WO2011040880A1 - Control of pests in plants - Google Patents
Control of pests in plants Download PDFInfo
- Publication number
- WO2011040880A1 WO2011040880A1 PCT/SG2010/000339 SG2010000339W WO2011040880A1 WO 2011040880 A1 WO2011040880 A1 WO 2011040880A1 SG 2010000339 W SG2010000339 W SG 2010000339W WO 2011040880 A1 WO2011040880 A1 WO 2011040880A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- rna
- pest
- virus
- host
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8285—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for nematode resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- the present invention relates to the field of controlling pests, such as insects, using a virus to express pest genes in hosts. More specifically, the present invention relates to a method for rapidly screening for pest genes which can lead to mortality of the pest when the pest has ingested host tissues expressing virus-linked pest gene sequences. The present invention also relates to a method for controlling pests by viral expression of target pest sequences to modify endogenous expression of pest genes in cells or tissues of the pest. [0004]
- the publications and other materials used herein to illuminate the background of the invention or provide additional details respecting the practice, are incorporated by reference, and for convenience are respectively grouped in the bibliography.
- compositions for controlling infestations by microscopic pests such as bacteria, fungi and viruses have been provide in the form of antibiotic compositions, antiviral compositions, and antifungal compositions.
- Compositions for controlling infestations by larger pests such as nematodes, flatworm, roundworms, pin worms, heartworms, tapeworms,
- trypanosomes, schistosomes, and the like have typically been in the form of chemical compositions which can either be applied to the surfaces of substrates on which pests are known to infest, or to be ingested by an infested animal in the form of pellets, powders, tablets, pastes, or capsules and the like.
- Chemical pesticides have been very effective in eradicating pest infestations.
- chemical pesticidal agents are not selective, therefore, on the same time of controlling target insect, because of the lack of selectivity, they also exert their effects on non-target fauna, often effectively sterilizing a field for a period of time over which the pesticidal agents have been applied.
- chemical pesticidal agents persist in the environment and generally are slow to be metabolized, if at all.
- Bt crops such as corn and cotton
- target pests may develop resistance to these toxins.
- Bt- resistant insect populations have not yet been observed in the field, resistant strains have been developed in the laboratory by selection with toxin-impregnated diet (McGaughy, 1985).
- McGaughy, 1985 Toxin-impregnated diet
- Double stranded RNA (dsRNA) mediated inhibition of specific genes in eukaryotic organisms has been used to silence genes and study gene function in few insect such as coleopteran Tribolium castaneum (Bucher et al., 2002) previously.
- Normal delivery of dsRNA to mediate dsRNA-involved genetic control includes generating transgenic insects that express double stranded RNA molecules or injecting dsRNA solutions into the insect body or within the egg sac prior to or during embryonic development. It is widely believed this method of transgenic expression in insect for controlling insect on field crop would be impractical to provide dsRNA molecules in the diet of most invertebrate pest species or to inject compositions containing dsRNA into the bodies of invertebrate pest.
- transgenically expressed dsRNA can enhanced resistance to the economically important agricultural pests cotton bollworm (Helicoverpa armigera; Lepidoptera) and Western corn rootworm (WC ; Diabrotica virgifera virgifera
- the key to compete or even to replace Bt transgenic plant technology is to identify one or more suitable insect genes by feeding expressed dsRNA in vivo in specific plant-insect pair in the content of huge gene number for each agriculturally important pest (for example, 16,404 gene for the model beetle and pest Tribolium castaneum).
- dsRNA for example, 16,404 gene for the model beetle and pest Tribolium castaneum.
- one essential technology to evaluate these candidate genes is stable transformation of plants.
- the inefficient production of transgenic plants in some important crops such as cotton limits gene identification on a large scale.
- such procedure is laborious, expensive, time consuming and not suitable for high throughput analysis on a genomic scale.
- RNA silencing in plant first was found as a virus resistance as early as 1928 (Wingard, 1928). Wingard described tobacco plants infected with tobacco ringspot virus. The upper leaves had become immune to the virus and consequently were asymptomatic and resistant to secondary infection (Wingard, 1928). Cross protection is therefore widely-used to artificial intervention severe strain virus infection after pre- treated crops with a mild strain in all over the world (Prins et al., 2008). Good examples of diseases control by cross protection were successfully in citrus tristeza and barley yellow dwarf, respectively (Prins et al., 2008).
