or Cyfipl heterozygous (closed symbols) mice, the latter in the absence (circles) or presence (squares) of both MPEP (10 ⁇ ) and LY367385 (indicated by the long horizontal bar).
  • FIG. 1 1 shows the results of an inhibitory avoidance protocol for wild-type (wt) and Cyfipl heterozygous mice (Het) at training and 6 h, 24 h and 48 h following training.
  • the present invention provides methods for treating a neurological or psychiatric disease or disorder using mGluR antagonists.
  • the methods of the present invention are directed to treating a patient with a disease or disorder associated with a cytoplasmic FMRP interacting protein 1 (CYFIP1) gene change.
  • CYFIP1 cytoplasmic FMRP interacting protein 1
  • the specific combination of mGluRl and mGluR5 antagonists is surprisingly more beneficial than use of either antagonist alone for the treatment of disorders associated with a CYFIP1 gene change.
  • a "CYFIP1 gene change” includes CYFIP1 mutations and gene dosage abnormalities, also called copy number variations (CNVs), caused, e.g., by deletion or duplication.
  • CNVs copy number variations
  • gene dosage refers to the number of copies of a particular gene present in a subject.
  • the location of a human gene is given as the chromosome number and the region of the chromosome (locus) where the gene is found.
  • 15ql 1.2 refers to the 1 1.2 region of the q arm on human chromosome 15.
  • the human and murine amino acid and nucleic acid sequences of CYFIP1 /Cyfipl are known and have been described.
  • the CYFIP1 (human) nucleic acid sequences have Genbank® Accession numbers NM 014608.2 (SEQ ID NO: 1) and NM 001033028.1 (SEQ ID NO: 2); and the amino acid sequences have Accession numbers NP_055423.1 (SEQ ID NO: 3) and NP 001028200.1 (SEQ ID NO: 4).
  • the Cyfipl (murine) nucleic acid sequence has Genbank® Accession number NM 01 1370.1 (SEQ ID NO: 5) and the amino acid sequence has Accession number NP 035500.1 (SEQ ID NO: 6).
  • Genomic imbalances including CNVs, have been shown to be etiologically significant in many patients with autism spectrum diagnoses (ASDs) (Cook and Scherer, 2008). These genomic imbalances include those that are inherited or de novo and those that are recurrent and not recurrent. Recurrent genomic imbalances typically arise due to non-allelic homologous recombination (NHAR) mediated by low-copy repeats (LCR) (more recently also referred to as segmental duplications) (Gu and Lupski, 2008).
  • NHAR non-allelic homologous recombination
  • LCR low-copy repeats
  • Some recurrent genomic imbalances can increase risk for diverse psychiatric disorders, including ASDs, schizophrenia, attention deficit/hyperactivity disorder, and obsessive- compulsive disorder.
  • ASDs psychiatric disorders
  • schizophrenia attention deficit/hyperactivity disorder
  • obsessive- compulsive disorder a disorder that has been known for some time that CNVs in the 22ql 1 region are associated with schizophrenia and autism, while more recently, additional rarer CNVs have been shown to be associated with these same two disorders (O 'Donovan et al, 2008; Burbach and van der Zwaag, 2009).
  • CNVs in the 15ql l .2 region are correlated with autism spectrum diagnoses (ASDs).
  • the 15ql l .2 region includes a minimal 0.3 Mb region that encompasses at least 4 genes, including TUBGCP5, CYFIP1, NIPA2, and NIPA1 [Chai et al, 2003].
  • CYFIP1 gene changes are associated with ASDs, and that CYFIP1 is an important target for the treatment of ASDs, as well as other psychiatric diseases or disorders characterized by CNVs in the 15ql 1.2 region.
  • ASDs are a spectrum of psychological conditions characterized by widespread abnormalities of social interactions and communication, as well as severely restricted interests and/or highly repetitive behavior. Autism forms the core of the ASDs.
  • the defining characteristics of ASDs are qualitative impairments of social communication and interaction, along with restricted and repetitive activities and interests. Individual symptoms occur in the general population and appear not to associate highly, without a sharp line separating pathological severity from common traits. Other aspects of ASDs, such as atypical eating, are also common but are not essential for diagnosis; they can affect the individual or the family.
  • Most recent reviews tend to estimate a prevalence of 1-2 per 1,000 for autism and close to 6 per 1,000 for ASD; (Newschaffer CJ, et al. (2007) Annu Rev Public Health 28: 235-58.) because of inadequate data, these numbers may underestimate ASD's true prevalence. See, Caronna EB, et al. (2008) Arch Dis Child 93 (6): 518-23.
  • a number of different treatments for autism have been developed. Many of the treatments, however, address the symptoms of the disease rather than the causes. For example, therapies ranging from behavioral therapies to psychopharmacology have been employed in the treatment of autism. Although some clinical symptoms may be lessened by these treatments, modest improvement, at best, has been demonstrated in only a minor fraction of the cases. Only a small percentage of autistic persons become able to function as self-sufficient adults. Thus, new therapeutic treatment methods for ASDs such as autism are needed. The present invention provides such methods.
  • schizophrenia, Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are also associated with CNVs in the 15ql l .2 region.
  • these psychiatric conditions can also benefit from the methods of the present invention.
  • Schizophrenia is a psychiatric diagnosis that describes a mental disorder characterized by abnormalities in the perception or expression of reality. Distortions in perception may affect all five senses, including sight, hearing, taste, smell and touch, but most commonly manifest as auditory hallucinations, paranoid or playful delusions, or disorganized speech and thinking with significant social or occupational dysfunction. Onset of symptoms typically occurs in young adulthood, with approximately 0.4-0.6% of the population affected. Recently, a recurrent CNV was identified to increase risk for schizophrenia by 2-4 fold in two large studies involving the 15ql l .2 region (Stefansson et al, 2008; Kirov et al, 2008) (see FIG. 1).
  • the CNV identified by these studies includes a minimal 0.3 Mb region that encompasses CYFIP1.
  • the methods of the present invention which are useful for treating patients having a psychiatric disorder and a CYFIP1 gene change, are useful for the treatment of schizophrenia.
  • PWS and AS are also associated with CNVs in regions that include the
  • the loss can be due to a deletion in 15ql 1-13.
  • the proximal breakpoint for such deletions can be at one of two loci, termed BP1 and BP2 (Chai et al., 2003) (see FIG. 1), resulting, respectively, in a longer type I or a shorter type II deletion.
  • the BP1-BP2 interval corresponds to the 15ql 1.2 region identified in schizophrenia and illustrated in Figure 1.
  • Type I deletion was associated with an increased severity of speech impairments as well as a delay in sitting without support (Varela et al., 2004). Furthermore, there was significantly increased likelihood of having an ASD in individuals with AS arising from a Type I deletion (Sahoo et al, 2006). These larger deletions were associated with lower cognitive scores, lower expressive language scores, and more severe seizure risk (Sahoo et al, 2006).
  • the methods of the present invention are also useful for the treatment of Fragile X syndrome (FXS).
  • IQ moderate to severe mental retardation
  • seizures e.g., benign childhood epilepsy, temporal lobe epilepsy
  • visual spatial defects anxiety, learning difficulties and certain characteristics of autism.
  • LTD long-term depression
  • LTD is the weakening of a neuronal synapse that lasts from hours to days.
  • LTD is thought to result from changes in postsynaptic receptor density, although changes in presynaptic release may also play a role.
  • Hippocampal/cortical LTD can be dependent of NMD A receptors, mGluRs or endocannabinoids.
  • LTD is distinct from synaptic depotentiation, which is the reversal of long-term potentiation (LTP). LTD is a novel reduction in synaptic strength - specifically, an activity-dependent reduction in the excitatory post-synaptic potential compared to the baseline level.
  • LTP is the opposing process to LTD.
  • LTP is the long-lasting improvement in communication between two neurons that results from stimulating them simultaneously.
  • LTP is commonly divided into three phases that occur sequentially: short-term potentiation, early LTP, and late LTP.
