WO2011050281A2 - A method of controlling plant growth and architecture by controlling expression of gibberellin 2-oxidase - Google Patents
A method of controlling plant growth and architecture by controlling expression of gibberellin 2-oxidase Download PDFInfo
- Publication number
- WO2011050281A2 WO2011050281A2 PCT/US2010/053786 US2010053786W WO2011050281A2 WO 2011050281 A2 WO2011050281 A2 WO 2011050281A2 US 2010053786 W US2010053786 W US 2010053786W WO 2011050281 A2 WO2011050281 A2 WO 2011050281A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- amino acid
- plant
- acid sequence
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8291—Hormone-influenced development
- C12N15/8297—Gibberellins; GA3
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
Definitions
- Gs Gibberellins
- GAs are a class of essential hormones controlling a variety of growth and development processes during the entire life cycle of plants, including seed germination, apical dominance, leaf expansion, stem elongation, root growth, floral initiation, anther development and fruit maturation (Harberd et al., 1998; Ross et al., 1997; Hedden and Phillips, 2000, Kin and Evan, 2003, Sun and Gubler, 2004; Kende and Zeevaart, 1997, del Pozo, et al., 2005).
- GAs are substituted tetracyclic diterpene carboxylic acids formed over several biosynthetic steps (Hedden and Phillips, 2000).
- 136 different GAs have been identified in plants, fungi and bacteria (see for example, the World Wide Web site of plant-hormones.info/gibberellins); however, most of these GAs are precursors or degradation products.
- the bioactive GAs synthesized by higher plants are GA ls GA 3 , GA 4 , and GA 7 (Hedden and Phillips, 2000).
- the GA biosynthetic pathway can be classified into three stages, with three classes of enzymes involved, including terpene cyclases, cytochrome P450 monooxygenases (CYP450s), and 2-oxoglutarate-dependent dioxygenases (2-ODDs, including GA 20-oxidase, GA 7- oxidase, GA 3-oxidase, and GA 2-oxidase) (Olszewski et al., 2002; Graebe, 1987, Hedden and Phillip, 2000, Sakamoto et al., 2004).
- Mutants defective in GA biosynthesis have been identified in a variety of plant species, with the most prominent phenotypes being reduced internode length and small dark green leaves (Koornneef and van der Veen, 1980). Other phenotypes include prolonged germination dormancy, inhibited root growth, defective flowering, reduced seed production, and male sterility (King and Evans, 2003, Sakamoto et al., 2004, Tanimoto, 2005, Wang and Li, 2005).
- GA 2-oxidases are a class of 2-ODDs (Thomas, et al., 1999; Sakamoto, et al.,
- the class C19 GA2oxs identified in various plant species can hydroxylate the C-2 of active C ⁇ -GAs (GA ⁇ and
- GA 4 or C ⁇ -GA precursors (GA 20 and GA9) to produce biologically inactive GAs (GA 8 , GA 34 ,
- GA precursors (converting GAi 2 and GA 53 to GAno and GAc> 7 , respectively) but not Qg-GAs (Schomburg et al., 2003, Lee and Zeevaart, 2005).
- Qg-GAs Schomburg et al., 2003, Lee and Zeevaart, 2005.
- GAno and GA97 renders them unable to be converted to active GAs and thus decreases active GA levels.
- the class C20 GA2oxs contain three unique and conserved amino acid domains that are absent in the class CI 9 GA2oxs (Lee and Zeevaart, 2005).
- GA2oxs The physiological function of GA2oxs has been studied in a variety of plant species. Arabidopsis GA2oxl and GA2ox2 were found to be expressed in inflorescences and developing siliques, which is consistent with a role of GA2oxs in reducing GA levels and promoting seed dormancy (Thomas et al., 1999). Further study with the pea slender mutant, where the SLENDER gene encoding a GA2ox had been knocked out, showed that GA level increased during germination, and resultant seedlings were hyperelongated (Martin et al., 1999).
- the application also describes methods related to GA2ox genes, such as a method of inhibiting stem elongation and promoting tiller growth in a plant by controlling the expression of a GA2ox gene in a plant.
- the present invention relates to a method of obtaining at least one desirable feature of enhanced stress tolerance and stronger and thicker stem of a plant compared to a control plant.
- the method comprises obtaining a transgenic plant, wherein the transgenic plant comprises a recombinant polynucleotide encoding a polypeptide selected from the group consisting of:
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
- amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO: 75;
- the mutant C20 GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that does not comprise the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17, and
- polypeptide when expressed in the transgenic plant, confers the at least one desirable feature of enhanced stress tolerance and stronger and thicker stem to the transgenic plant as compared to the control plant grown under the same conditions.
- Another general aspect of the present invention relates to a method of obtaining at least one desirable feature of enhanced stress tolerance and stronger and thicker stem of a plant compared to a control plant, the method comprising increasing expression of a gibberellin 2-oxidase or a derivative thereof in the plant as compared to the control plant.
- the method comprising increasing the expressio of a polypeptide selected from the group consisting of:
- polypeptide having an amino acid sequence that is at least about 80%) identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
- SEQ ID NO:8 wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO: 73;
- domain III of class C20 GA2ox the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C 20 -GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17.
- polypeptide when its expression is increased in the plant, results in reduced amount of endogenous bioactive gibberellins as compared to the control plant grown under the same conditions.
- the present invention relates to an isolated nucleic acid comprising a nucleotide sequence that encodes a polypeptide selected from the group consisting of:
- SEQ ID NO:6 wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:14 or at least about 80% identical to SEQ ID NO:16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
- the present invention relates to an isolated polypeptide comprising an amino acid sequence selected from the group consisting of: (1) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
- amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
- amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
- Another general aspect of the present invention relates to an isolated nucleic acid comprising a nucleotide sequence that encodes a mutant class C20 gibberellin 2-oxidase protein (GA2ox), the mutant GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C 20 -GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, wherein the domain III comprises an amino acid sequence of SEQ ID NO: 17.
- G2ox gibberellin 2-oxidase protein
- Another general aspect of the present invention relates to an isolated polypeptide comprising a mutant class C20 gibberellin 2-oxidase (GA2ox), the mutant GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C 20 -GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, wherein the domain III comprises the amino acid sequence of SEQ ID NO: 17.
- G2ox gibberellin 2-oxidase
- the present invention relates to a transgenic plant comprising a transgene, wherein the transgene encodes a polypeptide selected from the group consisting of:
- amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
- SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75;
- the present invention also relates to a propagation material obtained from the transgenic plant of the present invention, wherein the propagation material contains the transgene.
- the present invention relates to a method of producing a transgenic plant according to embodiments of the present invention, comprising:
- Another general aspect of the present invention relates to a method of inhibiting plant growth, comprising:
- Another general aspect of the present invention relates to a method of obtaining a semi- dwarf transgenic plant, comprising:
- Another general aspect of the present invention relates to a method of inhibiting stem elongation and promoting tiller growth in a plant, comprising administering to the plant a compound that increases the expression of a gene encoding a polypeptide or a compound that increases the enzymatic activity of the polypeptide in the plant, wherein the polypeptide is selected from the group consisting of:
- SEQ ID NO:10 or at least about 80% identical to SEQ ID NO:12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74; and (f) a polypeptide having an amino acid sequence that is at least about 80% identical to
- SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
- Another general aspect of the present invention relates to a method of identifying a compound that inhibits stem elongation and promotes tiller growth in a plant, comprising identifying a compound that increases the expression of a gene encoding a polypeptide or a compound that increases the enzymatic activity of the polypeptide in the plant, wherein the polypeptide is selected from the group consisting of:
- SEQ ID NO:6 wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
- Figs. 1A-1C illustrate the rice GA2ox family: Fig. 1 A shows chromosome locations of
- GA2oxs as determined by the NCBI map viewer program (www.ncbi.nlm.nih.gov/mapview/); Fig.
- IB shows the phylogenetic tree based on the comparison of deduced amino acid sequences of rice
- Fig. 1C shows the phylogenetic tree based on the comparison of amino acid sequences of
- Figs. 2A-2C illustrate differential expression of GA2oxs that correlated with flower and tiller development:
- Fig. 2 A shows various developmental phases during the life cycle of rice;
- Fig. 2B shows temporal expression patterns of GA2oxs in rice, wherein the 18S rR A gene (rRNA) was used as a control;
- Fig. 2C shows tiller development during the life cycle of rice, wherein a total of 8 plants were used for counting tiller number and error bars indicate the SE (standard errors) of the mean at each time point, and DAI means days after imbibition;
- Figs. 3A and 3B illustrate decrease in GA2ox6 expression that correlated with seed germination: Fig. 3 A shows that germination rate of rice seeds reached 100% at 2 DAI; Fig. 3B shows expression patterns of GA2oxs in rice seeds between 0 ⁇ 5 DAI, wherein total R As were isolated from embryos at each time point and analyzed by RT-PCR, and wherein the 18S rRNA gene (rRNA) was used as a control;
- Figs 4A -4D illustrate four GA2ox mutants identified from the TRIM mutant library:
- Fig. 4A shows the severely dwarf mutant M77777, designated as GA2OX3 A CT , which carries a T-DNA insertion at a position 587 bp upstream of the translation start codon of GA2ox3, wherein
- Fig. 4B shows the semi-dwarf mutant M27337, designated as GA2OX5A335-341 A CT, which carries a T-DNA insertion in the coding region, at a position 23 bp upstream of the translation stop codon of GA2ox5, wherein accumulation of the truncated GA2ox5 mRNA was significantly enhanced by T-DNA activation tagging in both heterozygous and homozygous (T/T) mutants; Fig.
- FIG. 1C shows the severely dwarf mutant M47191, designated as GA2OX6ACT, which carries a T-DNA insertion at a position 2.1 kb upstream of the translation start codon of GA2ox6, wherein accumulation of GA2ox6 mRNA was significantly enhanced by T-DNA activation tagging in both heterozygous and homozygous mutants; and Fig.
- 4D shows the semi-dwarf mutant M58817, designated as GA2OX9ACT, which carries a T-DNA insertion at a position 2.4 kb upstream of the translation start codon of GA2ox9, wherein accumulation of GA2ox9 mRNA was significantly enhanced by T-DNA activation tagging in the homozygous mutant; wherein in the diagram, an asterisk indicates translation start codon, filled box indicates exon, triangle indicates T-DNA, arrowheads indicate position of primers used for RT-PCR analysis, and scale bar represents DNA length for each gene, and the open box in the triangle indicates the position of the CaMV35S enhancers (next to the left border of T-DNA);
- Figs. 5A-5C illustrate that activation of GA2oxs expression had different effect on seed germination and seedling growth:
- Fig. 5A shows morphology of Tl seedlings at 18 DAI;
- Fig. 5B shows that seedling heights of GA2OX5A335-341 A CT and GA2OX9 A CT mutants were slightly shorter while seedlings of GA2OX6 A CT were severely shorter than the wild type, wherein heights of 8 plants in each line were measured and error bars indicate the SE of the mean at each time point;
- Fig. 5A shows morphology of Tl seedlings at 18 DAI
- Fig. 5B shows that seedling heights of GA2OX5A335-341 A CT and GA2OX9 A CT mutants were slightly shorter while seedlings of GA2OX6 A CT were severely shorter than the wild type, wherein heights of 8 plants in each line were measured and error bars indicate the SE of the mean at each time point;
- 5C shows that as compared with the wild type, germination rate was normal for GA2OX9 A CT mutant, slightly delayed for GA2ox5A335-341 A C T mutant, and significantly delayed for GA2OX6 A C T mutant; wherein germination rates of 154, 20, 156, 49 seeds for TNG67, GA2OX5A335-341 A CT, GA2OX6 CT, and GA2OX9A C T, respectively, were determined at each time point, and + and - indicate the presence and absence, respectively;
- Figs. 6A-6D illustrate that overexpression of GA2ox5 and GA2ox6 recapitulated the dwarf phenotypes in transgenic rice and tobacco: Figs. 6A and 6B show that expression of
- Ubi: :GA2ox5 and Ubi::GA2ox6, respectively resulted in dwarfism in transgenic rice as compared with control rice transformed with vector pCAMBIA1301 only (CK);
- Fig. 6C and 6D show that expression of Ubi::GA2ox5 and Ubi::GA2ox6, respectively, resulted in different degrees of dwarfism in transgenic tobacco as compared with control tobacco transformed with vector only
- Figs. 7A -7C show that overexpression of GA2ox6 reduced GA levels in rice mutant in which only shoot but not root growth was affected:
- Fig. 7A shows that treatment with GA 3 (5 ⁇ ) promoted germination and seedling growth of GA2OX6 A CT mutant (photo taken at 6 DAI);
- Fig. 7B shows that overexpression of GA2ox6 in rice mutants reduced shoot but not root growth, wherein treatment with GA 3 (5 ⁇ ) recovered plant height of the GA2OX6ACT mutant and root growth of both wild type and mutant, and a total of 8 plants were used for measuring plant height and root length and error bars indicate the SE of the mean;
- Fig. 7A shows that treatment with GA 3 (5 ⁇ ) promoted germination and seedling growth of GA2OX6 A CT mutant (photo taken at 6 DAI);
- Fig. 7B shows that overexpression of GA2ox6 in rice mutants reduced shoot but not root growth, wherein treatment with GA 3 (5 ⁇ ) recovered plant height of the GA2OX6
- FIG. 7C illustrates that accumulation of GA2ox6 mR A in leaves and roots of wild type and mutant seedlings (at 18 DAI) was not altered by GA 3 treatment, wherein thel8S rRNA gene (rRNA) was used as a control, and WT stands for wild type;
- Figs. 8A-8F illustrate that overexpression of GA2ox5 and GA2ox6 promoted early tiller and adventitious root growth and affects root architecture:
- Fig. 8A shows that swelling on the embryo surface adjacent to the base of the first seedling/tiller (IT) was observed in the GA2OX6 AC T mutant and Ubi::OsGA2ox5 and Ubi::OsGA2ox6 transgenic rice (panels 2-4) and not in the wild type (panel 1) (photos taken at 3 DAI);
- Fig. 8 B shows that a second tiller (2T) grew out from the swollen embryo surface of mutant and transgenic rice (photo taken at 9 DAI);
- FIG. 8C shows that three tillers formed in some seedlings of mutant and transgenic rice (photo taken at 15 DAI);
- Fig. 8D shows that each tiller grew out of its own coleoptile and all new tillers in the mutant and transgenic rice had their own adventitious roots (photo taken at 21 DAI), wherein panel 2 is a higher magnification of the boxed area in panel 1 that reveals coleoptiles (1C and 2C, respectively) and adventitious roots (1R and 2R, respectively) of the first and second tillers;
- FIG. 8E shows dwarfism and early tillering of seedlings of mutant and transgenic rice as compared with the wild type (photo taken at 12 DAI), wherein panel 2 is a higher magnification of the boxed area in panel 1 that reveals first and second tillers;
- Fig. 8F shows that mutant and transgenic roots became highly curled and zigzag (panel 2) as compared with the wild type (panel 1), wherein photos were taken at 15 DAI from the bottom of agar plates for better visualization of root growth and WT stands for wild type.
- Figs. 9A-C show that overexpression of GA2ox5 and GA2ox6 decreased plant heights, but increased tiller numbers and root numbers: Fig. 9A shows plant heights of various plants; Fig. 9B shows tiller of various plants; Fig. 9C shows root numbers of various plants; wherein mutant or transgenic rice seeds germinated on MS agar medium for 18 DAI, ten plants in each line were averaged and error bars indicate the SE of the mean, and wherein WT stands for wild type;
- Figs. 10A and 10B illustrate that mutations in domain III affected the activity of GA2ox5 and GA2ox6:
- Fig. 10A shows design of constructs encoding the full-length and domain Ill-truncated GA2ox5 and GA2ox6, wherein boxes indicate positions of three highly conserved amino acid domains, and the last amino acid residue was shown at the C-terminus of deduced polypeptides;
- Fig. 10B shows the comparison of morphology among transgenic rice overexpressing full-length and domain-III-truncated GA2ox5 and GA2ox6 and vector pCAMBIA1301 only (CK);
- Fig. 11 illustrates amino acid sequence alignment of rice GA2oxs, including OsGA2ox5 (SEQ ID NO: 2), OsGA2ox6 (SEQ ID NO:4) and OsGA2ox9 (SEQ ID NO: 10); Arabidopsis GA2oxs, including AtGA2ox7 (SEQ ID NO: 24) and AtGA2ox8 (SEQ ID NO:25); and spinach
- GA2ox including SoGA2ox3 (SEQ ID NO: 26), using the Vector NTI 6.0 software (InforMaxJnc), wherein these GA2oxs contain three highly conserved domains (underlined) that are absent in other
- Figs. 12 A and 12 B show dwarfism of Ubi::GA2ox6 transgenic rice that is partially rescued by GA 3 : Wild type (WT) and Ubi: :GA2ox6 transgenic rice grown in pot soil were treated with (+) or without (-) 10 ⁇ GA 3 at a 12-day interval for 5 weeks; the height of WT plant was not altered, while that of transgenic plant was enhanced, by GA 3 treatment; Figure 12A shows morphology of plants, and Figure 12B shows growth curve of plants; the height of transgenic plants increased linearly during first 10 days, tapered off afterward, and finally only reached 63% of the
- Fig. 13 is schematic diagram that shows GA catabolism and response pathways:
- bioactive GA positively regulates germination, stem and root elongation, and flower development, but negatively regulates OSH1 and TBI that control tillering; bioactive GA also negatively regulates adventitious root development;
- Figs. 14A and 14B illustrate that GA 3 suppresses OSH1 and TBI expression:
- Fig. 14A shows the relative mR A levels of OSH1 and TBI in Wild type (WT), GA2OX6 ACT and
- GA2ox5 335-341 ACT mutants seeds were germinated in MS agar medium with (+) or without (-) 5 ⁇ GA 3 , total RNAs were isolated from embryos that containing tiller buds at 12 DAI and analyzed by RT-PC using primers that specifically amplified rice OSH1 and TBI cDNAs, the highest mRNA level was assigned a value of 100, and mRNA levels of other samples were calculated relative to this value, error bars indicate the SE for three replicate experiments;
- Fig. 14B shows photographs of the seedlings analyzed in Fig.
- panels (1) and (2) are higher magnifications of boxed areas for GA2ox5A335-34lACT&nd GA2OX6ACT mutants without GA 3 treatment to reveal the main stem (MS) and first tiller (IT);
- Figs. 15A and 15B show that GA 3 represses tiller growth independent of growth stages:
- Fig. 15A shows GA2OX6ACT mutant and wild type seedlings grown on MS agar medium with or without GA 3 (5 ⁇ ) for 15 days, the lower left panel is a higher magnification of the boxed area for the GA2OX6ACT mutant treated with GA3 to reveal the main stem and first tiller; MS means main stem; IT means first tiller; and 1L means first true leave; and Fig. 15B shows 1 -month-old wild type and GA2OX6 A CT mutant plants sprayed with 10 ⁇ GA 3 or water only every 7 days for a total of 3 sprays: + and -, presence and absence of 10 ⁇ GA 3 , respectively. [0042] Figs.
- FIG. 16A-C illustrate that GA deficiency enhanced the strength of stem and root and increased the number of leaves at seedling stages:
- Fig. 16A shows a photograph of the intact seedlings taken at 12 DAI: stems of mutant and transgenic rice were thicker than that of the wild type (TNG67);
- Fig. 16B shows a photograph of the root system of the seedlings taken at 12 DAI: the mutants and transgenic rice had higher number and stronger roots;
- Fig. 16C illustrates that GA deficiency enhanced the number of leaves;
- Figs. 17A-C illustrate that GA deficiency enhanced the drought tolerance of the plant:
- Fig. 17A shows a photograph of the well watered plant of wild type, GA2OX6 A CT, Ubi:GA2ox5, and UB:iGA2ox6;
- Fig. 17B illustrates that GA deficient mutant and transgenic rice had higher drought tolerance after 20 days without watering;
- Fig. 17C is the magnification of the wild type and GA2OX6A C T plants, illustrating that the GA deficient mutant kept growing and its leaves remained green under the drought condition while the wild type wilted;
- Fig. 18 A and B illustrate that GA deficiency enhanced cold tolerance of the plant:
- Fig. 18A shows a photograph of 15-day-old seedlings after they were incubated at 28°C or 4°C for 6 days, the seedlings shown are: wild type, GA2OX9 A CT, GA2OX6 A CT and Ubi:GA2ox5;
- Fig. 18B shows a photograph of 15-day-old seedlings after they were incubated at 4°C for 6 days, then transferred to 28°C and recovered for 5 days, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6ACT and Ubi:GA2ox5;
- Fig. 19A and B illustrate that GA deficiency enhanced freezing tolerance of the plant:
- Fig. 19B shows a photograph of 15-day-old seedlings after they were incubated at -20°C for 30 min, then transferred to 28°C and recovered for 5 days, the seedlings shown are: wild type, GA2OX9 A CT, GA2OX6 A CT and Ubi:GA2ox5;
- Fig. 20A and B illustrate that GA deficiency enhanced salt tolerance of the plant:
- Fig. 20A shows a photograph of 15-day-old seedlings after they were incubated in water or 200 mM NaCl solution at 28°C for 2 days, the seedlings shown are: wild type, GA2OX9 A C T , GA2OX6 A CT and Ubi:GA2ox5;
- Fig. 20B shows a photograph of 15-day-old seedlings after they were incubated with 200 mM NaCl for 2 days, then transferred to water and recovered for 5 days, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6ACT and Ubi:GA2ox5;
- Fig. 21 A and B illustrate that GA deficiency enhanced heat tolerance of the plant:
- Fig. 21 A shows a photograph of 15-day-old seedlings after they were incubated at 28°C or 42°C for 42 hours, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6 A CT and Ubi:GA2ox5;
- Fig. 21B shows a photograph of 15-day-old seedlings after they were incubated at 42°C for 42 hours, then transferred to 28°C and recovered for 5 days, the seedlings shown are: wild type, GA2OX9A C T,
- Fig. 21 A and B illustrate that GA deficiency enhanced heat tolerance of the plant:
- Fig. 21A shows a photograph of 15-day-old seedlings after they were incubated at 28°C or 42°C for 42 hours, the seedlings shown are: wild type, GA2OX9 a CT, GA2OX6 AC T and Ubi:GA2ox5;
- Fig. 21 B shows a photograph of 15-day-old seedlings after they were incubated at 42°C for 42 hours, then transferred to 28°C and recovered for 5 days, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6 A CT and Ubi:GA2ox5;
- Fig. 22A and B illustrate that GA deficiency enhanced drought tolerance of the plant: they show photographs of 40-day-old plants that were well-watered (Fig. 22A) or de-hydrated (Fig. 22B) at 28°C for 14 days, the plants shown are: wild type, GA2OX6 a CT Ubi:GA2ox5 and
- Fig. 23 illustrates that GA deficiency enhanced submergence tolerance of the plant: it shows a photograph of 6-day-old seedlings grown in the air (-)or submerged in water (+) at 28°C for 7 days, then both the air-grown and the submerged seedlings were grown in the air for 5 days, the plants shown are: wild type, GA2OX9 A CT, GA2OX6 a CT and Ubi:GA2ox5.
- the term "gene” refers to a segment of DNA involved in producing a functional RNA.
- a gene includes the coding region, non-coding regions preceding ("5'UTR") and following ("3'UTR") the coding region, alone or in combination.
- the functional RNA can be an mRNA that is translated into a peptide, polypeptide, or protein.
- the functional RNA can also be a non-coding RNA that is not translated into a protein species, but has a physiological function otherwise. Examples of the non-coding RNA include, but are not limited to, a transfer RNA
- tRNA ribosomal RNA
- rRNA ribosomal RNA
- micro RNA a ribozyme
- a “gene” can include intervening non-coding sequences ("introns") between individual coding segments (“exons”).
- coding region refers to the portion of a gene that is transcribed into an mRNA, which is translated into a polypeptide and the start and stop signals for the translation of the corresponding polypeptide via triplet-base codons.
- a “coding region” or “coding sequence” also refers to the portion of a gene that is transcribed into a non-coding but functional RNA.
- a "promoter” refers to a portion of a gene that provides a control point for regulated gene transcription.
- a promoter can include a binding site for RNA polymerase.
- a promoter can also include one or more binding sites for one or more transcription factors.
- a promoter is often upstream of ("5' to") the transcription initiation site of a gene.
- a promoter is typically adjacent to the transcriptional start site of the gene. However, a promoter can also be located at a distance from the transcriptional start site of the gene.
- positions in the promoter are designated relative to the transcriptional start site, where transcription of RNA begins for a particular gene (i.e., positions upstream are negative numbers counting back from -1, for example -100 is a position 100 base pairs upstream).
- positions upstream are negative numbers counting back from -1, for example -100 is a position 100 base pairs upstream.
- Conventional notation is used herein to describe polynucleotide sequences.
- the left-hand end of a single-stranded polynucleotide sequence is the 5 '-end, and the left-hand direction of a single-stranded polynucleotide sequence is referred to as the 5 '-direction.
- the left-hand end of a double-stranded polynucleotide sequence is the 5 '-end of the plus strand, which is depicted as the top strand of the double strands
- the right-hand end of the double-stranded polynucleotide sequence is the 5 '-end of the minus strand, which is depicted as the bottom strand of the double strands.
- the direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction.
- a DNA strand having the same sequence as an mRNA is referred to as the "coding strand.” Sequence on a DNA strand which is located 5' to a reference point on the DNA is referred to as “upstream sequence”; sequence on a DNA strand which is 3' to a reference point on the DNA is referred to as "downstream sequence.”
- operably linked refers to a functional relationship between two nucleotide sequences.
- a single-stranded or double-stranded nucleic acid moiety comprises the two nucleotide sequences arranged within the nucleic acid moiety in such a manner that at least one of the two nucleotide sequences is able to exert a physiological effect by which it is characterized upon the other.
- a promoter sequence that controls transcription of a coding sequence is operably linked to that coding sequence.
- Operably linked nucleic acid sequences can be contiguous, typical of many promoter sequences, or non-contiguous, in the case of, for example, nucleic acid sequences that encode repressor proteins.
- operably linked is intended to mean that the coding sequence of interest is linked to the regulatory sequence(s) in a manner that allows for expression of the coding sequence, e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell.
- Sequence means the linear order in which monomers occur in a polymer, for example, the order of amino acids in a polypeptide or the order of nucleotides in a polynucleotide.
- nucleotide sequence refers to the arrangement of either deoxyribonucleotide or ribonucleotide residues in a polymer in either single- or double-stranded form.
- Nucleic acid sequences can be composed of natural nucleotides of the following bases: T, A, C, G, and U, and/or synthetic analogs of the natural nucleotides.
- adenosine is abbreviated as "A”
- cytidine is abbreviated as “C”
- guanosine is abbreviated as "G”
- thymidine is abbreviated as “T”
- uridine is abbreviated as "U”.
- an "isolated" nucleic acid molecule is one that is substantially separated from at least one of the other nucleic acid molecules present in the natural source of the nucleic acid, or is substantially free of at least one of the chemical precursors or other chemicals when the nucleic acid molecule is chemically synthesized.
- An "isolated" nucleic acid molecule can also be, for example, a nucleic acid molecule that is substantially free of at least one of the nucleotide sequences that naturally flank the nucleic acid molecule at its 5' and 3' ends in the genomic DNA of the organism from which the nucleic acid is derived.
- a nucleic acid molecule is "substantially separated from” or “substantially free of other nucleic acid molecule(s) or other chemical(s) in preparations of the nucleic acid molecule when there is less than about 30%, 20%, 10%, or 5% or less, and preferably less than 1%, (by dry weight) of the other nucleic acid molecule(s) or the other chemical(s) (also referred to herein as a "contaminating nucleic acid molecule” or a "contaminating chemical”).
- Isolated nucleic acid molecules include, without limitation, separate nucleic acid molecules (e.g., cDNA or genomic DNA fragments produced by PCR or restriction endonuclease treatment) independent of other sequences, as well as nucleic acid molecules that are incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote.
- an isolated nucleic acid molecule can include a nucleic acid molecule that is part of a hybrid or fusion nucleic acid molecule.
- An isolated nucleic acid molecule can be a nucleic acid sequence that is: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) synthesized by, for example, chemical synthesis;
- PCR polymerase chain reaction
- a polynucleotide can have a single strand or parallel and anti-parallel strands.
- a polynucleotide may be a single-stranded or a double-stranded nucleic acid.
- a polynucleotide is not defined by length and thus includes very large nucleic acids, as well as short ones, such as an oligonucleotide.
- sequence identity or similarity is the relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences.
- identity in the context of the relationship between two or more nucleic acid sequences or two or more polypeptide sequences, refers to the percentage of nucleotide or amino acid residues, respectively, that are the same when the sequences are optimally aligned and analyzed. For purposes of comparing a queried sequence against, for example, the amino acid sequence SEQ ID NO: 6, the queried sequence is optimally aligned with SEQ ID NO: 6 and the best local alignment over the entire length of SEQ ID NO: 6 is obtained.
- Analysis can be carried out manually or using sequence comparison algorithms.
- sequence comparison typically one sequence acts as a reference sequence, to which a queried sequence is compared.
- test and reference sequences are input into a computer, sub-sequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
- Optimal alignment of sequences for comparison can be conducted, for example, by using the homology alignment algorithm of Needleman & Wunsch, J Mol. Biol., 48:443 (1970).
- Software for performing Needleman & Wunsch analyses is publicly available through the Institut Pasteur (France) Biological Software website: http://bioweb.pasteur.fr/seqanal/
- the NEEDLE program uses the Needleman- Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length. The identity is calculated along with the percentage of identical matches between the two sequences over the reported aligned region, including any gaps in the length. Similarity scores are also provided wherein the similarity is calculated as the percentage of matches between the two sequences over the reported aligned region, including any gaps in the length. Standard comparisons utilize the EBLOSUM62 matrix for protein sequences and the EDNAFULL matrix for nucleotide sequences.
- the gap open penalty is the score taken away when a gap is created; the default setting using the gap open penalty is 10.0. For gap extension, a penalty is added to the standard gap penalty for each base or residue in the gap; the default setting is 0.5.
- Hybridization can also be used as a test to indicate that two polynucleotides are substantially identical to each other. Polynucleotides that share a high degree of identity will hybridize to each other under stringent hybridization conditions. "Stringent hybridization conditions" has the meaning known in the art, as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1989).
- An exemplary stringent hybridization condition comprises hybridization in a medium comprising 4-6 x sodium chloride/sodium citrate (SSC) at about 45-65°C, followed by one or more washes in 0.2 x SSC and 0.1% SDS at 50 - 65°C, depending upon the length over which the hybridizing polynucleotides share complementarity or percent of identity.
- SSC sodium chloride/sodium citrate
- polypeptide and protein are used herein interchangeably to refer to amino acid chains in which the amino acid residues are linked by peptide bonds or modified peptide bonds.
- the amino acid chains can be of any length of greater than two amino acids.
- polypeptide and protein also encompass various modified forms thereof. Such modified forms may be naturally occurring modified forms or chemically modified forms. Examples of modified forms include, but are not limited to, glycosylated forms, phosphorylated forms, myristoylated forms, palmitoylated forms, ribosylated forms, acetylated forms, ubiquitinated forms, etc.
- Modifications also include intra-molecular crosslinking and covalent attachment to various moieties such as lipids, flavin, biotin, polyethylene glycol or derivatives thereof, etc.
- modifications may also include cyclization, branching and cross-linking.
- amino acids other than the conventional twenty amino acids encoded by the codons of genes may also be included in a polypeptide.
- an "isolated protein” or “isolated polypeptide” is one that is substantially separated from at least one of the other proteins present in the natural source of the protein, or is substantially free of at least one of the chemical precursors or other chemicals when the protein is chemically synthesized.
- a protein is "substantially separated from” or “substantially free of other protein(s) or other chemical(s) in preparations of the protein when there is less than about 30%, 20%, 10%, or 5% or less, and preferably less than 1% (by dry weight) of the other protein(s) or the other chemical(s) (also referred to herein as a "contaminating protein” or a "contaminating chemical”).
- Isolated proteins can have several different physical forms.
- the isolated protein can exist as a full-length nascent or unprocessed polypeptide, or as a partially processed polypeptide or as a combination of processed polypeptides.
- the full-length nascent polypeptide can be postranslationally modified by specific proteolytic cleavage events that result in the formation of fragments of the full-length nascent polypeptide.
- a fragment, or physical association of fragments can have the biological activity associated with the full-length polypeptide; however, the degree of biological activity associated with individual fragments can vary.
- An isolated polypeptide or isolated protein can be a non- naturally occurring
- an isolated polypeptide can be a "hybrid polypeptide.”
- An isolated polypeptide can also be a polypeptide derived from a naturally occurring polypeptide by additions or deletions or substitutions of amino acids.
- An isolated polypeptide can also be a "purified polypeptide” which is used herein to mean a specified polypeptide in a substantially homogeneous preparation substantially free of other cellular components, other polypeptides, viral materials, or culture medium, or when the polypeptide is chemically synthesized, chemical precursors or byproducts associated with the chemical synthesis.
- a "purified polypeptide” can be obtained from natural or recombinant host cells by standard purification techniques, or by chemical synthesis, as will be apparent to skilled artisans.
- recombinant refers to a polynucleotide, a polypeptide encoded by a polynucleotide, a cell, a viral particle or an organism that has been modified using molecular biology techniques to something other than its natural state.
- a "recombinant cell” or “recombinant host cell” is a cell that has had introduced into it a recombinant polynucleotide sequence.
- recombinant cells can contain at least one nucleotide sequence that is not found within the native (non-recombinant) form of the cell or can express native genes that are otherwise abnormally expressed, under-expressed, or not expressed at all.
- Recombinant cells can also contain genes found in the native form of the cell wherein the genes are modified and re-introduced into the cell by artificial means.
- the term also encompasses cells that contain ail endogenous nucleic acid that has been modified without removing the nucleic acid from the cell; such modifications include those obtained, for example, by gene replacement, and site-specific mutation.
- the term encompasses cells that contain the recombinant polynucleotide sequence either on a vector, such as an expression vector, or integrated into a cell chromosome.
- Recombinant DNA sequence can be introduced into host cells using any suitable method including, for example, electroporation, calcium phosphate precipitation, microinjection, transformation, biolistics and viral infection.
- Recombinant DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
- the recombinant DNA can be maintained on an episomal element, such as a plasmid.
- the recombinant DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication.
- transgenic plant or “transgenic line” refers to a plant that contains a recombinant nucleotide sequence comprising a genetically modified gene, e.g., a transgene.
- the transgenic plant can be grown or derived from a recombinant cell.
- a transgenic plant includes progeny, offspring, clone, breeding material or propagation material, such as seeds, thereof that comprises the transgene.
- a "transgenic plant” is synonymous with “transgenic recombinant plant” or “genetically engineered plant.”
- the term "semi-dwarf transgenic plant” means a transgenic plant having the phenotypic trait of a reduced height of the stem or size that is about 50% to 90% of a non- transgenic plant of the same genetic background while being grown under the same conditions.