- dsRNA virus-related small interfering RNAs
- the dsRN A may be formed by annealing of overlapping
- Virus-induced gene silencing for plant gene (VIGS) (Ruiz et al., 1998; Burch-Smith et al., 2004) offers an attractive alternative as it allows the investigation of gene functions without plant transformation in plant gene functional analysis.
- Recombinant viruses can be constructed carrying an inserted partial sequence of a candidate gene. Such recombinant viruses can move systemically in plants, producing dsRNA (further siRNA) including the inserted fragment of candidate gene that can mediate degradation of the endogenous gene transcripts (Brigneti et al., 2004; Burch-Smith et al., 2004), resulting in silencing of the candidate gene expression in inoculated plants.
- VIGS can be used as an efficient reverse genetics tool for gene/gene family knock-down in a rapid and high-throughout fashion (Nasir et al., 2005). Because the knock-down phenotype is transient and reversible, this method can be used to access functions of genes whose deficiency may cause embryo lethality (Burch-Smith et al., 2004).
- VIGS has been shown to function in different organs, such as leaves (Liu et al., 2002; Burch-Smith et al., 2006), roots (Valentine et al., 2004; Bhattarai et al., 2007), flowers (Liu et al., 2004; Chen et al., 2005) and even fruits (Fu et al., 2005).
- VIGS systems have been successfully applied to assay for gene functions in plants such as Tobacco Rattle Virus in tobacco (Ratcliff et al., 2001), pepper (Chung et al., 2004), tomato (Liu et al., 2002), Jatropha (US Provisional Patent Application No. 61/143,484), cotton (US Provisional Patent Application No.
- Yamagishi and Yoshikawa, 2009 Bean pod mottle virus in soybean (Zhang and Ghabrial, 2006); Pea early browning virus in Pisum sativum (Constantin et al., 2008), Medicago truncatula and Lathyrus odoratus (Granlund, et al., 2008); plant DNA virus such as Beet curly top virus (Golenberg et al., 2009) and Tomato yellow leaf curl China virus (Huang et al., 2009). For a general review, see Unver and Budak (2009).
- the present invention relates to the field of controlling pests, such as insects, using a virus to express pest genes in hosts. More specifically, the present invention relates to a method for rapidly screening for pest genes which can lead to mortality of the pest when the pest has ingested host tissues expressing virus-linked pest gene sequences. The present invention also relates to a method for controlling pests by viral expression of target pest sequences to modify endogenous expression of pest genes in cells or tissues of the pest.
- the present invention provides a method of screening pest genes to identify pest genes which can lead to mortality of the pest when expression of the pest gene is silenced in the pest.
- the method comprises:
- pest toxicity identifies the pest gene as a pest gene that leads to mortality of the pest when the pest gene expression is silenced in the pest.
- the pest is an insect.
- the host is a plant.
- the VIGS vector is derived from a virus that can infect a desired host, such as a plant.
- the modified VIGS vector comprises a single vector that includes the nucleic acid.
- the VIGS vector comprises two vectors, one of which is modified to include the nucleic acid.
- the virus is a DNA virus. In other embodiments, the virus is an RNA virus.
- the host such as a plant, is inoculated with the modified VIGS vector by inoculation with virus particles.
- the host is inoculated by Agrobacterium infiltration, such as by syringe infiltration or vacuum infiltration or agro-drench or other inoculation methods to generate virus particles through agrobacterium infection as an intermediate step.
- the host is inoculated by particle bombardment.
- the host is inoculated by vector transmission, such as by Bacteria, Fungi, Nematodes, Arthropods and Arachnids.
- the host is inoculated by mechanical transmission or by other natural methods of transmission.
- the RNA is double stranded RNA (dsRNA).
- the RNA is small interfering RNA (siRNA), which may be in the form of a short hairpin RNA (shRNA).
- shRNA short hairpin RNA
- the RNA is single stranded RNA (ssRNA).
- the RNA may be produced in the host from the modified VIGS vector as described herein.
- the present invention provides a method of controlling pests by viral expression of target pest sequences in a host to modify endogenous expression of pest genes in cells or tissues of the pest.
- the method comprises: [0024] (a) inserting a nucleic acid comprising a sequence of a desired pest gene to be silenced, in the sense or antisense orientation or as an inverted repeat, into a virus- induced gene silencing (VIGS) vector of a virus that can infect a desired host to produce a modified VIGS vector;
- VIPGS virus- induced gene silencing
- RNA causes gene silencing in the pest upon ingestion of the RNA produced in the host, whereby pests are controlled.