  • the early (E-LTP) and late (L-LTP) phases of LTP are each characterized by a series of three events: induction, maintenance, and expression.
  • Induction is the process by which a short-lived signal triggers that phase of LTP to begin.
  • Maintenance corresponds to the persistent biochemical changes that occur in response to the induction of that phase.
  • Expression entails the long-lasting cellular changes that result from activation of the maintenance signal.
  • CYFIP1 plays an integral part in the LTD mechanism that is critical to normal synaptic plasticity. Disruption of normal synaptic plasticity, such as e.g., increased LTD, is associated with neurological and psychiatric disorders.
  • the term "subject” or “individual” refers to an animal, preferably a mammal (e.g., rodent, such as mouse). In particular, the term refers to humans.
  • the term "about” or “approximately” usually means within an acceptable error range for the type of value and method of measurement. For example, it can mean within 20%, more preferably within 10%, and most preferably still within 5% of a given value or range. Alternatively, especially in biological systems, the term “about” means within about a log (i.e., an order of magnitude) preferably within a factor of two of a given value.
  • an "effective amount” refers to the amount of a compound including an mGluR antagonist that is effective, upon single or multiple dose administration to a patient, in treating the patient suffering from the named disorder.
  • ED 50 means the dose of a drug that produces 50%> of its maximum response or effect.
  • IC 50 means the concentration of a drug which inhibits an activity or property by 50%, e.g., by reducing the frequency of a condition, such as cell death, by 50%>, by reducing binding of a competitor peptide to a protein by 50%> or by reducing the level of an activity by 50%.
  • LD 50 means the dose of a drug that is lethal in 50%> of test subjects.
  • composition indicates a combination of multiple substances into an aggregate mixture.
  • the term "statistically significant” as used herein means that the obtained results are not likely to be due to chance fluctuations at the specified level of probability.
  • the level of significance equal to 0.05 and 0.01 means that the probability of error is 5 out of 100 and 1 out of 100, respectively.
  • the present invention relates to the use of antagonists of Group I mGluRs, such as antagonists of mGluR5 and mGluRl, for treating FXS, schizophrenia, Prader-Willi syndrome, Angelman syndrome and ASDs, including autism.
  • the present invention is also directed to the use of antagonists of Group I mGluRs, such as antagonists of mGluR5 and mGluRl, for treating a disease or disorder associated with a CYFIP1 gene change.
  • mGluR5 and mGluRl antagonists are used in combination.
  • children with FXS, schizophrenia, Prader-Willi syndrome, Angelman syndrome or an ASD, including autism can be treated with Group I mGluR antagonists.
  • Preferably treatment is with a combination of mGluRl and mGluR5 antagonists.
  • the children can be treated during infancy (between about 0 to about 1 year of life), childhood (the period of life between infancy and puberty) and during puberty (between about 8 years of life to about 18 years of life).
  • the methods of the invention can be used to treat adults (greater than about 18 years of life) having FXS, schizophrenia, Prader-Willi syndrome, Angelman syndrome or an ASD, including autism.
  • An "agonist” is a molecule which activates a certain type of receptor.
  • glutamate molecules act as agonists when they excite EM receptors.
  • An example of an agonist of the present invention is DHPG, which induces mGluR5 -dependent long-term depression (LTD).
  • an "antagonist” is a molecule which prevents or reduces the effects exerted by an agonist on a receptor.
  • the term "antagonist” includes antagonists and inverse agonists (also known as “reverse agonists”).
  • An inverse agonist is an agent which binds to the same receptor binding-site as an agonist for that receptor and reverses the constitutive activity of the receptor. Whereas an antagonist blocks the ability of an agonist to activate a receptor and needs the presence of agonist to block the activity, an inverse agonist binds to a receptor and reverses the action of the receptor, in the absence of agonist.
  • An inverse agonist is also known as a reverse agonist.
  • An example of an antagonist of the present invention is 2-methyl-6-(phenylethynyl)-pyridine (MPEP), which is an mGluR5 antagonist and inhibits the ability of DHPG to induce mGluR5 -mediated LTD.
  • An example of an inverse agonist that may be used as an antagonist in the present invention is Fenobam [N-(3-chlorophenyl)-N'-(4,5- dihydro-l-methyl-4-oxo-lH-imidazole-2-yl)urea], which is a noncompetitive mGluR5 antagonist with inverse agonist activity. See, Porter et al. (2005) J Pharmacol Exp Ther. Nov;315(2):711-21.
  • mGluR antagonist includes group I mGluR antagonists, such as mGluRl and mGluR5 antagonists.
  • preferred antagonists are those that provide a reduction of activation by the ligand or reveres the activity of the receptor by at least 10%, and more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or even at least 99% at a concentration of the antagonist, for example, of 1 ⁇ g/ml, 10 ⁇ g/ml, 100 ⁇ g/ml, 500 ⁇ g/ml, 1 mg/ml, 10 mg/ml, or 100 mg/ml.
  • the percentage antagonism represents the percentage decrease in activity of mGluR, e.g., mGluR5, in a comparison of assays in the presence and absence of the antagonist. Any combination of the above mentioned degrees of percentage antagonism and concentration of antagonist may be used to define an antagonist of the invention, with greater antagonism at lower concentrations being preferred.
  • An antagonist for use in the invention may be a relatively non-specific antagonist that is an antagonist of mGluRs in general. Preferably, however, an antagonist selectively antagonizes mGluR5 and/or mGluRl . Even more preferably, an antagonist used in the invention is a selective antagonist of either mGluR5 or mGluRl .
  • a selective antagonist of mGluR5 is one that antagonizes mGluR5, but antagonizes other mGluRs only weakly or substantially not at all, or at least antagonizes other mGluRs with an EC50 at least 10 or even 100 or 1000 times greater than the EC50 at which it antagonizes mGluR5.
  • a selective antagonist of mGluRl is one that antagonizes mGluRl, but antagonizes other mGluRs only weakly or substantially not at all, or at least antagonizes other mGluRs with an EC50 at least 10 or even 100 or 1000 times greater than the EC50 at which it antagonizes mGluRl .
  • Most preferred antagonists are those which can selectively antagonize their target at low concentrations, for example, those that cause a level of antagonism of 50% or greater at a concentration of 100 ⁇ g/ml or less.
  • Exemplary mGluR5 antagonists include, without limitation, 2-methyl-6-
  • Antagonists of mGluR5 are also described in WO 01/66113, WO 01/32632, WO
  • Examples of antagonists of mGluRl include but are not limited to LY367385, A
  • Antagonists including inverse agonists, for use in the present invention are commercially available, e.g., from Tocris Bioscience (Ellisville, MO).
  • an mGluRl antagonist and an mGluR5 antagonist of the invention can be administered together in one composition or in two different compositions, which are administered simultaneously or sequentially (to the same or different sites).
  • the mGluR5 antagonist MPEP is used in combination with the mGluRl antagonist LY367385 for the treatment of a neurological or psychiatric condition.
  • Antisense oligonucleotides to mGluR5 can be prepared by analogy and used to selectively antagonize mGluR5, as desired.
  • Also contemplated by the present invention are additional small molecule inhibitors of mGluRl and mGluR5.
  • Diverse libraries of small molecule inhibitors can be generated.
  • the compounds of the present invention particularly libraries of variants having various representative classes of substituents, are amenable to combinatorial chemistry and other parallel synthesis schemes (see, for example, PCT WO 94/08051).
  • the result is that large libraries of related compounds, e.g., a variegated library of potential mGluR antagonists, can be screened rapidly in high-throughput assays to identify potential lead compounds, as well as to refine the specificity, toxicity, and/or cytotoxic-kinetic profile of a lead compound.
  • mGluR antagonists are meant to serve as representative examples only. It should be understood that any agent or small compound that is useful as an mGluRl or mGluR5 antagonist is contemplated for use in the methods and compositions of the present invention.