- the semi-dwarf transgenic plant can have a height of the stem that is about 50%, 55%,
- the term "dwarf transgenic plant” means a transgenic plant having the phenotypic trait of a reduced height of the stem or size that is about 20% to 50% of a non-transgenic plant of the same genetic background while being grown under the same conditions.
- the dwarf transgenic plant can have a height of the stem that is about 20%, 25%, 30%, 35%, 40%, 45%, or 50% of a non-transgenic plant of the same genetic background while being grown under the same conditions.
- dwarf transgenic plant means a transgenic plant having the phenotypic trait of a reduced height of the stem or size that is less than about 20% of a non-transgenic plant of the same genetic background while being grown under the same conditions.
- cereal plant or "cereal crop” refers to a species of true grasses, i.e., Poaceae or Gramineae family in the Class Liliopsida of the flowering plants, or a species of pseudocereals, that is cultivated for its edible grains or seeds. Cereal plants are staple crops grown in greater quantities and provide more energy worldwide than any other type of crop.
- Cereal grains are a rich source of carbohydrate.
- Examples of cereal plants include, but are not limited to, plants of maize, rice, wheat, barley, sorghum, millets, oats, rye, triticale, buckwheat, fonio, quinoa, etc.
- an "expression vector” refers to a nucleic acid molecule that is used to recombinantly express a gene in a target cell.
- a heterologous or isolated nucleic acid encoding a gene of interest can be or is inserted into an expression vector.
- the expression vector with the heterologous or isolated nucleic acid can be or is introduced into a host cell. Once the expression vector is inside the cell, the gene product encoded by the heterologous or isolated nucleic acid is produced by the transcription and translation machinery of the host cell.
- An expression vector typically has for example, an origin of replication sequence allowing replication of the expression vector in the host cell, multiple cloning sites allowing insertion of the heterologous or isolated nucleic acid, a promoter allowing transcription of a gene of interest in the host cell, a heterologous or isolated nucleic acid encoding the gene of interest, a selectable marker gene that encodes a gene product allowing selection of the host cell containing the expression vector from those that do not.
- the properties, construction and use of expression vectors in the present invention will be readily apparent to those of skill in view of the present disclosure.
- the expression vector according to embodiments of the present invention can be a plasmid that is replicable in an agrobacterium and contains a stress-inducible promoter operably linked to the coding sequence of a stress-resistant gene.
- Gibberellin 2-oxidase protein refers to a 2-oxoglutarate-dependent dioxygenase (2-ODD) that catalyzes the inactivation of biologically active gibberellin (GA) and/or its precursors, thus reducing the endogenous levels of bioactive GAs.
- GODD 2-oxoglutarate-dependent dioxygenase
- a "GA2ox” can be a class C 19 GA2ox, that catalyzes 2p-hydroxylation of the C-2 of biologically active C ⁇ -GAs (GA ⁇ and GA 4 ) or C ⁇ -GA precursors (GA 20 and GA9) to produce biologically inactive GAs (GA 8 , GA 34 , GA 2 9, and GA 51 , respectively).
- Examples of CI 9 GA2ox include, but are not limited to, rice GA2oxs 1-4, GA2ox7, GA2ox8 and GA2o lO.
- a "GA2ox” can also be a class C20 GA2ox, that catalyzes 2p-hydroxylation of C 20 -GA precursors but not C ⁇ -GAs.
- the 2p-hydroxylation of C 20 -GA precursors e.g., converting GAj 2 and GA 5 3 to GA 1 10 and GA9 7 , respectively, renders them unable to be converted to active GAs and thus decreases active GA levels.
- the class C20 GA2oxs contain three unique and conserved amino acid domains that are absent in the class C19 GA2oxs (Lee and Zeevaart, 2005). Examples of C20
- GA2ox include, but are not limited to, Arabidopsis GA2ox7 and GA2ox8, spinach GA2ox3, and rice GA2ox5, GA2ox6 and GA2ox9.
- bioactive gibberellin compound and “bioactive GA compound”, as used herein interchangeably, all refer to a gibberellin or a derivative thereof that regulates growth and influences various developmental processes of a plant.
- the physiological effects of a bioactive GA include, but are not limited to, one or more selected from the group consisting of stimulating stem elongation, stimulating bolting/flowering, breaking seed dormancy, stimulating germination, inducing sex expression, enzyme induction, causing parthenocarpic (seedless) fruit development, and delaying senescence in leaves and fruits.
- bioactive GA compound include, but are not limited to, GA 1; GA 3 , GA 4 and GA 7 .
- the "2-ODD conserved domain” is a conserved domain of the 20G- Fe(II) oxygenase superfamily. This family contains members of the 2-oxoglutarate (20 G) and Fe(II)-dependent oxygenase superfamily. This family includes the C-terminal of prolyl 4- hydroxylase alpha subunit.
- the full enzyme consists of a alpha2 beta2 complex with the alpha subunit contributing most of the parts of the active site.
- GA2oxs are members of the 20G-Fe(II) oxygenase superfamily.
- OsGA2ox7; OsGA2ox8; OsGA2ox9-l and OsGA2ox9-2; and OsGA2oxl0-l and OsGA2oxlO-2 are SEQ ID NO:70; SEQ ID NO:71; SEQ ID NO:72; SEQ ID NO:73; SEQ ID NO:74; and SEQ ID NO:75, respectively.
- GA2ox5, GA2ox6 and GA2ox9 were three genes encoding class C20 GA2oxs in rice, and their functions were further investigated using T-DNA activation tagged rice mutants and transgenic ectopic overexpression approaches. Mutants or transgenic rice recombinantly expressing class C20 GA2oxs, under the control of their native promoters or a constitutive promoter, exhibited a broad range of mutant phenotypes. Mutations in the conserved domain III were found to affect the physiological activity of class C20 GA2oxs, suggesting domain III is important for the proper biological activity of class C20 GA2oxs. Overexpression of GA2ox5 with partially functional domain III significantly alleviated the mutant phenotype.
- Embodiments of the present invention demonstrate that improvement of plant architecture can be achieved by overexpression of certain wild-type or mutant GA2oxs under the control of various promoters, such as the native, constitutive, or inducible promoters.
- one general aspect of the present invention relates to an isolated nucleic acid, comprising a nucleotide sequence that encodes a polypeptide selected from the group consisting of:
- amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:14 or at least about 80% identical to SEQ ID NO:16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
- the invention encompasses any isolated nucleic acid encoding an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO:14 or SEQ ID NO:16, and the amino acid sequence has a domain that is at least 80%o identical to the 2-ODD conserved domain within each of the respective sequences.
- the nucleic acid encodes an amino acid sequence that is 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10 or SEQ ID NO: 12; or SEQ ID NO: 14 or SEQ ID NO: 16, and the amino acid sequence has a domain that is at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:72; SEQ ID NO:73; SEQ ID NO:74; or SEQ ID NO:75, respectively.
- the nucleic acid can be genomic DNAs, cDNAs, and chemically synthesized DNAs.
- an amino acid sequence (for example, SEQ ID NO: 6) can be encoded by any one of a plurality of nucleic acid sequences.
- Isolated nucleic acid includes sequences wherein one or more codons in the sequence are replaced by codons of a different sequence but that code for the same amino acid residue are herein referred to as "conservative codon substitutions".
- the invention encompasses nucleic acid sequences that have one or more than one conservative codon substitutions.
- One of skill in the art would be able to determine a particular nucleic acid sequence having one or more than one conservative codon substitutions and encoding the above amino acid sequence, based on the sequence information provided herein.
- TTT/C can encode a Phe (phenylalanine) residue
- other exemplary codon substitutions include, but are not limited to: TTA/G and CTT/C/A/G: Leu; ATT/C: lie; ATG: Met; GTT/C/A/G: Val; TCT/C/A/G: Ser;
- CCT/C/A/G Pro; ACT/C/A/G: Thr; GCT/C/A/G: Ala; TAT/C: Tyr; CAT/C: His; CAA/G: Gin; AAT/C: Asn; AAA/G: Lys; GAT/C: Asp; GAA/G Glu; TGT/C: Cys; CGT/C/A/G: Arg; AGT/C: Ser; AGA/G; Arg; GGT/C/A/G:Gly.
- Conservative codon substitutions can be made at any position in the nucleic acid sequence that encodes the recited amino acid sequence.
- the isolated nucleic acid comprises a nucleotide sequence that encodes a polypeptide selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO: 14 and SEQ ID NO:16.
- the isolated nucleic acid comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:l 1, SEQ ID NO: 13 and SEQ ID NO: 15.
- a nucleic acid according to embodiments of the present invention can be readily designed, synthesized and isolated using methods known in the art, in view of the present disclosure.
- a genomic DNA or cDNA can be prepared according to conventional methods known to those skilled in the art in view of the present disclosure.
- genomic DNA can be prepared as follows: (1) extract a genomic DNA from rice cultivars having a DNA encoding a protein with a GA2-oxidation activity; (2) construct a genomic library (utilizing a vector such as a plasmid, phage, cosmid, BAC, or PAC); (3) spread the library; and (4) conduct colony hybridization or plaque hybridization using a probe prepared based on a DNA encoding a polypeptide that is at least about 80% identical to an amino acid sequence selected from the group consisting of SEQ ID
- a genomic DNA can be prepared via PCR using primers specific for a DNA encoding a polypeptide that is at least about 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO:16.
- cDNA can be prepared as follows: (1) synthesize cDNAs based on mRNAs extracted from rice cultivars having a DNA encoding a protein with a GA2-oxidation activity; (2) prepare a cDNA library by inserting the synthesized cDNA into a vector such as ⁇ ;
- cDNA can also be prepared by RT-PCR.
- the DNA can be isolated by gel electrophoresis.
- a nucleic acid according to embodiment of the present invention can be used to express a polypeptide of the present invention.
- the nucleic acid can also be used to produce an expression vector, a recombinant cell or a transgenic plant.
- the polypeptide, expression vector, recombinant cell and transgenic plant can be used to regulate plant development, e.g., to suppress plant growth resulting in a semi-dwarf transgenic plant.
- the present invention relates to an isolated polypeptide comprising an amino acid sequence selected from the group consisting of:
- the invention encompasses any isolated polypeptide comprising an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:
- the polypeptide comprises an amino acid sequence that is
- polypeptide has GA2ox biological activity.
- polypeptide according to embodiment of the present invention can have additional amino acid residues.
- the additional amino acids are present at the amino terminus, the carboxyl terminus, within the polypeptide sequence or combinations of these locations.
- Polypeptides having these types of additional amino acid sequences can be referred to as "fusion proteins". In some cases, it may be more appropriate to refer to them otherwise as “chimeric” or “tagged” proteins, or the like, depending on the nature of the additional amino acid sequences.
- the additional amino acid residues can be short, for example, from one to about 20 additional amino acid residues, or longer, for example, greater than about 20 additional amino acid residues.
- the additional amino acid residues can serve one or more functions or purposes including, for example, serving as epitopes for protein (e.g., antibody) or small molecule binding; serving as tags for intracellular and extracellular trafficking; providing additional enzymatic or other activity; or providing a detectable signal.
- the fusion protein can include additional amino acid residues providing coordinates for bonding (such as ionic, covalent, coordinative, hydrogen or Van der Waals bonding or combinations thereof) with organic or inorganic compounds.
- additional amino acid sequences include, for example, poly-histidine residues useful for protein purification via Ni + - coupled residue, constant domains of immunoglobulins (IgA, IgE, IgG, IgM) or portions thereof (CHI, CH2, CH3), albumin, hemagluttinin (HA) or myc affinity epitope tags useful for the formation of immuno-complexes for detection or purification (antibodies against these moieties can be obtained commercially), polypeptides useful for detection such as the green fluorescent protein (GFP), enzymes such as beta-galactosidase (B-Gal), chloramphenicol acetyltransferase (CAT), luciferase, and alkaline phosphatase (A), signal sequence
- GFP green fluorescent
- SEQ ID NO: 12 SEQ ID NO:14 and SEQ ID NO:16.
- a polypeptide according to embodiments of the present invention can be readily designed, synthesized and isolated using methods known in the art, in view of the present disclosure.
- the polypeptide can be produced as recombinant or naturally-occurring proteins by a method known to one skilled in the art.
- a recombinant protein can be produced by a method comprising: (1) synthesizing a DNA encoding the protein using PCR with primers having desired restriction enzyme sites; (2) cloning the DNA into an expression vector, such as the pMAL-c2 expression vector (NEB); (3) transforming the expression vector into a host cell, such as Escherichia coli strain BL21 cell, to create a recombinant cell; (4) growing the recombinant cell under conditions to allow its expression of the recombinant protein; and (5) isolating the recombinant protein from the recombinant cell.
- an expression vector such as the pMAL-c2 expression vector (NEB)
- NEB pMAL-c2 expression vector
- the isolation of the recombinant protein can be facilitated by expressing the recombinant protein as a fusion protein with a histidine tag, maltose-binding protein, or glutathione-S-transferase (GST), and subsequently purifying or isolating the protein on a nickel column, an amylose-column, or a GST-glutathione column, respectively.
- GST glutathione-S-transferase
- the above-described tag can be cleaved off using proteases, such as, thrombin and factor Xa as required.
- polypeptide When the polypeptide is produced and isolated as a naturally-occurring protein, such a protein is naturally produced by a plant or a plant tissue, and is isolated, for example, by binding an antibody to the polypeptide to an affinity column and contacting with the column an extract from the plant or plant tissue, such as rice or rice leaves, naturally expressing the polypeptide.
- the antibody can be prepared by immunizing a suitable animal with a partial sequence of the polypeptide made synthetically.
- Another general aspect of the present invention relates to an isolated nucleic acid comprising a nucleotide sequence that encodes a mutant class C20 gibberellin 2-oxidase protein (GA2ox), or an isolated polypeptide comprising the mutant class C20 GA2ox.
- G2ox gibberellin 2-oxidase protein
- the mutant C20 GA2ox has at least one mutation in domain III of a class C20 GA2ox and has a reduced enzymatic activity to hydroxylate a class C 20 -GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation.
- the domain III which comprises an amino acid sequence of SEQ ID NO: 17, is one of the three unique and conserved amino acid domains that are present in the class C20 GA2oxs, but absent in the class C19 GA2oxs. It was discovered in the present invention that mutations in domain III affect the physiological activity of class C20 GA2oxs.
- domain III comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21 , SEQ ID NO:22, and SEQ ID NO:23
- the otherwise identical class C20 GA2ox comprises an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26.
- methods known in the art such as site-directed mutagenesis (Kramer and Fritz, Methods in Enzymology, 154: 350-367 (1987)), can be used to introduce the at least one mutation, such as a deletion, insertion or substation of one or more amino acids, in domain III.
- the number and identity of amino acids that are mutated in domain III are not particularly restricted, as long as the class C20 GA2ox with the mutated domain III has a reduced enzymatic activity to hydroxylate a class C 20 -GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation.
- the enzymatic activity of a class C20 GA2ox with or without one or more mutations in domain III can be assayed using various methods known in the art in view of the present disclosure.
- the class C20 GA2ox can be isolated or purified, e.g., from a recombinant cell that expresses the C20 GA2ox, or from a plant that has the C20 GA2ox.
- the enzymatic activity of the isolated or purified C20 GA2ox to hydroxylate a class C 2 o-GA precursor can be measured in vitro using a radio-labeled C 20 -GA precursor, such as radio-labeled GA 12 or GAs 3 (see Lee and Zeevaart, 2002; Schomburg et al., 2003).
- the enzymatic activity of the isolated or purified C20 GA2ox to hydroxylate a class C 20 -GA precursor can also be measured in vivo by analyzing the amount of GAi or GA 97 in plant extracts, e.g., from the mature leaves or seedlings of plants containing the C20 GA2ox.
- the mutant class C20 GA2ox comprises an amino acid sequence selected from the group consisting of:
- Another general aspect of the present invention relates to an expression vector comprising a nucleotide sequence that encodes a polypeptide selected from the group consisting of :
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75;
- the expression vectors comprise a nucleic acid according to embodiments of the invention in a form suitable for expression of the nucleic acid in a host cell. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc.
- the expression vectors according to embodiments of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein.
- the expression vector is replicable and confers a selective marker in a plant cell.
- the expression vector is replicable and confers a selective marker in an Agrobacterium, a bacterium known for its ability to transfer nucleic acid between itself and plants.
- the expression vector allows the shuttling or exchange of nucleotide sequences between a plant cell and an Agrobacterium.
- Such expression vectors can be a modified bacterial tumor-inducing (Ti) plasmid or a bacterial root-inducing (Ri) plasmid.
- the expression vector comprises a nucleotide sequence that encodes a polypeptide selected from the group consisting of : SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14 and SEQ ID NO:16.
- the expression vector comprises a nucleotide sequence that encodes a mutant class C20 GA2ox comprising an amino acid sequence selected from the group consisting of: SEQ ID NOs:27-30, SEQ ID NO:68 and SEQ ID NO:69.
- the present invention relates to a recombinant cell comprising a nucleotide sequence according to embodiments of the invention.
- the recombinant cell is a recombinant plant cell, which includes various forms of plant cells, such as cultured cell suspensions, protoplasts, leaf sections and calluses.
- the recombinant cell is a recombinant Agrobacterium cell.
- the recombinant cell comprises an expression vector according to embodiments of the present invention.
- the recombinant cell comprises a nucleotide sequence that encodes a polypeptide selected from the group consisting of : SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NOs:27-30, SEQ ID NO:68 and SEQ ID NO:69.
- a nucleotide sequence according to embodiments of the invention can be introduced into a host cell via a vector.
- the nucleotide sequence can stay on the vector, separate from the chromosome, in the recombinant cell, such as in a transiently transfected recombinant cell that transiently expresses a gene product encoded by the nucleotide sequence.
- the nucleotide sequence can also be integrated into the chromosome in the recombinant cell, such as in a stably transfected recombinant cell that stably expresses a gene product encoded by the nucleotide sequence.
- the present invention relates to a transgenic plant comprising a transgene, wherein the transgene encodes a polypeptide selected from the group consisting of :
- amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75;
- GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17.
- the transgenic plant comprises the mutant class C20 GA2ox, wherein
- the domain III comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 18-23;
- the otherwise identical class C20 GA2ox comprises an amino acid sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:26.
- the transgenic plant comprises a transgene, which encodes a polypeptide having the amino acid sequence selected from the group consisting of : SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NOs:27-30, SEQ ID NO:68 and SEQ ID NO:69.
- a transgenic plant stably expresses a gene encoded by a recombinant nucleic acid molecule according to embodiments of the invention.
- the recombinant nucleic acid molecule is stably transformed or transfected into a plant cell and has become integrated into the chromosome of the plant cell so that the recombinant nucleic acid molecule is inherited by daughter cells of the plant cell through chromosome replication.
- the transgenic plant is constructed by transforming a tissue of a plant, such as a protoplast or leaf-disc of the plant, with a recombinant Agrobacterium cell comprising a nucleic acid molecule according to embodiments of the present invention, and generating a whole plant using the transformed plant tissue.
- flowers of a plant can be dipped in a culture of recombinant Agrobacterium cell comprising a nucleic acid molecule according to embodiments of the present invention. After the bacterium transforms the germline cells that make the female gametes, seeds can be screened for markers carried by the nucleic acid molecule according to embodiments of the present invention. Transgenic plants are then grown out of the seeds.
- a nucleic acid molecule according to embodiments of the invention can be introduced into a plant via gene gun technology, particularly when transformation with a recombinant Agrobacterium cell is less efficient in the plant.
- the gene gun technology also referred to as biolistics, delivers genetic information via an elemental particle of a heavy metal coated with plasmid DNA. This technology is able to transform almost any type of plant cells.
- a transgenic plant according to embodiments of the present invention transiently expresses a gene encoded by a recombinant nucleic acid molecule according to embodiments of the invention. Any of a variety of procedures known in the art can be used to engineer such a transgenic plant in view of the present disclosure.
- a recombinant nucleic acid molecule according to embodiments of the invention can be introduced into a transgenic plant by particle bombardment, a specific example of which is described below in the examples.
- the method of agroinfiltration can be used to allow transient expression of genes in a plant.
- a recombinant nucleic acid molecule according to embodiments of the invention is first introduced into a strain of Agrobacterium to generate a recombinant Agrobacterium cell.
- a liquid suspension of the recombinant Agrobacterium is then injected into the airspaces inside a plant leaf. Once inside the leaf, the recombinant
- Agrobacterium transforms the gene of interest to a portion of the plant cells and the gene is then transiently expressed. As compared to traditional plant transformation, the method of
- agroinfiltration is speedy and convenient.
- the transgenic plant according to embodiments of the present invention can be both monocot and dicot transgenic plants.
- the transgenic plant is a transgenic cereal plant, preferably a transgenic rice plant.
- the transgenic plant according to embodiments of the present invention can comprise a transgene that is operably linked to any suitable promoters known in the art to provide a control point for regulated gene transcription of the transgene in the transgenic plant.
- the promoters that can be used in the present invention include, but are not limited to a native promoter; a constitutive promoter selected from the group consisting of a maize ubiquitin (Ubi) promoter, a rice actin (Actl) promoter, and cauliflower mosaic 35S RNA promoter (CaMV35S) promoter; a tissue-specific promoter selected from the group consisting of a rice glutelin (GluB) promoter, a rubisco small subunit (rbcS) promoter and a maize zean gene promoter; a developmental stage-specific promoter selected from the group consisting of a rice alpha-amylase ( ⁇ 4w2y)promoter and a rice glycine rich RNA binding protein (GRRP-AJ)
- inducible promoters examples include, but are not limited to, promoters for the genes of Arabidopsis rd29A, cor 15 A, kinl, heat-shock factor (HSF), C-repeat- binding factor (CBF1) and dehydration-responsive element binding protein (DREB1 A); and promoters for the genes of rice HVA1 (ABA-inducible), alcohol dehydrogenase (Adh), ethanol- inducible, and alpha-amylase (GA-inducible).
- HSF heat-shock factor
- CBF1 C-repeat- binding factor
- DREB1 A dehydration-responsive element binding protein
- the promoter is expressed in developing seeds, during seed germination, in early seedlings, or in growing plants.
- the transgenic plant is at least about 10% shorter, or has more root system, earlier tillering, higher tillering numbers, higher biomass, or higher seed production, than a non-transgenic plant of the same genetic background while being grown under the same conditions.
- Tillering is an important agronomic trait for grain yield.
- the tiller is a specialized grain-bearing branch that normally arises from the axil of each leaf and grows independently of the mother stem (culm) with its own adventitious roots.
- the present invention demonstrates that plant architecture improvements, including, but not limited to semidwarfism, increased root system and higher tiller numbers, which favor grain yield, could be induced by increased expression or activity of wild-type or modified C19 GA2oxs or C20 GA2oxs.
- the transgenic plant is a semi-dwarf or dwarf transgenic plant having a height that is about 20% to 90% of a non-transgenic plant of the same genetic background while being grown under the same conditions.
- the transgenic plant is a semi-dwarf or dwarf transgenic plant having a height that is about 20%, 25%, 30%, 35%, 40%, 45%), 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% of that of a non-transgenic plant of the same genetic background while being grown under the same conditions.
- An embodiment of the present invention also includes a propagation material obtained from the transgenic plant according to embodiments of the present invention, wherein the propagation material contains the transgene.
- the present invention relates to a method of producing a transgenic plant of the present invention.
- the method comprises: (a) transforming a plant cell with a nucleic acid molecule comprising the transgene according to an embodiment of the present invention to obtain a recombinant plant cell; and (b) growing the recombinant plant cell obtained in (a) to generate a transgenic plant.
- Another general aspect of the present invention relates to a method of inhibiting stem elongation and promoting tiller growth in a plant.
- the method comprises: (a) transforming a plant cell with a nucleic acid molecule comprising a transgene according to an embodiment of the present invention to obtain a recombinant plant cell that expresses a polypeptide encoded by the transgene; and (b) growing the recombinant plant cell obtained in (a) to generate a transgenic plant; wherein the polypeptide is expressed in the transgenic plant at a level sufficient to inhibit stem elongation and promote tiller growth in the transgenic plant.
- the transgene encodes a mutant class C20 GA2ox having at least one mutation in domain III of the class C20 GA2ox.
- the mutant GA2ox has a reduced enzymatic activity to hydroxylate a class C2 0 -GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation.
- the domain III comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 and SEQ ID NO:23, and the otherwise identical class C20 GA2ox that lacks the at least one mutation comprising an amino acid sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26.
- the transgene used in the method encodes a polypeptide selected from the group consisting of a polypeptide having the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:27, SEQ ID NO:30 and SEQ ID NO:69.
- the transgene can be any transgene.
- transgenic plant i.e., is expressed at a level higher than that of an otherwise identical gene in a non-transgenic plant of the same genetic background.
- transgene encoding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NO:28, or SEQ ID NO:29 was overexpressed in transgenic rice plants according to embodiments of the invention.
- the transgene can be expressed at a level the same as or lower than that of an otherwise identical gene in a non-transgenic plant of the same genetic background.
- embodiments of the present invention encompass transgenic plants having a transgene encoding SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:27, SEQ ID NO:30 or SEQ ID NO:69 expressed at a level that is equal to, less or more than that found in the wild-type.
- the method further comprises breeding the transgenic plant with another plant to obtain a semi -dwarf or dwarf transgenic plant that still contains the transgene.
- the transgenic plant is a severely dwarf transgenic plant and the other plant is a non-transgenic plant of the same genetic background.
- the breeding of the severely dwarf transgenic plant with the non-transgenic plant can produce a semi- dwarf or dwarf transgenic plant that is less dwarf than the severely dwarf parent transgenic plant.
- the transgene in the transgenic plant encodes a polypeptide selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO: 10.
- the transgene used in the method encodes a polypeptide selected from the group consisting of a polypeptide having the amino acid sequence of SEQ ID NO: 10, SEQ ID NO:27, SEQ ID NO:30 and SEQ ID NO:69, and the polypeptide is expressed in the transgenic plant at a level sufficient to inhibit growth and make a semi-dwarf transgenic plant.
- Another general aspect of the present invention relates to a method of obtaining a semi- dwarf transgenic plant.
- the method comprises: (a) providing a transgenic plant according to embodiments of the present invention or a propagation material thereof; (b) growing the transgenic plant or the propagation material thereof, so that the polypeptide transgenically or recombinantly expressed in the transgenic plant is at a level sufficient to inhibit growth of the transgenic plant; and (c) applying to the transgenic plant or the propagation material thereof a composition comprising at least one bioactive GA compound, so that the transgenic plant or propagation material thereof produces a semi-dwarf transgenic plant.
- the bioactive GA compound can be applied directly to the transgenic plant or the propagation material or indirectly to the soil in which the transgenic plant or the propagation material is grown.
- the transgene expressed in the transgenic plant can be any of the transgene according to embodiments of the present invention.
- the transgene encodes a polypeptide having the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO: 10.
- the transgene is overexpressed in the transgenic plant.
- the bioactive GA compound can be any bioactive GA compounds.
- the bioactive GA compound is not inactivated by the polypeptide
- the bioactive GA compound is selected from the group consisting of GA], GA 3 , GA 4 and GA 7 .
- Another general aspect of the present invention relates to a method of inhibiting stem elongation and promoting tiller growth in a plant, comprising administering to the plant a compound that increases the expression of a gene encoding a polypeptide or the enzymatic activity of the polypeptide in the plant, wherein the polypeptide is selected from the group consisting of:
- amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
- SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
- the polypeptide is selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, and the plant is a rice plant.
- the compound that increases the expression of a gene encoding a polypeptide or the enzymatic activity of the polypeptide in the plant can be of any type, including, but not limited to a small molecule chemical compound and a molecule of biological origin, i.e., that is originally identified as a molecule made by a biological system, such as a plant, a microorganism, etc., or derivatives thereof.
- Another general aspect of the present invention relates to a method of identifying a compound that inhibits stem elongation and promotes tiller growth in a plant, comprising identifying a compound that increases the expression of a gene encoding a polypeptide or the enzymatic activity of the polypeptide in the plant, wherein the polypeptide is selected from the group consisting of:
- amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71; (c) a polypeptide having an amino acid sequence that is at least about 80% identical to
- SEQ ID NO:6 wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
- SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
- the polypeptide is selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO: 10, and the plant is a rice plant.
- in vitro assay preferably high-though put assay, can be conducted using an isolated polypeptide to identify compounds that increase the enzymatic activity of the polypeptide.
- in vitro assay can be based on the enzymatic activity of a CI 9 GA2ox, such as GA2ox7, GA2ox8 or GA2oxl0, to hydroxylate the C-2 of biologically active Ci 9 -GAs (GA, and GA 4 ) or C 1 9-GA precursors (GA 2 0 and GA9) to produce biologically inactive GAs (GA 8 , GA 34 , GA 2 9, and GA 51 , respectively).
- the in vitro assay can also be based on the enzymatic activity of a C20 GA2ox, such as GA2ox5, GA2ox6 or GA2ox9, to catalyze 2p-hydroxylation of C 20 -GA precursors, e.g., converting GA 12 and GA 53 to GAn 0 and GAg 7 , respectively.
- the enzymatic activity of a C19 GA2ox or C20 GA2ox can be measured using methods known to those skilled in the art, for example, by using a radio-labeled C ⁇ -GA, C ⁇ -GA precursor or C 20 -GA precursor.
- Compounds that increase the expression of a gene of interest can be identified using a cell based reporter assay.
- the transcriptional regulatory region of a gene according to an embodiment of the present invention including the promoter and the 5'- and/or 3'- untranslated regulatory (UTR) region of the gene, can be operably linked to the coding sequence of a reporter gene, such as a luciferase gene (lux), a ⁇ -galactosidase gene (lacZ), a green fluorescent protein gene (GFP), etc.
- lux luciferase gene
- lacZ ⁇ -galactosidase gene
- GFP green fluorescent protein gene
- the compound can be further identified using an in vivo assay, e.g., by administering the compound to a plant and analyzing the amount of biologically inactive GAs in plant extracts.
- Another general aspect of the invention relates to a method of generating a transgenic plant having a feature selected from the group consisting of less height, higher tillering, more biomass, a stronger and thicker stem, a stronger root system, more leaves, stable increase of yields and/or seed production, and enhanced stress tolerance, as compared with a plant of substantially the same genetic background grown under the same conditions.
- the method comprises:
- transgenic plant recombinantly expresses a polypeptide selected from the group consisting of:
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO:16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:
- mutant class C20 GA2ox a mutant class C20 GA2ox, the mutant C20 GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C 20 -GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17.
- a "plant of substantially the same genetic background” or a “control plant” refers to a plant that has substantially the same genotype, i.e., genetic constitution, as that of the transgenic plant according to an embodiment of the present invention, except that the plant does not recombinantly express a polypeptide selected from the group consisting of (1) to (7) above.
- the "plant of substantially the same genetic background” may contain an unmodified endogenous gene for a polypeptide selected from the group consisting of (1) to (7).
- the transgenic plant can have one or more other genetic alterations resulting from the construction of the transgenic plant, such as an insertion, a deletion, or a disruption of certain gene or genomic sequences, as compared with the "plant of substantially the same genetic background" or the control plant.
- such other genetic alterations do not result in significantly phenotypic changes to the transgenic plant.
- the transgenic plant recombinantly expresses a polypeptide selected from the group consisting of (1) to (7) above from a transgene that is not found within the plant of substantially the same genetic background.
- the transgene is introduced into a cell of the plant of substantially the same genetic background to obtain a recombinant plant cell, which is subsequently used to generate the transgenic plant.
- the transgenic plant recombinantly expresses a polypeptide selected from the group consisting of (1) to (7) above from a gene found within the plant of substantially the same genetic background, but the gene is modified and reintroduced into the transgenic plant by recombinant DNA technologies.
- the gene modifications can include changes to the coding sequence and/or regulatory sequences to alter the activity of the expressed polypeptide and/or the level of protein expression.
- the endogenous gene can be cloned; the promoter for the endogenous gene can be replaced with a constitutive promoter or a stress-inducible promoter; the modified gene can be reintroduced into a cell of the plant of substantially the same genetic background to obtain a recombinant plant cell; and the recombinant plant cell is used to generate a transgenic plant.
- the resulting transgenic plant expresses the gene of interest constitutively or in a stress inducible fashion.
- the recombinantly expressed polypeptide is encoded by a gene stably integrated into the genome of the transgenic plant cell, such as in a stable transgenic plant.
- polypeptide is encoded by a gene that remains on a vector inside the plant cell, such as in a transient transgenic plant.
- the present invention relates to a method of improving one or more traits of a plant selected from the group consisting of reduced height, increased tillering number, more biomass, a stronger and thicker stem, a stronger root system, more leaves, stable increase of yields and/or seed production, and enhanced stress tolerance compared to a control plant.
- the method comprises increasing expression and/or activity of a gibberellin 2-oxidase or a derivative thereof in the plant as compared to the control plant.
- the method comprises increasing the expression in the plant of a polypeptide selected from the group consisting of:
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
- polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
- mutant class C20 GA2ox a mutant class C20 GA2ox, the mutant GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C 20 -GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17,
- polypeptide when its expression is increased in the plant, results in reduced amount of endogenous bioactive gibberellins as compared to a control plant grown under the same conditions.
- the expression of the desired polypeptide is increased by recombinant expression in a transgenic plant comprising a recombinant polynucleotide encoding the polypeptide.
- the expression of the polypeptide is increased by active mutation of the gene encoding the polypeptide.
- the expression and/or activity of the gibberellin 2-oxidase or its derivative is increased by administering to the plant an agent that increases the expression and/or activity of the gibberellin 2-oxidase or its derivative in the plant.
- an agent that increases the expression and/or activity of the gibberellin 2-oxidase or its derivative in the plant.
- agent can be screened or identified using methods described herein.
- the resulting transgenic plant recombinantly expresses a mutant class C20 GA2ox gene.
- the mutant class C20 GA2ox has at least one mutation in domain III of class C20 GA2ox and a reduced enzymatic activity to hydroxylate a class C 20 -GA precursor compared with an otherwise identical wild-type class C20 GA2ox that lacks the at least one mutation in domain III.
- the domain III comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 and SEQ ID NO:23; and the otherwise identical class C20 GA2ox comprises an amino acid sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26.
- the resulting transgenic plant recombinantly expresses GA2ox selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO: 16, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:68 and SEQ ID NO:
- the gene expression of the polypeptide of interest can be driven by a native promoter for the gene; a constitutive promoter such as maize ubiquitin (Ubi) promoter, a rice actin (Actl) promoter, and cauliflower mosaic 35S RNA promoter (CaMV35S) promoter; a tissue-specific promoter such as a rice glutelin (GluB) promoter, a rubisco small subunit (rbcS) promoter and a maize zean gene promoter; a developmental stage-specific promoter such as a rice alpha-amylase (aA my)promoter and a rice glycine rich RNA binding protein (GRRP-A1) promoter; and an inducible promoter such as that inducible by drought, salt, high or low temperatures, hypoxia, arioxia, hydration, pH, chemicals, or hormones.
- a native promoter for the gene a constitutive promoter such as maize ubiquitin (Ubi) promoter, a rice act
- the inducible promoter is selected from the group consisting of promoters for the genes of Arabidopsis rd29A, corl5A, kinl, heat-shock factor (HSF), C-repeat-binding factor (CBF1) and dehydration-responsive element binding protein (DREB1 A); and promoters for the genes of rice HVA1 (ABA-inducible), alcohol dehydrogenase (Adh), ethanol-inducible, and alpha-amylase (GA-inducible).