  • hippocampal slices may be assayed for electrophysiology. Measurements including input/output function, paired-pulse facilitation, or various forms of LTP may be evaluated.
  • Input/output relationship is a measurement of the synaptic function and reflects the synaptic response to the number of axons activated by a given stimulus. A shift in the relationship indicates a change in the excitability.
  • LTP Long-term potentiation
  • TBS threshold level of theta-burst stimulation
  • Different LTP induction protocols may activate distinct signaling cascades that generate LTP with different expression mechanisms.
  • the excitatory postsynaptic potential (EPSP) of a synapse is determined.
  • An EPSP is a temporary depolarization of postsynaptic membrane potential caused by the flow of positively charged ions into the postsynaptic cell as a result of opening of ligand- sensitive channels.
  • EPSPs are the opposite of inhibitory postsynaptic potentials (IPSPs), which usually result from the flow of negative ions into the cell or positive ions out of the cell.
  • a postsynaptic potential is defined as excitatory if it makes it easier for the neuron to fire an action potential.
  • EPSPs can also result from a decrease in outgoing positive charges, while IPSPs are sometimes caused by an increase in positive charge outflow.
  • the flow of ions that causes an EPSP is an excitatory postsynaptic current (EPSC).
  • EPSPs like IPSPs, are graded (i.e. they have an additive effect). When multiple EPSPs occur on a single patch of postsynaptic membrane, their combined effect is the sum of the individual EPSPs. Larger EPSPs result in greater membrane depolarization and thus increase the likelihood that the postsynaptic cell reaches the threshold for firing an action potential.
  • EPSPs may be recorded using intracellular electrodes.
  • the extracellular signal from a single neuron is extremely small and thus next to impossible to record.
  • neurons are arranged in such a way that they all receive synaptic inputs in the same area. Because these neurons are in the same orientation, the extracellular signals from synaptic excitation don't cancel out, but rather add up to give a signal that can easily be recorded with a field electrode. This extracellular signal recorded from a population of neurons is the field potential.
  • fEPSP in stratum radiatum of CA1 in response to Schaffer collateral stimulation.
  • This is the signal seen by an extracellular electrode placed in the layer of apical dendrites of CA1 pyramidal neurons.
  • the Schaffer collaterals make excitatory synapses onto these dendrites, and so when they are activated, there is a current sink in stratum radiatum: the field EPSP.
  • the voltage deflection recorded during a field EPSP is negative-going, while an intracellularly recorded EPSP is positive-going. This difference is due to the relative flow of ions (primarily the sodium ion) into the cell, which, in the case of the field EPSP is away from the electrode, while for an intracellular EPSPs it is towards the electrode.
  • the extracellular electrode may record another change in electrical potential named the population spike which corresponds to the population of cells firing action potentials (spiking).
  • the field EPSP may be far more complex and harder to interpret as the source and sinks are far less defined.
  • regions such as the striatum neurotransmitters such as dopamine, acetylcholine, GABA and others may also be released and further complicate the interpretation.
  • MLPA Multiplex ligation-dependent probe amplification
  • CNVs in 15ql 1.2 were confirmed by multiplex ligation-dependent probe amplification (MLPA).
  • MLPA is a variation of polymerase chain reaction (PCR) that permits multiple targets to be amplified with only a single primer pair.
  • Each probe consists of a two oligonucleotides which recognize adjacent target sites on the DNA.
  • One probe oligonucleotide contains the sequence recognized by the forward primer, the other the sequence recognized by the reverse primer. Only when both probe oligonucleotides are hybridized to their respective targets, can they be ligated into a complete probe.
  • the advantage of splitting the probe into two parts is that only the ligated oligonucleotides, but not the unbound probe oligonucleotides, are amplified. If the probes were not split in this way, the primer sequences at either end would cause the probes to be amplified regardless of their hybridization to the template DNA, and the amplification product would not be dependent on the number of target sites present in the sample DNA.
  • Each complete probe has a unique length, so that its resulting amplicons can be separated and identified by (capillary) electrophoresis. Since the forward primer used for probe amplification is fluorescently labeled, each amplicon generates a fluorescent peak which can be detected by a capillary sequencer. Comparing the peak pattern obtained on a given sample with that obtained on various reference samples, the relative quantity of each amplicon can be determined. This ratio is a measure for the ratio in which the target sequence is present in the sample DNA.
  • MLPA can successfully and easily determine the relative copy number of all exons within a gene simultaneously with high sensitivity.
  • An important use of MLPA is to determine relative ploidy (i.e. to determine whether CNVs are present).
  • probes may be designed to target various regions of chromosome 21 of a human cell. The signal strengths of the probes are compared with those obtained from a reference DNA sample known to have two copies of the chromosome. If an extra copy is present in the test sample, the signals are expected to be 1.5 times the intensities of the respective probes from the reference. If only one copy is present the proportion is expected to be 0.5. If the sample has two copies, the relative probe strengths are expected to be equal.
  • SNP single-nucleotide polymorphism
  • a single-nucleotide polymorphism is a DNA sequence variation occurring when a single nucleotide— A, T, C, or G— in the genome (or other shared sequence) differs between members of a species (or between paired chromosomes in an individual). Almost all common SNPs have only two alleles.
  • SNPs can be assigned a minor allele frequency—the lowest allele frequency at a locus that is observed in a particular population. This is simply the lesser of the two allele frequencies for single-nucleotide polymorphisms. There are variations between human populations, so a SNP allele that is common in one geographical or ethnic group may be much rarer in another. Single nucleotide may be changed (substitution), removed (deletions) or added (insertion) to polynucleotide sequence. Ins/del SNP may shift translational frame.
  • Single-nucleotide polymorphisms may fall within coding sequences of genes, non-coding regions of genes, or in the intergenic regions between genes. SNPs within a coding sequence will not necessarily change the amino acid sequence of the protein that is produced, due to degeneracy of the genetic code. A SNP in which both forms lead to the same polypeptide sequence is termed synonymous (sometimes called a silent mutation) — if a different polypeptide sequence is produced they are nonsynonymous. A nonsynonymous change may either be missense or nonsense, where a missense change results in a different amino acid, while a nonsense change results in a premature stop codon. SNPs that are not in protein-coding regions may still have consequences for gene splicing, transcription factor binding, or the sequence of non-coding RNA.
  • SNPs are often found to be the etiology of many human diseases and are becoming of particular interest in pharmacogenetics. SNPs can be detected by various techniques such as dynamic allele-specific hybridization (DASH), which takes advantage of the differences in the melting temperature in DNA that results from the instability of mismatched base pairs, (see, Howell W., et al. (1999) Nat Biotechnol. 17(l):87-88); by molecular beacons, which make use of a specifically engineered single-stranded oligonucleotide probe (see, Abravaya et al.
  • DASH dynamic allele-specific hybridization
  • oligonucleotide SNP arrays hundreds of thousands of probes are arrayed on a small chip, allowing for many SNPs to be interrogated simultaneously. Because SNP alleles only differ in one nucleotide and because it is difficult to achieve optimal hybridization conditions for all probes on the array, the target DNA has the potential to hybridize to mismatched probes. This is addressed somewhat by using several redundant probes to interrogate each SNP. Probes are designed to have the SNP site in several different locations as well as containing mismatches to the SNP allele.
  • the Affymetrix® Human SNP 5.0 GeneChip performs a genome -wide assay that can genotype over 500,000 human SNPs (Affymetrix (2007) Genome- Wide Human SNP Array 5.0. [online] Address: http://www.affymetrix.com/products/arrays/specific/genome_wide/genome_wide_snp_5.affx)
  • BP1-BP2 CNVs and/or CYFIP1 gene changes in a patient may be determined by any method known in the art.
  • Non-limiting examples of identifying BP1-BP2 CNVs and/or CYFIPl gene changes are RT-PCR, MLPA, or SNPs. Any suitable sample from a patient may be used. Non-limiting examples include a tissue sample or blood.
  • the Apgar score provides a convenient shorthand for reporting the status of the newborn infant and the response to resuscitation. It is described in detail in "The Apgar Score"; American Academy of Pediatrics; Volume 117, Number 4, April 2006: 1444-1447.
  • ADI-R Autism Diagnostic Interview-Revised
  • Autism diagnostic interview-revised A revised version of a diagnostic interview for caregivers of individuals with possible pervasive developmental disorders. Journal of Autism and Developmental Disorders, 24(5), 659-685).
  • the ADI-R assesses communication, social impairment, and compulsive behaviors in addition to early developmental history, motor functioning, and general behaviors. It is a semi-structured psychiatric interview designed for the study of autism and related disorders and is typically administered to the patient's primary caretaker/family member. In children 2 years and older, the ADI-R demonstrates good validity in diagnosing autistic disorder (Lord et al, 1994).
  • ADOS-G Autism Diagnostic Observation Schedule-Generic
  • the ADOS-G assesses functioning in each of the three core symptom domains (communication, compulsivity, social impairment) as well as associated features of autism.
  • the ADOS-G involves a standardized observation protocol of social and communicative behavior in children, adolescents, and adults. This tool is commonly used in research, specifically paired with the ADI-R to complement a thorough diagnosis.
  • mice [00180] Detailed methods for mouse models of ASD are described in Current Protocols in Neuroscience, section 8.18.1-15, by Charles Heyser, 2003, and also in What's wrong with my mouse? Behavioral phenotyping of transgenic and knockout mice, 2 nd edition, 2007, by Jacqueline Crawley. Cyfi l mice
  • CYFIP1 in a complex that regulates protein synthesis in dendrites, the 15ql l .2 region in ASDs was examined and the function of the CYFIP1 gene was determined using mice with a disruption of the Cyfipl gene. Mice with a disruption in Cyfipl were generated from gene-trapped embryonic stem (ES) cells.
  • ES embryonic stem
  • mice were developed from an Omnibank (Lexicon) embryonic stem (ES) cell line that was produced by mutagenesis with a gene trap insertional vector. Briefly, an ES clone was identified that has a trapping cassette inserted into intron 1 of the Cyfipl gene (note that the start ATG is in exon 2). A mouse line was established from the ES cells in the 129SvEvBrd strain. The ES cells were injected into C57BL6/J mice (The Jackson Laboratory, Bar Harbor, ME) to obtain chimeric mice. Chimeric mice were mated with C57BL6 mice from Taconic (Hudson, NY) to obtain heterozygotes and were subsequently maintained on the C57BL6 background.
  • Gene trapping is a high-throughput approach that is used to introduce insertional mutations across the mammalian genome. It is performed with gene trap vectors whose principal element is a gene trapping cassette consisting of a promoterless reporter gene and/or selectable genetic marker flanked by an upstream 3' splice site (splice acceptor; SA) and a downstream transcriptional termination sequence (polyadenylation sequence; poly A).
  • SA splice acceptor
  • poly A downstream transcriptional termination sequence
  • the gene trap cassette is transcribed from the endogenous promoter of that gene in the form of a fusion transcript in which the exon(s) upstream of the insertion site is spliced in frame to the reporter/selectable marker gene.
  • the processed fusion transcript encodes a truncated and non-functional version of the cellular protein and the reporter/selectable marker.
  • gene traps simultaneously inactivate and report the expression of the trapped gene at the insertion site, and provide a DNA tag (gene trap sequence tag, GTST) for the rapid identification of the disrupted gene.
  • Cyfipl protein expression is determined using a monoclonal antibody specific for Cyfipl (Synaptic Systems GmbH, Germany).
  • protein synthesis is preferably inhibited using cycloheximide.
  • protein synthesis inhibitors include, but are not limited to anisomycin and cycloheximide (also emetine and puromycin).
  • the present invention provides compositions containing one or more group 1 mGluR antagonists.
  • the group 1 mGluR antagonists are selected from mGluRl and mGluR5 antagonists. Still more preferably, mGluRl and mGluR5 antagonists are used in combination.
  • a patient in need of such treatment is administered a composition containing an mGluR5 antagonist in combination with an mGluRl antagonist of the invention.
  • an mGluRl antagonist and an mGluR5 antagonist may be administered in separate compositions, at the same site or at a different site of administration, and at the same or at different times.
  • compositions of the invention can be formulated for administration in any convenient way for use in human or veterinary medicine.
  • the mGluR antagonists of the invention may be incorporated into liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts or spheroblasts.
  • the antagonists of the invention can be delivered in one or more vesicles, including as a liposome (see Langer, Science, 1990;249: 1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss: New York, pp.
  • the mGluR antagonists of the invention can be delivered in a controlled release form.
  • the mGluR antagonists may be administered in a polymer matrix such as poly (lactide-co-glycolide) (PLGA), in a microsphere or liposome implanted subcutaneously, or by another mode of delivery (see, Cao et al., 1999, Biomaterials, Feb;20(4):329-39).
  • Another aspect of delivery includes the suspension of the compositions of the invention in an alginate hydrogel.
  • terapéuticaally effective when applied to a dose or an amount refers to that quantity of a compound or pharmaceutical composition that is sufficient to result in a desired activity upon administration to a mammal in need thereof.
  • therapeutically effective amount/dose refers to the amount/dose of a pharmaceutical composition of the invention that is suitable for treating a patient or subject having an autoimmune disease.
  • the patient or subject may be a mammal.
  • the mammal may be a human.
  • compositions of the present invention can also include veterinary compositions, e.g., pharmaceutical preparations of the mGluR antagonists suitable for veterinary uses, e.g., for the treatment of livestock or domestic animals, e.g., dogs.
  • compositions of the present invention can be admixed with a pharmaceutically acceptable carrier or excipient.
  • pharmaceutically acceptable refers to molecular entities and compositions that are "generally regarded as safe", e.g., that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicles with which the compound is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions.
  • the carrier can be a solid dosage from carrier, including but not limited to one or more of a binder (for compressed pills), a tablet, an encapsulating agent, a flavorant, and a colorant. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E.W. Martin.
  • compositions can be determined empirically, according to procedures well known to medicinal chemists.
  • biologically acceptable medium includes any and all solvents, dispersion media, and the like which may be an appropriate carrier for the desired route of administration of the pharmaceutical preparation.
  • the use of such media for pharmaceutically active substances is known in the art.
  • Suitable vehicles and their formulation inclusive of other proteins are described, for example, in the book Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences. Mack Publishing Company, Easton, Pa., USA 1985). These vehicles include injectable "deposit formulations.”