- the promoter drives gene expression in a developing seed during seed germination, in early seedlings or in growing plants.
- Methods according to embodiments of the present invention can be applied to a dicot plant or a monocot plant.
- methods of the present invention can be applied to an agricultural plant, such as a rice plant; an ornamental plant; a grass used in pasture, ground cover, golf course, or turf; such as Bermuda grass and pangolagrass.
- transgenic plant can be bred with other plants in order to combine additional desirable traits into one plant.
- the other plants can be transgenic or
- Methods according to embodiments of the present invention optionally comprise one or more screening steps for screening the one or more desirable traits in the transgenic plants using any screening method known in the art in view of the present disclosure.
- the resulting transgenic plant has increased tolerance to one or more biotic stresses, such as that result from an invasion of the plant by a bacterium, a virus, a fungus, a parasite, a harmful insect, an algae, a nematode, or a weed.
- the resulting transgenic plant has increased tolerance to one or more abiotic stresses, such as that result the negative impact of a high wind, an extreme temperature, drought, flood, a poor edaphic condition (like rock content, low or high pH, infertile soil, etc), high radiation, compaction, contamination, pollution, or rapid rehydration during seed germination.
- abiotic stresses such as that result the negative impact of a high wind, an extreme temperature, drought, flood, a poor edaphic condition (like rock content, low or high pH, infertile soil, etc), high radiation, compaction, contamination, pollution, or rapid rehydration during seed germination.
- Another general aspect of the present invention relates to a method of obtaining at least one desirable feature of enhanced stress tolerance and stronger and thicker stem of a plant compared to a control plant.
- the method comprises obtaining a transgenic plant, e.g., one derived from the control plant, wherein the transgenic plant comprises a recombinant polynucleotide encoding a GA2ox or its derivative, wherein the GA2ox or its derivative, when expressed in the transgenic plant, confers the at least one desirable feature of enhanced stress tolerance and stronger and thicker stem to the transgenic plant as compared to the control plant grown under the same conditions.
- Putative rice GA2oxs were sought by BLAST searching the NCBI, TIGR, and
- SoGA2ox3 Spinacia oleracea AY935713
- GA2ox mRNA were analyzed by RT-PCR using GA2ox and GA3ox2 gene-specific primers (Table 7), and thel 8S rRNA gene (rRNA) was used as a control.
- GA2oxl to GA2ox9 were differentially expressed in leaves and the expression was temporally regulated.
- mRNAs of GA2oxlO was not detected in any tissue in any growth stage, indicating GA2oxlO may be a pseudogene or its mRNA level was too low to be detected.
- the GA2oxs could be classified into 2 groups. As can be seen in Fig. 2B, for members of group A, which exclude GA2ox2 and GA2ox6, accumulation of their mRNAs in leaves was detected prior to the transition from vegetative to reproductive growth phases.
- members of group B which include GA2ox2 and GA2ox6, their mRNAs accumulated in leaves after the phase transition from vegetative to reproductive growth. GA2ox6 mRNA could also be detected in leaves at early seedling stage and transiently at high level during active tillering stage.
- Bioactive-GAs are well-known to be responsible for relieving seed dormancy and promoting germination, so the role of GA2oxs during germination was studied. Seeds were imbibed for various lengths of time. Germination of wild-type seeds was observed from 1 DAI which reached almost 100% at 2 DAI (Fig. 3 A). Total RNAs were isolated from embryos after imibibition of seeds, and temporal expression profiles of six GA2oxs were analyzed by RT-PCR. Accumulation of most GA2ox mRNAs was detectable starting from 0 to 1 DAI, which was maintained at similar levels afterward (Fig. 3B).
- GA2ox6 had a distinct expression pattern as its mRNA quickly accumulated from 0.5 to 1 DAI and then decreased significantly from 2 to 4 DAI. Low-level accumulation of GA3ox mRNA was detected at 0 DAI and then at similarly high levels after 0.5 DAI. This study demonstrated that most GA2oxs were constitutively expressed and competed with GA3ox for GA, while only GA2ox6 was transiently expressed and its reduced expression correlated with the rapid seed germination at 2 DAI.
- Taiwan Rice Insertional Mutagenesis (TRIM) library (Hsing et al., 2007), were screened.
- the T-DNA tag used for generating the TRIM library contained multiple CaMV35S enhancers adjacent to the right border, which activate promoters located close to T-DNA insertion sites (Hsing et al., 2007).
- Two G42 ⁇ 3 ⁇ 4 -activated dwarf mutants, M77777 and M47191 were identified by a forward genetic screen and another two mutants, M27337 and M58817, were identified by a reverse genetic screen of the library (Fig. 4).
- the severely dwarf mutant M77777 designated as GA2OX3 A C T, carries a T-DNA insertion at a position 587 bp upstream of the translation start codon of GA2ox3 (Fig. 4A).
- the semi-dwarf mutant M27337 designated as GA2ox5A335-341 ACT , carries a T-DNA insertion in the coding region, at a position 23 bp upstream of the translation stop codon of GA2ox5 (Fig. 4B).
- Truncation of GA2ox5 by T-DNA resulted in a loss of 4 amino acids at the C-terminal of the putative GA2ox5 polypeptide.
- Accumulation of the truncated GA2ox5 mRNA was significantly enhanced by T-DNA activation tagging in both homozygous and heterozygous mutants, but the semi-dwarf phenotype was observed only in the homozygous mutant.
- the GA2OX5A335-341ACT homozygous mutant had an average plant height 90%, and produced seeds with an average fertility 88%, of the wild type (Table 5). These results suggest that the truncated GA2ox5 mRNA might encode a partially functional GA2ox5.
- Width of the leaf 1.64 ⁇ 0.1 (100) 1.66 ⁇ 0.1 (101) 1.75 ⁇ 0.2 1.51 ⁇ 0.1 1.2 ⁇ 0.1 1.04 ⁇ 0.1 below flag leaf (107) (92) (73) (63)
- c Values in parentheses indicate % of the wild type.
- the severely dwarf mutant M47191, designated as GA2OX6 AC T carries a T-DNA insertion at a position 2.1 kb upstream of the translation start codon of GA2ox6 (Fig. 4C).
- the semi-dwarf mutant M58817 designated as GA2OX9 A C T, carries a T-DNA insertion at a position 2.4 kb upstream of the translation start codon of GA2ox9 (Fig. 4D). Accumulation of GA2ox9 mRNA was significantly enhanced by T-DNA activation tagging, and the semi-dwarf phenotype was observed in both homozygous and heterozygous mutant.
- the GA2OX9 A CT homozygous mutant produced seeds with an average fertility of 92% of the wild type (Table 4).
- the three activation-tagged mutants, GA2OX5A335-341ACT, GA2OX6ACT and GA2OX9ACT were further characterized.
- Ubi::GA2ox6 transgenic rice Ubi::GA2ox6 transgenic rice.
- GA2ox6 mRNA in leaves and roots accumulated to a higher level in the GA2OX6AC T mutant than in the wild type, but both were unaffected by GA 3 treatment (Fig. 7C), indicating that plant and root growth was promoted by GA 3 and was not related to GA2ox6 expression.
- Fig. 7C unaffected by GA 3 treatment
- GA 3 treatment could compensate for the decrease in endogenous GA concentration and recover seed germination and plant growth of the GA2OX6 a CT mutant (Fig. 12), suggesting that GA responsiveness was not affected in the mutant.
- the rice wild type forms tillers 30 days after seed imbibition (Fig. 2C). It was found that rice mutants or transgenic rice overexpressing GA2oxs formed tillers not only with higher number but also much earlier than the wild type.
- the GA2OX6A C T mutant and Ubi::GA2ox5 and Ubi::GA2ox6 transgenic seedlings after growth of the first seedling/tiller from the embryo at 2 DAI, a subsequent swelling on the embryo surface adjacent to the base of the first seedling/tiller was observed at 3 DAI (Fig. 8A, panels 2 to 4). Then a second and even a third seedling/tiller grew out from the swelled embryo surface from 9 to 15 DAI (Fig.
- GA2ox5 and GA2ox6 Specifically Inactivated C20-GA Precursors and Reduced GA Biosynthesis
- a CT mutant M47191
- crude extracts containing GA were prepared from leaves of 18-day-old seedlings and mature plants and subjected to a GC-MS-selected ion monitoring method for identification of GA compounds (Lee and Zeevaart., 2002).
- the level of GAi was much lower in mutants (0.1 and 0 ng/g, respectively) than in the wild type (0.6 and 0.7 ng/g, respectively); in contrast, the level of GA 97 was much higher in mutants (28.7 and 10.8 ng/g, respectively) than in the wild type
- GA 53 a precursor of GA i , could be converted to GAg 7 in vitro by the Arabidopsis class C20 GA2ox through 2P-hydroxyIation (Schomburg et al., 2003).
- the in vitro activity of rice GA2ox5 and GA2ox6 were also investigated by overexpression as fusion proteins with glutathione S-transferase in E. coli. Fusion proteins were partially purified and their enzyme activity analyzed.
- the class C20 GA2oxs including the Arabidopsis GA2ox7 and GA2ox8 and spinach GA2ox3, contain three unique conserved domains that are absent in other GA2oxs (Lee and Zeevaart, 2005). These conserved domains are also present in the rice GA2ox5, GA2ox6 and GA2ox9 (Fig. 11). It has been demonstrated that rice GA2ox6 is capable of catalyzing 2 ⁇ - hydroxylation of C 20 -GAs (Table 7). Such C20 GA2ox activity can also be demonstrated for GA2ox5 and GA2ox9 using similar methods. The function of none of these three conserved - domains in plants had been previously identified.
- transgenic plants More than 30 independent transgenic plants, with transgene insertions being confirmed, were obtained for each construct.
- GA2ox can also be overexpressed via recombinant expression of GA2ox in transgenic lines, such as that in Ubi::GA2ox5 and Ubi::GA2ox6 lines.
- Fig. 19A and B illustrate that, while seedlings of WT were sensitive to freezing, seedlings of GA2OX6A C T, Ubi: :GA2ox5 and Ubi::GA2ox6 lines were tolerant to freezing stress.
- Fig. 20 A and B illustrate that, while seedlings of WT were sensitive to high salt, seedlings of GA2OX6A C T, Ubi: :GA2OX5 and Ubi::GA2ox6 lines were tolerant to salt stress.
- Fig. 21 A and B illustrate that, while seedlings of WT were sensitive to heat, seedlings of
- GA2OX6 A CT, Ubi::GA2ox5 and Ubi::GA2ox6 lines were tolerant to heat stress.
- Fig. 22A and B illustrate that, while seedlings of WT were sensitive to drought, seedlings of GA2OX6ACT Ubi:GA2ox5 and Ubi:GA2ox6 lines were tolerant to drought stress.
- Fig. 23 illustrates that, while seedlings of WT were sensitive to submergence, seedlings of GA2OX6ACT line were tolerant to submergence stress.
- Table 8 additionally demonstrates that GA deficient plants, such as the GA2OX6 AC T mutant, were more tolerant to multiple stresses than the wild type.
- Survival rate number of plants survived / total number of plant treated with stress.
- the tiller in rice is an important agronomic trait for grain yield.
- the rice tiller is a specialized grain-bearing branch that normally arises from the axil of each leaf and grows independently of the mother stem (culm) with its own adventitious roots.
- a MONOCULM 1 gene (MOC1) which encodes a GRAS family nuclear protein and is expressed mainly in the axillary buds, has been shown to be essential for controlling tiller bud growth (Li et al., 2003). It was found some similarities between GA2oxs and MOC1 in controlling rice growth. First, expression of group -
- the T- DNA activation-tagged rice mutant GA2OX6ACT and Ubi::GA2ox5 and Ubi: :GA2ox6 transgenic rice exhibited severe dwarfism and produced fewer seeds after more than 5 months of cultivation (Table 4), and germination of GA2OX6 A CT mutant seeds was delayed significantly (Fig. 5C).
- the T-DNA activation-tagged rice mutant GA2OX9ACT exhibited semi-dwarf phenotype but produced nearly normal amount of seeds (Table 5) with normal germination rate (Fig. 5C). GA2oxs with different biological activity might account for the difference in phenotypes.
- activation efficiency by enhancers in T-DNA inserted close to these GA2ox promoters or a positional effect of T-DNA insertion might contribute to the difference.
- GA2ox5, GA2ox6 and GA2ox9 contain three conserved domains that are similar to those of the Arabidopsis GA2ox7 and GA2ox8 and spinach GA2ox3 (Lee and Zeevaart, 2005), but are absent in other rice GA2oxs. These Arabidopsis and spinach GA2oxs have been shown to catalyze 2p-hydoxylation of C 20 -GAs, such as GA53 and GA 12 , instead of Q9-GA catalysis by most other GA2oxs.
- domain III is essential for substrate binding or for catalytic activity.
- the GA2ox5 A335-341 ACT mutant produced twice as many tillers, and its roots were 2.5 times longer than the wild type (Table 5), indicating that the partially-functional GA2ox5 promoted root and tiller meristem growth.
- T-DNA activation approach allows the overexpression of GA2oxs under the control of their native promoters.
- the T-DNA activation approach has been shown to mainly elevate the expression level of nearby genes without altering the original expression pattern in general (Jeong et al., 2002).
- the controlled expression of GA2oxs in the right time and right place may give rise to phenotypes that facilitate functional analysis of both GA2ox promoters and enzymes during all phases of the life cycle of rice.
- a HIGH-TILLERING DWARF 1 ⁇ HTDl gene encoding a carotenoid cleavage dioxygenase, negatively regulates tiller bud outgrowth in rice (Zou et al., 2006).
- HTDl expression is induced by auxin (NAA)
- NAA auxin
- auxin may suppress rice tillering partly through up-regulation of HTDl transcription (Zou et al., 2006).
- Further studies are required to understand whether auxin, cytokinin and GA signalings interact and control tillering in rice.
- Crown rootless (Crll) promotes crown and lateral root formation and Crll itself is up regulated by auxin in rice (Inukai et al., 2005).
- auxin in rice
- aboveground organs are normal in the crll mutant (Inukai et al., 2005), indicating that adventitious/crown root growth might be regulated by a root-specific auxin signaling pathway.
- auxin and GA signaling interacti on controls root growth in rice.
- MOC1 is an essential regulator of rice tiller bud formation and development (Li et al., 2003). Overexpression of MOC1 also promotes tiller growth and inhibits stem elongation in transgenic rice, and OSH1 and TBI are downstream positive regulators themselves positively regulated by MOC1 in tiller development (Li et al., 2003; Wang and Li, 2005). In addition to tillering, seed germination and fertilization are also impaired in the mod mutant, which indicates that MOCl might be involved in GA signaling pathways, by serving as both positive and negative regulators (Wang and Li, 2005). However, it is unclear how MOCl interacts with the GA signaling pathway for regulation of OSHl and TBI expression and thus tiller development.
- Gs are a class of essential plant hormones that control a variety of plant growth and developmental processes.
- G2oxs Gibberellin 2-oxidases
- native, inducible or constitutive promoters can be used for better ectopic overexpression of GA2oxs in transgenic rice to lead to desirable traits, such as reduced height, higher tillering, more biomass, increased root mass, stronger stems, enhanced stress tolerance, higher grain yield, etc. in transgenic rice.
- desirable traits can be obtained in a wide range of plant species by controlling expression of GA2oxs or a related gene product.
- the rice cultivar Oryza sativa L. cv Tainung 67 was used as in this study.
- Four T-DNA tagged rice GA2ox mutant lines were obtained from the Taiwan Rice Insertional Mutagenesis database (TRIM database, http://trim.sinica.edu.tw/). ⁇ mutant seeds were surface sterilized in 2.5% NaClO for 18 minutes, washed well with sterile water, placed on MS agar medium (Murashige and Skoog Basal Medium, Sigma), and incubated at 28°C with continuous light for 15-20 days.
- Wild type rice was grown under the same conditions. Plants were transplanted to pot soil and grown in a net-house during the growing season.
- GA2ox activation-tagged rice mutants (GA2OX9 AC T and GA2OX6 A CT) and GA2ox overexpressing transgenic lines (carrying constructs Ubi::GA2ox5 and Ubi::GA2ox6) were used .
- T-DNA flanking sequences were rescued using a built-in plasmid rescue system (Upadhyaya et al, 2002) and analyzed with an ABI Prism 3100 DNA sequencer (Applied Biosystems) using DNA sequences 100-bp upstream of the T-DNA right border as an RB primer.
- T-DNA flanking sequences were blasted by a BLASTN (Basic Local Alignment Search Tool) routine against the NCBI database for assignment in the rice BAC/PAC site, and gene dispersions were annotated by the RiceGAAS database.
- BLASTN Basic Local Alignment Search Tool
- RT-PCR analysis was carried out in a 15 ⁇ solution containing 0.9 ⁇ . cDNA, lx PCR buffer (Promega), 1.5 mM MgCl 2 , 0.2 mM each dNTP, 0.3 ⁇ each primer, 3% DMSO, and 0.6 units of Taq DNA polymerase (Promega).
- RT-PCR analysis was carried out using KOD Hot Start DNA Polymerase
- reaction solution contained 0.9 ⁇ . cDNA, lx PCR buffer (Novagen), 1.0 mM MgSG-4, 0.2 mM each dNTP, 0.3 ⁇ each primer, 3% DMSO, and 1 unit of KOD Hot Start DNA Polymerase (Novagen).
- PCR was performed with the following conditions: denaturation at 94 °C for 1 min, primer annealing at different temperature for each gene for 1 min, primer extension at 72°C for 1 min, and a final 10 min primer extension at 72°C using a programmable thermal cycler (PTC-200, MJ Research).
- PTC-200 programmable thermal cycler
- BamHI restriction site was designed at the 5' end of DNA primers used for PCR amplification
- Plasmid pAHC18 (Bruce et al., 1989) was derived from plasmid pUC18 that contains the maize ubiquitin
- IPTG Isopropyl- ⁇ - D-thiogalactopyranoside
- GA2oxl-F SEQ ID NO:38 5'- CGAGCAAACGATGTGGAAGGGCTACAGG -3' OsGA2oxl (332 bp)
- GA2oxl-R SEQ ID NO:39 5'- TGGCTCAGGCGGAGTGAGTACATTGTCG -3'
- GA2ox2-F SEQ ID NO:40 5'- CCCCACATCCCTGACAAGGCTC -3' OsGA2ox2 (592 bp)
- GA2ox2-R SEQ ID NO:41 5'- CTATTCATGGTCGTCATCGTCC -3'
- GA2ox3-F SEQ ID NO:42 5'- TGAGCGCGCTGGTGACGGCGGA -3' OsGA2ox3 ⁇ 15 ⁇ bp
- GA2ox3-R SEQ ID NO:43 5'- CTTGATTTGTAGGCAGCCTTC -3'-
- GA2ox4-F SEQ ID NO:44 5'- TCGGTGGAGGATAACTTCGGC -3' OsGA2ox4 (999 bp)
- GA2ox4-R SEQ ID NO:45 5'- TGGGTTAGCGACAGGTGGTGG -3'
- GA2ox5-F SEQ ID NO:46 5'- ATGGAGGAGCACGACTACGACT -3' OsGA2ox5 (974 bp)
- GA2ox6-F SEQ ID NO:48 5'- G ACGACGTGCTTCCTGCGGCTC AA-3 ' OsGA2ox6 (389 bp) GA2ox6-R SEQ ID NO:49 5'- CTTCCTGCACCTTCTTCCTGTA-3 '
- GA2ox7-F SEQ ID NO:50 5'- ACGGGAGCTTCTACGCGAGT -3 ' OsGA2ox7 (594 bp)
- GA2ox8-F SEQ ID NO:52 5'- GTGCTGCGGCGGATGGTGGTGG -3' OsGA2ox8 (555 bp)
- GA2ox8-R SEQ ID NO:53 5'- CTTCGTCGCGGCCTCATCGTTGG -3'
- GA2ox9-F SEQ ID NO:54 5'- ATGTCGAGGCTGGCCAGGG -3' OsGA2ox9 (533 bp)
- GA2ox9-R SEQ ID NO:55 5'- CATACGAGGAAATTACTGAGGC -3'
- GA2oxl0-F SEQ ID NO:56 5'- CTCCGATCCAACGACACCTCT -3' OsGA2oxll (501 bp)
- GA2oxlO-R SEQ ID NO:57 5'- AGCCAGCGCCTCGTCCTGAT -3'
- GA3ox2-F SEQ ID NO:58 5'- TCTCCAAGCTCATGTGGTCCGAGGGCTA -3' OsGA3ox2 (346 bp)
- GA3ox2-R SEQ ID NO:59 5'- TGGAGCACGAAGGTGAAGAAGCCCGAGT -3'
- 18S-F SEQ ID NO:60 5'- CCTCGTGCCCCTATC AACTT-3 ' 18S RNA (201 bp)
- GA2ox5-fiill-F SEQ ID NO:62 5'- AGCGGATCCATGGAGGAGCACGACTACG -3' OsGA2ox5 full length
- GA2ox6-full-F SEQ ID NO:64 5'- TTGGATCCATGCCGGCCTTCGC-3 ' OsGA2ox6 full length
- Wild type (WT) and mutant seeds were surface sterilized in 2.5% NaCIO, placed on MS agar medium (Murashige and Skoog Basal Medium, Sigma), and incubated at 28°C with 16 h light and 8 h dark for various days. Seedlings of WT grew normally. Seedlings of GA2OX9 A CT mutant line exhibited semi-dwarf phenotype. Seedlings of GA2OX6 A CT mutant line, Ubi::GA2ox5 and Ubi: :GA2ox6 transgenic lines exhibited severe-dwarf phenotypes.
- Seedlings of various ages e.g., 6-day-old, 15-day-old, or 40-day-old, were used in several abiotic stress assays, e.g., cold tolerance, freezing tolerance, salt tolerance, heat tolerance, draught tolerance, submergence tolerance, etc.
- Singh DP Jermakow AM, Swain SM (2002) Gibberellins are required for seed development and pollen tube growth in Arabidopsis. Plant Cell 14: 3133-3147.
- Tanimoto E (2005) Regulation of root growth by plant hormones - roles of auxin and gibberellin. Critic. Rev. in Plant Sci. 24: 249-265.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Endocrinology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Cultivation Of Plants (AREA)
Abstract
Novel gibberellin 2-oxidase (GA2ox) genes were identified. GA2ox5, GA2ox6 and GA2ox9 were three genes encoding class C20 GA2oxs in rice. Mutations in the conserved domain III were found to affect the physiological activity of class C20 GA2oxs. Mutants or transgenic rice overexpressing GA2oxs exhibited increased tolerance to multiple stresses. Methods are described for enhancing stress tolerance by overexpressing GA2ox in the plant.
Description
TITLE OF THE INVENTION
A Method of Controlling Plant Growth and Architecture by Controlling Expression of Gibberellin 2-
Oxidase REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Patent Application No. 12/604,808, filed on October 23, 2009, published as U.S. Patent Application Publication No. 20100095406 Al on April 15, 2010, titled "A Method of Controlling Plant Growth and Architecture by Controlling Expression of Gibberellin 2-Oxidase," which is a continuation-in-part patent application of U.S. patent application Ser. No. 12/139,674, filed on June 16, 2008, published as U.S. Patent Application
Publication No. 20090313725 Al on December 17, 2009, titled "Gibberellin 2-Oxidase Genes And Uses Thereof," the disclosure of all of the applications is hereby incorporated by reference herein in its entirety. BACKGROUND OF THE INVENTION
[0002] Gibberellins (GAs) are a class of essential hormones controlling a variety of growth and development processes during the entire life cycle of plants, including seed germination, apical dominance, leaf expansion, stem elongation, root growth, floral initiation, anther development and fruit maturation (Harberd et al., 1998; Ross et al., 1997; Hedden and Phillips, 2000, Kin and Evan, 2003, Sun and Gubler, 2004; Kende and Zeevaart, 1997, del Pozo, et al., 2005). GAs are substituted tetracyclic diterpene carboxylic acids formed over several biosynthetic steps (Hedden and Phillips, 2000). To date, 136 different GAs have been identified in plants, fungi and bacteria (see for example, the World Wide Web site of plant-hormones.info/gibberellins); however, most of these GAs are precursors or degradation products.
[0003] The bioactive GAs synthesized by higher plants are GAls GA3, GA4, and GA7 (Hedden and Phillips, 2000). The GA biosynthetic pathway can be classified into three stages, with three classes of enzymes involved, including terpene cyclases, cytochrome P450 monooxygenases (CYP450s), and 2-oxoglutarate-dependent dioxygenases (2-ODDs, including GA 20-oxidase, GA 7- oxidase, GA 3-oxidase, and GA 2-oxidase) (Olszewski et al., 2002; Graebe, 1987, Hedden and Phillip, 2000, Sakamoto et al., 2004). Mutants defective in GA biosynthesis have been identified in a variety of plant species, with the most prominent phenotypes being reduced internode length and small dark green leaves (Koornneef and van der Veen, 1980). Other phenotypes include prolonged germination dormancy, inhibited root growth, defective flowering, reduced seed production, and
male sterility (King and Evans, 2003, Sakamoto et al., 2004, Tanimoto, 2005, Wang and Li, 2005).
Normal growth of these mutants can be restored by exogenous application of active GAs.
[0004] GA 2-oxidases (GA2oxs) are a class of 2-ODDs (Thomas, et al., 1999; Sakamoto, et al.,
2001, Schomburg, et al., 2003, Sakamoto et al., 2004, Lee and Zeevaart, 2005). The class C19 GA2oxs identified in various plant species can hydroxylate the C-2 of active C^-GAs (GA\ and
GA4) or C^-GA precursors (GA20 and GA9) to produce biologically inactive GAs (GA8, GA34,
GA29, and GA51, respectively) (Sakamoto et al., 2004). Recently, three novel class C20 GA2oxs, including Arabidopsis GA2ox7 and GA2ox8 and spinach GA2ox3, were found to hydroxylate C20-
GA precursors (converting GAi2 and GA53 to GAno and GAc>7, respectively) but not Qg-GAs (Schomburg et al., 2003, Lee and Zeevaart, 2005). The 2 -hydroxylation of C20-GA precursors to
GAno and GA97 renders them unable to be converted to active GAs and thus decreases active GA levels. The class C20 GA2oxs contain three unique and conserved amino acid domains that are absent in the class CI 9 GA2oxs (Lee and Zeevaart, 2005).
[0005] The physiological function of GA2oxs has been studied in a variety of plant species. Arabidopsis GA2oxl and GA2ox2 were found to be expressed in inflorescences and developing siliques, which is consistent with a role of GA2oxs in reducing GA levels and promoting seed dormancy (Thomas et al., 1999). Further study with the pea slender mutant, where the SLENDER gene encoding a GA2ox had been knocked out, showed that GA level increased during germination, and resultant seedlings were hyperelongated (Martin et al., 1999). More recently, dwarf phenotype was also found to correlate with reduced GA levels in two Arabidopsis mutants in which GA2ox7 and GA2ox8 were activation-tagged, and ectopic overexpression of these two genes in transgenic tobacco led to dwarf phenotype (Schomburg et al., 2003). These studies demonstrated that GA2oxs are responsible for reducing the endogenous level of biologically active GAs in plants. The class C20 GA2oxs, regulating early steps in the GA biosynthesis pathway, have also been shown to control photoperiods in dicots. In long-day (LD) rosette plants, such as spinach, LD-induced stem elongation and flowering are dependent on GA-regulated processes. In short-day (SD) plants, deactivation of GA53 to GA97 prevails, while in LD plants, conversion of GA53 to the bioactive GA20 and GAi is favored (Lee and Zeevaart, 2005). The functions of four rice GA2oxs have been previously studied (Sakamoto, et al., 2001, 2004; Sakai et al., 2003).
[0006] U.S. patent application Ser. No. 12/139,674 describes the identification and
characterization of 10 putative GA2ox genes from the sequence analysis of the rice genome.
Differential expression of the GA2ox genes was found to correlate with various developmental processes during rice growth, such as flower development, seed germination and tiller growth. The
application also describes methods related to GA2ox genes, such as a method of inhibiting stem elongation and promoting tiller growth in a plant by controlling the expression of a GA2ox gene in a plant.
[0007] Features such as semidwarfism, higher tillering, more biomass, more adventitious roots, stronger stems and enhanced stress tolerance are the most valuable traits in crop breeding, because they result in plants that are more resistant to damages caused by wind and rain (lodging resistant) and biotic and abiotic stresses, and have stable increase of yields. However, it is difficult to create such plant varieties by conventional breeding of the natural genetic variations of crops species. The present invention offers transgenic approaches for obtaining plants with desirable traits that have not been easily obtained with conventional breading methods, i.e., by controlling expression of GA2ox gene in both monocots and dicots. Plants with more adventitious roots, thicker or stronger stems and branches, more leaf numbers or more biomass, and higher stress tolerance, as well as plants with semidwarfism and higher tillering, have been obtained using the present invention.
SUMMARY OF THE INVENTION
[0008] It has been surprisingly discovered in the present invention that increased expression of a GA2ox in a plant conferred increased tolerance to multiple stresses.
[0009] In one general aspect, the present invention relates to a method of obtaining at least one desirable feature of enhanced stress tolerance and stronger and thicker stem of a plant compared to a control plant. The method comprises obtaining a transgenic plant, wherein the transgenic plant comprises a recombinant polynucleotide encoding a polypeptide selected from the group consisting of:
(1) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(2) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(3) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(4) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ
ID NO: 8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(5) a polypeptide having an amino acid sequence that is at least about 80%) identical to SEQ ID NO:10 or at least about 80% identical to SEQ ID NO:12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
(6) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO: 75; and
(7) a mutant class C20 GA2ox having at least one mutation in domain III of class C20
GA2ox, the mutant C20 GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that does not comprise the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17, and
wherein the polypeptide, when expressed in the transgenic plant, confers the at least one desirable feature of enhanced stress tolerance and stronger and thicker stem to the transgenic plant as compared to the control plant grown under the same conditions.
[0010] Another general aspect of the present invention relates to a method of obtaining at least one desirable feature of enhanced stress tolerance and stronger and thicker stem of a plant compared to a control plant, the method comprising increasing expression of a gibberellin 2-oxidase or a derivative thereof in the plant as compared to the control plant.
[0011] In an embodiment of the present invention, the method comprising increasing the expressio of a polypeptide selected from the group consisting of:
(1) a polypeptide having an amino acid sequence that is at least about 80%) identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(2) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(3) a polypeptide having an amino acid sequence that is at least about 80%) identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(4) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO: 73;
(5) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
(6) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75; and (7) a mutant class C20 GA2ox, the mutant GA2ox having at least one mutation in
domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17.
wherein the polypeptide, when its expression is increased in the plant, results in reduced amount of endogenous bioactive gibberellins as compared to the control plant grown under the same conditions.
[0012] In one general aspect, the present invention relates to an isolated nucleic acid comprising a nucleotide sequence that encodes a polypeptide selected from the group consisting of:
(a) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(b) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(c) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74; and
(d) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:14 or at least about 80% identical to SEQ ID NO:16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
[0013] In another general aspect, the present invention relates to an isolated polypeptide comprising an amino acid sequence selected from the group consisting of:
(1) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(2) an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID
NO:73;
(3) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74; and
(4) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
[0014] Another general aspect of the present invention relates to an isolated nucleic acid comprising a nucleotide sequence that encodes a mutant class C20 gibberellin 2-oxidase protein (GA2ox), the mutant GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, wherein the domain III comprises an amino acid sequence of SEQ ID NO: 17.
[0015] Another general aspect of the present invention relates to an isolated polypeptide comprising a mutant class C20 gibberellin 2-oxidase (GA2ox), the mutant GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, wherein the domain III comprises the amino acid sequence of SEQ ID NO: 17.
[0016] Other general aspects of the present invention relate to an expression vector and a recombinant cell comprising a nucleic acid according to an embodiment of the present invention.
[0017] In another general aspect, the present invention relates to a transgenic plant comprising a transgene, wherein the transgene encodes a polypeptide selected from the group consisting of:
(a) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(b) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(c) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ
ID NO:72;
(d) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(e) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
(f) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75; and
(g) a mutant class C20 GA2ox, the mutant GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17.
[0018] The present invention also relates to a propagation material obtained from the transgenic plant of the present invention, wherein the propagation material contains the transgene.
[0019] In another general aspect, the present invention relates to a method of producing a transgenic plant according to embodiments of the present invention, comprising:
(a) transforming a plant cell with a nucleic acid molecule comprising a transgene according to an embodiment of the present invention to obtain a recombinant plant cell; and
(b) growing the recombinant plant cell obtained in (a) to generate a transgenic plant.
[0020] Another general aspect of the present invention relates to a method of inhibiting plant growth, comprising:
(a) transforming a plant cell with a nucleic acid molecule comprising a transgene according to an embodiment of the present invention to obtain a recombinant plant cell that expresses a recombinant polypeptide; and
(b) growing the recombinant plant cell obtained in (a) to generate a transgenic plant;
wherein the recombinant polypeptide is expressed in the transgenic plant at a level sufficient to inhibit growth of the transgenic plant.
[0021] Another general aspect of the present invention relates to a method of obtaining a semi- dwarf transgenic plant, comprising:
(a) providing a transgenic plant according to an embodiment of the present invention or a propagation material thereof;
(b) growing the transgenic plant or the propagation material thereof, so that a recombinant polypeptide is expressed in the transgenic plant at a level sufficient to inhibit growth of the transgenic plant; and
(c) applying to the transgenic plant or the propagation material thereof a composition comprising at least one bioactive GA compound, so that the transgenic plant or propagation material thereof produces the semi-dwarf transgenic plant.
[0022] Another general aspect of the present invention relates to a method of inhibiting stem elongation and promoting tiller growth in a plant, comprising administering to the plant a compound that increases the expression of a gene encoding a polypeptide or a compound that increases the enzymatic activity of the polypeptide in the plant, wherein the polypeptide is selected from the group consisting of:
(a) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(b) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(c) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to
SEQ ID NO:72;
(d) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(e) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO:10 or at least about 80% identical to SEQ ID NO:12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74; and
(f) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
[0023] Another general aspect of the present invention relates to a method of identifying a compound that inhibits stem elongation and promotes tiller growth in a plant, comprising identifying a compound that increases the expression of a gene encoding a polypeptide or a compound that increases the enzymatic activity of the polypeptide in the plant, wherein the polypeptide is selected from the group consisting of:
(a) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to
SEQ ID NO:70;
(b) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(c) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(d) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(e) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74; and
(f) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
[0024] Other aspects, features and advantages of the invention will be apparent from the following disclosure, including the detailed description of the invention and its preferred embodiments and the appended claims.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0025] The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawing. For the purpose of
illustrating the invention, there is shown in the drawing embodiments of the invention. It should be understood, however, that the invention is not limited to the precise arrangements and
instrumentalities shown.
[0026] In the drawings:
[0027] Figs. 1A-1C illustrate the rice GA2ox family: Fig. 1 A shows chromosome locations of
GA2oxs as determined by the NCBI map viewer program (www.ncbi.nlm.nih.gov/mapview/); Fig.
IB shows the phylogenetic tree based on the comparison of deduced amino acid sequences of rice
GA2oxs; Fig. 1C shows the phylogenetic tree based on the comparison of amino acid sequences of
29 GA2oxs from 9 plant species (Table 4); wherein the plant species are: At, Arabidopsis thaliana; Cm, Cucurbita maxima; Ls, Lactuca sativa; Nt, Nicotiana sylvestris; Pc, Phaseolus coccineus; Po,
Populus alba x P. tremuloides; Ps, Pisum sativum; and So, Spinacia oleracea; wherein GA2oxs with three unique highly conserved domains are enclosed in squares;
[0028] Figs. 2A-2C illustrate differential expression of GA2oxs that correlated with flower and tiller development: Fig. 2 A shows various developmental phases during the life cycle of rice; Fig. 2B shows temporal expression patterns of GA2oxs in rice, wherein the 18S rR A gene (rRNA) was used as a control; Fig. 2C shows tiller development during the life cycle of rice, wherein a total of 8 plants were used for counting tiller number and error bars indicate the SE (standard errors) of the mean at each time point, and DAI means days after imbibition;
[0029] Figs. 3A and 3B illustrate decrease in GA2ox6 expression that correlated with seed germination: Fig. 3 A shows that germination rate of rice seeds reached 100% at 2 DAI; Fig. 3B shows expression patterns of GA2oxs in rice seeds between 0~5 DAI, wherein total R As were isolated from embryos at each time point and analyzed by RT-PCR, and wherein the 18S rRNA gene (rRNA) was used as a control;
[0030] Figs 4A -4D illustrate four GA2ox mutants identified from the TRIM mutant library: Fig. 4A shows the severely dwarf mutant M77777, designated as GA2OX3ACT, which carries a T-DNA insertion at a position 587 bp upstream of the translation start codon of GA2ox3, wherein
accumulation of GA2ox3 mRNA in this mutant was significantly enhanced in the heterozygous (T/W) mutant as analyzed by RT-PCR analysis; Fig. 4B shows the semi-dwarf mutant M27337, designated as GA2OX5A335-341ACT, which carries a T-DNA insertion in the coding region, at a position 23 bp upstream of the translation stop codon of GA2ox5, wherein accumulation of the truncated GA2ox5 mRNA was significantly enhanced by T-DNA activation tagging in both heterozygous and homozygous (T/T) mutants; Fig. 1C shows the severely dwarf mutant M47191, designated as GA2OX6ACT, which carries a T-DNA insertion at a position 2.1 kb upstream of the
translation start codon of GA2ox6, wherein accumulation of GA2ox6 mRNA was significantly enhanced by T-DNA activation tagging in both heterozygous and homozygous mutants; and Fig. 4D shows the semi-dwarf mutant M58817, designated as GA2OX9ACT, which carries a T-DNA insertion at a position 2.4 kb upstream of the translation start codon of GA2ox9, wherein accumulation of GA2ox9 mRNA was significantly enhanced by T-DNA activation tagging in the homozygous mutant; wherein in the diagram, an asterisk indicates translation start codon, filled box indicates exon, triangle indicates T-DNA, arrowheads indicate position of primers used for RT-PCR analysis, and scale bar represents DNA length for each gene, and the open box in the triangle indicates the position of the CaMV35S enhancers (next to the left border of T-DNA);
[0031] Figs. 5A-5C illustrate that activation of GA2oxs expression had different effect on seed germination and seedling growth: Fig. 5A shows morphology of Tl seedlings at 18 DAI; Fig. 5B shows that seedling heights of GA2OX5A335-341ACT and GA2OX9ACT mutants were slightly shorter while seedlings of GA2OX6ACT were severely shorter than the wild type, wherein heights of 8 plants in each line were measured and error bars indicate the SE of the mean at each time point; Fig. 5C shows that as compared with the wild type, germination rate was normal for GA2OX9ACT mutant, slightly delayed for GA2ox5A335-341 ACT mutant, and significantly delayed for GA2OX6ACT mutant; wherein germination rates of 154, 20, 156, 49 seeds for TNG67, GA2OX5A335-341ACT, GA2OX6 CT, and GA2OX9ACT, respectively, were determined at each time point, and + and - indicate the presence and absence, respectively;
[0032] Figs. 6A-6D illustrate that overexpression of GA2ox5 and GA2ox6 recapitulated the dwarf phenotypes in transgenic rice and tobacco: Figs. 6A and 6B show that expression of
Ubi: :GA2ox5 and Ubi::GA2ox6, respectively, resulted in dwarfism in transgenic rice as compared with control rice transformed with vector pCAMBIA1301 only (CK); Fig. 6C and 6D show that expression of Ubi::GA2ox5 and Ubi::GA2ox6, respectively, resulted in different degrees of dwarfism in transgenic tobacco as compared with control tobacco transformed with vector only
(CK); wherein photographs were taken at the heading stage (upper panel) and 18 days (lower panel) after sowing of seeds;
[0033] Figs. 7A -7C show that overexpression of GA2ox6 reduced GA levels in rice mutant in which only shoot but not root growth was affected: Fig. 7A shows that treatment with GA3 (5 μΜ) promoted germination and seedling growth of GA2OX6ACT mutant (photo taken at 6 DAI); Fig. 7B shows that overexpression of GA2ox6 in rice mutants reduced shoot but not root growth, wherein treatment with GA3 (5 μΜ) recovered plant height of the GA2OX6ACT mutant and root growth of both
wild type and mutant, and a total of 8 plants were used for measuring plant height and root length and error bars indicate the SE of the mean; Fig. 7C illustrates that accumulation of GA2ox6 mR A in leaves and roots of wild type and mutant seedlings (at 18 DAI) was not altered by GA3 treatment, wherein thel8S rRNA gene (rRNA) was used as a control, and WT stands for wild type;
[0034] Figs. 8A-8F illustrate that overexpression of GA2ox5 and GA2ox6 promoted early tiller and adventitious root growth and affects root architecture: Fig. 8A shows that swelling on the embryo surface adjacent to the base of the first seedling/tiller (IT) was observed in the GA2OX6ACT mutant and Ubi::OsGA2ox5 and Ubi::OsGA2ox6 transgenic rice (panels 2-4) and not in the wild type (panel 1) (photos taken at 3 DAI); Fig. 8 B shows that a second tiller (2T) grew out from the swollen embryo surface of mutant and transgenic rice (photo taken at 9 DAI); Fig. 8C shows that three tillers formed in some seedlings of mutant and transgenic rice (photo taken at 15 DAI); Fig. 8D shows that each tiller grew out of its own coleoptile and all new tillers in the mutant and transgenic rice had their own adventitious roots (photo taken at 21 DAI), wherein panel 2 is a higher magnification of the boxed area in panel 1 that reveals coleoptiles (1C and 2C, respectively) and adventitious roots (1R and 2R, respectively) of the first and second tillers; Fig. 8E shows dwarfism and early tillering of seedlings of mutant and transgenic rice as compared with the wild type (photo taken at 12 DAI), wherein panel 2 is a higher magnification of the boxed area in panel 1 that reveals first and second tillers; Fig. 8F shows that mutant and transgenic roots became highly curled and zigzag (panel 2) as compared with the wild type (panel 1), wherein photos were taken at 15 DAI from the bottom of agar plates for better visualization of root growth and WT stands for wild type.
[0035] Figs. 9A-C show that overexpression of GA2ox5 and GA2ox6 decreased plant heights, but increased tiller numbers and root numbers: Fig. 9A shows plant heights of various plants; Fig. 9B shows tiller of various plants; Fig. 9C shows root numbers of various plants; wherein mutant or transgenic rice seeds germinated on MS agar medium for 18 DAI, ten plants in each line were averaged and error bars indicate the SE of the mean, and wherein WT stands for wild type;
[0036] Figs. 10A and 10B illustrate that mutations in domain III affected the activity of GA2ox5 and GA2ox6: Fig. 10A shows design of constructs encoding the full-length and domain Ill-truncated GA2ox5 and GA2ox6, wherein boxes indicate positions of three highly conserved amino acid domains, and the last amino acid residue was shown at the C-terminus of deduced polypeptides; Fig. 10B shows the comparison of morphology among transgenic rice overexpressing full-length and domain-III-truncated GA2ox5 and GA2ox6 and vector pCAMBIA1301 only (CK);
[0037] Fig. 11 illustrates amino acid sequence alignment of rice GA2oxs, including OsGA2ox5 (SEQ ID NO: 2), OsGA2ox6 (SEQ ID NO:4) and OsGA2ox9 (SEQ ID NO: 10); Arabidopsis
GA2oxs, including AtGA2ox7 (SEQ ID NO: 24) and AtGA2ox8 (SEQ ID NO:25); and spinach
GA2ox, including SoGA2ox3 (SEQ ID NO: 26), using the Vector NTI 6.0 software (InforMaxJnc), wherein these GA2oxs contain three highly conserved domains (underlined) that are absent in other
GA2oxs (Lee and Zeevaart, 2005);
[0038] Figs. 12 A and 12 B show dwarfism of Ubi::GA2ox6 transgenic rice that is partially rescued by GA3: Wild type (WT) and Ubi: :GA2ox6 transgenic rice grown in pot soil were treated with (+) or without (-) 10 μΜ GA3 at a 12-day interval for 5 weeks; the height of WT plant was not altered, while that of transgenic plant was enhanced, by GA3 treatment; Figure 12A shows morphology of plants, and Figure 12B shows growth curve of plants; the height of transgenic plants increased linearly during first 10 days, tapered off afterward, and finally only reached 63% of the
WT; arrows indicate dates for GA3 treatment;
[0039] Fig. 13 is schematic diagram that shows GA catabolism and response pathways:
bioactive GA positively regulates germination, stem and root elongation, and flower development, but negatively regulates OSH1 and TBI that control tillering; bioactive GA also negatively regulates adventitious root development;
[0040] Figs. 14A and 14B illustrate that GA3 suppresses OSH1 and TBI expression: Fig. 14A shows the relative mR A levels of OSH1 and TBI in Wild type (WT), GA2OX6ACT and
GA2ox5 335-341 ACT mutants: seeds were germinated in MS agar medium with (+) or without (-) 5 μΜ GA3, total RNAs were isolated from embryos that containing tiller buds at 12 DAI and analyzed by RT-PC using primers that specifically amplified rice OSH1 and TBI cDNAs, the highest mRNA level was assigned a value of 100, and mRNA levels of other samples were calculated relative to this value, error bars indicate the SE for three replicate experiments; Fig. 14B shows photographs of the seedlings analyzed in Fig. 14A prior to RNA isolation: panels (1) and (2) are higher magnifications of boxed areas for GA2ox5A335-34lACT&nd GA2OX6ACT mutants without GA3 treatment to reveal the main stem (MS) and first tiller (IT);
[0041] Figs. 15A and 15B show that GA3 represses tiller growth independent of growth stages:
Fig. 15A shows GA2OX6ACT mutant and wild type seedlings grown on MS agar medium with or without GA3 (5 μΜ) for 15 days, the lower left panel is a higher magnification of the boxed area for the GA2OX6ACT mutant treated with GA3 to reveal the main stem and first tiller; MS means main stem; IT means first tiller; and 1L means first true leave; and Fig. 15B shows 1 -month-old wild type and GA2OX6ACT mutant plants sprayed with 10 μΜ GA3 or water only every 7 days for a total of 3 sprays: + and -, presence and absence of 10 μΜ GA3, respectively.
[0042] Figs. 16A-C illustrate that GA deficiency enhanced the strength of stem and root and increased the number of leaves at seedling stages: Fig. 16A shows a photograph of the intact seedlings taken at 12 DAI: stems of mutant and transgenic rice were thicker than that of the wild type (TNG67); Fig. 16B shows a photograph of the root system of the seedlings taken at 12 DAI: the mutants and transgenic rice had higher number and stronger roots; and Fig. 16C illustrates that GA deficiency enhanced the number of leaves;
[0043] Figs. 17A-C illustrate that GA deficiency enhanced the drought tolerance of the plant: Fig. 17A shows a photograph of the well watered plant of wild type, GA2OX6ACT, Ubi:GA2ox5, and UB:iGA2ox6; Fig. 17B illustrates that GA deficient mutant and transgenic rice had higher drought tolerance after 20 days without watering; and Fig. 17C is the magnification of the wild type and GA2OX6ACT plants, illustrating that the GA deficient mutant kept growing and its leaves remained green under the drought condition while the wild type wilted;
[0044] Fig. 18 A and B illustrate that GA deficiency enhanced cold tolerance of the plant: Fig. 18A shows a photograph of 15-day-old seedlings after they were incubated at 28°C or 4°C for 6 days, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6ACT and Ubi:GA2ox5; Fig. 18B shows a photograph of 15-day-old seedlings after they were incubated at 4°C for 6 days, then transferred to 28°C and recovered for 5 days, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6ACT and Ubi:GA2ox5;
[0045] Fig. 19A and B illustrate that GA deficiency enhanced freezing tolerance of the plant: Fig. 19A shows a photograph of 15-day-old seedlings after they were incubated at 28°C or -20°C for 30 min, the seedlings shown are: wild type, GA2OX9ACT= GA2OX6ACT and Ubi:GA2ox5; Fig. 19B shows a photograph of 15-day-old seedlings after they were incubated at -20°C for 30 min, then transferred to 28°C and recovered for 5 days, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6ACT and Ubi:GA2ox5;
[0046] Fig. 20A and B illustrate that GA deficiency enhanced salt tolerance of the plant: Fig. 20A shows a photograph of 15-day-old seedlings after they were incubated in water or 200 mM NaCl solution at 28°C for 2 days, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6ACT and Ubi:GA2ox5; Fig. 20B shows a photograph of 15-day-old seedlings after they were incubated with 200 mM NaCl for 2 days, then transferred to water and recovered for 5 days, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6ACT and Ubi:GA2ox5;
[0047] Fig. 21 A and B illustrate that GA deficiency enhanced heat tolerance of the plant: Fig. 21 A shows a photograph of 15-day-old seedlings after they were incubated at 28°C or 42°C for 42 hours, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6ACT and Ubi:GA2ox5; Fig. 21B
shows a photograph of 15-day-old seedlings after they were incubated at 42°C for 42 hours, then transferred to 28°C and recovered for 5 days, the seedlings shown are: wild type, GA2OX9ACT,
GA2OX6ACT arid Ubi:GA2ox5;
[0048] Fig. 21 A and B illustrate that GA deficiency enhanced heat tolerance of the plant: Fig. 21A shows a photograph of 15-day-old seedlings after they were incubated at 28°C or 42°C for 42 hours, the seedlings shown are: wild type, GA2OX9aCT, GA2OX6ACT and Ubi:GA2ox5; Fig. 21 B shows a photograph of 15-day-old seedlings after they were incubated at 42°C for 42 hours, then transferred to 28°C and recovered for 5 days, the seedlings shown are: wild type, GA2OX9ACT, GA2OX6ACT and Ubi:GA2ox5;
[0049] Fig. 22A and B illustrate that GA deficiency enhanced drought tolerance of the plant: they show photographs of 40-day-old plants that were well-watered (Fig. 22A) or de-hydrated (Fig. 22B) at 28°C for 14 days, the plants shown are: wild type, GA2OX6aCT Ubi:GA2ox5 and
Ubi:GA2ox6;
[0050] Fig. 23 illustrates that GA deficiency enhanced submergence tolerance of the plant: it shows a photograph of 6-day-old seedlings grown in the air (-)or submerged in water (+) at 28°C for 7 days, then both the air-grown and the submerged seedlings were grown in the air for 5 days, the plants shown are: wild type, GA2OX9ACT, GA2OX6aCT and Ubi:GA2ox5.
DETAILED DESCRIPTION OF THE INVENTION
[0051] It will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof. It is understood, therefore, that this invention is not limited to the particular embodiments disclosed, but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims.
[0052] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention pertains. Otherwise, certain terms used herein have the meanings as set in the specification. All patents, published patent applications and publications cited herein are incorporated by reference as if set forth fully herein. It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise.
[0053] As used herein, the term "gene" refers to a segment of DNA involved in producing a functional RNA. A gene includes the coding region, non-coding regions preceding ("5'UTR") and following ("3'UTR") the coding region, alone or in combination. The functional RNA can be an
mRNA that is translated into a peptide, polypeptide, or protein. The functional RNA can also be a non-coding RNA that is not translated into a protein species, but has a physiological function otherwise. Examples of the non-coding RNA include, but are not limited to, a transfer RNA
(tRNA), a ribosomal RNA (rRNA), a micro RNA, a ribozyme, etc. A "gene" can include intervening non-coding sequences ("introns") between individual coding segments ("exons"). A
"coding region" or "coding sequence" refers to the portion of a gene that is transcribed into an mRNA, which is translated into a polypeptide and the start and stop signals for the translation of the corresponding polypeptide via triplet-base codons. A "coding region" or "coding sequence" also refers to the portion of a gene that is transcribed into a non-coding but functional RNA.
[0054] As used herein, a "promoter" refers to a portion of a gene that provides a control point for regulated gene transcription. A promoter can include a binding site for RNA polymerase. A promoter can also include one or more binding sites for one or more transcription factors. A promoter is often upstream of ("5' to") the transcription initiation site of a gene. A promoter is typically adjacent to the transcriptional start site of the gene. However, a promoter can also be located at a distance from the transcriptional start site of the gene.
[0055] As promoters are typically immediately adjacent to the gene in question, positions in the promoter are designated relative to the transcriptional start site, where transcription of RNA begins for a particular gene (i.e., positions upstream are negative numbers counting back from -1, for example -100 is a position 100 base pairs upstream). Conventional notation is used herein to describe polynucleotide sequences. The left-hand end of a single-stranded polynucleotide sequence is the 5 '-end, and the left-hand direction of a single-stranded polynucleotide sequence is referred to as the 5 '-direction. The left-hand end of a double-stranded polynucleotide sequence is the 5 '-end of the plus strand, which is depicted as the top strand of the double strands, and the right-hand end of the double-stranded polynucleotide sequence is the 5 '-end of the minus strand, which is depicted as the bottom strand of the double strands. The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. A DNA strand having the same sequence as an mRNA is referred to as the "coding strand." Sequence on a DNA strand which is located 5' to a reference point on the DNA is referred to as "upstream sequence"; sequence on a DNA strand which is 3' to a reference point on the DNA is referred to as "downstream sequence."
[0056] As used herein, "operably linked" refers to a functional relationship between two nucleotide sequences. A single-stranded or double-stranded nucleic acid moiety comprises the two nucleotide sequences arranged within the nucleic acid moiety in such a manner that at least one of the two nucleotide sequences is able to exert a physiological effect by which it is characterized upon
the other. By way of example, a promoter sequence that controls transcription of a coding sequence is operably linked to that coding sequence. Operably linked nucleic acid sequences can be contiguous, typical of many promoter sequences, or non-contiguous, in the case of, for example, nucleic acid sequences that encode repressor proteins. Within a recombinant expression vector, "operably linked" is intended to mean that the coding sequence of interest is linked to the regulatory sequence(s) in a manner that allows for expression of the coding sequence, e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell.
[0057] "Sequence" means the linear order in which monomers occur in a polymer, for example, the order of amino acids in a polypeptide or the order of nucleotides in a polynucleotide.
[0058] As used herein, the term "nucleotide sequence", "nucleic acid" or "polynucleotide" refers to the arrangement of either deoxyribonucleotide or ribonucleotide residues in a polymer in either single- or double-stranded form. Nucleic acid sequences can be composed of natural nucleotides of the following bases: T, A, C, G, and U, and/or synthetic analogs of the natural nucleotides. In the context of the present invention, adenosine is abbreviated as "A", cytidine is abbreviated as "C", guanosine is abbreviated as "G", thymidine is abbreviated as "T", and uridine is abbreviated as "U".
[0059] As used herein, an "isolated" nucleic acid molecule is one that is substantially separated from at least one of the other nucleic acid molecules present in the natural source of the nucleic acid, or is substantially free of at least one of the chemical precursors or other chemicals when the nucleic acid molecule is chemically synthesized. An "isolated" nucleic acid molecule can also be, for example, a nucleic acid molecule that is substantially free of at least one of the nucleotide sequences that naturally flank the nucleic acid molecule at its 5' and 3' ends in the genomic DNA of the organism from which the nucleic acid is derived. A nucleic acid molecule is "substantially separated from" or "substantially free of other nucleic acid molecule(s) or other chemical(s) in preparations of the nucleic acid molecule when there is less than about 30%, 20%, 10%, or 5% or less, and preferably less than 1%, (by dry weight) of the other nucleic acid molecule(s) or the other chemical(s) (also referred to herein as a "contaminating nucleic acid molecule" or a "contaminating chemical").
[0060] Isolated nucleic acid molecules include, without limitation, separate nucleic acid molecules (e.g., cDNA or genomic DNA fragments produced by PCR or restriction endonuclease treatment) independent of other sequences, as well as nucleic acid molecules that are incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote. In addition, an isolated nucleic acid
molecule can include a nucleic acid molecule that is part of a hybrid or fusion nucleic acid molecule.
An isolated nucleic acid molecule can be a nucleic acid sequence that is: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) synthesized by, for example, chemical synthesis;
(iii) recombinantly produced by cloning; or (iv) purified, as by cleavage and electrophoretic or chromatographic separation.
[0061] A polynucleotide can have a single strand or parallel and anti-parallel strands. Thus, a polynucleotide may be a single-stranded or a double-stranded nucleic acid. Unless otherwise indicated, a polynucleotide is not defined by length and thus includes very large nucleic acids, as well as short ones, such as an oligonucleotide.
[0062] "Sequence identity or similarity", as known in the art, is the relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. As used herein, "identity", in the context of the relationship between two or more nucleic acid sequences or two or more polypeptide sequences, refers to the percentage of nucleotide or amino acid residues, respectively, that are the same when the sequences are optimally aligned and analyzed. For purposes of comparing a queried sequence against, for example, the amino acid sequence SEQ ID NO: 6, the queried sequence is optimally aligned with SEQ ID NO: 6 and the best local alignment over the entire length of SEQ ID NO: 6 is obtained.
[0063] Analysis can be carried out manually or using sequence comparison algorithms. For sequence comparison, typically one sequence acts as a reference sequence, to which a queried sequence is compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, sub-sequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
[0064] Optimal alignment of sequences for comparison can be conducted, for example, by using the homology alignment algorithm of Needleman & Wunsch, J Mol. Biol., 48:443 (1970). Software for performing Needleman & Wunsch analyses is publicly available through the Institut Pasteur (France) Biological Software website: http://bioweb.pasteur.fr/seqanal/
interfaces/needle.html. The NEEDLE program uses the Needleman- Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length. The identity is calculated along with the percentage of identical matches between the two sequences over the reported aligned region, including any gaps in the length. Similarity scores are also provided wherein the similarity is calculated as the percentage of matches between the two sequences over the reported aligned region, including any gaps in the length. Standard comparisons utilize the EBLOSUM62 matrix for protein sequences and the EDNAFULL matrix for nucleotide
sequences. The gap open penalty is the score taken away when a gap is created; the default setting using the gap open penalty is 10.0. For gap extension, a penalty is added to the standard gap penalty for each base or residue in the gap; the default setting is 0.5.
[0065] Hybridization can also be used as a test to indicate that two polynucleotides are substantially identical to each other. Polynucleotides that share a high degree of identity will hybridize to each other under stringent hybridization conditions. "Stringent hybridization conditions" has the meaning known in the art, as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1989). An exemplary stringent hybridization condition comprises hybridization in a medium comprising 4-6 x sodium chloride/sodium citrate (SSC) at about 45-65°C, followed by one or more washes in 0.2 x SSC and 0.1% SDS at 50 - 65°C, depending upon the length over which the hybridizing polynucleotides share complementarity or percent of identity.
[0066] As used herein, the terms "polypeptide" and "protein" are used herein interchangeably to refer to amino acid chains in which the amino acid residues are linked by peptide bonds or modified peptide bonds. The amino acid chains can be of any length of greater than two amino acids. Unless otherwise specified, the terms "polypeptide" and "protein" also encompass various modified forms thereof. Such modified forms may be naturally occurring modified forms or chemically modified forms. Examples of modified forms include, but are not limited to, glycosylated forms, phosphorylated forms, myristoylated forms, palmitoylated forms, ribosylated forms, acetylated forms, ubiquitinated forms, etc. Modifications also include intra-molecular crosslinking and covalent attachment to various moieties such as lipids, flavin, biotin, polyethylene glycol or derivatives thereof, etc. In addition, modifications may also include cyclization, branching and cross-linking. Further, amino acids other than the conventional twenty amino acids encoded by the codons of genes may also be included in a polypeptide.
[0067] An "isolated protein" or "isolated polypeptide" is one that is substantially separated from at least one of the other proteins present in the natural source of the protein, or is substantially free of at least one of the chemical precursors or other chemicals when the protein is chemically synthesized. A protein is "substantially separated from" or "substantially free of other protein(s) or other chemical(s) in preparations of the protein when there is less than about 30%, 20%, 10%, or 5% or less, and preferably less than 1% (by dry weight) of the other protein(s) or the other chemical(s) (also referred to herein as a "contaminating protein" or a "contaminating chemical").
[0068] Isolated proteins can have several different physical forms. The isolated protein can exist as a full-length nascent or unprocessed polypeptide, or as a partially processed polypeptide or
as a combination of processed polypeptides. The full-length nascent polypeptide can be postranslationally modified by specific proteolytic cleavage events that result in the formation of fragments of the full-length nascent polypeptide. A fragment, or physical association of fragments can have the biological activity associated with the full-length polypeptide; however, the degree of biological activity associated with individual fragments can vary.
[0069] An isolated polypeptide or isolated protein can be a non- naturally occurring
polypeptide. For example, an isolated polypeptide can be a "hybrid polypeptide." An isolated polypeptide can also be a polypeptide derived from a naturally occurring polypeptide by additions or deletions or substitutions of amino acids. An isolated polypeptide can also be a "purified polypeptide" which is used herein to mean a specified polypeptide in a substantially homogeneous preparation substantially free of other cellular components, other polypeptides, viral materials, or culture medium, or when the polypeptide is chemically synthesized, chemical precursors or byproducts associated with the chemical synthesis. A "purified polypeptide" can be obtained from natural or recombinant host cells by standard purification techniques, or by chemical synthesis, as will be apparent to skilled artisans.
[0070] As used herein, "recombinant" refers to a polynucleotide, a polypeptide encoded by a polynucleotide, a cell, a viral particle or an organism that has been modified using molecular biology techniques to something other than its natural state.
[0071] As used herein, a "recombinant cell" or "recombinant host cell" is a cell that has had introduced into it a recombinant polynucleotide sequence. For example, recombinant cells can contain at least one nucleotide sequence that is not found within the native (non-recombinant) form of the cell or can express native genes that are otherwise abnormally expressed, under-expressed, or not expressed at all. Recombinant cells can also contain genes found in the native form of the cell wherein the genes are modified and re-introduced into the cell by artificial means. The term also encompasses cells that contain ail endogenous nucleic acid that has been modified without removing the nucleic acid from the cell; such modifications include those obtained, for example, by gene replacement, and site-specific mutation. The term encompasses cells that contain the recombinant polynucleotide sequence either on a vector, such as an expression vector, or integrated into a cell chromosome.
[0072] Recombinant DNA sequence can be introduced into host cells using any suitable method including, for example, electroporation, calcium phosphate precipitation, microinjection, transformation, biolistics and viral infection. Recombinant DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. For example, the
recombinant DNA can be maintained on an episomal element, such as a plasmid. Alternatively, with respect to a stably transformed or transfected cell, the recombinant DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the stably transformed or transfected cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA. It is further understood that the term "recombinant host cell" refers not only to the particular subject cell, but also to the progeny or potential progeny of such a cell. Because certain modifications can occur in succeeding generations due to either mutation or environmental influences, and in such circumstances, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
[0073] As used herein, the term "transgenic plant" or "transgenic line" refers to a plant that contains a recombinant nucleotide sequence comprising a genetically modified gene, e.g., a transgene. The transgenic plant can be grown or derived from a recombinant cell. A transgenic plant includes progeny, offspring, clone, breeding material or propagation material, such as seeds, thereof that comprises the transgene. As used herein, a "transgenic plant" is synonymous with "transgenic recombinant plant" or "genetically engineered plant."
[0074] As used herein, the term "semi-dwarf transgenic plant" means a transgenic plant having the phenotypic trait of a reduced height of the stem or size that is about 50% to 90% of a non- transgenic plant of the same genetic background while being grown under the same conditions. For example, the semi-dwarf transgenic plant can have a height of the stem that is about 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, or 90% of a non-transgenic plant of the same genetic background while being grown under the same conditions.
[0075] As used herein, the term "dwarf transgenic plant" means a transgenic plant having the phenotypic trait of a reduced height of the stem or size that is about 20% to 50% of a non-transgenic plant of the same genetic background while being grown under the same conditions. For example, the dwarf transgenic plant can have a height of the stem that is about 20%, 25%, 30%, 35%, 40%, 45%, or 50% of a non-transgenic plant of the same genetic background while being grown under the same conditions.
[0076] As used herein, the term "severely dwarf transgenic plant" means a transgenic plant having the phenotypic trait of a reduced height of the stem or size that is less than about 20% of a non-transgenic plant of the same genetic background while being grown under the same conditions.
[0077] As used herein, the term "cereal plant" or "cereal crop" refers to a species of true grasses, i.e., Poaceae or Gramineae family in the Class Liliopsida of the flowering plants, or a
species of pseudocereals, that is cultivated for its edible grains or seeds. Cereal plants are staple crops grown in greater quantities and provide more energy worldwide than any other type of crop.
Cereal grains are a rich source of carbohydrate. Examples of cereal plants include, but are not limited to, plants of maize, rice, wheat, barley, sorghum, millets, oats, rye, triticale, buckwheat, fonio, quinoa, etc.
[0078] As used herein, an "expression vector" refers to a nucleic acid molecule that is used to recombinantly express a gene in a target cell. A heterologous or isolated nucleic acid encoding a gene of interest can be or is inserted into an expression vector. The expression vector with the heterologous or isolated nucleic acid can be or is introduced into a host cell. Once the expression vector is inside the cell, the gene product encoded by the heterologous or isolated nucleic acid is produced by the transcription and translation machinery of the host cell. An expression vector typically has for example, an origin of replication sequence allowing replication of the expression vector in the host cell, multiple cloning sites allowing insertion of the heterologous or isolated nucleic acid, a promoter allowing transcription of a gene of interest in the host cell, a heterologous or isolated nucleic acid encoding the gene of interest, a selectable marker gene that encodes a gene product allowing selection of the host cell containing the expression vector from those that do not. The properties, construction and use of expression vectors in the present invention will be readily apparent to those of skill in view of the present disclosure. For example, the expression vector according to embodiments of the present invention can be a plasmid that is replicable in an agrobacterium and contains a stress-inducible promoter operably linked to the coding sequence of a stress-resistant gene.
[0079] The terms "gibberellin 2-oxidase protein," "GA 2-oxidase," and "GA2ox", as used herein interchangeably, all refer to a 2-oxoglutarate-dependent dioxygenase (2-ODD) that catalyzes the inactivation of biologically active gibberellin (GA) and/or its precursors, thus reducing the endogenous levels of bioactive GAs.
[0080] A "GA2ox" can be a class C 19 GA2ox, that catalyzes 2p-hydroxylation of the C-2 of biologically active C^-GAs (GA\ and GA4) or C^-GA precursors (GA20 and GA9) to produce biologically inactive GAs (GA8, GA34, GA29, and GA51, respectively). Examples of CI 9 GA2ox include, but are not limited to, rice GA2oxs 1-4, GA2ox7, GA2ox8 and GA2o lO.
[0081] A "GA2ox" can also be a class C20 GA2ox, that catalyzes 2p-hydroxylation of C20-GA precursors but not C^-GAs. The 2p-hydroxylation of C20-GA precursors, e.g., converting GAj2 and GA53 to GA1 10 and GA97, respectively, renders them unable to be converted to active GAs and thus
decreases active GA levels. The class C20 GA2oxs contain three unique and conserved amino acid domains that are absent in the class C19 GA2oxs (Lee and Zeevaart, 2005). Examples of C20
GA2ox include, but are not limited to, Arabidopsis GA2ox7 and GA2ox8, spinach GA2ox3, and rice GA2ox5, GA2ox6 and GA2ox9.
[0082] As used herein, the term "bioactive gibberellin compound" and "bioactive GA compound", as used herein interchangeably, all refer to a gibberellin or a derivative thereof that regulates growth and influences various developmental processes of a plant. Depending on the type of gibberellin present as well as the species of plant, the physiological effects of a bioactive GA include, but are not limited to, one or more selected from the group consisting of stimulating stem elongation, stimulating bolting/flowering, breaking seed dormancy, stimulating germination, inducing sex expression, enzyme induction, causing parthenocarpic (seedless) fruit development, and delaying senescence in leaves and fruits. Examples of bioactive GA compound include, but are not limited to, GA1; GA3, GA4 and GA7.
[0083] As used herein, the "2-ODD conserved domain" is a conserved domain of the 20G- Fe(II) oxygenase superfamily. This family contains members of the 2-oxoglutarate (20 G) and Fe(II)-dependent oxygenase superfamily. This family includes the C-terminal of prolyl 4- hydroxylase alpha subunit. The holoenzyme has the activity EC:1.14.1 1.2 catalyzing the reaction: Procollagen L-proline + 2-oxoglutarate + 02 <=> procollagen trans- 4-hydroxy-L-proline + succinate + C02. The full enzyme consists of a alpha2 beta2 complex with the alpha subunit contributing most of the parts of the active site. The family also includes lysyl hydrolases, isopenicillin synthases and AlkB. GA2oxs are members of the 20G-Fe(II) oxygenase superfamily. The amino acid sequences of the 2-ODD conserved domains for OsGA2ox5; OsGA2ox6;
OsGA2ox7; OsGA2ox8; OsGA2ox9-l and OsGA2ox9-2; and OsGA2oxl0-l and OsGA2oxlO-2, are SEQ ID NO:70; SEQ ID NO:71; SEQ ID NO:72; SEQ ID NO:73; SEQ ID NO:74; and SEQ ID NO:75, respectively.
[0084] In the present study, 10 putative rice GA2ox genes were identified, and differential expression of nine of them correlated with various developmental processes during rice growth, such as flower development, seed germination and tiller growth. Differential expression and/or biological activities of GA2oxs can give rise to some beneficial phenotypes in rice, including semi- dwarfism, increased root system and higher tiller numbers that may favor grain yield. In addition to some known effects caused by overexpression of GA2oxs, the early and increased growth of tiller and adventitious root and altered root architecture further suggest the pleiotropic role of GA2oxs in controlling rice growth and architecture.
[0085] GA2ox5, GA2ox6 and GA2ox9 were three genes encoding class C20 GA2oxs in rice, and their functions were further investigated using T-DNA activation tagged rice mutants and transgenic ectopic overexpression approaches. Mutants or transgenic rice recombinantly expressing class C20 GA2oxs, under the control of their native promoters or a constitutive promoter, exhibited a broad range of mutant phenotypes. Mutations in the conserved domain III were found to affect the physiological activity of class C20 GA2oxs, suggesting domain III is important for the proper biological activity of class C20 GA2oxs. Overexpression of GA2ox5 with partially functional domain III significantly alleviated the mutant phenotype.