  • compositions and formulations of the present invention can be administered topically, parenterally, orally, by inhalation, as a suppository, or by other methods known in the art.
  • parenteral includes injection (for example, intravenous, epidural, intrathecal, intramuscular, intraluminal, intratracheal or subcutaneous).
  • the compositions of the present invention may also be administered using a transdermal patch.
  • compositions of the invention may be once a day, twice a day, or more often, but frequency may be decreased during a maintenance phase of the disease or disorder, e.g., once every second or third day instead of every day or twice a day.
  • the dose and the administration frequency will depend on the clinical signs, which confirm maintenance of the remission phase, with the reduction or absence of at least one or more preferably more than one clinical signs of the acute phase known to the person skilled in the art. More generally, dose and frequency will depend in part on recession of pathological signs and clinical and subclinical symptoms of a disease condition or disorder contemplated for treatment with the present compounds.
  • mGluR antagonists compositions described herein can be used to treat or prevent psychiatric or neurological disorders.
  • "treating" or “treatment” of a state, disorder or condition includes: (1) preventing or delaying the appearance of clinical symptoms of the state, disorder or condition developing in a human or other mammal that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition, (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical or subclinical symptom thereof, or (3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or subclinical symptoms.
  • the benefit to an individual to be treated is either statistically significant or at least perceptible to the patient or to the physician.
  • compositions of the invention will typically contain an effective amount of the compositions of the invention, alone or in combination with an effective amount of any other active material, e.g., those described above.
  • Preliminary doses can be determined according to animal tests, and the scaling of dosages for human administration can be performed according to art-accepted practices.
  • typical dosages of mGluRl and mGluR5 antagonists of the invention may range from about 0.0001 mg to about 100 mg per kilogram of body weight per day. In certain embodiments, a patient may receive, for example, 1 mg per day of each antagonist intravenously.
  • mGluRl and mGluR5 antagonists of the invention may range from about 0.0001 mg to about 100 mg per kilogram of body weight per day. In certain embodiments, a patient may receive, for example, 1 mg per day of each antagonist intravenously.
  • conventional molecular biology, microbiology, recombinant DNA, immunology, cell biology and other related techniques within the skill of the art. See, e.g., Sambrook et al., (2001) Molecular Cloning: A Laboratory Manual. 3rd ed.
  • IQ tests appropriate for the age and level of verbal communication of the subjects were administered, as was the Vineland Adaptive Behavioral Scales (VABS).
  • VABS Vineland Adaptive Behavioral Scales
  • Subjects were evaluated with a complete medical and neurological examination, including a dermatological examination with Wood's lamp to look for signs of tuberous sclerosis and hypomelanosis of Ito.
  • Subjects were assessed for dysmorphology and a full panel of photographs were taken for further evaluation by a clinical geneticist. Blood samples were taken from subjects and parents for DNA extraction and transformation into cell lines.
  • CVCR The University of California Los Angeles DNA Microarray Facility, part of the NIH Neuroscience Microarray Consortium, using manufacturer- recommended procedures for probe generation and hybridization to the Nspl arrays, which contain probes for 262,264 SNPs throughout the genome at a median spacing of one SNP for every 9 kb. Analysis of this microarray data for CNVs was carried out as described previously (Nakamine et al., 2008). Analysis of the CNVs in an additional sample has been described in detail (Glessner et al., 2009).
  • MLPA Multiplex ligation-dependent probe amplification
  • GUSB GUSB #3 IF (SEQ ID NO: 29)
  • GUSB #31R (SEQ ID NO: 30)
  • RPL13A catgaggtcgggtggaagta
  • mice were developed from an Omnibank (Lexicon) embryonic stem (ES) cell line that was produced by mutagenesis with a gene trap insertional vector. Briefly, an ES clone that has a trapping cassette inserted into intron 1 of the Cyfipl gene (note that the start ATG is in exon 2) was identified. A mouse line was established from the ES cells in the 129SvEvBrd strain.
  • Hippocampal slices 350 ⁇ were prepared from 4-6 week old heterozygous mice and their wild-type littermate controls. Slices were perfused with Ringer's solution containing (in mM): NaCl, 125.0; KC1, 2.5; MgS04, 1.3; NaH2P04, 1.0; NaHC03, 26.2; CaC12, 2.5; glucose, 11.0. The Ringer's solution was bubbled with 95% 02/5% C02, at 32°C, during extracellular recordings (electrode solution: 3 M NaCl).
  • fEPSPs field excitatory postsynaptic potentials
  • Cycloheximide 60 ⁇ , Sigma
  • dihydroxyphenylglycine DHPG, 50 ⁇ , Sigma
  • 2-methyl-6-phenylethynyl-pyridine MPEP, 10 ⁇ , Tocris
  • LY367385 100 ⁇ , Tocris
  • rapamycin 20 nM, Enzo Life Sciences
  • DHPG-induced LTD was also used as described in the Examples, below
  • MLPA data was analyzed as was described previously (Cai et al., 2008).
  • qPCR data was analyzed using qBase (Hellemans et al., 2007).
  • data are expressed as means ⁇ SD, and statistical analyses were performed using ANOVA or Student's t- test, where P ⁇ 0.05 was considered significant.
  • Cyfipl mice were backcrossed to strain C57Bl/6Tac at least 5 times, and prepared in cohorts of 28 male animals (13 wild type and 15 heterozygotes) from 6 litters from wild type x heterozygote matings. Behavioral studies were conducted substantially as described in Nadler et al. (2004) and Elder et al. (2008). Contextual memory was tested using a contextual conditioned fear paradigm in sound-attenuated test chambers (Coulbourn Instruments) running the Freeze Frame (Actimetrics) video tracking software. Following one hour of acclimation to the test room, subjects were habituated to the test chamber with 68 dB background noise for 2 minutes.
  • Subjects were then exposed to a series of 2 tones (20 sec, 80dB, 2 KHz) accompanied by cue light and co-terminating shock (1 sec, .7mA), separated by a 1 minute interval. Twenty-four hours later, subjects were returned to the prior test chamber without any tone or cue light, and freezing was measured for 3 minutes.
  • Inhibitory avoidance was performed following the protocol published by Dolen et al. (2007) except longer cut off times were used (180 sec instead of 120 sec) during the initial training phase. Testing was performed at 6 h, 24 h and 48 h after initial training. The inhibitory avoidance box was obtained from San Diego Instruments.
  • MLPA was carried out to confirm the CNVs identified by SNP arrays. Examples from the patient with a 15ql l .2 deletion (Family 1) and a patient with a 15ql l .2 duplication (Family 3) are shown. All probes, except the probes between BP1-BP2 (in TUBGCP1 and CYFIP1) showed normal dosage. A copy number loss arose de novo in one case (Family 1), while two copy number gains were inherited (Family 2,3). The rate of CNVs in this cohort involving just the BP1-BP2 interval was 1.6%, with the rate of deletions (often more deleterious) being 0.5%.
  • the first patient (Family 1) was a male child, 5 years (yrs) old at the time of recruitment, born to a 21-yr-old mother and 24-yr-old father. He was the eldest of two siblings, with a 6-month-old brother. His father was healthy, with paternal history positive for mental retardation in his father's male first cousin. His mother was a healthy adult with a history of delayed language acquisition and articulations difficulties in childhood. The maternal uncle also had congenital deafness in one ear. The patient was the product of a normal full-term pregnancy. He was born with a nuchal cord but with no reported complications and Apgar scores were in the normal range (Apgarl : 8; Apgar2: 9).
  • the second patient (Family 2) was a male child, 10 yrs old at the time of recruitment, born to a healthy 27-yr-old mother and 31-yr-old father and the eldest of two siblings, with a 6-yr-old healthy brother.
  • Family history was positive for developmental and learning delays in the family line, including a paternal great-uncle and maternal female second cousin with congenital deafness. His mother was diagnosed with hypertension during pregnancy, and he was born via cesarean section as a result of acute fetal distress. Apgar scores at 1 and 5 min were 5 and 6, respectively. He was born at 3.2 kg and 53 cm in height.