[0086] Embodiments of the present invention demonstrate that improvement of plant architecture can be achieved by overexpression of certain wild-type or mutant GA2oxs under the control of various promoters, such as the native, constitutive, or inducible promoters.
[0087] Accordingly, one general aspect of the present invention relates to an isolated nucleic acid, comprising a nucleotide sequence that encodes a polypeptide selected from the group consisting of:
(a) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ
ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(b) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(c) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74; and
(d) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:14 or at least about 80% identical to SEQ ID NO:16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
[0088] The invention encompasses any isolated nucleic acid encoding an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO:14 or SEQ ID NO:16, and the amino acid sequence has a domain that is at least 80%o identical to the 2-ODD conserved domain within each of the respective sequences. In embodiments of the present invention, the nucleic acid encodes an amino acid sequence that is 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10 or SEQ ID NO: 12; or SEQ ID NO: 14 or SEQ ID NO: 16, and the amino acid sequence has a domain that is at
least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:72; SEQ ID NO:73; SEQ ID NO:74; or SEQ ID NO:75, respectively. In particular embodiments of the present invention, the nucleic acid can be genomic DNAs, cDNAs, and chemically synthesized DNAs.
[0089] Due to the degeneracy of the genetic code, more than one codon may be used to encode a particular amino acid, and therefore, an amino acid sequence (for example, SEQ ID NO: 6) can be encoded by any one of a plurality of nucleic acid sequences. Isolated nucleic acid includes sequences wherein one or more codons in the sequence are replaced by codons of a different sequence but that code for the same amino acid residue are herein referred to as "conservative codon substitutions".
[0090] In one embodiment, the invention encompasses nucleic acid sequences that have one or more than one conservative codon substitutions. One of skill in the art would be able to determine a particular nucleic acid sequence having one or more than one conservative codon substitutions and encoding the above amino acid sequence, based on the sequence information provided herein.
Conservative codon substitutions can be made in the nucleic acid sequence encoding the
polypeptide, for example, the codons TTT and TTC (collectively referred to as TTT/C) can encode a Phe (phenylalanine) residue; other exemplary codon substitutions include, but are not limited to: TTA/G and CTT/C/A/G: Leu; ATT/C: lie; ATG: Met; GTT/C/A/G: Val; TCT/C/A/G: Ser;
CCT/C/A/G: Pro; ACT/C/A/G: Thr; GCT/C/A/G: Ala; TAT/C: Tyr; CAT/C: His; CAA/G: Gin; AAT/C: Asn; AAA/G: Lys; GAT/C: Asp; GAA/G Glu; TGT/C: Cys; CGT/C/A/G: Arg; AGT/C: Ser; AGA/G; Arg; GGT/C/A/G:Gly. Conservative codon substitutions can be made at any position in the nucleic acid sequence that encodes the recited amino acid sequence.
[0091] In an embodiment of the present invention, the isolated nucleic acid comprises a nucleotide sequence that encodes a polypeptide selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO: 14 and SEQ ID NO:16.
[0092] In another embodiment of the present invention, the isolated nucleic acid comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:l 1, SEQ ID NO: 13 and SEQ ID NO: 15.
[0093] A nucleic acid according to embodiments of the present invention can be readily designed, synthesized and isolated using methods known in the art, in view of the present disclosure. For example, a genomic DNA or cDNA can be prepared according to conventional methods known to those skilled in the art in view of the present disclosure. In one embodiment, genomic DNA can be prepared as follows: (1) extract a genomic DNA from rice cultivars having a DNA encoding a protein with a GA2-oxidation activity; (2) construct a genomic library (utilizing a vector such as a
plasmid, phage, cosmid, BAC, or PAC); (3) spread the library; and (4) conduct colony hybridization or plaque hybridization using a probe prepared based on a DNA encoding a polypeptide that is at least about 80% identical to an amino acid sequence selected from the group consisting of SEQ ID
NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 and SEQ ID NO:16. In another embodiment, a genomic DNA can be prepared via PCR using primers specific for a DNA encoding a polypeptide that is at least about 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID
NO:14 and SEQ ID NO:16. cDNA can be prepared as follows: (1) synthesize cDNAs based on mRNAs extracted from rice cultivars having a DNA encoding a protein with a GA2-oxidation activity; (2) prepare a cDNA library by inserting the synthesized cDNA into a vector such as λΖΑΡ;
(3) spread the cDNA library; and (4) conduct colony hybridization or plaque hybridization as described above. Alternatively, cDNA can also be prepared by RT-PCR. The DNA can be isolated by gel electrophoresis.
[0094] A nucleic acid according to embodiment of the present invention can be used to express a polypeptide of the present invention. The nucleic acid can also be used to produce an expression vector, a recombinant cell or a transgenic plant. Preferably, the polypeptide, expression vector, recombinant cell and transgenic plant can be used to regulate plant development, e.g., to suppress plant growth resulting in a semi-dwarf transgenic plant.
[0095] In another general aspect, the present invention relates to an isolated polypeptide comprising an amino acid sequence selected from the group consisting of:
(a) an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(b) an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73; (c) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74; and
(d) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
[0096] The invention encompasses any isolated polypeptide comprising an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID
NO: 12, SEQ ID NO: 14 or SEQ ID NO: 16, and the amino acid sequence has a domain that is at least
80% identical to the 2-ODD conserved domain within each of the respective sequences. In embodiments of the present invention, the polypeptide comprises an amino acid sequence that is
80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO: 10 or SEQ
ID NO:12; or SEQ ID NO:14 or SEQ ID NO:16, and the amino acid sequence has a domain that is at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:72; SEQ ID NO:73; SEQ ID
NO:74; or SEQ ID NO:75, respectively. Preferably, the polypeptide has GA2ox biological activity.
[0097] The polypeptide according to embodiment of the present invention can have additional amino acid residues. In some embodiments, the additional amino acids are present at the amino terminus, the carboxyl terminus, within the polypeptide sequence or combinations of these locations. Polypeptides having these types of additional amino acid sequences can be referred to as "fusion proteins". In some cases, it may be more appropriate to refer to them otherwise as "chimeric" or "tagged" proteins, or the like, depending on the nature of the additional amino acid sequences.
Nonetheless, one will be able to discern a polypeptide having additional amino acid sequences given the sequence information provided herein. The additional amino acid residues can be short, for example, from one to about 20 additional amino acid residues, or longer, for example, greater than about 20 additional amino acid residues. The additional amino acid residues can serve one or more functions or purposes including, for example, serving as epitopes for protein (e.g., antibody) or small molecule binding; serving as tags for intracellular and extracellular trafficking; providing additional enzymatic or other activity; or providing a detectable signal.
[0098] For example, the fusion protein can include additional amino acid residues providing coordinates for bonding (such as ionic, covalent, coordinative, hydrogen or Van der Waals bonding or combinations thereof) with organic or inorganic compounds. Useful additional amino acid sequences include, for example, poly-histidine residues useful for protein purification via Ni+- coupled residue, constant domains of immunoglobulins (IgA, IgE, IgG, IgM) or portions thereof (CHI, CH2, CH3), albumin, hemagluttinin (HA) or myc affinity epitope tags useful for the formation of immuno-complexes for detection or purification (antibodies against these moieties can be obtained commercially), polypeptides useful for detection such as the green fluorescent protein (GFP), enzymes such as beta-galactosidase (B-Gal), chloramphenicol acetyltransferase (CAT), luciferase, and alkaline phosphatase (A), signal sequences for protein trafficking and protease cleavage sequences useful for separating additional amino acid sequences from the sequence, if desired.
[0099] In an embodiment of the present invention, the isolated polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10,
SEQ ID NO: 12, SEQ ID NO:14 and SEQ ID NO:16.
[00100] A polypeptide according to embodiments of the present invention can be readily designed, synthesized and isolated using methods known in the art, in view of the present disclosure. The polypeptide can be produced as recombinant or naturally-occurring proteins by a method known to one skilled in the art. For example, a recombinant protein can be produced by a method comprising: (1) synthesizing a DNA encoding the protein using PCR with primers having desired restriction enzyme sites; (2) cloning the DNA into an expression vector, such as the pMAL-c2 expression vector (NEB); (3) transforming the expression vector into a host cell, such as Escherichia coli strain BL21 cell, to create a recombinant cell; (4) growing the recombinant cell under conditions to allow its expression of the recombinant protein; and (5) isolating the recombinant protein from the recombinant cell. The isolation of the recombinant protein can be facilitated by expressing the recombinant protein as a fusion protein with a histidine tag, maltose-binding protein, or glutathione-S-transferase (GST), and subsequently purifying or isolating the protein on a nickel column, an amylose-column, or a GST-glutathione column, respectively. After the purification or isolation, the above-described tag can be cleaved off using proteases, such as, thrombin and factor Xa as required.
[00101] When the polypeptide is produced and isolated as a naturally-occurring protein, such a protein is naturally produced by a plant or a plant tissue, and is isolated, for example, by binding an antibody to the polypeptide to an affinity column and contacting with the column an extract from the plant or plant tissue, such as rice or rice leaves, naturally expressing the polypeptide. The antibody can be prepared by immunizing a suitable animal with a partial sequence of the polypeptide made synthetically.
[00102] Another general aspect of the present invention relates to an isolated nucleic acid comprising a nucleotide sequence that encodes a mutant class C20 gibberellin 2-oxidase protein (GA2ox), or an isolated polypeptide comprising the mutant class C20 GA2ox.
[00103] The mutant C20 GA2ox has at least one mutation in domain III of a class C20 GA2ox and has a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation. The domain III, which comprises an amino acid sequence of SEQ ID NO: 17, is one of the three unique and conserved amino acid domains that are present in the class C20 GA2oxs, but absent in the class C19 GA2oxs.
It was discovered in the present invention that mutations in domain III affect the physiological activity of class C20 GA2oxs.
[00104] In an embodiment of the present invention, domain III comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21 , SEQ ID NO:22, and SEQ ID NO:23, and the otherwise identical class C20 GA2ox comprises an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26.
[00105] In view of the present disclosure, methods known in the art, such as site-directed mutagenesis (Kramer and Fritz, Methods in Enzymology, 154: 350-367 (1987)), can be used to introduce the at least one mutation, such as a deletion, insertion or substation of one or more amino acids, in domain III. The number and identity of amino acids that are mutated in domain III are not particularly restricted, as long as the class C20 GA2ox with the mutated domain III has a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation.
[00106] The enzymatic activity of a class C20 GA2ox with or without one or more mutations in domain III can be assayed using various methods known in the art in view of the present disclosure. For example, the class C20 GA2ox can be isolated or purified, e.g., from a recombinant cell that expresses the C20 GA2ox, or from a plant that has the C20 GA2ox. The enzymatic activity of the isolated or purified C20 GA2ox to hydroxylate a class C2o-GA precursor can be measured in vitro using a radio-labeled C20-GA precursor, such as radio-labeled GA12 or GAs3 (see Lee and Zeevaart, 2002; Schomburg et al., 2003). The enzymatic activity of the isolated or purified C20 GA2ox to hydroxylate a class C20-GA precursor can also be measured in vivo by analyzing the amount of GAi or GA97 in plant extracts, e.g., from the mature leaves or seedlings of plants containing the C20 GA2ox.
[00107] In an embodiment of the present invention, the mutant class C20 GA2ox comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:27, which has a deletion of amino acid residues 335-341 of SEQ ID NO:2 (GA2ox5), i.e., GA2ox5 Δ335-341;
(b) the amino acid sequence of SEQ ID NO:28, which has a deletion of amino acid residues 325-341 of SEQ ID NO:2 (GA2ox5), i.e., GA2ox5A325-341;
(c) the amino acid sequence of SEQ ID NO:29, which has a deletion of amino acid residues 338-358 of SEQ ID NO:4 (GA2ox6), i.e., GA2ox6A338-358;
(d) the amino acid sequence of SEQ ID NO:30, which has a deletion of amino acid residues
348-358 of SEQ ID NO:4 (GA2ox6), i.e., GA2ox6A348-358;
(e) the amino acid sequence of SEQ ID NO:68, which has a deletion of amino acid residues 344-358 of SEQ ID NO: 10 (GA2ox9-l), i.e., GA2ox9-lA344-359; and
(f) the amino acid sequence of SEQ ID NO:69, which has a deletion of amino acid residues 354-358 of SEQ ID NO:10 (GA2ox9-l), i.e., GA2ox9-lA354-359.
[00108] Another general aspect of the present invention relates to an expression vector comprising a nucleotide sequence that encodes a polypeptide selected from the group consisting of :
(a) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(b) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71 ;
(c) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(d) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(e) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
(f) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75;
(g) a mutant class C20 GA2ox, the mutant GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17.
[00109] The expression vectors comprise a nucleic acid according to embodiments of the invention in a form suitable for expression of the nucleic acid in a host cell. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors according to embodiments of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein.
[00110] In an embodiment of the present invention, the expression vector is replicable and confers a selective marker in a plant cell. In another embodiment of the present invention, the expression vector is replicable and confers a selective marker in an Agrobacterium, a bacterium known for its ability to transfer nucleic acid between itself and plants. In yet another embodiment of the present invention, the expression vector allows the shuttling or exchange of nucleotide sequences between a plant cell and an Agrobacterium. Such expression vectors can be a modified bacterial tumor-inducing (Ti) plasmid or a bacterial root-inducing (Ri) plasmid.
[00111] In an embodiment of the present invention, the expression vector comprises a nucleotide sequence that encodes a polypeptide selected from the group consisting of : SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14 and SEQ ID NO:16.
[00112] In another embodiment of the present invention, the expression vector comprises a nucleotide sequence that encodes a mutant class C20 GA2ox comprising an amino acid sequence selected from the group consisting of: SEQ ID NOs:27-30, SEQ ID NO:68 and SEQ ID NO:69.
[00113] Any of a variety of procedures known in the art, such as electroporation, calcium phosphate precipitation, polyethylene glycol transformation, microinjection, nanoparticle-mediated transformation, particle bombardment, Agrobacterium-mediated transfer, biolistics-mediated transfomation and viral infection, can be used to introduce an expression vector into a host cell in view of the present disclosure.
[00114] In another general aspect, the present invention relates to a recombinant cell comprising a nucleotide sequence according to embodiments of the invention. In one embodiment, the recombinant cell is a recombinant plant cell, which includes various forms of plant cells, such as cultured cell suspensions, protoplasts, leaf sections and calluses. In another embodiment, the recombinant cell is a recombinant Agrobacterium cell. In another embodiment, the recombinant cell comprises an expression vector according to embodiments of the present invention. In an embodiment of the present invention, the recombinant cell comprises a nucleotide sequence that
encodes a polypeptide selected from the group consisting of : SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NOs:27-30, SEQ ID NO:68 and SEQ ID NO:69.
[00115] Any of a variety of procedures known in the art can be used to construct a recombinant cell according to embodiments of the present invention. For example, a nucleotide sequence according to embodiments of the invention can be introduced into a host cell via a vector. The nucleotide sequence can stay on the vector, separate from the chromosome, in the recombinant cell, such as in a transiently transfected recombinant cell that transiently expresses a gene product encoded by the nucleotide sequence. The nucleotide sequence can also be integrated into the chromosome in the recombinant cell, such as in a stably transfected recombinant cell that stably expresses a gene product encoded by the nucleotide sequence.
[00116] In another general aspect, the present invention relates to a transgenic plant comprising a transgene, wherein the transgene encodes a polypeptide selected from the group consisting of :
(a) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to
- SEQ ID NO:70;
(b) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(c) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ
ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(d) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:8; , wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73
(e) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
(f) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75;
(g) a mutant class C20 GA2ox, the mutant GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to
hydroxylate a class C20-GA precursor compared with an otherwise identical class C20
GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17.
[00117] In an embodiment of the present invention, the transgenic plant comprises the mutant class C20 GA2ox, wherein
(a) the domain III comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 18-23; and
(b) the otherwise identical class C20 GA2ox comprises an amino acid sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:26.
[00118] In a preferred embodiment of the present invention, the transgenic plant comprises a transgene, which encodes a polypeptide having the amino acid sequence selected from the group consisting of : SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NOs:27-30, SEQ ID NO:68 and SEQ ID NO:69.
[00119] In one embodiment, a transgenic plant according to embodiments of the present invention stably expresses a gene encoded by a recombinant nucleic acid molecule according to embodiments of the invention. In such a transgenic plant, the recombinant nucleic acid molecule is stably transformed or transfected into a plant cell and has become integrated into the chromosome of the plant cell so that the recombinant nucleic acid molecule is inherited by daughter cells of the plant cell through chromosome replication.
[00120] Any of a variety of procedures known in the art can be used to engineer a stable transgenic plant in view of the present disclosure. In one embodiment of the present invention, the transgenic plant is constructed by transforming a tissue of a plant, such as a protoplast or leaf-disc of the plant, with a recombinant Agrobacterium cell comprising a nucleic acid molecule according to embodiments of the present invention, and generating a whole plant using the transformed plant tissue. In another embodiment of the present invention, flowers of a plant can be dipped in a culture of recombinant Agrobacterium cell comprising a nucleic acid molecule according to embodiments of the present invention. After the bacterium transforms the germline cells that make the female gametes, seeds can be screened for markers carried by the nucleic acid molecule according to embodiments of the present invention. Transgenic plants are then grown out of the seeds.
[00121] In another embodiment of the present invention, a nucleic acid molecule according to embodiments of the invention can be introduced into a plant via gene gun technology, particularly when transformation with a recombinant Agrobacterium cell is less efficient in the plant. The gene
gun technology, also referred to as biolistics, delivers genetic information via an elemental particle of a heavy metal coated with plasmid DNA. This technology is able to transform almost any type of plant cells.
[00122] In another embodiment, a transgenic plant according to embodiments of the present invention transiently expresses a gene encoded by a recombinant nucleic acid molecule according to embodiments of the invention. Any of a variety of procedures known in the art can be used to engineer such a transgenic plant in view of the present disclosure. In one embodiment, a recombinant nucleic acid molecule according to embodiments of the invention can be introduced into a transgenic plant by particle bombardment, a specific example of which is described below in the examples. In another embodiment, the method of agroinfiltration can be used to allow transient expression of genes in a plant. In the method, for example, a recombinant nucleic acid molecule according to embodiments of the invention is first introduced into a strain of Agrobacterium to generate a recombinant Agrobacterium cell. A liquid suspension of the recombinant Agrobacterium is then injected into the airspaces inside a plant leaf. Once inside the leaf, the recombinant
Agrobacterium transforms the gene of interest to a portion of the plant cells and the gene is then transiently expressed. As compared to traditional plant transformation, the method of
agroinfiltration is speedy and convenient.
[00123] The transgenic plant according to embodiments of the present invention can be both monocot and dicot transgenic plants. In an embodiment of the present invention, the transgenic plant is a transgenic cereal plant, preferably a transgenic rice plant.
[00124] The transgenic plant according to embodiments of the present invention can comprise a transgene that is operably linked to any suitable promoters known in the art to provide a control point for regulated gene transcription of the transgene in the transgenic plant. The promoters that can be used in the present invention, include, but are not limited to a native promoter; a constitutive promoter selected from the group consisting of a maize ubiquitin (Ubi) promoter, a rice actin (Actl) promoter, and cauliflower mosaic 35S RNA promoter (CaMV35S) promoter; a tissue-specific promoter selected from the group consisting of a rice glutelin (GluB) promoter, a rubisco small subunit (rbcS) promoter and a maize zean gene promoter; a developmental stage-specific promoter selected from the group consisting of a rice alpha-amylase (< 4w2y)promoter and a rice glycine rich RNA binding protein (GRRP-AJ) promoter; and an inducible promoter inducible by drought, salt, high or low temperatures, hypoxia, anoxia, hydration, pH, chemicals, or hormones. Examples of the inducible promoters that can be used in the present invention, include, but are not limited to, promoters for the genes of Arabidopsis rd29A, cor 15 A, kinl, heat-shock factor (HSF), C-repeat-
binding factor (CBF1) and dehydration-responsive element binding protein (DREB1 A); and promoters for the genes of rice HVA1 (ABA-inducible), alcohol dehydrogenase (Adh), ethanol- inducible, and alpha-amylase (GA-inducible).
[00125] In an embodiment of the present invention, the promoter is expressed in developing seeds, during seed germination, in early seedlings, or in growing plants.
[00126] In another embodiment of the present invention, the transgenic plant is at least about 10% shorter, or has more root system, earlier tillering, higher tillering numbers, higher biomass, or higher seed production, than a non-transgenic plant of the same genetic background while being grown under the same conditions. Tillering is an important agronomic trait for grain yield. The tiller is a specialized grain-bearing branch that normally arises from the axil of each leaf and grows independently of the mother stem (culm) with its own adventitious roots. The present invention demonstrates that plant architecture improvements, including, but not limited to semidwarfism, increased root system and higher tiller numbers, which favor grain yield, could be induced by increased expression or activity of wild-type or modified C19 GA2oxs or C20 GA2oxs.
[00127] In a preferred embodiment, the transgenic plant is a semi-dwarf or dwarf transgenic plant having a height that is about 20% to 90% of a non-transgenic plant of the same genetic background while being grown under the same conditions. In particular embodiments, the transgenic plant is a semi-dwarf or dwarf transgenic plant having a height that is about 20%, 25%, 30%, 35%, 40%, 45%), 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% of that of a non-transgenic plant of the same genetic background while being grown under the same conditions.
[00128] An embodiment of the present invention also includes a propagation material obtained from the transgenic plant according to embodiments of the present invention, wherein the propagation material contains the transgene.
[00129] In another general aspect, the present invention relates to a method of producing a transgenic plant of the present invention. The method comprises: (a) transforming a plant cell with a nucleic acid molecule comprising the transgene according to an embodiment of the present invention to obtain a recombinant plant cell; and (b) growing the recombinant plant cell obtained in (a) to generate a transgenic plant.
[00130] Another general aspect of the present invention relates to a method of inhibiting stem elongation and promoting tiller growth in a plant. The method comprises: (a) transforming a plant cell with a nucleic acid molecule comprising a transgene according to an embodiment of the present invention to obtain a recombinant plant cell that expresses a polypeptide encoded by the transgene; and (b) growing the recombinant plant cell obtained in (a) to generate a transgenic plant; wherein
the polypeptide is expressed in the transgenic plant at a level sufficient to inhibit stem elongation and promote tiller growth in the transgenic plant.
[00131] In another embodiment of the method of the present invention, the transgene encodes a mutant class C20 GA2ox having at least one mutation in domain III of the class C20 GA2ox. The mutant GA2ox has a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation. Preferably, the domain III comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 and SEQ ID NO:23, and the otherwise identical class C20 GA2ox that lacks the at least one mutation comprising an amino acid sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26.
[00132] According to an embodiment of the present invention, the transgene used in the method encodes a polypeptide selected from the group consisting of a polypeptide having the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:27, SEQ ID NO:30 and SEQ ID NO:69.
[00133] According to an embodiment of the present invention, the transgene can be
overexpressed in the transgenic plant, i.e., is expressed at a level higher than that of an otherwise identical gene in a non-transgenic plant of the same genetic background. For example, the transgene encoding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NO:28, or SEQ ID NO:29 was overexpressed in transgenic rice plants according to embodiments of the invention.
[00134] According to another embodiment of the present invention, the transgene can be expressed at a level the same as or lower than that of an otherwise identical gene in a non-transgenic plant of the same genetic background. For example, embodiments of the present invention encompass transgenic plants having a transgene encoding SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:27, SEQ ID NO:30 or SEQ ID NO:69 expressed at a level that is equal to, less or more than that found in the wild-type.
[00135] According to a preferred embodiment of the present invention, the method further comprises breeding the transgenic plant with another plant to obtain a semi -dwarf or dwarf transgenic plant that still contains the transgene. Preferably, the transgenic plant is a severely dwarf transgenic plant and the other plant is a non-transgenic plant of the same genetic background. The breeding of the severely dwarf transgenic plant with the non-transgenic plant can produce a semi- dwarf or dwarf transgenic plant that is less dwarf than the severely dwarf parent transgenic plant.
More preferably, the transgene in the transgenic plant encodes a polypeptide selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO: 10.
[00136] According to another preferred embodiment of the present invention, the transgene used in the method encodes a polypeptide selected from the group consisting of a polypeptide having the amino acid sequence of SEQ ID NO: 10, SEQ ID NO:27, SEQ ID NO:30 and SEQ ID NO:69, and the polypeptide is expressed in the transgenic plant at a level sufficient to inhibit growth and make a semi-dwarf transgenic plant.
[00137] Another general aspect of the present invention relates to a method of obtaining a semi- dwarf transgenic plant. The method comprises: (a) providing a transgenic plant according to embodiments of the present invention or a propagation material thereof; (b) growing the transgenic plant or the propagation material thereof, so that the polypeptide transgenically or recombinantly expressed in the transgenic plant is at a level sufficient to inhibit growth of the transgenic plant; and (c) applying to the transgenic plant or the propagation material thereof a composition comprising at least one bioactive GA compound, so that the transgenic plant or propagation material thereof produces a semi-dwarf transgenic plant. The bioactive GA compound can be applied directly to the transgenic plant or the propagation material or indirectly to the soil in which the transgenic plant or the propagation material is grown.
[00138] The transgene expressed in the transgenic plant can be any of the transgene according to embodiments of the present invention. In an embodiment of the present invention, the transgene encodes a polypeptide having the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO: 10. In a preferred embodiment, the transgene is overexpressed in the transgenic plant.
[00139] The bioactive GA compound can be any bioactive GA compounds. In an embodiment of the present invention, the bioactive GA compound is not inactivated by the polypeptide
recombinantly produced by the transgenic plant. Preferably, the bioactive GA compound is selected from the group consisting of GA], GA3, GA4 and GA7.
[00140] Another general aspect of the present invention relates to a method of inhibiting stem elongation and promoting tiller growth in a plant, comprising administering to the plant a compound that increases the expression of a gene encoding a polypeptide or the enzymatic activity of the polypeptide in the plant, wherein the polypeptide is selected from the group consisting of:
(a) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(b) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(c) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to
SEQ ID NO:72;
(d) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(e) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74; and
(f) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
[00141] In a preferred embodiment, the polypeptide is selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, and the plant is a rice plant.
[00142] The compound that increases the expression of a gene encoding a polypeptide or the enzymatic activity of the polypeptide in the plant can be of any type, including, but not limited to a small molecule chemical compound and a molecule of biological origin, i.e., that is originally identified as a molecule made by a biological system, such as a plant, a microorganism, etc., or derivatives thereof.
[00143] Another general aspect of the present invention relates to a method of identifying a compound that inhibits stem elongation and promotes tiller growth in a plant, comprising identifying a compound that increases the expression of a gene encoding a polypeptide or the enzymatic activity of the polypeptide in the plant, wherein the polypeptide is selected from the group consisting of:
(a) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(b) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(c) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(d) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 8, wherein the amino acid sequence has a domain that is at least 80% identical to
SEQ ID NO:73;
(e) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74; and
(f) a polypeptide having an amino acid sequence that is at least about 80% identical to
SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75.
[00144] In a preferred embodiment, the polypeptide is selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO: 10, and the plant is a rice plant.
[00145] Various methods can be used to facilitate the identification of the compounds. For example, in vitro assay, preferably high-though put assay, can be conducted using an isolated polypeptide to identify compounds that increase the enzymatic activity of the polypeptide. Such in vitro assay can be based on the enzymatic activity of a CI 9 GA2ox, such as GA2ox7, GA2ox8 or GA2oxl0, to hydroxylate the C-2 of biologically active Ci9-GAs (GA, and GA4) or C19-GA precursors (GA20 and GA9) to produce biologically inactive GAs (GA8, GA34, GA29, and GA51, respectively). The in vitro assay can also be based on the enzymatic activity of a C20 GA2ox, such as GA2ox5, GA2ox6 or GA2ox9, to catalyze 2p-hydroxylation of C20-GA precursors, e.g., converting GA12 and GA53 to GAn0 and GAg7, respectively. The enzymatic activity of a C19 GA2ox or C20 GA2ox can be measured using methods known to those skilled in the art, for example, by using a radio-labeled C^-GA, C^-GA precursor or C20-GA precursor.
[00146] Compounds that increase the expression of a gene of interest can be identified using a cell based reporter assay. The transcriptional regulatory region of a gene according to an embodiment of the present invention, including the promoter and the 5'- and/or 3'- untranslated regulatory (UTR) region of the gene, can be operably linked to the coding sequence of a reporter gene, such as a luciferase gene (lux), a β-galactosidase gene (lacZ), a green fluorescent protein gene (GFP), etc. The expression level of the gene can thus be more easily measured from a cell as the
biological activity of the reporter gene product. A compound that increases the expression of the gene can be identified by its ability to increase the detected amount of the biological activity of the reporter gene product from the reporter assay.
[00147] The compound can be further identified using an in vivo assay, e.g., by administering the compound to a plant and analyzing the amount of biologically inactive GAs in plant extracts.
[00148] Another general aspect of the invention relates to a method of generating a transgenic plant having a feature selected from the group consisting of less height, higher tillering, more biomass, a stronger and thicker stem, a stronger root system, more leaves, stable increase of yields and/or seed production, and enhanced stress tolerance, as compared with a plant of substantially the same genetic background grown under the same conditions. The method comprises:
(a) transforming a cell of the plant of substantially the same genetic background with a nucleic acid molecule to obtain a recombinant plant cell; and
(b) generating a transgenic plant from the recombinant plant cell,
wherein the transgenic plant recombinantly expresses a polypeptide selected from the group consisting of:
(1) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(2) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least
80% identical to SEQ ID NO:71;
(3) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(4) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(5) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID
NO:74;
(6) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO:16, wherein the
amino acid sequence has a domain that is at least 80% identical to SEQ ID
NO:75; and
(7) a mutant class C20 GA2ox, the mutant C20 GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17.
[00149] As used herein a "plant of substantially the same genetic background" or a "control plant" refers to a plant that has substantially the same genotype, i.e., genetic constitution, as that of the transgenic plant according to an embodiment of the present invention, except that the plant does not recombinantly express a polypeptide selected from the group consisting of (1) to (7) above. The "plant of substantially the same genetic background" may contain an unmodified endogenous gene for a polypeptide selected from the group consisting of (1) to (7).
[00150] In addition to the gene alterations responsible for the recombinant expression of the polypeptide selected from the group consisting of (1) to (7) above, the transgenic plant can have one or more other genetic alterations resulting from the construction of the transgenic plant, such as an insertion, a deletion, or a disruption of certain gene or genomic sequences, as compared with the "plant of substantially the same genetic background" or the control plant. Preferably, such other genetic alterations do not result in significantly phenotypic changes to the transgenic plant.
[00151] In one embodiment of the present invention, the transgenic plant recombinantly expresses a polypeptide selected from the group consisting of (1) to (7) above from a transgene that is not found within the plant of substantially the same genetic background. The transgene is introduced into a cell of the plant of substantially the same genetic background to obtain a recombinant plant cell, which is subsequently used to generate the transgenic plant.
[00152] In another embodiment of the present invention, the transgenic plant recombinantly expresses a polypeptide selected from the group consisting of (1) to (7) above from a gene found within the plant of substantially the same genetic background, but the gene is modified and reintroduced into the transgenic plant by recombinant DNA technologies. The gene modifications can include changes to the coding sequence and/or regulatory sequences to alter the activity of the expressed polypeptide and/or the level of protein expression. For example, the endogenous gene can be cloned; the promoter for the endogenous gene can be replaced with a constitutive promoter or a stress-inducible promoter; the modified gene can be reintroduced into a cell of the plant of substantially the same genetic background to obtain a recombinant plant cell; and the recombinant
plant cell is used to generate a transgenic plant. Unlike the plant of substantially the same genetic background, the resulting transgenic plant expresses the gene of interest constitutively or in a stress inducible fashion.
[00153] In one embodiment of the present invention, the recombinantly expressed polypeptide is encoded by a gene stably integrated into the genome of the transgenic plant cell, such as in a stable transgenic plant.
[00154] In another embodiment of the present invention, the recombinantly expressed
polypeptide is encoded by a gene that remains on a vector inside the plant cell, such as in a transient transgenic plant.
[00155] In another general aspect, the present invention relates to a method of improving one or more traits of a plant selected from the group consisting of reduced height, increased tillering number, more biomass, a stronger and thicker stem, a stronger root system, more leaves, stable increase of yields and/or seed production, and enhanced stress tolerance compared to a control plant. The method comprises increasing expression and/or activity of a gibberellin 2-oxidase or a derivative thereof in the plant as compared to the control plant.
[00156] In an embodiment of the present invention, the method comprises increasing the expression in the plant of a polypeptide selected from the group consisting of:
(1) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(2) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(3) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(4) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(5) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to the 2-ODD conserved domain of SEQ ID NO: 10 or SEQU ID NO: 12;
(6) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ
ID NO:14 or at least about 80% identical to SEQ ID NO:16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75; and
(7) a mutant class C20 GA2ox, the mutant GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17,
wherein the polypeptide, when its expression is increased in the plant, results in reduced amount of endogenous bioactive gibberellins as compared to a control plant grown under the same conditions.
[00157] In an embodiment of the present invention, the expression of the desired polypeptide is increased by recombinant expression in a transgenic plant comprising a recombinant polynucleotide encoding the polypeptide.
[00158] In another embodiment of the present invention, the expression of the polypeptide is increased by active mutation of the gene encoding the polypeptide.
[00159] In yet another embodiment of the present invention, the expression and/or activity of the gibberellin 2-oxidase or its derivative is increased by administering to the plant an agent that increases the expression and/or activity of the gibberellin 2-oxidase or its derivative in the plant. Such agent can be screened or identified using methods described herein.
[00160] In one embodiment of the present invention, the resulting transgenic plant recombinantly expresses a mutant class C20 GA2ox gene. The mutant class C20 GA2ox has at least one mutation in domain III of class C20 GA2ox and a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical wild-type class C20 GA2ox that lacks the at least one mutation in domain III. According to embodiments of the present invention, the domain III comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 and SEQ ID NO:23; and the otherwise identical class C20 GA2ox comprises an amino acid sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26.
[00161] In another embodiment of the present invention, the resulting transgenic plant recombinantly expresses GA2ox selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID
NO: 16, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:68 and SEQ
ID NO:69.
[00162] The gene expression of the polypeptide of interest can be driven by a native promoter for the gene; a constitutive promoter such as maize ubiquitin (Ubi) promoter, a rice actin (Actl) promoter, and cauliflower mosaic 35S RNA promoter (CaMV35S) promoter; a tissue-specific promoter such as a rice glutelin (GluB) promoter, a rubisco small subunit (rbcS) promoter and a maize zean gene promoter; a developmental stage-specific promoter such as a rice alpha-amylase (aA my)promoter and a rice glycine rich RNA binding protein (GRRP-A1) promoter; and an inducible promoter such as that inducible by drought, salt, high or low temperatures, hypoxia, arioxia, hydration, pH, chemicals, or hormones.