  • His head circumference at birth was 38 cm (90th percentile), did not normalize, and thus, he carried a diagnosis of macrocephaly at the time of recruitment.
  • His early developmental history suggested significant motor delays including holding his head without support at 6 months, sitting at 12 months, self-feeding at 18 months, standing at 24 months, and walking at 30 months. Language/speech development was also delayed, with first words at 36 months.
  • His history is positive for asthma and seizure activity, which started shortly before he was recruited. His physical screenings were normal.
  • a neurological evaluation conducted at the time of recruitment found cortico-subcortical atrophy.
  • Patient 3 (Family 3) was a male child, 5-yrs-old at the time of recruitment, born to a 30-yr-old healthy mother and 30-yr-old father with paranoid schizophrenia. He was the youngest of three siblings, with a healthy sister and brother, ages 15 and 13 respectively at the time of the evaluation. In addition to his father's diagnosis of schizophrenia, a first cousin on the maternal side had communication and learning problem that the family considered to be autistic- like. His mother had hypertension during the 7th month of pregnancy, for which she did not receive medical interventions. His mother did receive a course of steroids to enhance fetal lung maturity.
  • the delivery was marked by several complications including shoulder dystocia and a clavicle fracture resulting from a complicated labor requiring external help, but no forceps.
  • Motor development during infancy progressed within normal limits. He held his head up at 2 months, sat at 7 moths, crawled at 10 months, and walked at 13 months. While first words were delayed (21 months), he used phrases by age 2.
  • Medical and neurological exams were normal for weight, height, head circumference, and hearing. Medical reports indicate he was taking 10 mg/day of methylphenidate since age 3.
  • Psychological testing indicated a diagnosis of autistic disorder confirmed by both the ADOS and ADI.
  • FIG. 3 A shows the genomic structure of CYFIP1 to scale with larger horizontal boxes representing exons, and the first (ATG) and last (Stop) coding exons indicated.
  • the site of the gene -trap insertion (identified as LTR-flanked TRAPPING CASSETTE) in intron 1 (5' to the first coding exon), is indicated.
  • mice with a disruption of both copies of Cyfipl were never recovered, and even at embryonic days 4 and 5 there was no evidence for knockout embryos.
  • LTP is an important measure of synaptic plasticity. Prior to LTP induction, the evoked synaptic input-output relationship was examined in all acute hippocampal slices. Test pulses (100 duration) were collected every 30 seconds. Input-output curves were generated by setting the stimulus intensity (5-200 ⁇ ) to evoke a half-maximal slope of field EPSP at this stimulus duration. An early phase LTP (E-LTP) was induced with 100 Hz tetanic stimulation for 1 second in hippocampal slices. There were no significant differences among the genotypes with this stimulation paradigm (FIG. 5A).
  • LTD is another important measure of synaptic plasticity and one that has been shown to be altered in the absence of FMRP.
  • field EPSPs were recorded at Schaffer collateral-CAl synapses in acute hippocampal slices prepared from wild-type and Cyfipl heterozygous mice.
  • PP-LFS paired-pulse low-frequency stimulation
  • mTOR mammalian target of rapamycin
  • mTOR mammalian target of rapamycin
  • mTOR mammalian target of rapamycin
  • mTOR is an important regulator of translation in long-lasting forms of synaptic plasticity and it has been shown that DHPG-induced mGluR-LTD in hippocampal area CA1 is dependent on mTOR (see Richter and Klann, 2009).
  • hippocampal slices were treated with DHPG in the presence of the mTOR inhibitor rapamycin.
  • Treatment of hippocampal slices with rapamycin abolished mGluR-LTD induced by DHPG in wild-type mice but did not affect LTD in the Cyfipl heterozygous mice (FIG. 9). Inhibition of protein synthesis-dependent LTP with rapamycin did not differ between wild-type and Cyfipl heterozygous mice.
  • mice lacking one functional copy of Cyfipl show enhanced LTD that is independent of protein synthesis.
  • This observation provides a mechanism by which CYFIPl gene changes can alter synaptic plasticity and function, and implicates shared mechanisms between FXS and loss of a functional copy of CYFIPl .
  • these Examples illustrate the present discovery that mGluRl and mGluR5 antagonists are surprisingly useful in combination for treatment of neurological or psychiatric diseases or disorders such as FXS, schizophrenia, Prader-Willi syndrome, Angelman syndrome and ASDs, including autism.
  • the BP1-BP2 region of 15ql l .2 has been implicated in schizophrenia and in more severe phenotypes in both PWS and AS.
  • the current results from patients suggest that this same region might increase risk for ASDs, likely in the presence of other genetic risk factors. This conclusion is consistent with recent reports.
  • a boy with a BP1-BP2 deletion was recently described: The boy presented with intellectual disability (ID), neurological disorder, developmental delay and speech impairment (Murthy et al., 2007). The deletion was inherited from a father with a similar, but milder phenotype. Not infrequently, genes associated with ID and/or developmental delay can also contribute to an ASD phenotype.
  • FMRP is an important regulator of translation in the brain and recently it has been shown that FMRP represses translation initiation (the rate limiting step in translation and hence an important target for regulation) via interaction with CYFIP1 (Napoli et al, 2008).
  • CYFIP1 functions like other eukaryotic initiation factor (elF) 4E-binding proteins (4E-BP), competing with eIF4G binding to eIF4E. Disrupting the eIF4E-eIF4G interaction inhibits translation as the bridge between the mRNA and the ribosomal preinitiation complex is lost (Costa-Mattioli et al., 2009). For canonical 4E-BP proteins, and perhaps for eIF4G, phosphorylation by an activated mTOR complex reverses the blockade on translation (Costa-Mattioli et al., 2009), a mechanism that may also occur with CYFIP1 (Napoli et al, 2008).
  • 4E-BP eukaryotic initiation factor
  • 4E-BP eukaryotic initiation factor 4E-binding proteins
  • LTP in CA1 induced by high frequency stimulation is also known to be unaffected in Fmrl knockout mice (Godfraind et al. 1996; Paradee et al. 1999), however, LTP elicited by threshold theta burst afferent stimulation is impaired in young adult Fmrl knockout mice (Lauterborn et al., 2007) which is reversed by BDNF perfusion. Whether this is an age- specific effect or a difference between the two models remains to be determined.
  • the present Examples demonstrate a role for BP1-BP2 CNVs in phenotypes in patients with an ASD, as well as in patients with additional psychiatric conditions including schizophrenia, PWA, and AS. Testing for BP1-BP2 CNVs is therefore important in etiological diagnosis in these patients.
  • disruption of CYFIP1 i.e. a CYFIP1 gene change
  • CNV CNV
  • mutation can contribute to etiology in some cases of ASD and other psychiatric conditions.
  • the development of a mouse model with a loss of a functional copy of Cyfipl, as disclosed in the present Examples provides an important resource to understand the role of this gene in psychiatric illness and in screening potential therapies.
  • the present invention also centers on the discovery that mGluR may be targeted with a specific combination of mGluRl and mGluR5 antagonists.
  • the use of the two antagonists together produced results superior to those of either alone, demonstrating that a combined approach is highly beneficial in patients having a 15ql l .2 CNV, e.g., patients having schizophrenia, Prader-Willi syndrome, Angelman syndrome and ASD, and also in patients with FXS.
  • Marianne Doornbos et al. "Nine patients with a microdeletion 15ql l .2 between breakpoints 1 and 2 of the Prader-Willi critical region, possibly associated with behavioural disturbances," European Journal of Medical Genetics 52, no. 2-3 (June 2009): 108-115, doi: 10.1016/j.ejmg.2009.03.010.
  • Trilochan Sahoo et al. "Prader-Willi phenotype caused by paternal deficiency for the HBII-85 C/D box small nucleolar RNA cluster," Nature Genetics 40, no. 6(June 2008): 719-721, doi: 10.1038/ng. l58.

Landscapes

  • Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Psychiatry (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)

Abstract

L'invention porte sur des procédés de traitement d'une maladie ou d'un trouble psychiatrique ou neurologique à l'aide de combinaisons d'antagonistes mGluR de groupe 1. Dans certains aspects, ces procédés comprennent le traitement d'un patient ayant une maladie ou un trouble neurologique ou psychiatrique associé à un changement de gène CYFIP1.
PCT/US2010/054260 2009-10-27 2010-10-27 Procédés de traitement de troubles psychiatriques ou neurologiques avec des antagonistes mglur WO2011053636A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/504,847 US20130225623A1 (en) 2010-10-27 2010-10-27 Methods of Treating Psychiatric or Neurological Disorders with MGLUR Antagonists

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US25534009P 2009-10-27 2009-10-27
US61/255,340 2009-10-27

Publications (1)

Publication Number Publication Date
WO2011053636A1 true WO2011053636A1 (fr) 2011-05-05

Family

ID=43922510

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/054260 WO2011053636A1 (fr) 2009-10-27 2010-10-27 Procédés de traitement de troubles psychiatriques ou neurologiques avec des antagonistes mglur

Country Status (1)

Country Link
WO (1) WO2011053636A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120329851A1 (en) * 2011-05-27 2012-12-27 Foster Alan C D-serine transporter inhibitors as pharmaceutical compositions for the treatment of central nervous system disorders
US20130122102A1 (en) * 2011-11-06 2013-05-16 Murty Pharmaceuticals, Inc. Delivery Systems For Improving Oral Bioavailability of Fenobam, Its Hydrates, And Salts
WO2016164768A1 (fr) * 2015-04-08 2016-10-13 University Of Georgia Research Foundation, Inc. Dislocation du complexe de la protéine wave3 pour supprimer l'invasion et la métastase
US20160375000A1 (en) * 2015-06-26 2016-12-29 Korea Advanced Institute Of Science And Technology Pharmaceutical composition for prevention and treatment of mental disease with enhanced nmdar function
JP2020514398A (ja) * 2017-03-21 2020-05-21 上海 インスティテューツ フォー バイオロジカル サイエンシーズ、チャイニーズ アカデミー オブ サイエンシーズＳｈａｎｇｈａｉ Ｉｎｓｔｉｔｕｔｅｓ Ｆｏｒ Ｂｉｏｌｏｇｉｃａｌ Ｓｃｉｅｎｃｅｓ， Ｃｈｉｎｅｓｅ Ａｃａｄｅｍｙ Ｏｆ Ｓｃｉｅｎｃｅｓ Ａｌｄｈ１ａおよびその作動剤、触媒産物と阻害剤の使用
US11791941B2 (en) 2015-12-31 2023-10-17 Nec Corporation Methods and apparatuses for transmitting and receiving uplink information

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002078745A2 (fr) * 2001-04-02 2002-10-10 Brown University Research Foundation Compositions et utilisations d'antagonistes de mglur5
US20050171067A1 (en) * 2001-04-02 2005-08-04 Brown University Methods of treating disorders with group I mGluR antagonists
WO2008066750A1 (fr) * 2006-11-22 2008-06-05 Seaside Therapeutics, Llc Procédés de traitement du retard mental, du syndrome de down, du syndrome de l'x fragile et de l'autisme

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002078745A2 (fr) * 2001-04-02 2002-10-10 Brown University Research Foundation Compositions et utilisations d'antagonistes de mglur5
US6890931B2 (en) * 2001-04-02 2005-05-10 Brown University Methods of treating disorders with group I mGluR antagonists
US20050171067A1 (en) * 2001-04-02 2005-08-04 Brown University Methods of treating disorders with group I mGluR antagonists
WO2008066750A1 (fr) * 2006-11-22 2008-06-05 Seaside Therapeutics, Llc Procédés de traitement du retard mental, du syndrome de down, du syndrome de l'x fragile et de l'autisme