[00163] In an embodiment of the present invention, the inducible promoter is selected from the group consisting of promoters for the genes of Arabidopsis rd29A, corl5A, kinl, heat-shock factor (HSF), C-repeat-binding factor (CBF1) and dehydration-responsive element binding protein (DREB1 A); and promoters for the genes of rice HVA1 (ABA-inducible), alcohol dehydrogenase (Adh), ethanol-inducible, and alpha-amylase (GA-inducible).
[00164] In another embodiment of the present invention, the promoter drives gene expression in a developing seed during seed germination, in early seedlings or in growing plants.
[00165] Methods according to embodiments of the present invention can be applied to a dicot plant or a monocot plant. In an embodiment of the present invention, methods of the present invention can be applied to an agricultural plant, such as a rice plant; an ornamental plant; a grass used in pasture, ground cover, golf course, or turf; such as Bermuda grass and pangolagrass.
[00166] It is readily understood that the transgenic plant can be bred with other plants in order to combine additional desirable traits into one plant. The other plants can be transgenic or
nontransgenic.
[00167] Methods according to embodiments of the present invention optionally comprise one or more screening steps for screening the one or more desirable traits in the transgenic plants using any screening method known in the art in view of the present disclosure.
[00168] In one embodiment of the present invention, the resulting transgenic plant has increased tolerance to one or more biotic stresses, such as that result from an invasion of the plant by a bacterium, a virus, a fungus, a parasite, a harmful insect, an algae, a nematode, or a weed.
[00169] In another embodiment of the present invention, the resulting transgenic plant has increased tolerance to one or more abiotic stresses, such as that result the negative impact of a high wind, an extreme temperature, drought, flood, a poor edaphic condition (like rock content, low or
high pH, infertile soil, etc), high radiation, compaction, contamination, pollution, or rapid rehydration during seed germination.
[00170] Another general aspect of the present invention relates to a method of obtaining at least one desirable feature of enhanced stress tolerance and stronger and thicker stem of a plant compared to a control plant. The method comprises obtaining a transgenic plant, e.g., one derived from the control plant, wherein the transgenic plant comprises a recombinant polynucleotide encoding a GA2ox or its derivative, wherein the GA2ox or its derivative, when expressed in the transgenic plant, confers the at least one desirable feature of enhanced stress tolerance and stronger and thicker stem to the transgenic plant as compared to the control plant grown under the same conditions.
[00171] This invention will be better understood by reference to the non-limiting examples that follow, but those skilled in the art will readily appreciate that the examples are only illustrative of the invention as described more fully in the claims which follow thereafter.
[00172] Identification of the Rice GA2ox Family
[00173] The preliminary computer search of the rice genome has identified 10 putative GA2ox genes. Three members of this gene family in rice had previously been found to encode GA2oxs with three unique and conserved domains, as with the class C20 GA2oxs of Arabidopsis and spinach (Lee and Zeevaart, 2005). Questions were thus raised as to whether all predicted rice GA2oxs are differentially expressed and regulated, and what their physiological functions in rice are.
[00174] Putative rice GA2oxs were sought by BLAST searching the NCBI, TIGR, and
RiceGAAS databases with the conserved domain in the 2-oxoglutarate (20G) and Fe (Independent oxygenase family and nucleotide sequences of four previously identified rice GA2oxs (GA2oxl to GA2ox4). A total of 10 putative GA2oxs were identified (Table 1). Among them, GA2oxl to GA2ox4 had previously been partially characterized (Sakamoto, et al., 2001, 2004; Sakai et al., 2003), and GA2ox5 and GA2ox6 had been reported but remained uncharacterized (Lee and Zeevaart, 2005). Four other GA2oxs, designated here as GA2ox7 to GA2oxlO, were identified in this study. Almost all GA2oxs encoded 300 to 400 amino acid residues, including the 20G-Fe (II) oxygenase conserved domain. However, the predicted PI value of GA2oxlO is 9.3, which is significantly different from those of other GA2oxs with predicted PI values ranging from 5.0 ~ 7.2.
[00175] Table 1. Putative GA2ox gene family in rice (Oryza sativa)
Gene Ghromo- Accession PI Amino
BAC No. Site' a Locusb
Name some no. of cDNA value acid
GA2oxl 5 OSJNBa0017J22 8748 - LOC_Os05g06670 -AK 120967 6.52 403
34623
GA2ox2 1 B1140D12 9818 - LOC_Os01g22910 6.64 370
19799
GA2ox3 1 OJ1414_E05 66551 ~ LOC_Os01g55240 AK101713 6.26 327
68322
GA2ox4 5 P0022D06 49345 - LOC_Os05g43880 AK107211 6.39 354
50496
GA2ox5 7 P0446F04 52078 - LOC_Os07g01340 AK106859 5.88 341
53103
GA2ox6 4 OSJNBa0019Dl l 138689 ~ LOC_Os04g44150 7.18 358
141990
GA2ox7 1 P0466B10 35930 - LOC_Os01gl l l50 AK108802 6.67 335
39272
GA2ox8 5 OJ1 115_B06 55485 - LOC_Os05g48700 AK101758 6.03 353
57032
GA2ox9 2 B1469H02 122528 - LOC_Os02g41954.1 Ak059045 5.58 359
120151 LOC_Os02g41954.2 AK108598 5.04 299
GA2oxlO 5 OSJNBb0016G07 9180 - LOC_Os05gl l 810.1 9.37 378
13210 LOC_Os05gl 1810.2 9.33 271
The critical site of BAC clone.
b Locus was identified by the TIGR Rice Pseudomolecuies and Genome Annotation 5.0 (www.tigr.org/ tdb/e2kl/osal/), but the relative cDNA clone of GA2oxlO could not be found. GA2oxl to GA2ox4 were identified by Sakamoto et al. (2001, 2004). GA2ox5 and GA2ox6 were nominated by Lee and Zeevaart (2005). GA2ox7 to GA2oxll were nominated in this study, based on the sequence similarity search and gene annotation using the NCBI, TIGR and RiceGAAS databases.
[00176] The locations of GA2oxs in the rice genome were determined, with seven GA2oxs clustered on chromosome 1 and 5 and others located on chromosomes 2, 4, and 7 (Fig. 1A). Amino acid sequence comparison (Table 2) generated a phylogenetic tree among the rice GA2ox family (Fig. IB). GA2oxs located on the same chromosome have more amino acid sequence divergence from each other than from GA2oxs located on different chromosomes, indicating that gene duplication by crossing-over among chromosomes has occurred throughout their evolution.
[00177] The sequence identities of conserved domains of the deduced amino acids were compared. The identities were low among the 10 rice GA2oxs, indicating that these GA2oxs may play various roles (Table 3).
[00178] Table 2. Comparison of deduced amino acids among rice GA2oxs
GA2ox5 GA2ox6 GA2ox9 GA2ox1 GA2ox2 GA2ox10 GA2ox7 GA2ox3 GA2ox4 GA2ox8
GA2ox5 100 62 63 38 43 22 47 50 47 45
GA2ox6 100 76 36 41 20 44 46 44 44
GA2ox9 100 34 39 19 43 45 42 42
GA2ox1 100 66 24 49 50 49 51
GA2ox2 100 32 56 57 56 57
GA2ox10 100 41 38 35 35
GA2ox7 100 70 63 64
GA2ox3 100 73 70
GA2ox4 00 67
GA2ox8 100
[00179] Table 3 . Identities of conserved domains among rice GA2oxs
GA2ox5 GA2ox6 GA2ox9 GA2ox1 GA2ox2 GA2ox10 GA2ox7 GA2ox3 GA2ox4 GA2ox8
GA2ox5 100 79 83 51 50 44 50 53 54 55
GA2ox6 100 87 51 51 46 55 54 53 56
GA2ox9 100 50 50 44 51 50 50 54
GA2ox1 100 74 57 64 68 66 68
GA2ox2 100 58 70 70 66 67
GA2ox10 100 65 64 62 59
GA2ox7 100 83 75 77
GA2ox3 100 82 84
GA2ox4 100 75
GA2ox8 100
[00180] Amino acid sequence comparison also generated a phylogenetic tree of 10 rice GA2oxs and 19 GA2oxs from 8 dicot plant species (Table 3), which revealed that rice GA2ox5, GA2ox6 and GA2ox9 are more closely related to the Arabidopsis GA2ox7 and GA2ox8 and spinach GA2ox3 (Fig. 1C). These six GA2oxs contain three unique and conserved domains (Lee and Zeevaart, 2005) (Fig. 11).
[00181] Table 4. Gene names and accession number of 19 GA2oxs from different plant species
Name Species Accession Number
AtGA2oxl Arabidopsis thaliana AJ132435
AtGA2ox2 Arabidopsis thaliana AJ132436
AtGA2ox3 Arabidopsis thaliana AJ132437
AtGA2ox4 Arabidopsis thaliana AY859740
AtGA2ox6 Arabidopsis thaliana AY859741
AtGA2ox7 Arabidopsis thaliana NM103976
AtGA2ox8 Arabidopsis thaliana NM118239
CmGA2ox Cucurbita maxima AJ302041
LsGA2oxl Lactuca sativa AB031206
NtGA2oxl Nicotiana sylvestris AB125232
NtGA2ox3 Nicotiana sylvestris EF4711 17
NtGA2ox5 Nicotiana sylvestris EF4711 18
PcGA2oxl Phaseolus coccineus AJ 132438
Poplar GA2oxl Populus alba x P. tremuloides AY392094
PsGA2oxl Pisum sativum AF056935
PsGA2ox2 Pisum sativum AF100954
SoGA2oxl Spinacia oleracea AF506281
SoGA2ox2 Spinacia oleracea AF506282
SoGA2ox3 Spinacia oleracea AY935713
[00182] Differential Expression of GA2ox Correlated with Flower and Tiller Development
[00183] Growth of the rice cultivar TNG67 used in the present study could be divided into vegetative, reproductive and ripening phases (Fig. 2A). To understand the role that individual GA2oxs may play in rice growth, the temporal expression patterns of GA2oxs in rice during the rice life cycle was examined. As leaves have been shown to be a major site of GA biosynthesis (Choi et al., 1995), fully expanded leaves at different growth or developmental stages ranging from 5 to 100
days after imbibition (DAI) were collected. The different growth or developmental stages include seedling from about 1-20 DAI, tillering from about 30-40 DAI, reproductive from about 60-90 DAI and ripening at about 100 DAI. Total RNAs were isolated from the leaves. The expression levels of
GA2ox mRNA were analyzed by RT-PCR using GA2ox and GA3ox2 gene-specific primers (Table 7), and thel 8S rRNA gene (rRNA) was used as a control.
[00184] It was observed that the genes GA2oxl to GA2ox9 were differentially expressed in leaves and the expression was temporally regulated. However, mRNAs of GA2oxlO was not detected in any tissue in any growth stage, indicating GA2oxlO may be a pseudogene or its mRNA level was too low to be detected. Based on temporal mRNA accumulation patterns, the GA2oxs could be classified into 2 groups. As can be seen in Fig. 2B, for members of group A, which exclude GA2ox2 and GA2ox6, accumulation of their mRNAs in leaves was detected prior to the transition from vegetative to reproductive growth phases. In contrast, for members of group B, which include GA2ox2 and GA2ox6, their mRNAs accumulated in leaves after the phase transition from vegetative to reproductive growth. GA2ox6 mRNA could also be detected in leaves at early seedling stage and transiently at high level during active tillering stage.
[00185] Since expression of most GA2oxs terminated after tillering, the pattern of tiller growth throughout the rice life cycle was examined. Tiller number increased from 30 to 50 DAI, remained constant until 75 DAI, and then increased again until 90 DAI when the experiment was terminated (Fig. 2C). Expression of group A and group B GA2oxs paralleled the increase in tiller number in the vegetative and reproductive phases, respectively (Fig. 2, compare B with C). Except for a slight reduction in the reproductive phase, the expression of GA3ox2, which encodes the enzyme involved in GA biosynthesis, was not significantly altered in leaves throughout the rice life cycle. These results suggest that up- and down-regulation of group A GA2oxs may control GA levels for tiller growth in the vegetative phase and for flower development in the reproductive phase, respectively, while up-regulation of group B GA2oxs controls tiller growth in the reproductive phase.
[00186] Decrease in GA2ox6 Expression Correlated with Seed Germination
[00187] Bioactive-GAs are well-known to be responsible for relieving seed dormancy and promoting germination, so the role of GA2oxs during germination was studied. Seeds were imbibed for various lengths of time. Germination of wild-type seeds was observed from 1 DAI which reached almost 100% at 2 DAI (Fig. 3 A). Total RNAs were isolated from embryos after imibibition of seeds, and temporal expression profiles of six GA2oxs were analyzed by RT-PCR. Accumulation of most GA2ox mRNAs was detectable starting from 0 to 1 DAI, which was maintained at similar levels afterward (Fig. 3B). GA2ox6 had a distinct expression pattern as its mRNA quickly
accumulated from 0.5 to 1 DAI and then decreased significantly from 2 to 4 DAI. Low-level accumulation of GA3ox mRNA was detected at 0 DAI and then at similarly high levels after 0.5 DAI. This study demonstrated that most GA2oxs were constitutively expressed and competed with GA3ox for GA, while only GA2ox6 was transiently expressed and its reduced expression correlated with the rapid seed germination at 2 DAI.
[00188] Plant Growth and Seed Germination Were Impaired in T-DNA Tagged Rice Mutants Overexpressing GA2oxs
[00189] To study the functions of GA2oxs in rice, mutants in a T-DNA tagged rice mutant library, the Taiwan Rice Insertional Mutagenesis (TRIM) library (Hsing et al., 2007), were screened. The T-DNA tag used for generating the TRIM library contained multiple CaMV35S enhancers adjacent to the right border, which activate promoters located close to T-DNA insertion sites (Hsing et al., 2007). Two G42<¾ -activated dwarf mutants, M77777 and M47191, were identified by a forward genetic screen and another two mutants, M27337 and M58817, were identified by a reverse genetic screen of the library (Fig. 4).
[00190] The severely dwarf mutant M77777, designated as GA2OX3ACT, carries a T-DNA insertion at a position 587 bp upstream of the translation start codon of GA2ox3 (Fig. 4A).
Accumulation of GA2ox3 mRNA in this mutant was significantly enhanced in the heterozygous mutant. GA2OX3 CT mutant did not produce seeds and was therefore maintained and propagated vegetatively.
[00191] The semi-dwarf mutant M27337, designated as GA2ox5A335-341ACT, carries a T-DNA insertion in the coding region, at a position 23 bp upstream of the translation stop codon of GA2ox5 (Fig. 4B). Truncation of GA2ox5 by T-DNA resulted in a loss of 4 amino acids at the C-terminal of the putative GA2ox5 polypeptide. Accumulation of the truncated GA2ox5 mRNA was significantly enhanced by T-DNA activation tagging in both homozygous and heterozygous mutants, but the semi-dwarf phenotype was observed only in the homozygous mutant. The GA2OX5A335-341ACT homozygous mutant had an average plant height 90%, and produced seeds with an average fertility 88%, of the wild type (Table 5). These results suggest that the truncated GA2ox5 mRNA might encode a partially functional GA2ox5.
[00192] Table 5. Characterization of rice mutants and transgenic rice overexpressing GA2oxs
GA2ox5A335- GA2ox9ACT GA2ox6ACT Ubi::GA2ox5 Ubi::GA2ox6
Traits Wild type
341ACT ( 2f (T3) (T2) (Tl) (Tl)
Tiller number of 1.0 ± 0.0 (100)c 1.8 ± 0.8 (180) 1.0 ± 0.0 2.6 ± 0.5 2.7 ± 0.6 2.5 ± 0.7 seedling (18 DAI) (100) (260) (270) (250)
Root length (cm) at 6.3 ± 0.9 (100) 15.7 ± 3.2 (249) 1 1.0 ± 1.9 5.8 ± 1.8 6.3 ± 2.1 6.6 ± 0.4
18 DAI (175) (92) (100) (105)
Plant height (cm) 109.5± 2.5 (100) 98.0 ± 7.1 (90) 83.2 ± 4.1 16.6 ± 1.7 16.7 ± 2.8 12.1 ± 2.7 at 120 DAI (76) (15) (15) (Π)
Length of the leaf 49.9 ± 6.0 (100) 49.6 ± 5.1 (100) 49.3 ± 3.3 12.2 ± 0.9 10.6 ± 1.2 8.1 ± 0.8 below flag leaf (99) (24) (21) (16)
(cm) at 120 DAI
Width of the leaf 1.64 ± 0.1 (100) 1.66 ± 0.1 (101) 1.75 ± 0.2 1.51 ± 0.1 1.2 ± 0.1 1.04 ± 0.1 below flag leaf (107) (92) (73) (63)
(cm) at 120 DAI
Heading day (DAI) 108.7 ± 1.5 107.6 ± 1.3 107.9 ± 1.0 >150 >150 >150
Panicle length (cm) 21.6 ± 2.0 (100) 20.3 ± 1.5 (94) 19.7 ± 1.8 7.7 ± 1.6 5.9 ± 0.8 7.5 ± 0.9
(91) (36) (27) (35)
Final Tiller number 1 1.0 ± 1.8 (100) 20.3 ± 4.1 (185) 13.4 ± 2.9 17.6 ± 3.7 NA 18.8 ± 4.5
(122) (160) (171)
Grain weight 2.44 ± 0.1 (100) 2.04 ± 0.1 (84) 2.34 ± 0.2 1.54 (63) 1.43 ( 59) 1.98 (81)
(g/100 grains) (96)
Fertility (%) 92.6 ± 4.2 (100) 81.1 ± 5.4 (88) 85.4 ± 8.9 39.5 ± 18 27.7 ± 12.0 59.4 ± 4.4
(92) (43) (30) (64) a Tl, T2 and T3 in parenthesis indicate generation of mutants.
b SE; n = 20 for GA2ox5A335-341ACT, GA2ox9ACT, and GA2ox6ACf, n = 10 for Ubi::GA2ox5 and Ubi::GA2ox6 . cValues in parentheses indicate % of the wild type.
NA: not available. DAI: days after imbibition.
[00193] The severely dwarf mutant M47191, designated as GA2OX6ACT, carries a T-DNA insertion at a position 2.1 kb upstream of the translation start codon of GA2ox6 (Fig. 4C).
Accumulation of GA 2 ox6 mRNA was significantly enhanced by T-DNA activation tagging, and severely dwarf phenotype was observed in both heterozygous and homozygous mutants. The GA2OX6ACT homozygous mutant produced seeds with an average fertility of only 43% of the wild type after more than 5 months of growth (Table 5).
[00194] The semi-dwarf mutant M58817, designated as GA2OX9ACT, carries a T-DNA insertion at a position 2.4 kb upstream of the translation start codon of GA2ox9 (Fig. 4D). Accumulation of GA2ox9 mRNA was significantly enhanced by T-DNA activation tagging, and the semi-dwarf phenotype was observed in both homozygous and heterozygous mutant. The GA2OX9ACT homozygous mutant produced seeds with an average fertility of 92% of the wild type (Table 4).
[00195] The three activation-tagged mutants, GA2OX5A335-341ACT, GA2OX6ACT and GA2OX9ACT, were further characterized. Mutant seedlings and plants displayed the same phenotypes as their parents, with GA2OX5 335-341ACT growing slightly shorter and GA2OX9ACT shorter still than the wild type, while GA2OX6ACT remained severely dwarfed throughout all growth stages (Fig 5, A and B). GA2OX5A335-341ACT and GA2OX9ACT displayed a rather normal phenotype, except for longer roots and higher tiller numbers than the wild type (Table 5). Other phenotypes significantly altered in the severely dwarf GA2OX6ACT mutant included shorter leaf length, longer heading day, shorter panicle length, higher tiller numbers, lower grain weight and lower seed fertility as compared with the wild type (Table 5). Germination of GA2OX6ACI seeds was also significantly delayed, as it took 20 days to reach 90% germination rate, while the wild type and GA2OX9ACT mutant seeds took only 2 days to reach a germination rate of 97% and 98%, respectively (Fig. 5C). Germination of
GA2OX5A335-341ACT seeds was delayed for 4 days to reach a final 88% germination rate (Fig. 5C).
[00196] Overexpression of GA2ox5 and GA2ox6 Recapitulated the Dwarf or Semi-Dwarf Phenotypes in Transgenic Rice and Tobacco
[00197] To verify the function of GA2ox5 and GA2ox6 in dwarfism of rice plants, full length cDNAs of GA2ox5 and GA2ox6 were isolated from rice and fused downstream of the maize ubiquitin (Ubi) promoter, generating Ubi::GA2ox5 and Ubi::GA2ox6 constructs for rice
transformation. More than 30 independent transgenic rice lines were obtained for each construct. All transgenic rice plants showed dwarf phenotypes, although slight variations in final height were observed. The overall phenotypes of Ubi::GA2ox5 and Ubi::GA2ox6 Ί\ plants were similar to the GA2OX6ACT mutant, except that the seed fertility produced by Ubi::GA2ox6 transgenic rice (average 64%) was higher than of Ubi::GA2ox5 transgenic rice (average 30%) (Fig. 6, A and B and Table 5). RT-PCR analysis showed that both GA2ox5 and GA2ox6 mRNAs accumulated at similar high levels in all transgenic lines (data not shown). These results demonstrated that ectopic overexpression of GA2ox5 or GA2ox6 was able to recapitulate the dwarf phenotype in transgenic rice. They also suggest that the nearly normal phenotype of GA2OX5A335-341ACT mutant could be due to overexpression of a GA2ox5 product missing part of domain III.
[00198] Ectopic overexpression of Arabidopsis GA2ox7 and GA2ox8 and spinach GA2ox3 reduced the bioactive GA content and resulted in a dwarf phenotype of transgenic tobacco plants (Schomburg et al., 2003: Lee and Zeevaart, 2005). To examine whether rice GA2oxs are also functional in dicots, Ubi::GA2ox5 and Ubi::GA2ox6 constructs were used for tobacco
transformation.
[00199] Ectopic overexpression of these two rice GA2oxs in transgenic tobacco revealed the same retardation of plant growth, but with different effects. While Ubi::GA2ox5 reduced plant height to
32% and seed production to 62%, and Ubi::GA2ox6 reduced plant height to 67% of the wild type tobacco, Ubi: :GA2ox6 had no effect on seed production (Fig. 6C and D, upper panels, and Table 6).
The numbers of leaves to inflorescence were not different between the transgenic and wild type tobacco, but the flowering time was delayed approximately 2 to 4 weeks for all transgenic tobacco.
Growth of hypocotyls and roots of 18-day-old Ti transgenic tobacco seedlings was slightly retarded by overexpression of GA2ox6, but significantly retarded by overexpression of GA2ox5, compared with the wild type (Fig. 6C and D, lower panels, and Table 6). These studies demonstrated that the two rice GA2oxs have similar functions in monocots and dicots, with GA2ox5 being more potent in inactivation of GA than GA2ox6 in both transgenic rice and tobacco.
[00200] Table 6. Characterization of transgenic tobacco overexpressing rice GA2ox5 and GA2ox6
Traits Wild Type Ubi::GA2ox5 Ubi:: GA2ox6
Root length (mm) at 18 20.8 ± 2.7a(100)b 9.6 ± 4.6 (46) 17.7± 3.6 (85)
DAI
Hypocotyl length (mm) at 6.5 ± 0.8 (100) 3.2 ± 0.6 (49) 4.6± 1.0 (71)
18 DAI
Final Plant height (cm) 127.7 ± 4.7 (100) 41.2 ± 18.9 (32) 85.3 ± 9.4 (67)
Number of leaves to 18.3 ± 0.6 (100) 20.8 ± 3.3 (1 14) 19.0± 0.8 (104)
inflorescence
Seeds yield (g) /plant 31.1 (100) 19.3 ± 3.4 (62) 31.3 ± 4.1 (100)
SE with n = 40. Values in parentheses indicate % of the wild type. [00201] Overexpression of GA2ox6 Reduced GA Levels in Rice Mutants in Which Only Shoot But Not Root Growth Was Affected
[00202] To determine whether the dwarfism of rice mutants overexpressing GA2ox was a result of a reduction of bio-active GAs, GA2OX6ACT mutant seeds were germinated on MS agar medium with or without supplementation with 5 μΜ GA3. Addition of GA3 promoted germination of GA2OX6ACT seeds (Fig. 7A), indicating that an insufficient endogenous GA concentration was responsible for the reduced germination of GA2OX6ACT mutant seeds. Plant height of 18-day-old wild-type seedlings was only slightly enhanced by GA3 treatment; in contrast, height of the dwarf
GA2OX6ACT mutant seedlings was significantly enhanced by GA3 treatment, with recovery of up to .
84% of the wild type (Fig. 7B). Root lengths of the wild type and GA2OX6ACT mutant seedlings were similar, and both were effectively enhanced by GA3 treatment (Fig. 7B).
[00203] It was noticed that root growth of GA2OX6ACT was significantly slower initially after germination (Fig. 7A, upper panel), but it sped up after 6 DAI and became similar to the wild type at
18 DAI (Fig. 7B). A similar phenomenon was observed for other mutants and Ubi::GA2ox5 and
Ubi::GA2ox6 transgenic rice. GA2ox6 mRNA in leaves and roots accumulated to a higher level in the GA2OX6ACT mutant than in the wild type, but both were unaffected by GA3 treatment (Fig. 7C), indicating that plant and root growth was promoted by GA3 and was not related to GA2ox6 expression. These results suggest that reduction of GA levels affected only stem and leaf growth but not root growth. Additionally, GA3 treatment could compensate for the decrease in endogenous GA concentration and recover seed germination and plant growth of the GA2OX6aCT mutant (Fig. 12), suggesting that GA responsiveness was not affected in the mutant.
[00204] Overexpression of GA2ox5 and GA2ox6 Promoted Early Tiller and Adventitious Root Growth and Affected Root Architecture
[00205] Normally, the rice wild type forms tillers 30 days after seed imbibition (Fig. 2C). It was found that rice mutants or transgenic rice overexpressing GA2oxs formed tillers not only with higher number but also much earlier than the wild type. In the GA2OX6ACT mutant and Ubi::GA2ox5 and Ubi::GA2ox6 transgenic seedlings, after growth of the first seedling/tiller from the embryo at 2 DAI, a subsequent swelling on the embryo surface adjacent to the base of the first seedling/tiller was observed at 3 DAI (Fig. 8A, panels 2 to 4). Then a second and even a third seedling/tiller grew out from the swelled embryo surface from 9 to 15 DAI (Fig. 8, B and C). Each tiller grew out from its own coleoptile (Fig. 8D), suggesting these tillers developed independently in the embryo. Both the mutant and transgenic seedlings showed early tillering (Fig. 8E). The swollen embryo surface where a second shoot was about to emerge was not observed in the wild type (Fig. 8A, panel 1). All new tillers in the mutant and transgenic rice had their own adventitious roots (Fig. 8D), a feature similar to tillers from the wild type plant around 30 DAI. Despite some retardation of shoot elongation, root length appeared normal; however, roots of mutant and transgenic seedlings became very curled and zigzag in shape, compared to the wild type (Fig. 8F). Quantitation of the data also revealed that only stem elongation was inhibited, while tiller and root numbers for 18-day-old mutant and transgenic rice were enhanced, as compared with the wild type (Fig. 9).
[00206] GA2ox5 and GA2ox6 Specifically Inactivated C20-GA Precursors and Reduced GA Biosynthesis
[00207] To examine if GA metabolism in the rice GA2OX6ACT mutant (M47191) was altered, crude extracts containing GA were prepared from leaves of 18-day-old seedlings and mature plants and subjected to a GC-MS-selected ion monitoring method for identification of GA compounds (Lee and Zeevaart., 2002). In seedling and mature leaves, the level of GAi was much lower in mutants (0.1 and 0 ng/g, respectively) than in the wild type (0.6 and 0.7 ng/g, respectively); in contrast, the level of GA97 was much higher in mutants (28.7 and 10.8 ng/g, respectively) than in the wild type
(3.6 and 0.5 ng/g, respectively) (Table 7).
[00208] Table 7. GAs content in GA2OX6ACT mutant and the wild type
Sample GAt GA97
Leaves from seedlings at 18 DAI
GA2OX6ACT 0.1* 28.7
Wild type 0.6 3.6
Leaves from mature plants
GA2OX6ACT 0.0 10.8
Wild type 0.7 0.5
* GA content in ng/g dry weight. [00209] GA53, a precursor of GA i , could be converted to GAg7 in vitro by the Arabidopsis class C20 GA2ox through 2P-hydroxyIation (Schomburg et al., 2003). The in vitro activity of rice GA2ox5 and GA2ox6 were also investigated by overexpression as fusion proteins with glutathione S-transferase in E. coli. Fusion proteins were partially purified and their enzyme activity analyzed. Both proteins could convert GAs3 to GA97, an activity similar to the Arabidopsis GA2ox7 and GA2ox8 (Schomburg et al., 2003) and spinach GA2ox3 (Lee and Zeevaart, 2005). These studies provide evidence that overexpression of GA2ox6 could promote conversion of GAs3 to GA97 and consequently reduced synthesis of bio-active GAt from GA53 in vivo.
[00210] Mutations in Domain III Affect the Activity of GA2ox5 and GA2ox6
[00211] The class C20 GA2oxs, including the Arabidopsis GA2ox7 and GA2ox8 and spinach GA2ox3, contain three unique conserved domains that are absent in other GA2oxs (Lee and Zeevaart, 2005). These conserved domains are also present in the rice GA2ox5, GA2ox6 and GA2ox9 (Fig. 11). It has been demonstrated that rice GA2ox6 is capable of catalyzing 2β- hydroxylation of C20-GAs (Table 7). Such C20 GA2ox activity can also be demonstrated for GA2ox5 and GA2ox9 using similar methods. The function of none of these three conserved
- domains in plants had been previously identified. It was discovered in the present invention that the rice GA2ox5A335-341 ACT mutant, which expresses a mutant GA2ox5 with 4 amino acids deleted in domain III, exhibited severe mutant phenotype. This observation prompted investigation of the function of domain III in GA2oxs.
[00212] Truncated cDNAs of GA2ox5 and GA2ox6, with deletion of nucleotides encoding domain III, were fused downstream of the Ubi promoter. The resulting constructs, Ubi::GA2ox5-
ΙΙΙΔ325-341 and Ubi::GA2ox6-IIIA338-358 (Fig. 10A), were then used for rice transformation.
More than 30 independent transgenic plants, with transgene insertions being confirmed, were obtained for each construct.
[00213] As shown in Fig. 10B, these transgenic plants exhibited the same normal phenotype as the control transformed with the empty vector (compare panels 2 and 5 with panel 3), which was in contrast to the dwarf phenotype of rice plants transformed with Ubi::GA2ox5 and Ubi::GA2ox6 (panels 1 and 4). Plant height, panicle number and seed germination were normal in all transgenic plants overexpressing GA2oxs with domain III deleted. These studies demonstrated that domain III is important for the activity of GA2ox5 and GA2ox6, and that mutations in domain III affect the activity of GA2ox5 and GA2ox6.
[00214] GA deficiency promotes expression of OSH1 and TBI
[00215] The studies demonstrated that tiller and adventitious root growth was promoted by GA- deficiency and inhibited by GA. (see Figures 15A and B). Additionally, the inhibition of tillering by GA3 was independent of rice growth stage (see Figure 15B). To demonstrate that the increase in tiller and adventitious root growth was due to a decrease in endogenous GA levels by
overexpression of GA2ox, wild type and GA2OX6ACT seedlings were grown in media with or without 5 μΜ GA3 after germination. The first tiller of the mutant without GA treatment developed at 9 DAI while that of the GA-treated mutant developed at 16 DAI, indicating that GA3 delayed tillering (Figure 15 A). Root system in the GA-treated mutant was also significantly reduced compared to the mutant without GA treatment, suggesting that GA3 repressed adventitious root development. To further demonstrate that GA inhibits tillering is independent of growth stage, 1 -month-old wild type and GA2OX6ACT plants grown in pot soil were sprayed with 10 μΜ GA3 or water only once every 7 days for a total of 3 sprays. Both GA-treated GA2OX6ACT mutant and wild-type plants produced 2-3 times fewer tillers than mutant and wild-type plants without GA treatment (Figure 15B).
[00216] To determine whether GA deficiency induced expression of OSH1 and TBI that in turn promotes tillering and root development, GA2ox5 ^335-341 GA2ox6ACT and wild type seedlings
were grown in media with or without 5 μΜ GA3 after germination. Rice embryos containing tiller buds were collected at 12 DAI. RT-PCR and real-time quantitative RT-PCR analyses revealed that levels of both OSHl and TBI mRNAs were significantly higher in mutants than in the wild type, whereas GA3 significantly reduced levels of both mRNAs in mutants (Figure 14A). Increase in OSHl and TBI mRNA levels correlated well with early tillering and adventitious root development in both mutants, whereas GA3 coordinately suppressed OSHl and TBI mRNA accumulation, and tillering and adventitious root development in both mutants (compare Figures 14A with 14B). It is not clear why the accumulation of OSHl and TBI mRNAs in the wild type was enhanced by GA3 (Figure 14 A), nevertheless, its stem became slenderer and adventitious root growth was inhibited similar as mutants (Figure 14B).
[00217] Plants overexpressing GA2ox were more tolerant to various stresses
[00218] Plants overexpressing GA2ox, thus deficient in bioactive GA, were subject to various stress tests. The test results were compared with that from the wild type. GA2ox can be
overexpressed in the plants by various mechanisms, for example, by mutational activation, such as the active mutation in mutants GA2OX6ACT or GA2OX9ACT, where an insertion at a position upstream of the translation start codon resulted in accumulation of GA2ox mRNA, thus increased GA2ox expression. GA2ox can also be overexpressed via recombinant expression of GA2ox in transgenic lines, such as that in Ubi::GA2ox5 and Ubi::GA2ox6 lines.
[00219] As shown in Fig. 18A and B, while seedlings of WT were sensitive to cold, seedlings of GA2OX6ACT, Ubi::GA2ox5 and Ubi: :GA2ox6 lines were tolerant to cold stress.
[00220] Fig. 19A and B illustrate that, while seedlings of WT were sensitive to freezing, seedlings of GA2OX6ACT, Ubi: :GA2ox5 and Ubi::GA2ox6 lines were tolerant to freezing stress.
[00221] Fig. 20 A and B illustrate that, while seedlings of WT were sensitive to high salt, seedlings of GA2OX6ACT, Ubi: :GA2OX5 and Ubi::GA2ox6 lines were tolerant to salt stress.
[00222] Fig. 21 A and B illustrate that, while seedlings of WT were sensitive to heat, seedlings of
GA2OX6ACT, Ubi::GA2ox5 and Ubi::GA2ox6 lines were tolerant to heat stress.
[00223] Fig. 22A and B illustrate that, while seedlings of WT were sensitive to drought, seedlings of GA2OX6ACT Ubi:GA2ox5 and Ubi:GA2ox6 lines were tolerant to drought stress.
[00224] Fig. 23 illustrates that, while seedlings of WT were sensitive to submergence, seedlings of GA2OX6ACT line were tolerant to submergence stress.