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
CHAI ET AL.: "Identification of Four Highly Conserved Genes between Breakpoint Hotspots BP1 and BP2 of the Prader-Willi/Angelman Syndromes Deletion Region That Have Undergone Evolutionary Transposition Mediated by Flanking Duplicons.", AM. J. HUM. GENET., vol. 73, no. 4, October 2003 (2003-10-01), pages 898 - 925 *
CHUANG ET AL.: "Prolonged Epileptiform Discharges Induced by Altered Group I Metabotropic Glutamate Receptor-Mediated Synaptic Responses in Hippocampal Slices of a Fragile X Mouse Model.", THE JOUMAL OF NEUROSCIENCE, vol. 25, no. 35, 31 August 2005 (2005-08-31), pages 8048 - 8055 *
FRACARRO ET AL.: "Deficiency, transposition, and duplication of one 15q region may be alternatively associated with Prader-Willi (or a similar) Analysis of seven cases after varying ascertainment.", HUM GENET, vol. 64, no. 4, 1983, pages 388 - 394 *
NICHOLLS ET AL.: "Restriction Fragment Length Polymorphisms Within Proximal 15q and Their Use in Molecular Cytogenetics and the Prader-Willi Syndrome.", AMERICAN JOURNAL OF MEDICAL GENETICS, vol. 33, no. 1, May 1989 (1989-05-01), pages 66 - 77 *
STEFANSSON ET AL.: "Large recurrent microdeletions associated with schizophrenia.", NATURE., vol. 455, no. 7210, 11 September 2008 (2008-09-11), pages 232 - 236 *
VOLK ET AL.: "Differential Roles for Group 1 mGIuR Subtypes in Induction and Expression of Chemically Induced Hippocampal Long-Term Depression.", J NEUROPHYSIOL, DIFFERENTIAL ROLES FOR GROUP 1 MGIUR SUBTYPES IN INDUCTION AND EXPRESSION OF CHEMICALLY INDUCED HIPPOCAMPAL LONG-TERM DEPRESSION, vol. 95, no. 4, April 2006 (2006-04-01), pages 2427 - 2438 *
YEN ET AL.: "Suppression of two major Fragile X Syndrome mouse model phenotypes by the mGluR5 antagonist MPEP.", NEUROPHARMACOLOGY, vol. 49, no. 7, December 2005 (2005-12-01), pages 1053 - 1066 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120329851A1 (en) * 2011-05-27 2012-12-27 Foster Alan C D-serine transporter inhibitors as pharmaceutical compositions for the treatment of central nervous system disorders
US20170172957A1 (en) * 2011-05-27 2017-06-22 Allergan, Inc. D-serine transporter inhibitors as pharmaceutical compositions for the treatment of central nervous system disorders
US8741955B2 (en) * 2011-05-27 2014-06-03 Allergan, Inc. D-serine transporter inhibitors as pharmaceutical compositions for the treatment of central nervous system disorders
EP2773344A4 (fr) * 2011-11-06 2015-05-13 Santos B Murty Systèmes d'administration pour améliorer la biodisponibilité orale du fénobam, de ses hydrates et de ses sels
US20130122102A1 (en) * 2011-11-06 2013-05-16 Murty Pharmaceuticals, Inc. Delivery Systems For Improving Oral Bioavailability of Fenobam, Its Hydrates, And Salts
US9717678B2 (en) * 2011-11-06 2017-08-01 Murty Pharmaceuticals, Inc. Delivery systems for improving oral bioavailability of Fenobam, its hydrates, and salts
WO2016164768A1 (fr) * 2015-04-08 2016-10-13 University Of Georgia Research Foundation, Inc. Dislocation du complexe de la protéine wave3 pour supprimer l'invasion et la métastase
EP3280431A4 (fr) * 2015-04-08 2018-10-17 University of Georgia Research Foundation Inc. Dislocation du complexe de la protéine wave3 pour supprimer l'invasion et la métastase
US10822380B2 (en) 2015-04-08 2020-11-03 University Of Georgia Research Foundation, Inc. Disruption of the WAVE3 protein complex for suppression of invasion and metastasis
US11773146B2 (en) 2015-04-08 2023-10-03 University Of Georgia Research Foundation, Inc. Disruption of the WAVE3 protein complex for suppression of invasion and metastasis
US20160375000A1 (en) * 2015-06-26 2016-12-29 Korea Advanced Institute Of Science And Technology Pharmaceutical composition for prevention and treatment of mental disease with enhanced nmdar function
US11791941B2 (en) 2015-12-31 2023-10-17 Nec Corporation Methods and apparatuses for transmitting and receiving uplink information
JP2020514398A (ja) * 2017-03-21 2020-05-21 上海 インスティテューツ フォー バイオロジカル サイエンシーズ、チャイニーズ アカデミー オブ サイエンシーズＳｈａｎｇｈａｉ Ｉｎｓｔｉｔｕｔｅｓ Ｆｏｒ Ｂｉｏｌｏｇｉｃａｌ Ｓｃｉｅｎｃｅｓ， Ｃｈｉｎｅｓｅ Ａｃａｄｅｍｙ Ｏｆ Ｓｃｉｅｎｃｅｓ Ａｌｄｈ１ａおよびその作動剤、触媒産物と阻害剤の使用
EP3622950A4 (fr) * 2017-03-21 2020-12-16 Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences Utilisation d'aldh1a et d'un agoniste, d'un catalyseur et d'un inhibiteur de celui-ci
JP7068334B2 (ja) 2017-03-21 2022-05-16 センター フォー エクセレンス イン モレキュラー セル サイエンス，チャイニーズ アカデミー オブ サイエンシーズ Ａｌｄｈ１ａおよびその作動剤、触媒産物と阻害剤の使用

Similar Documents

Publication Publication Date Title
US20130225623A1 (en) Methods of Treating Psychiatric or Neurological Disorders with MGLUR Antagonists
Harris et al. Genetic and pharmacologic manipulation of TLR4 has minimal impact on ethanol consumption in rodents
Kleijer et al. Neurobiology of autism gene products: towards pathogenesis and drug targets
Kennedy et al. Tcf4 regulates synaptic plasticity, DNA methylation, and memory function
JP6884703B2 (ja) 障害を治療するための５ｈｔ作動薬
Xu et al. mGluR5 has a critical role in inhibitory learning
Provenzano et al. Mutant mouse models of autism spectrum disorders
Cope et al. Abolition of zolpidem sensitivity in mice with a point mutation in the GABAA receptor γ2 subunit
WO2011053636A1 (fr) Procédés de traitement de troubles psychiatriques ou neurologiques avec des antagonistes mglur
Modi et al. Hyperactivity and hypermotivation associated with increased striatal mGluR1 signaling in a Shank2 rat model of autism
US20150313913A1 (en) Positive allosteric modulators of the gaba-a receptor in the treatment of autism
Bellini et al. Neuronal glutamate transporters control dopaminergic signaling and compulsive behaviors
Caldwell et al. Social context, stress, neuropsychiatric disorders, and the vasopressin 1b receptor
Porro et al. β‐adducin (Add2) KO mice show synaptic plasticity, motor coordination and behavioral deficits accompanied by changes in the expression and phosphorylation levels of the α‐and γ‐adducin subunits
Premoli et al. Ultrasonic vocalizations in mice: relevance for ethologic and neurodevelopmental disorders studies
Qiu et al. Modeling of autism genetic variations in mice: focusing on synaptic and microcircuit dysfunctions
CA3036984A1 (fr) Utilisation de la pridopidine pour le traitement du syndrome de rett
Hawkins et al. Epilepsy and neurobehavioral abnormalities in mice with a dominant-negative KCNB1 pathogenic variant
KR102537686B1 (ko) D-아미노산 옥시다제 억제제로서 공지된 화합물의 용도
Drake et al. Imprinted Rasgrf1 expression in neonatal mice affects olfactory learning and memory
US20220331333A1 (en) Rhoa pathway inhibitor in the treatment of neurodevelopmental disorder or neuropsychiatric disorder
Kopp et al. Gtf2i and Gtf2ird1 mutation are not sufficient to reproduce mouse phenotypes caused by the Williams Syndrome critical region
Lagojda Investigating Cerebellar Mechanisms of Schizophrenia by Using a Pharmacological Mouse Model: Regulation of Voltage-gated Potassium Channels
KR20140019208A (ko) Ｓｈａｎｋ2 유전자가 결실된 자폐증 모델 형질전환마우스 및 그 용도
Lam Characterization of Williams-Beuren Syndrome Mouse Models: Linking Genes with Cognition and Behaviour

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10827426

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13504847

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 10827426

Country of ref document: EP

Kind code of ref document: A1