[00225] Table 8 additionally demonstrates that GA deficient plants, such as the GA2OX6ACT mutant, were more tolerant to multiple stresses than the wild type.
Line Wild type GA 2 ox6 ACT
No. of plant 31 17
Treatment Survival ratea
Cold (4°C) 63.3 + 10.8 91.7 ± 8.3
Freeze (-20°C) 55.7 + 9.4 92.3 + 7.7
Drought 9.1 ± 0.0 93.8 ± 6.3
Heat (42°C) 14.9 + 7.9 35.0 + 12.6
200 mM NaCl 27.7 + 3.1 87.5 + 12.5
Submergence 68.8 + 0.0 100.0 + 0.0
Survival rate = number of plants survived / total number of plant treated with stress.
[00226] DISCUSSION
[00227] The GA2ox Family Is Differentially Regulated and Plays Pleiotropic Roles
Regulating Rice Growth and Development
[00228] In the present study, gene expression profiling and mutant and transgenic analyses demonstrate that rice GA2oxs control GA levels and regulate rice growth and development, including stem elongation, flower development and seed germination. It was found that differential expression of different members of the rice GA2ox family may control different aspects of rice growth and development. For example, downregulation of the group A, but not group B, GA2oxs correlated with the phase transition from vegetative to reproductive growth (Fig. 1). This is consistent with the role of GA in promoting flowering in maize and Arabidopsis (Evans and Poethig, 1995; Blazquez et al., 1998). Also, although the mRNAs of most GA2oxs accumulated to high levels during seed germination, the mRNA of GA2ox6 decreased significantly and this decrease correlated with rapid seed germination (Fig. 2). Furthermore, similarities as well as differences between monocots and dicots in GA control of some important traits were found, some of which is discussed below.
[00229] GA2oxs Control Tiller Growth
[00230] The tiller in rice is an important agronomic trait for grain yield. The rice tiller is a specialized grain-bearing branch that normally arises from the axil of each leaf and grows independently of the mother stem (culm) with its own adventitious roots. A MONOCULM 1 gene (MOC1), which encodes a GRAS family nuclear protein and is expressed mainly in the axillary buds, has been shown to be essential for controlling tiller bud growth (Li et al., 2003). It was found
some similarities between GA2oxs and MOC1 in controlling rice growth. First, expression of group -
A GA2oxs correlated with tiller growth in the vegetative phase, and expression of group B GA2oxs correlated with tiller growth in the reproductive phase (Fig. 2C). More importantly, higher tiller number and earlier tiller growth were observed in the GA2ox mutant and Ubi: :GA2ox transgenic rice (Fig. 8) and in MOClr.MOCl transgenic rice (Li et al., 2003). Second, plants became dwarf in the GA2ox mutant and Ubi::GA2ox transgenic rice (Fig. 4 and Fig. 6) and in MOClr.MOCl transgenic rice (Li et al., 2003). Third, shoot but not root growth was affected in the GA2ox mutant and Ubi::GA2ox transgenic rice (Fig. 7B) and in the mod mutant (Li et al., 2003). Fourth, seed germination was impaired in the GA2ox mutant and Ubi::GA2ox transgenic rice (Fig. 5C) and in the mod mutant (Wang and Li, 2005). These studies suggest that both GA2ox and MOC1 promote tiller growth but inhibit stem elongation and seed germination in rice. It is unclear whether there is crosstalk between the GA and MOC1 signaling pathways or whether they act independently.
[00231] One class of dwarf mutants, called tillering dwarf mutants, shows increased tiller number and reduced plant height (Ishikawa et al., 2005). A more recent study also showed that
overexpression of YABl gene, a feedback regulator of GA biosynthesis, in transgenic rice leads to reduced GA level, increased tiller number and a semi-dwarf phenotype (Dai et al., 2007).
Consequently, based on those previous studies and this work, it was concluded that GA deficiency concomitantly suppress shoot elongation and promotes tillering, though the mechanism is unclear. Increased tiller growth indicates loss of apical dominance, which is well known to be mediated by a network of hormonal signals: apically-produced auxin inhibits axillary meristems while cytokinin promotes meristem growth. Whether the auxin, cytokinin and GA signaling pathways crosstalk in rice mutants overexpressing GA2oxs merits further study.
[00232] GA2oxs Expressed with Different Promoter and/or Biological Activity Differentially Affect Phenotype
[00233] The level of bioactive GAs are tightly regulated by a dynamic balance between their synthesis and catabolism, and therefore, expression of enzymes involved in these processes affects the degree of GA-defective phenotypes. In the present study, it was observed that overexpression of individual GA2oxs caused various GA-defective phenotypes in rice. For example, both the T-DNA activation-tagged rice mutant GA2ox3ACT∞id CaMV35S::GA2ox3 exhibited severe dwarfism and bore no seeds despite long cultivation periods (Fig. 4A and Sakai et al., 2003). Similarly, the T- DNA activation-tagged rice mutant GA2OX6ACT and Ubi::GA2ox5 and Ubi: :GA2ox6 transgenic rice exhibited severe dwarfism and produced fewer seeds after more than 5 months of cultivation (Table 4), and germination of GA2OX6ACT mutant seeds was delayed significantly (Fig. 5C). In contrast, the
T-DNA activation-tagged rice mutant GA2OX9ACT exhibited semi-dwarf phenotype but produced nearly normal amount of seeds (Table 5) with normal germination rate (Fig. 5C). GA2oxs with different biological activity might account for the difference in phenotypes. Alternatively, activation efficiency by enhancers in T-DNA inserted close to these GA2ox promoters or a positional effect of T-DNA insertion might contribute to the difference. Dose effects of gene overexpression, as detected by mRNA accumulation of tagged genes and severity of phenotypes, appeared to be common for all mutant lines.
[00234] Although ectopic overexpression of both GA2ox5 and GA2ox6 caused severe dwarfism in transgenic rice, overexpression of GA2ox5 had more severe growth effects than GA2ox6 in transgenic rice (on fertility and grain weight) and tobacco (on root and hypocotyl length, plant height and seed yield) (Fig. 6), indicating conservation of activity of these two enzymes in monocots and dicots. Similar phenomena were also observed in transgenic Arabidopsis and tobacco overexpressing the Arabidopsis GA2ox7 and GA2ox8 genes under the control of the CaMV35S promoter; GA2ox7 overexpression generally caused a more severely dwarf phenotype than GA2ox8 overexpression did (Schomburg et al., 2003). However, shortage of GA appeared to affect root growth in docots (Figs. 6C and 6D; Lee and Zeevaart, 2005). One additional difference is that reduced GA levels promoted tillering of transgenic rice but had no effect on branching of transgenic tobacco (Fig. 6).
[00235] GA2oxs Containing a Unique Functional Domain Display Substrate Specificity
[00236] GA2ox5, GA2ox6 and GA2ox9 contain three conserved domains that are similar to those of the Arabidopsis GA2ox7 and GA2ox8 and spinach GA2ox3 (Lee and Zeevaart, 2005), but are absent in other rice GA2oxs. These Arabidopsis and spinach GA2oxs have been shown to catalyze 2p-hydoxylation of C20-GAs, such as GA53 and GA12, instead of Q9-GA catalysis by most other GA2oxs. In the present study, we found that GA2ox6 also catalyzed 2P-hydroxylation of C20-GAs (Table 7), which suggests that the class C20 GA2oxs may have distinct substrate specificity from the class C19 GA2oxs in rice. Domain III appears to be important for activity of class C20 GA2oxs. Transgenic rice overexpressing intact GA2ox5 and GA2ox6 showed severe dwarfism (Fig. 6).
[00237] In contrast, the rice GA2ox5A335-34lACTmutant overexpressing a truncated GA2ox5 missing 4 amino acids of domain III, showed semi-dwarfism (Fig. 4B) on an otherwise nearly normal phenotype (Table 5), and transgenic rice overexpressing GA2ox5-IIIA325-341 and GA2ox6- ΠΙΔ338-358, with deletion of the entire domain III, showed normal phenotype (Fig. 10B). These data indicate that GA2ox5 activity was only partially lost by partial deletion or mutation, e.g., by
deleting 4 amino acids, of domain III, while it was completely lost by deleting the entire domain III.
It is unclear whether domain III is essential for substrate binding or for catalytic activity.
Interestingly, the GA2ox5 A335-341 ACT mutant produced twice as many tillers, and its roots were 2.5 times longer than the wild type (Table 5), indicating that the partially-functional GA2ox5 promoted root and tiller meristem growth.
[00238] T-DNA Activation-Tagged Rice Mutants Are Useful for Studying Functions of
GA2oxs
[00239] More than 18 GA-deflcient mutants have been identified by screening rice mutant populations that were generated by chemical mutagen, retrotransposon (Tosl 7) insertion, and γ-ray irradiation (Sakamoto et al., 2004). Despite extensive efforts, loss-of-function mutations in GA2ox that caused elongated slender phenotype were not found in these mutant populations, probably due to functional redundancy of the GA2ox multigene family; however, gain-of-function mutations in a GA2ox that caused dwarf phenotype were not found in these mutant populations either, perhaps due to a lack of tools for gene activation in the three mutagenesis approaches used (Sakamoto et al., 2004). In the present study, severely dwarf rice mutants GA2OX3ACT and GA2OX6ACT were identified by forward genetics screens, and semi-dwarf mutants
GA2OX9ACT VJ XZ identified by reverse genetics screens, of the TRIM mutant library (Hsing et al., 2007). Further study of the GA2OX5ACTA335-341 mutant led to the discovery of an important functional domain, domain III, in GA2oxs. All these mutants displayed specific phenotypes due to activation of individual GA2oxs. Consequently, the gene activation and/or knockout rice mutant population is a useful resource not only for the identification of mutants with altered GA2ox functions but also for the study of the functions of other genes involved in GA biosynthesis and signaling pathways in rice.
[00240] An additional advantage of the T-DNA activation approach is that it allows the overexpression of GA2oxs under the control of their native promoters. The T-DNA activation approach has been shown to mainly elevate the expression level of nearby genes without altering the original expression pattern in general (Jeong et al., 2002). The controlled expression of GA2oxs in the right time and right place may give rise to phenotypes that facilitate functional analysis of both GA2ox promoters and enzymes during all phases of the life cycle of rice.
[00241] GA signaling represses OSH1 and TBI expression that in turn inhibits tillering
[00242] Despite the important contribution of tillering and root system to grain yield, the mechanisms that control these two developmental processes in rice are mostly unclear. It is
interesting to note that high tillering often accompanies dwarfism in rice (Ishikawa et al., 2005). A recent study shows that overexpression of a YAB1 gene, a feedback regulator of GA biosynthesis, in transgenic rice leads to reduced GA level, increased tiller number and a semidwarf phenotype (Dai et al., 2007), which provides a clue that GA might coordinately control the two opposite
developmental processes.
[00243] In the present study, by using GA-deficient mutants, we demonstrated that stem elongation was inhibited but tillering was promoted by GA-deficiency; in contrast, stem elongation was promoted but tillering was inhibited by GA3 (Figure 14B). Consequently, we conclude that GA concomitantly promotes shoot elongation and inhibits tillering (Figure 13). However, increase in tillering indicates a loss of apical dominance. Studies mostly with dicots indicate that this process is mediated by a network of hormonal signals: apically-produced auxin inhibits axillary meristems, while cytokinin promotes meristem growth (Busov et al., 2008). A HIGH-TILLERING DWARF 1 {HTDl) gene, encoding a carotenoid cleavage dioxygenase, negatively regulates tiller bud outgrowth in rice (Zou et al., 2006). As HTDl expression is induced by auxin (NAA), it has been suggested that auxin may suppress rice tillering partly through up-regulation of HTDl transcription (Zou et al., 2006). Further studies are required to understand whether auxin, cytokinin and GA signalings interact and control tillering in rice.
[00244] In the present study, we also showed that growth of adventitious roots was induced by GA-deficiency and suppressed by GA3 (Figure 10). This notion is supported by a recent study which shows that GA3 inhibits adventitious root formation in Populus tree (Busov et al., 2006). Additionally, overexpression of DELLA-less versions of GA insensitive (GAI) and repressor of GAI-like 1 (RGL1), which conferred GA insensitivity in transgenic Populus trees, led to dwarfism and increase in adventitious root growth (Busov et al., 2006). Crown rootless (Crll) promotes crown and lateral root formation and Crll itself is up regulated by auxin in rice (Inukai et al., 2005). However, aboveground organs are normal in the crll mutant (Inukai et al., 2005), indicating that adventitious/crown root growth might be regulated by a root-specific auxin signaling pathway. Again, further studies are required to determine whether auxin and GA signaling interacti on controls root growth in rice.
[00245] MOC1 is an essential regulator of rice tiller bud formation and development (Li et al., 2003). Overexpression of MOC1 also promotes tiller growth and inhibits stem elongation in transgenic rice, and OSH1 and TBI are downstream positive regulators themselves positively regulated by MOC1 in tiller development (Li et al., 2003; Wang and Li, 2005). In addition to
tillering, seed germination and fertilization are also impaired in the mod mutant, which indicates that MOCl might be involved in GA signaling pathways, by serving as both positive and negative regulators (Wang and Li, 2005). However, it is unclear how MOCl interacts with the GA signaling pathway for regulation of OSHl and TBI expression and thus tiller development.
[00246] We were unable to detect MOCl mRNA in GA2ox6ACT mutant and wild type seedlings by the RT-PCR method in a quantitative manner, probably due to its low abundance in the axillary buds (Li et al., 2003). Nevertheless, we showed that expression of OSHl and TBI was induced by GA-deficiency and suppressed by GA. (Figure 14A). Meanwhile, development of tiller and adventitious roots was promoted by GA-deficiency and inhibited by GA3 (Figure 14B).
Consequently, our study provides evidence that GA negatively regulates OSHl and TBI expression that in turn inhibits tiller development (Figure 13).
[00247] GA2ox Mutants Are Useful in Plant Breeding
[00248] Semi-dwarfism is one of the most valuable traits in crop breeding, because it results in plants that are more resistant to damage by wind and rain (lodging resistant) and have stable yield increases. It is a major component in the increasing yield of the "green revolution" varieties (Peng et al., 1999; Spielmeyer et al., 2002). However, the creation of such varieties has relied on limited natural genetic variations within the crop species. Overexpression of GA2oxs is an easy way to reduce GA levels in transgenic plants, but constitutive ectopic overexpression of most GA2oxs caused severe dwarfism and low seed production in various plant species because active GAs were probably deactivated as soon as they were produced (Schomburg et al., 2003; Lee and Zeevaart, 2005; Dijkstra et al., 2007; Sakamoto et al., 2001 ; Singh et al., 2002; Biemelt et al., 2004).
Expression of the rice GA2oxl under the control of the rice GA3ox2 promoter, at the site of active GA biosynthesis in shoot apex, led to a semi-dwarf phenotype with normal flowering and grain development (Sakamoto et al., 2003). The present invention offers three alternative approaches for breeding plants with reduced height but normal flowering, leaf mass, seed production, and other desirable traits. First, overexpression of GA2ox9 generated a semi-dwarf rice variety. The average grain weight and fertility of the GA2OX9ACT mutant were only slightly reduced (by 8 and 4%, respectively), but tiller number increased 22% compared to the wild type (Table 5), which suggests a potential yield increase. Second, overexpression of GA2oxs with defective domain III could also generate a semi-dwarf rice variety. The average grain weight and fertility of the GA2ox5A335-
341 ACT mutant was reduced by 16 and 12%, respectively, but tiller number increased almost 2-fold (Table 5), which also suggests a potential for overall yield increase. Third, overexpression of a
selected GA2ox gene, such as GA2ox6 which has less effect on plant growth, could be used for breeding a semi-dwarf plant without sacrificing seed production. It is interesting to note that roots of both GA2ox5A335-341 ACT and GA2OX9ACT ^^ 2-3-fold longer than the wild type (Table 5), a trait that could be beneficial for increased uptake of nutrients and water from soil.
[00249] Gibberellins (GAs) are a class of essential plant hormones that control a variety of plant growth and developmental processes. Gibberellin 2-oxidases (GA2oxs) down-regulate the endogenous levels of bioactive GAs in plants through 2p-hydroxylation of biologically active GA.
Identities of conserved domain of deduced amino acids were low among the 10 putative GA2oxs in rice, indicating that these GA2oxs may play variable roles (Table 1). We also found that mutants or transgenic rice overexpressing GA2oxs, under the control of their native or a constitutive promoter, exhibited a broad range mutant phenotypes, depending on promoters and GA2ox genes. In addition to some previously discussed effects caused by overexpression of GA2oxs, such as reduced plant height, small dark green leaves, delayed seed germination, delayed flowering, and reduced seed production, we further discovered thicker and stronger stems, normal-size dark green leaves, early and increased tillering, more active adventitious, stronger root growth and altered root architecture (Figure 16), and enhanced stress tolerance, due to the reduced accumulation of bioactive GA. Our experiment also demonstrated that GA content in plants is closely related to the thickness of stem (Figure 15). These studies suggest the pleiotropic role of GA2oxs in controlling rice growth and architecture. We also found that overexpression of GA2oxs in transgenic dicotyledons plants, such as tobacco, exhibited various levels of semidwarfism and increases in the number of leaves (Table 5 and Figure 6). Our studies demonstrated that GA2oxs can be applied to breeding of various plant species for alteration of statures.
[00250] Semidwarfism, higher tillering, more biomass, more adventitious roots, stronger and thicker stems, stable increase of yields and/or seed production, enhanced stress tolerance (Figure 17), etc., are the most valuable traits in crop breeding, because it results in plants that are more resistant to damages caused by wind and rain (lodging resistant) and biotic and abiotic stresses, and have stable increase of yields. However, the creation of such varieties has relied on natural genetic variations within the crops species that are difficult to achieve in conventional breeding.
Overexpression of GA2oxs is an easy way to control GA levels in transgenic plants. Our discoveries offer approaches for breeding plants with desirable traits that have not been described previously, in addition to other known traits. That is, overexpression of GA2ox gene in both
monocots and dicots resulted in plants with thicker stems, branches, more leaf numbers, and higher stress tolerance.
[00251] In view of the present disclosure, native, inducible or constitutive promoters can be used for better ectopic overexpression of GA2oxs in transgenic rice to lead to desirable traits, such as reduced height, higher tillering, more biomass, increased root mass, stronger stems, enhanced stress tolerance, higher grain yield, etc. in transgenic rice. The desirable traits can be obtained in a wide range of plant species by controlling expression of GA2oxs or a related gene product.
[00252] Overexpression of GA2ox confer increased tolerance to multiple stresses
[00253] As demonstrated in the present invention, plants with increased expression of GA2ox, thus decreased bioactive GA, were surprisingly more tolerant to multiple stresses, such as cold, freezing, high salt, heat, drought, submergence, etc. Such plants fulfill the need for more stress tolerant plants.
[00254] MATERIALS AND METHODS
[00255] Plant Materials
[00256] The rice cultivar Oryza sativa L. cv Tainung 67 was used as in this study. Four T-DNA tagged rice GA2ox mutant lines were obtained from the Taiwan Rice Insertional Mutagenesis database (TRIM database, http://trim.sinica.edu.tw/). Ί mutant seeds were surface sterilized in 2.5% NaClO for 18 minutes, washed well with sterile water, placed on MS agar medium (Murashige and Skoog Basal Medium, Sigma), and incubated at 28°C with continuous light for 15-20 days.
Wild type rice was grown under the same conditions. Plants were transplanted to pot soil and grown in a net-house during the growing season.
[00257] For various abiotic stress tests, GA2ox activation-tagged rice mutants (GA2OX9ACT and GA2OX6ACT) and GA2ox overexpressing transgenic lines (carrying constructs Ubi::GA2ox5 and Ubi::GA2ox6) were used .
[00258] Database Searching and Bioinformatics Analysis of GA2oxs
[00259] Putative GA2ox genes were searched by blast with the database
(www.ncbi.nlm.nih.gov/BLAST/) using the published rice GA2oxl to GA2ox4 and 20G-Fe (II) oxygenase conserved domain, and by annotation of two rice databases, The Institute for Genomic Research (TIGR) (www.tigr.org/tdb/e2kl/osal/irgsp.shtml) and the Rice Genome Annotation (RiceGAAS) (http://ricegaas.dna.affrc.go.jp). Non-redundant amino acid sequences of putative GA2oxs were analyzed for conserved domains with the program Vector NTI (version 9.0.0). The deduced amino acid sequences were aligned and the phylogenetic tree was obtained with Vector
NTI using the Neighbor Joining (NJ) method (Saitou and Nei, 1987). The Knowledge-based Oryza
Molecular Biological Encyclopedia (KOME) database (http://cdna01.dna.affrc.go.jp/cDNA) was used to search cDNA.
[00260] T-DNA Flanking Sequence Analysis
[00261] Genomic DNA was extracted with CTAB extraction buffer as described elsewhere
(Doyle and Doyle, 1987). T-DNA flanking sequences were rescued using a built-in plasmid rescue system (Upadhyaya et al, 2002) and analyzed with an ABI Prism 3100 DNA sequencer (Applied Biosystems) using DNA sequences 100-bp upstream of the T-DNA right border as an RB primer. T-DNA flanking sequences were blasted by a BLASTN (Basic Local Alignment Search Tool) routine against the NCBI database for assignment in the rice BAC/PAC site, and gene dispersions were annotated by the RiceGAAS database.
[00262] PCR and RT-PCR
[00263] Total RNA was purified from rice tissues using a Trizol reagent (Invitrogen). Total RNA (15 μg aliquots) was treated with 1 unit of RNase-free DNase I (Promega) in a 20 μΐ, volume and incubated at 37°C for 30 min. The RNA sample was then incubated at 65°C for 10 min and placed on ice. cDNA synthesis was performed in a 20 μΐ. mixture containing lx reverse transcription reaction buffer (Invitrogen), 4.5 μg of purified RNA, 400 ng oligo (dT)i6 primer, 5 mM DTT, 0.5 mM each dNTP, 40 units RNasin (Promega), and 200 umts Superscript III reverse transcriptase (Invitrogen). The reaction was carried out at room temperature (25 °C) for 10 min, transferred to 50°C for 1 h, and terminated by heating at 72°C for 15 min. The sample, which served as a cDNA stock for PCR analysis, was then stored at -70°C.
[00264] RT-PCR analysis was carried out in a 15 μί solution containing 0.9 μί. cDNA, lx PCR buffer (Promega), 1.5 mM MgCl2, 0.2 mM each dNTP, 0.3 μπιοΐε each primer, 3% DMSO, and 0.6 units of Taq DNA polymerase (Promega). For GA2ox2, GA2ox7, and GA2ox8 that had very low mRNA abundance, RT-PCR analysis was carried out using KOD Hot Start DNA Polymerase
(Novagen). Each 15 μΐ, of reaction solution contained 0.9 μΐ. cDNA, lx PCR buffer (Novagen), 1.0 mM MgSG-4, 0.2 mM each dNTP, 0.3 μπιοΐε each primer, 3% DMSO, and 1 unit of KOD Hot Start DNA Polymerase (Novagen). PCR was performed with the following conditions: denaturation at 94 °C for 1 min, primer annealing at different temperature for each gene for 1 min, primer extension at 72°C for 1 min, and a final 10 min primer extension at 72°C using a programmable thermal cycler (PTC-200, MJ Research). The RT-PCR products were fractionated in a 1.5% agarose gel and visualized by ethidium bromide staining.
[00265] Rice and Tobacco Transformation
[00266] Full length GA2ox5 and GA2ox6 cDNAs were PCR-amplified from the rice genomic-
DNA based on their putative open reading frames annotated with the RiceGAAS database. A
BamHI restriction site was designed at the 5' end of DNA primers used for PCR amplification
(Supplemental Table SIV). The PCR products of 1,043 and 1,094 bps were ligated into the pGEM®- T Easy cloning vector (Promega) and their sequences were confirmed by DNA sequencing. Plasmid pAHC18 (Bruce et al., 1989) was derived from plasmid pUC18 that contains the maize ubiquitin
(Ubi) promoter and nopaline synthase (Nos) terminator. GA2ox5 and GA2ox6 cDNAs were then excised with BamHI from the pGEM-T Easy vector and ligated into the same site between the Ubi promoter and Nos terminator in plasmid pLN. Plasmids containing Ubi::GA2ox5 and Ubi:GA2ox6 were linearized with HindUl and inserted into the same site in pCAMBIAl 301 (Hajdukiewicz et al.,
1994). The resulting binary vectors were transferred into Agrobacteri m tumefaciens strain
EHA105 and then used for rice and tobacco transformation using methods previously described
(Krugel, et al., 2002).
[00267] The constructs G^2o 5-H/ 1325-341 and GA2ox6-IIIA338-358, which generated GA2ox5 and GA2ox6 with deletions of domain III (amino acids 325 to 341 and 338 to 358, respectively), were PCR-amplified with DNA primers shown in Supplemental Table SIV. PCR products of 992 and 1,031 bps were ligated into the pGEM®-T Easy cloning vector and then the pCAMBIAl 301 binary vector, following procedures described above, for generation of binary vectors containing Ubi: :GA2ox5-IIlA325-34l and Ubi::GA2ox6-IIIA338-358 for rice
transformation.
[00268] Expression and Activity Assay of Recombinant GA2ox5 and GA2ox6
[00269] Full length cDNAs of GA2ox5 and GA2ox6 in the pGEM®-T Easy cloning vector were digested with BamHI and subcloned into the same site in pGEX-5X expression vector (Amersham Biosciences). The resulting expression vectors were used to transform E. coli strain BL21- CodonPlus® (DE3) RIPL (Stratagen). A volume of 5 mL transformants pre-cultured overnight in Luria-Bertani broth (LB broth, DIFCO) was transferred to 500 mL of LB broth with 100 mgL"1 ampicillin and incubated at 37°C until cell density reached an OD600 around 0.6 ~ 0.8. Isopropyl-β- D-thiogalactopyranoside (IPTG) was added to the bacteria culture to a final concentration of 0.3 mM and incubated at 28°C for another 3 hours. Bacteria were pelleted by centrifuge and harvested, resuspended in BugBuster® Protein Extraction Reagent (Novagen) at room temperature for 10-20 minutes, and centrifuged at 1,3000 rpm for 30 min. The supernatant protein extracts were partially purified through GST-Bind resin (Novagen), and the purified protein extracts were stored at -80°C.
Enzyme assays with recombinant GA2ox5 and GA2ox6 were performed in Dr. Zeevaart's laboratory. The assay methods for product identification were described in Lee and Zeevaart
(2002).
[00270] Analysis of Endogenous GA Levels
[00271] The procedures for extraction, purification, and quantification of endogenous GAs have been described elsewhere (Talon et al., 1990, Zeevaart et al., 1993, Schomburg et al., 2003).
[00272] Primers
[00273] Primers used for the confirmation of T-DNA insertions in mutant genomes, DNA PCR and RT-PCR analysis are provided in Table 7.
[00274] Table 7. Primers used for T-DNA flanking sequence, PCR and RT-PCR analyses and plasmid construction.
Primers SEQ ID NO Sequence Gene
PCR (Confirmation of T-DNA insertion and genotyping)
GA2ox5-5' SEQ ID NO:31 5'- ATGGAGGAGCACGACTACGACT -3' OsGA2ox5*335-
341 ACT genotyping
GA2ox5-R2 SEQ ID NO:32 5" rCCTCCATGATCTGCTTCCTGTA -3'
GA2ox6-5' SEQ ID NO:33 5'- AGATACTCACTCCGTTTCATGTT -3' OSGA2OX6aCY
genotyping
GA2ox6-3' SEQ ID NO:34 5'- GTAGTGCGGTGAAACAGGATGCC -3'
GA2ox9-5' SEQ ID NO:35 5'- TGCTCCGGACGCCACAATCTA -3' OsGA2ox9ACT
genotyping
GA2ox9-3' SEQ ID NO:36 5'- CGAGATGATACTTTGACCAACAAT -3'
RB SEQ ID NO:37 5'- AACTC ATGGCGATCTCTTACC-3 ' T-DNA right border
RT-PCR- analysis of gene expression
GA2oxl-F SEQ ID NO:38 5'- CGAGCAAACGATGTGGAAGGGCTACAGG -3' OsGA2oxl (332 bp)
GA2oxl-R SEQ ID NO:39 5'- TGGCTCAGGCGGAGTGAGTACATTGTCG -3'
GA2ox2-F SEQ ID NO:40 5'- CCCCACATCCCTGACAAGGCTC -3' OsGA2ox2 (592 bp)
GA2ox2-R SEQ ID NO:41 5'- CTATTCATGGTCGTCATCGTCC -3'
GA2ox3-F SEQ ID NO:42 5'- TGAGCGCGCTGGTGACGGCGGA -3' OsGA2ox3 {15\ bp)
GA2ox3-R SEQ ID NO:43 5'- CTTGATTTGTAGGCAGCCTTC -3'-
GA2ox4-F SEQ ID NO:44 5'- TCGGTGGAGGATAACTTCGGC -3' OsGA2ox4 (999 bp)
GA2ox4-R SEQ ID NO:45 5'- TGGGTTAGCGACAGGTGGTGG -3'
GA2ox5-F SEQ ID NO:46 5'- ATGGAGGAGCACGACTACGACT -3' OsGA2ox5 (974 bp)
GA2ox5-R SEQ ID NO:47 5' TCCTCCATGATCTGCTTCCTGTA -3*
GA2ox6-F SEQ ID NO:48 5'- G ACGACGTGCTTCCTGCGGCTC AA-3 ' OsGA2ox6 (389 bp)
GA2ox6-R SEQ ID NO:49 5'- CTTCCTGCACCTTCTTCCTGTA-3 '
GA2ox7-F SEQ ID NO:50 5'- ACGGGAGCTTCTACGCGAGT -3 ' OsGA2ox7 (594 bp)
GA2ox7-R SEQ ID NO:51 5'- TCAAATCTGCAGAGCCTGTCGTC -3'
GA2ox8-F SEQ ID NO:52 5'- GTGCTGCGGCGGATGGTGGTGG -3' OsGA2ox8 (555 bp)
GA2ox8-R SEQ ID NO:53 5'- CTTCGTCGCGGCCTCATCGTTGG -3'
GA2ox9-F SEQ ID NO:54 5'- ATGTCGAGGCTGGCCAGGG -3' OsGA2ox9 (533 bp)
GA2ox9-R SEQ ID NO:55 5'- CATACGAGGAAATTACTGAGGC -3'
GA2oxl0-F SEQ ID NO:56 5'- CTCCGATCCAACGACACCTCT -3' OsGA2oxll (501 bp)
GA2oxlO-R SEQ ID NO:57 5'- AGCCAGCGCCTCGTCCTGAT -3'
GA3ox2-F SEQ ID NO:58 5'- TCTCCAAGCTCATGTGGTCCGAGGGCTA -3' OsGA3ox2 (346 bp)
GA3ox2-R SEQ ID NO:59 5'- TGGAGCACGAAGGTGAAGAAGCCCGAGT -3'
18S-F SEQ ID NO:60 5'- CCTCGTGCCCCTATC AACTT-3 ' 18S RNA (201 bp)
18S-R SEQ ID NO:61 5'- GACACTAAAGCGCCCGGTAT-3 '
RT-PCR- cDNA amplification for cloning
GA2ox5-fiill-F SEQ ID NO:62 5'- AGCGGATCCATGGAGGAGCACGACTACG -3' OsGA2ox5 full length
GA2ox5-full- SEQ ID NO:63 5'- AATGGATCCCTATCGGGTTCGAAAGCGG -3' (for cloning)
R
GA2ox6-full-F SEQ ID NO:64 5'- TTGGATCCATGCCGGCCTTCGC-3 ' OsGA2ox6 full length
GA2ox6-full- SEQ ID NO:65 5'- CGGG ATCCTTATTGTACTG AAG A-3 ' (for cloning)
R
GA2ox5-III- SEQ ID NO:66 5'- TCGGATCCCTACTCCATGATCTGCTTCCTG - cloning of
D-R 3' Ubi::OsGA2ox5-
111 325-341
GA2ox6-III- SEQ ID NO:67 5'- TTTGGATCCTTATTCCTGCACCTTCTTCCT -3' cloning of
D-R Ubi::OsGA2ox6-
111*338-358
[00275] Abiotic stress assays
[00276] Wild type (WT) and mutant seeds were surface sterilized in 2.5% NaCIO, placed on MS agar medium (Murashige and Skoog Basal Medium, Sigma), and incubated at 28°C with 16 h light and 8 h dark for various days. Seedlings of WT grew normally. Seedlings of GA2OX9ACT mutant line exhibited semi-dwarf phenotype. Seedlings of GA2OX6ACT mutant line, Ubi::GA2ox5 and Ubi: :GA2ox6 transgenic lines exhibited severe-dwarf phenotypes. Seedlings of various ages, e.g., 6-day-old, 15-day-old, or 40-day-old, were used in several abiotic stress assays, e.g., cold tolerance, freezing tolerance, salt tolerance, heat tolerance, draught tolerance, submergence tolerance, etc.
[00277] LITERATURES CITED:
[00278] Biemelt S, Tschiersch H, Sonnewald U (2004) Impact of altered gibberellin metabolism on biomass accumulation, lignin biosynthesis, and photosynthesis in transgenic tobacco plants. Plant
Physiol 135: 254-265.
[00279] Blazquez MA, Green R, Nilsson O, Sussman MR, Weigel D (1998) Gibberellins promote flowering of arabidopsis by activating the LEAFY promoter. Plant Cell 10: 791-800.
[00280] Bruce, WB, Christensen, AH, Klein, T, Fromm, M, and Quail, PH (1989)
Photoregulation of a phytochrome gene promoter from oat transferred into rice by particle bombardment. Proc.Natl. Acad. Sci. USA 86: 9692-9696.
[00281] Choi YH, Kobayashi M, Fujioka S, Matsuno T, Hirosawa T, Sakurai A (1995)
Fluctuation of Endogenous Gibberellin Levels in the Early Development of Rice. Biosci. Biotech. Biochem. 59: 285-288.
[00282] Dai M, Zhao Y, Ma Q, Hu Y, Hedden P, Zhang Q, Zhou D-X (2007) The rice YABBY1 gene is involved in the feedback regulation of gibberellin metabolism. Plant Physiol. 144: 121-133.
[00283] Dijkstra C, Adams E, Bhattacharya A, Page AF, Anthony P, Kourmpetli S, Power JB, Lowe KC, Thomas SG, Hedden P, Phillips AL, Davey MR (2007) Over-expression of a gibberellin 2-oxidase gene from Phaseolus coccineus L. enhances gibberellin inactivation and induces dwarfism in Solanum species. Plant Cell Rep. 27: 463-470.
[00284] Doyle JJ, Doyle J L (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytoch. Bull. 19: 1 1-15.
[00285] Evans MM, Poethig RS (1995) Gibberellins promote vegetative phase change and reproductive maturity in maize. Plant Physiol 108: 475-487.
[00286] Graebe JE (1987) Gibberellin biosynthesis and control. Ann. Rev. Plant Physiol. 38: 419- 465.
[00287] Hajdukiewicz P, Svab Z, Maliga P (1994) The small, versatile pPZP family of
Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25: 989-994.
[00288] Harberd NP, King KE, Carol P, Cowling RJ, Peng J, Richards DE (1998) Gibberellin: inhibitor of an inhibitor of...? Bioessays 20: 1001-1008.
[00289] Hedden P, Phillips AL (2000). Gibberellin metabolism: new insights revealed by the genes. Trends in Plant Sci. 5: 523-530.
[00290] Hsing Y-I, Chern C-G, Fan M-J, Lu P-C, Chen K-T, Lo S-F, Sun P-K, Ho S-L, Lee K- W, Wang Y-C, Huang W-L, Ko S-S, Chen S, Chen J-L, Chung C-I, Lin Y-C, Hour A-L, Wang Y- W, Chang Y-C, Tsai M-W, Lin Y-S, Chen Y-C, Yen H-M, Li C-P, Wey C-K, Tseng C-S, Lai M-H,
Huang S.-C, Chen L-J, Yu S-M (2007) A rice gene activation/knockout mutant resource for high throughput functional genomics. Plant Mol. Biol. 63: 351-364.
[00291] Ishikawa S, Maekawa M, Arite T, Onishi K, Takamure I, Kyozuka J (2005) Suppression of tiller bud activity in tillering dwarf mutants of rice. Plant Cell Physiol. 46: 79-86.
[00292] Jeong DH, An S, Kang HG, Moon S, Han JJ, Park S, Lee HS, An K, An G (2002) T- DNA insertional mutagenesis for activation tagging in rice. Plant Physiol 130: 1636-1644.
[00293] Kende H, Zeevaart JAD (1997) The five "classical" plant hormones. The Plant Cell 9: 1 197-1210.
[00294] King RW, Evans LT (2003) Gibberellins and flowering of grasses and cereals: prizing open the lid of the "Florigen" black box. Ann. Rev. Plant Biol. 54: 307-328.
[00295] Koornneef M and van der Veen JH (1980) Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) heynh. Theor. Appl. Genet. 58: 257-263.
[00296] Krugel, T, Lim, M, Gase, K, Halitschke, R and Baldwin, IT (2002) Agrobacterium- mediated transformation of Nicotiana attenuata, a model ecological expression system.
Chemoecology, 12: 177-183.
[00297] Lee DJ, Zeevaart JAD (2002) Differential regulation of RNA levels of gibberellin dioxygenases by photoperiod in spinach. Plant Physiol. 130: 2085-2094.
[00298] Lee DJ, Zeevaart JAD (2005) Molecular Cloning of GA 2-oxidase3 from spinach and its ectopic expression in Nicotiana sylvestris. Plant Physiol. 138: 243-254.
[00299] Li X, Qian Q, Fu Z, Wang Y, Xiong G, Zeng D, Wang X, Liu X, Teng S, Hiroshi F, Yuan M, Luo D, Han B, Li J (2003) Control of tillering in rice. Nature 422: 618-621.
[00300] Martin DN, Proebsting WM, Hedden P (1999) The SLENDER gene of pea encodes a gibberellin 2-oxidase. Plant Physiol 121 : 775-781.
[00301] Olszewski N, Sun T-P, Gubler F (2002) Gibberellin signaling: biosynthesis, catabolism, and response pathways. The Plant Cell 14: S61 -S80.
[00302] Peng J, Richards DE, Hartley NM, Murphy GP, Devos KM, Flintham JE, Beales J, Fish
LJ, Worland AJ, Pelica F, Sudhakar D, Christou P, Snape JW, Gale MD, Harberd NP (1999) 'Green revolution' genes encode mutant gibberellin response modulators. Nature 400: 256-261.
[00303] del Pozo JC, Lopez-Matas MA, Ramirez-Parra E, Gutierrez C (2005) Hormonal control of the plant cell cycle. Physiol. Plant. 123: 173-183.
[00304] Ross, JJ, Murfet IC, Reid JB (1997) Gibberellin mutants. Physiol. Plant. 100: 550-560.
[00305] Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406-425.
[00306] Sakai M, Sakamoto T, Saito T, Matsuoka M, Tanaka H, Kobayashi M (2003) Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins. J. Plant Res. 116: 161-164.
[00307] Sakamoto T, Kobayashi M, Itoh H, Tagiri A, Kayano T, Tanaka H, Iwahori S, Matsuoka M (2001) Expression of a gibberellin 2-oxidase gene around the shoot apex is related to phase transition in rice. Plant Physiol. 125: 1508-1516.
[00308] Sakamoto T, Morinaka Y, Ishiyama K, Kobayashi M, Itoh H, Kayano T, Iwahori S, Matsuoka M, Tanaka H (2003) Genetic manipulation of gibberellin metabolism in transgenic rice. Nat Biotechnol 21 : 909-913.
[00309] Sakamoto T, Miura K, Itoh H, Tatsumi T, Ueguchi-Tanaka M, Ishiyama K, Kobayashi M, Agrawal GK, Takeda S, Abe K, Miyao A, Hirochika H, Kitano H, Ashikari M, Matsuoka M (2004) An overview of gibberellin metabolism enzyme genes and their related mutants in rice. Plant Physiol. 134: 1642-1653.
[00310] Schomburg FM, Bizzell CM, Lee DJ, Zeevaart JAD, Amasino RM (2003).
Overexpression of a novel class of gibberellin 2-oxidases decreases gibberellin levels and creates dwarf plants. Plant Cell 15: 151-163.
[00311] Singh DP, Jermakow AM, Swain SM (2002) Gibberellins are required for seed development and pollen tube growth in Arabidopsis. Plant Cell 14: 3133-3147.
[00312] Spielmeyer W, Ellis MH, Chandler PM (2002) Semidwarf (sd-1), "green revolution" rice, contains a defective gibberellin 20-oxidase gene. Proc Natl Acad Sci U S A 99: 9043-9048.
[00313] Sun T-P, Gubler F (2004) Molecular mechanism of gibberellin signaling in plants. Ann. Rev. Plant Biol. 55: 197-223.
[00314] Tanimoto E (2005) Regulation of root growth by plant hormones - roles of auxin and gibberellin. Critic. Rev. in Plant Sci. 24: 249-265.
[00315] Talon M, Koornneef M, Zeevaart JAD (1990) Endogenous gibberellins in Arabidopsis thaliana and possible steps blocked in the biosynthetic pathways of the semidwarf ga4 and ga5 mutants. Proc. Natl. Acad. Sci. USA 87: 7983-7987.
[00316] Thomas SG, Philips AL, Hedden P (1999) Molecular cloning and functional expression of gibberellin 2-oxidases, multifunctional enzymes involved in gibberellin deactivation. Proc. Natl. Acad. Sci. USA 96: 4698-4703.
[00317] Upadhyaya, NM, Zhou, XR, Zhu, QH et al. (2002) An iAc/Ds gene and enhancer trapping system for insertional mutagenesis in rice. Funct. Plant Biol. 29: 547-559.
[00318] Wang Y, Li J (2005) The plant architecture of rice (Oryza sativa). Plant Mol. Biol. 59:
75-84.
[00319] Zeevaart JAD, Gage DA, Talon M (1993) Gibberellin Ai is required for stem elongation in spinach. Proc. Natl. Acad. Sci. USA 90: 7401-7405.
[00320] It will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof. It is understood, therefore, that this invention is not limited to the particular embodiments disclosed, but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims.
Claims
1. A method of obtaining at least one desirable feature of enhanced stress tolerance and stronger and thicker stem of a plant compared to a control plant, comprising obtaining a transgenic plant, wherein the transgenic plant comprises a recombinant polynucleotide encoding a polypeptide selected from the group consisting of:
(1) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(2) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(3) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(4) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(5) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
(6) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75; and
(7) a mutant class C20 GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant C20 GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that does not comprise the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO: 17, and
wherein the polypeptide, when expressed in the transgenic plant, confers the at least one desirable feature of enhanced stress tolerance and stronger and thicker stem to the transgenic plant as compared to the control plant grown under the same conditions.
2. The method of claim 1 , wherein the transgenic plant comprises a recombinant polynucleotide encoding a polypeptide selected from the group consisting of : SEQ ID NO:2; SEQ ID NO:4; SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO:12; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO:27; SEQ ID NO:28; SEQ ID NO:29; SEQ ID NO:30; SEQ ID NO:68; SEQ ID NO:69; and the mutant class C20 GA2ox, wherein the domain III comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 and SEQ ID NO:23, and the otherwise identical class C20 GA2ox comprises an amino acid sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26.
3. The method of claim 1 , wherein the transgenic plant is a stably transfected transgenic plant.
4. The method of claim 1 , wherein gene expression of the polypeptide in the transgenic plant is controlled by a promoter selected from the group consisting of a native promoter; a constitutive promoter selected from the group consisting of a maize ubiquitin (Ubi) promoter, a rice actin (Actl) promoter, and cauliflower mosaic 35S RNA promoter (CaMV35S) promoter; a tissue-specific promoter selected from the group consisting of a rice glutelin (GluB) promoter, a rubisco small subunit (rbcS) promoter and a maize zean gene promoter; a developmental stage-specific promoter selected from the group consisting of a rice alpha-amylase (<x4»2y)promoter and a rice glycine rich RNA binding protein (GRRP-A1) promoter; and an inducible promoter inducible by drought, salt, high or low temperatures, hypoxia, anoxia, hydration, pH, chemicals, or hormones.
5. The method of claim 4, wherein the inducible promoter is selected from the group consisting of promoters for the genes of Arabidopsis rd29A, corl5A, kinl, heat-shock factor (HSF), C-repeat- binding factor (CBF1) and dehydration-responsive element binding protein (DREB1A); and promoters for the genes of rice HVA1 (ABA-inducible), alcohol dehydrogenase (Adh), ethanol- inducible, and alpha-amylase (GA-inducible).
6. The method of claim 1 , wherein gene expression of the polypeptide in the transgenic plant is controlled by a promoter that controls gene expression in a developing seed during seed germination of the transgenic plant, in an early seedling of the transgenic plant, or in a growing plant of the transgenic plant.
7. The method of claim 1 , wherein the transgenic plant is a dicot plant.
8. The method of claim 1, wherein the transgenic plant is a monocot plant.
9. The method of claim 8, wherein the transgenic plant is a rice plant.
10. The method of claim 1 , comprising growing a propagation material obtained for the transgenic plant, wherein the propagation material contains the recombinant polynucleotide.
11. The method of claim 1 , comprising growing a seed for the transgenic plant.
12. A method of obtaining at least one desirable feature of enhanced stress tolerance and stronger and thicker stem of a plant compared to a control plant, the method comprising increasing expression of a gibberellin 2-oxidase or a derivative thereof in the plant as compared to the control plant.
13. The method of claim 12, comprising increasing expression in the plant of a polypeptide selected from the group consisting of:
(1) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:2, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:70;
(2) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:4, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:71;
(3) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:6, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:72;
(4) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO:8, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:73;
(5) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10 or at least about 80% identical to SEQ ID NO: 12, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:74;
(6) a polypeptide having an amino acid sequence that is at least about 80% identical to SEQ ID NO: 14 or at least about 80% identical to SEQ ID NO: 16, wherein the amino acid sequence has a domain that is at least 80% identical to SEQ ID NO:75; and
(7) a mutant class C20 GA2ox, the mutant GA2ox having at least one mutation in domain III of class C20 GA2ox, the mutant GA2ox having a reduced enzymatic activity to hydroxylate a class C20-GA precursor compared with an otherwise identical class C20 GA2ox that lacks the at least one mutation, and the domain III comprising the amino acid sequence of SEQ ID NO:17,
wherein the polypeptide, when its expression is increased in the plant, results in reduced amount of endogenous bioactive gibberellins as compared to the control plant grown under the same conditions.
14. The method of claim 13, comprising.increasing expression in the plant of a polypeptide selected from the group consisting of: SEQ ID NO:2; SEQ ID NO:4; SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO: 16; SEQ ID NO:27; SEQ ID NO:28; SEQ ID NO:29; SEQ ID NO:30; SEQ ID NO:68; SEQ ID NO:69; and the mutant class C20 GA2ox, wherein the domain III comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 and SEQ ID NO:23, and the otherwise identical class C20 GA2ox comprises an amino acid sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26.
15. The method of claim 13, wherein the plant is a transgenic plant comprising a recombinant polynucleotide encoding the polypeptide, and the expression of the polypeptide is increased by recombinant expression of the polypeptide in the transgenic plant.
16. The method of claim 13, wherein the expression of the polypeptide is increased by active mutation of the gene encoding the polypeptide.
17. The method of claim 12, wherein the plant is a dicot plant.
18. The method of claim 12, wherein the plant is a monocot plant.
19. The method of claim 12, wherein the stress is a biotic stress resulting from an invasion of the plant by a bacterium, a virus, a fungus, a parasite, a harmful insect, an algae, a nematode or a weed.
20. The method of claim 12, wherein the stress is an abiotic stress resulting from the negative impact of a high wind, a low or high temperature, drought, salinity, flood, a poor edaphic condition, high radiation, compaction, contamination, pollution or rapid rehydration during seed germination.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12/604,808 US8426677B2 (en) | 2008-06-16 | 2009-10-23 | Method of controlling plant growth and architecture by controlling expression of gibberellin 2-oxidase |
| US12/604,808 | 2009-10-23 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2011050281A2 true WO2011050281A2 (en) | 2011-04-28 |
| WO2011050281A3 WO2011050281A3 (en) | 2011-07-28 |
Family
ID=43426150
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/053786 Ceased WO2011050281A2 (en) | 2009-10-23 | 2010-10-22 | A method of controlling plant growth and architecture by controlling expression of gibberellin 2-oxidase |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US8426677B2 (en) |
| WO (1) | WO2011050281A2 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013037959A1 (en) * | 2011-09-16 | 2013-03-21 | Vib Vzw | Methods and means to produce abiotic stress tolerant plants |
| WO2018137173A1 (en) * | 2017-01-25 | 2018-08-02 | 中国农业大学 | Method for improving sensitivity of plant to gibberellin inhibitor and use thereof |
| CN108728420A (en) * | 2017-04-24 | 2018-11-02 | 中国科学院上海生命科学研究院 | It is a kind of regulation and control crop downgrade and its yield gene and its application |
| CN110408605A (en) * | 2019-08-15 | 2019-11-05 | 中国农业科学院作物科学研究所 | Rice Os GA2ox8 albumen and its encoding gene and recombinant vector are applied in enhancing plant drought resistance |
Families Citing this family (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130185826A1 (en) * | 2012-01-12 | 2013-07-18 | The Texas A&M University System | Materials, systems, organisms, and methods for enhancing abiotic stress tolerance, increasing biomass, and/or altering lignin composition |
| TWI545195B (en) * | 2012-11-28 | 2016-08-11 | 中央研究院 | Mutant gibberellin 2-oxidase genes and uses thereof |
| CN103525853B (en) * | 2013-09-29 | 2015-08-05 | 浙江工业大学 | The application of CBF1 gene in the high temperature resistance improving viride |
| MX2019001956A (en) | 2016-08-17 | 2019-09-04 | Monsanto Technology Llc | METHODS AND COMPOSITIONS FOR SHORT STATURE PLANTS THROUGH THE MANIPULATION OF THE METABOLISM OF GIBERELIN TO INCREASE THE HARVESTABLE YIELD. |
| CA3090007A1 (en) | 2018-02-15 | 2019-08-22 | Monsanto Technology Llc | Improved methods for hybrid corn seed production |
| MX2020008591A (en) * | 2018-02-15 | 2020-12-07 | Monsanto Technology Llc | Compositions and methods for improving crop yields through trait stacking. |
| AR114124A1 (en) | 2018-02-15 | 2020-07-22 | Monsanto Technology Llc | COMPOSITIONS AND METHODS TO IMPROVE CROP YIELD THROUGH TRAIT STACKING |
| US12274205B2 (en) | 2018-12-12 | 2025-04-15 | Monsanto Technology Llc | Delayed harvest of short stature corn plants |
| CN112430599B (en) * | 2019-08-08 | 2022-11-08 | 中国水稻研究所 | Rice plant type gene and application thereof |
| US20220162632A1 (en) | 2020-11-23 | 2022-05-26 | Monsanto Technology Llc | Delayed harvest of short stature corn plants |
| CA3205117A1 (en) * | 2020-12-15 | 2022-06-23 | Monsanto Technology Llc | Methods and compositions for short stature plants through manipulation of gibberellin metabolism |
| CN115873083A (en) * | 2021-09-29 | 2023-03-31 | 中国农业科学院油料作物研究所 | Genes Regulating Soybean Plant Height and Their Encoded Proteins and Applications |
| US12577624B2 (en) | 2021-11-02 | 2026-03-17 | Monsanto Technology Llc | Transgenic corn event ZM_BCS216090 and methods for detection and uses thereof |
| CN114085851B (en) * | 2021-12-01 | 2023-08-04 | 云南中烟工业有限责任公司 | A kind of gene that regulates tobacco flowering time and its application |
| CN114381546A (en) * | 2022-01-19 | 2022-04-22 | 河南农业大学 | Molecular marker co-separated from watermelon short hypocotyl gene Clsh and application |
| CN114591976A (en) * | 2022-04-07 | 2022-06-07 | 广西壮族自治区亚热带作物研究所(广西亚热带农产品加工研究所) | Gene for encoding GA2 ox-oxidase and application thereof in judging dwarf mango variety |
| CN114752573B (en) * | 2022-06-14 | 2022-08-12 | 中国农业科学院作物科学研究所 | Application of rice OsGA20ox2 protein and its encoding gene in improving plant resistance to abiotic stress |
| CN116286954B (en) * | 2023-03-15 | 2023-12-01 | 南京农业大学 | Construction and application of rice gibberellin decomposition gene OsGA2ox7 mutant |
| CN119552908B (en) * | 2024-11-27 | 2025-09-26 | 吉林省农业科学院(中国农业科技东北创新中心) | A method for reducing corn plant height |
| CN119709840B (en) * | 2024-12-30 | 2025-12-30 | 吉林省农业科学院(中国农业科技东北创新中心) | A method for regulating the length or width of maize leaves |
| CN119432881B (en) * | 2025-01-08 | 2025-03-11 | 吉林农业大学 | Sea buckthorn HrGA ox gene for reducing plant gibberellin content and plant height and application thereof |
| CN120060338A (en) * | 2025-03-03 | 2025-05-30 | 广东省农业科学院作物研究所 | Application of AhGA3ox1 gene in regulation of plant height and breeding |
| CN120758560B (en) * | 2025-09-11 | 2026-03-03 | 内蒙古师范大学 | Application of the protein encoded by the gibberellin synthesis pathway gene GA7ox in regulating plant development |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7186891B1 (en) * | 1996-04-12 | 2007-03-06 | University Of Kentucky, Research Foundation | Plant cells and plants expressing chimeric isoprenoid synthases |
| CN1310761A (en) * | 1998-06-12 | 2001-08-29 | 布里斯托尔大学 | Enzyme |
| AU5346099A (en) * | 1998-08-10 | 2000-03-06 | Monsanto Company | Methods for controlling gibberellin levels |
| US6921849B2 (en) * | 2002-05-23 | 2005-07-26 | Wisconsin Alumni Research Foundation | Dwarfism genes and dwarf plants |
| JP2005185101A (en) * | 2002-05-30 | 2005-07-14 | National Institute Of Agrobiological Sciences | Plant full-length cDNA and use thereof |
| JP3783777B2 (en) * | 2002-09-20 | 2006-06-07 | 独立行政法人農業生物資源研究所 | Gibberellin 2-oxidase gene having a new function and use thereof |
| WO2009064118A2 (en) | 2007-11-13 | 2009-05-22 | Genomine Inc. | Polypeptide inducing dwarfism of plants, polynucleotide coding the polypeptide, and those use |
| US8034992B2 (en) * | 2008-06-16 | 2011-10-11 | Academia Sinica | Gibberellin 2-oxidase genes and uses thereof |
-
2009
- 2009-10-23 US US12/604,808 patent/US8426677B2/en not_active Expired - Fee Related
-
2010
- 2010-10-22 WO PCT/US2010/053786 patent/WO2011050281A2/en not_active Ceased
Non-Patent Citations (45)
| Title |
|---|
| BIEMELT S; TSCHIERSCH H; SONNEWALD U: "Impact of altered gibberellin metabolism - on biomass accumulation, lignin biosynthesis, and photosynthesis in transgenic tobacco plants", PLANT PHYSIOL, vol. 135, 2004, pages 254 - 265, XP002617003, DOI: doi:10.1104/PP.103.036988 |
| BLAZQUEZ MA; GREEN R; NILSSON 0; SUSSMAN MR; WEIGEL D: "Gibberellins promote flowering of arabidopsis by activating the LEAFY promoter", PLANT CELL, vol. 10, 1998, pages 791 - 800 |
| BRUCE, WB; CHRISTENSEN, AH; KLEIN, T; FROMM, M; QUAIL, PH: "Photoregulation of a phytochrome gene promoter from oat transferred into rice by particle bombardment", PROC.NATL. ACAD. SCI. USA, vol. 86, 1989, pages 9692 - 9696 |
| CHOI YH; KOBAYASHI M; FUJIOKA S; MATSUNO T; HIROSAWA T; SAKURAI A: "Fluctuation of Endogenous Gibberellin Levels in the Early Development of Rice", BIOSCI. BIOTECH. BIOCHEM., vol. 59, 1995, pages 285 - 288 |
| DAI M; ZHAO Y; MA Q; HU Y; HEDDEN P; ZHANG Q; ZHOU D-X: "The rice YABBYI gene is involved in the feedback regulation of gibberellin metabolism", PLANT PHYSIOL., vol. 144, 2007, pages 121 - 133 |
| DEL POZO JC; LOPEZ-MATAS MA; RAMIREZ-PARRA E; GUTIERREZ C: "Hormonal control of the plant cell cycle", PHYSIOL. PLANT., vol. 123, 2005, pages 173 - 183 |
| DIJKSTRA C; ADAMS E; BHATTACHARYA A; PAGE AF; ANTHONY P; KOURMPETLI S; POWER JB; LOWE KC; THOMAS SG; HEDDEN P: "Over-expression of a gibberellin 2-oxidase gene from Phaseolus coccineus L. enhances gibberellin inactivation and induces dwarfism in Solanum species", PLANT CELL REP., vol. 27, 2007, pages 463 - 470, XP019587751 |
| DOYLE JJ; DOYLE J L: "A rapid DNA isolation procedure for small quantities of fresh leaf tissue", PHYTOCH. BULL., vol. 19, 1987, pages 11 - 15 |
| EVANS MM; POETHIG RS: "Gibberellins promote vegetative phase change and reproductive maturity in maize", PLANT PHYSIOL, vol. 108, 1995, pages 475 - 487 |
| GRAEBE JE: "Gibberellin biosynthesis and control", ANN. REV. PLANT PHYSIOL., vol. 38, 1987, pages 419 - 465 |
| HAJDUKIEWICZ P; SVAB Z; MALIGA P: "The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation", PLANT MOL BIOL, vol. 25, 1994, pages 989 - 994 |
| HARBERD NP; KING KE; CAROL P; COWLING RJ; PENG J; RICHARDS DE: "Gibberellin: inhibitor of an inhibitor of...?", BIOESSAYS, vol. 20, 1998, pages 1001 - 1008 |
| HEDDEN P; PHILLIPS AL: "Gibberellin metabolism: new insights revealed by the genes", TRENDS IN PLANT SCI., vol. 5, 2000, pages 523 - 530, XP002285953, DOI: doi:10.1016/S1360-1385(00)01790-8 |
| HSING Y-I; CHERN C-G; FAN M-J; LU P-C; CHEN K-T; LO S-F; SUN P-K; HO S-L; LEE K-W; WANG Y-C: "A rice gene activation/knockout mutant resource for high throughput functional genomics", PLANT MOL. BIOL., vol. 63, 2007, pages 351 - 364, XP019483631 |
| ISHIKAWA S; MAEKAWA M; ARITE T; ONISHI K; TAKAMURE I; KYOZUKA J: "Suppression of tiller bud activity in tillering dwarf mutants of rice", PLANT CELL PHYSIOL., vol. 46, 2005, pages 79 - 86 |
| JEONG DH; AN S; KANG HG; MOON S; HAN JJ; PARK S; LEE HS; AN K; AN G: "T-DNA insertional mutagenesis for activation tagging in rice", PLANT PHYSIOL, vol. 130, 2002, pages 1636 - 1644 |
| KENDE H; ZEEVAART JAD: "The five "classical" plant hormones", THE PLANT CELL, vol. 9, 1997, pages 1197 - 1210 |
| KING RW; EVANS LT: "Gibberellins and flowering of grasses and cereals: prizing open the lid of the "Florigen" black box", ANN. REV. PLANT BIOL., vol. 54, 2003, pages 307 - 328 |
| KOORNNEEF M; VAN DER VEEN JH: "Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) heynh", THEOR. APPL. GENET., vol. 58, 1980, pages 257 - 263 |
| KRAMER; FRITZ, METHODS IN ENZYMOLOGY, vol. 154, 1987, pages 350 - 367 |
| KRIIGEL, T; LIM, M; GASE, K; HALITSCHKE, R; BALDWIN, IT: "Agrobacterium-mediated transformation of Nicotiana attenuata, a model ecological expression system", CHEMOECOLOGY, vol. 12, 2002, pages 177 - 183 |
| LEE DJ; ZEEVAART JAD: "Differential regulation of RNA levels of gibberellin dioxygenases by photoperiod in spinach", PLANT PHYSIOL., vol. 130, 2002, pages 2085 - 2094 |
| LEE DJ; ZEEVAART JAD: "Molecular Cloning of GA 2-oxidase3 from spinach and its ectopic expression in Nicotiana sylvestris", PLANT PHYSIOL., vol. 138, 2005, pages 243 - 254, XP002616935, DOI: doi:10.1104/PP.104.056499 |
| LI X; QIAN Q; FU Z; WANG Y; XIONG G; ZENG D; WANG X; LIU X; TENG S; HIROSHI F: "Control of tillering in rice", NATURE, vol. 422, 2003, pages 618 - 621 |
| MARTIN DN; PROEBSTING WM; HEDDEN P: "The SLENDER gene of pea encodes a gibberellin 2-oxidase", PLANT PHYSIOL, vol. 121, 1999, pages 775 - 781 |
| NEEDLEMAN; WUNSCH, J MOL. BIOL., vol. 48, 1970, pages 443 |
| OLSZEWSKI N; SUN T-P; GUBLER F: "Gibberellin signaling: biosynthesis, catabolism, and response pathways", THE PLANT CELL, vol. 14, 2002, pages S61 - S80 |
| PENG J; RICHARDS DE; HARTLEY NM; MURPHY GP; DEVOS KM; FLINTHAM JE; BEALES J; FISH LJ; WORLAND AJ; PELICA F: "Green revolution' genes encode mutant gibberellin response modulators", NATURE, vol. 400, 1999, pages 256 - 261 |
| ROSS, JJ; MURFET IC; REID JB: "Gibberellin mutants", PHYSIOL. PLANT., vol. 100, 1997, pages 550 - 560 |
| SAITOU N; NEI M: "The neighbor-joining method: a new method for reconstructing phylogenetic trees", MOL BIOL EVOL, vol. 4, 1987, pages 406 - 425, XP001154601 |
| SAKAI M; SAKAMOTO T; SAITO T; MATSUOKA M; TANAKA H; KOBAYASHI M: "Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins", J. PLANT RES., vol. 116, 2003, pages 161 - 164, XP002616933, DOI: doi:10.1007/S10265-003-0080-Z |
| SAKAMOTO T; KOBAYASHI M; ITOH H; TAGIRI A; KAYANO T; TANAKA H; IWAHORI S; MATSUOKA M: "Expression of a gibberellin 2-oxidase gene around the shoot apex is related to phase transition in rice", PLANT PHYSIOL., vol. 125, 2001, pages 1508 - 1516 |
| SAKAMOTO T; MIURA K; ITOH H; TATSUMI T; UEGUCHI-TANAKA M; ISHIYAMA K; KOBAYASHI M; AGRAWAL GK; TAKEDA S; ABE K: "An overview of gibberellin metabolism enzyme genes and their related mutants in rice", PLANT PHYSIOL., vol. 134, 2004, pages 1642 - 1653, XP003003256, DOI: doi:10.1104/pp.103.033696 |
| SAKAMOTO T; MORINAKA Y; ISHIYAMA K; KOBAYASHI M; ITOH H; KAYANO T; IWAHORI S; MATSUOKA M; TANAKA H: "Genetic manipulation of gibberellin metabolism in transgenic rice", NAT BIOTECHNOL, vol. 21, 2003, pages 909 - 913, XP002429144, DOI: doi:10.1038/nbt847 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, Second Edition,", 1989, COLD SPRING HARBOR LABORATORY |
| SCHOMBURG FM; BIZZELL CM; LEE DJ; ZEEVAART JAD; AMASINO RM: "Overexpression of a novel class of gibberellin 2-oxidases decreases gibberellin levels and creates dwarf plants", PLANT CELL, vol. 15, 2003, pages 151 - 163 |
| SINGH DP; JERMAKOW AM; SWAIN SM: "Gibberellins are required for seed development and pollen tube growth in Arabidopsis", PLANT CELL, vol. 14, 2002, pages 3133 - 3147 |
| SPIELMEYER W; ELLIS MH; CHANDLER PM: "Semidwarf (sd-1), "green revolution" rice, contains a defective gibberellin 20-oxidase gene", PROC NATL ACAD SCI U S A, vol. 99, 2002, pages 9043 - 9048 |
| SUN T-P; GUBLER F: "Molecular mechanism of gibberellin signaling in plants", ANN. REV. PLANT BIOL., vol. 55, 2004, pages 197 - 223, XP002599865, DOI: doi:10.1146/annurev.arplant.55.031903.141753 |
| TALON M; KOOMNEEFM; ZEEVAART JAD: "Endogenous gibberellins in Arabidopsis thaliana and possible steps blocked in the biosynthetic pathways of the semidwarf ga4 and ga5 mutants", PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 7983 - 7987, XP002079879, DOI: doi:10.1073/pnas.87.20.7983 |
| TANIMOTO E: "Regulation of root growth by plant hormones - roles of auxin and gibberellin", CRITIC. REV. IN PLANT SCI., vol. 24, 2005, pages 249 - 265 |
| THOMAS SG; PHILIPS AL; HEDDEN P: "Molecular cloning and functional expression of gibberellin 2-oxidases, multifunctional enzymes involved in gibberellin deactivation", PROC. NATL. ACAD. SCI. USA, vol. 96, 1999, pages 4698 - 4703, XP002124383, DOI: doi:10.1073/pnas.96.8.4698 |
| UPADHYAYA, NM; ZHOU, XR; ZHU, QH ET AL.: "An iAc/Ds gene and enhancer trapping system for insertional mutagenesis in rice", FUNCT. PLANT BIOL., vol. 29, 2002, pages 547 - 559 |
| WANG Y; LI J: "The plant architecture of rice (Oryza sativa)", PLANT MOL. BIOL., vol. 59, 2005, pages 75 - 84, XP019262747, DOI: doi:10.1007/s11103-004-4038-x |
| ZEEVAART JAD; GAGE DA; TALON M: "Gibberellin Al is required for stem elongation in spinach", PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 7401 - 7405 |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013037959A1 (en) * | 2011-09-16 | 2013-03-21 | Vib Vzw | Methods and means to produce abiotic stress tolerant plants |
| WO2018137173A1 (en) * | 2017-01-25 | 2018-08-02 | 中国农业大学 | Method for improving sensitivity of plant to gibberellin inhibitor and use thereof |
| CN108728420A (en) * | 2017-04-24 | 2018-11-02 | 中国科学院上海生命科学研究院 | It is a kind of regulation and control crop downgrade and its yield gene and its application |
| CN108728420B (en) * | 2017-04-24 | 2021-10-29 | 中国科学院分子植物科学卓越创新中心 | A gene for regulating crop dwarfing and yield and its application |
| CN110408605A (en) * | 2019-08-15 | 2019-11-05 | 中国农业科学院作物科学研究所 | Rice Os GA2ox8 albumen and its encoding gene and recombinant vector are applied in enhancing plant drought resistance |
Also Published As
| Publication number | Publication date |
|---|---|
| US20100095406A1 (en) | 2010-04-15 |
| US8426677B2 (en) | 2013-04-23 |
| WO2011050281A3 (en) | 2011-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8426677B2 (en) | Method of controlling plant growth and architecture by controlling expression of gibberellin 2-oxidase | |
| US8034992B2 (en) | Gibberellin 2-oxidase genes and uses thereof | |
| JP4365021B2 (en) | Plant stress tolerance and aging delay | |
| ES2263214T3 (en) | WHEAT RHT GEN FOR GENETIC CONTROL OF GROWTH AND VEGETABLE DEVELOPMENT. | |
| CN103108955B (en) | For improving the nucleic acid construct of abiotic stress tolerance in plant | |
| US9809827B2 (en) | Transgenic maize | |
| CN101875689A (en) | New rice zinc finger protein transcription factor gene and its application in drought and salt tolerance | |
| CA2692650A1 (en) | Transgenic plants with increased stress tolerance and yield | |
| CN102099480A (en) | Plants having enhanced yield-related traits and a method for making the same | |
| CN105063063A (en) | Plants having enhanced yield-related traits and method for making the same | |
| Zhao et al. | Retrotransposon-mediated DELLA transcriptional reprograming underlies semi-dominant dwarfism in foxtail millet | |
| CN117844860A (en) | Application of rapeseed BnaREM1.3 gene and its encoded protein in regulating crop drought resistance | |
| WO2014069339A1 (en) | Nucleic acid imparting high-yielding property to plant, method for producing transgenic plant with increased yield, and method for increasing plant yield | |
| US20130139281A1 (en) | Transgenic Plants with Increased Stress Tolerance and Yield | |
| US20100138962A1 (en) | Use of plant chromatin remodeling genes for modulating plant architecture and growth | |
| BRPI1011495B1 (en) | METHOD FOR PRODUCTION OF A TRANSGENIC PLANT HAVING INCREASED TOLERANCE TO HEAT STRESS IN RELATION TO WILD TYPE CONTROL | |
| CN101796068A (en) | RHD6 and application thereof in regulating plant root hair development | |
| KR20020064352A (en) | Rice-Origin Gibberellin 3β-HydroxylaseGenes and Utilization Thereof | |
| CN114106129B (en) | Application of rape SWEET15 sugar transporter gene in improving rape yield | |
| JP3829157B2 (en) | Rice-derived gibberellin 2β-hydroxylase gene and use thereof | |
| CN111454963B (en) | Salt Tolerance Gene HuERF1 Gene of Dragon Fruit and Its Application | |
| US20030061636A1 (en) | Stress tolerance and delayed senescence in plants | |
| Kuluev et al. | Role of PtrXTH1 and PnXTH1 genes encoding xyloglucan endo-transglycosylases in regulation of growth and adaptation of plants to stress factors | |
| KR101559128B1 (en) | An abiotic stress-inducible OsATL5 gene, protein and an enhancer of OsATL5 expression enhancing environmental tolerance | |
| Kim MiJin et al. | Overexpression of AtSZF2 from Arabidopsis showed enhanced tolerance to salt stress in soybean. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10773486 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10773486 Country of ref document: EP Kind code of ref document: A2 |