- the pest is an insect.
- the host is a plant.
- the VIGS vector is derived from a virus that can infect a desired host, such as a plant.
- the modified VIGS vector comprises a single vector that includes the nucleic acid.
- the VIGS vector comprises two vectors, one of which is modified to include the nucleic acid.
- the virus is a DNA virus.
- the virus is an RNA virus.
- the host such as a plant, is inoculated with the modified VIGS vector by inoculation with virus particles.
- the host is inoculated by Agrobacterium infiltration, such as by syringe infiltration or vacuum infiltration.
- the host is inoculated by particle bombardment.
- the host is inoculated by vector transmission, such as by Bacteria, Fungi, Nematodes, Arthropods and Arachnids.
- the host is inoculated by mechanical transmission or by other natural methods of transmission.
- the RNA is double stranded RNA (dsRN A).
- the RNA is small interfering RNA (siRNA), which may be in the form of a short hairpin RNA (shRNA).
- the RNA is single stranded RNA (ssRNA). The RNA may be produced in the host from the modified VIGS vector as described herein.
- the present invention uses a recombinant plant virus RNA sequence expressed in host plants to effect heterologous silencing in insect pests which ingest these RNA sequences.
- the invention is not restricted to the use of any single virus, such as TRV, but also includes the use of any plant DNA or RNA virus as described hereing, (e.g., Geminivirus, BSMV, BMV, PVX, CMV, etc) in those crops (such as monocot plants, including rice, wheat, barley, maize, etc. and dicot plants including cotton, Jatropha, tobacco, tomato, potato, soybean etc.) and other plants which may be infected by plant viruses.
- any plant DNA or RNA virus as described hereing, (e.g., Geminivirus, BSMV, BMV, PVX, CMV, etc) in those crops (such as monocot plants, including rice, wheat, barley, maize, etc. and dicot plants including cotton, Jatropha, tobacco, tomato, potato, soybean etc.) and other plants which may be infected
- non-pathogenic, attenuated strains of microorganisms may be used as a carrier for the insect control agents and, in this perspective, the microorganisms carrying such agents are also referred to as insect control agents.
- the microorganisms may be engineered to express a recombinant plant virus nucleotide sequence with an insect target gene to produce RNA molecules comprising RNA sequences homologous or complementary to RNA sequences typically found within the cells of an insect. Exposure of the insects to the microorganisms result in ingestion of the microorganisms and down-regulation of expression of target genes mediated directly or indirectly by the RNA molecules or fragments or derivatives thereof.
- mild strains of viruses which do not elicit any symptoms on host plants but can protect the hosts from subsequent infection by a severe virus strain.
- Such mild virus strains which are said to be attenuated and can confer cross protection have been used in field experiments in several countries for virus resistance.
- These mild strains usually produce a weak suppressor of gene silencing so that viral RNAs are not completely degraded by the host machinery.
- the present invention utilizes a synthetic TRV to demonstate that a mild strain of TRV infection induces no obvious morphological phentoypes in cotton and weak phenotypes in tobacco.
- the present invention utilizes recombinant virus to produce pest sequences in host plants by inoculation with virus particles.
- the host is inoculated by Agrobacterium infiltration, such as by sprayer inoculation, syringe infiltration or vacuum infiltration, or agro- drench or other inoculation methods to generate virus particles through agrobacterium infection as an intermediate step.
- the host is inoculated by particle bombardment.
- the host is inoculated by vector transmission, such as by Bacteria, Fungi, Nematodes, Arthropods and Arachnids.
- the host is inoculated by mechanical transmission or by other natural methods of transmission.
- recombinant virus RNA embedded with target insect gene can be in vitro transcribed and were further used to infected plants to confer plants with insect resistance.
- a transgenic event that produces recombinant virus provides protection from invertebrate pest infestation that is within the preferred effectiveness range against a target pest.
- it is well known to the skilled artisan that there are situations where it is advantageous to have such transgenic events within the preferred range of effectiveness.
- compositions of the present invention can be incorporated within the seeds of a plant species either as a product of expression from a recombinant gene incorporated into a genome of the plant cells, or incorporated into a coating or seed treatment that is applied to the seed before planting.
- the plant cell containing a recombinant gene is considered herein to be a transgenic event.
- the present invention also includes seeds and plants having more that one transgenic event. Such combinations are referred to as "stacked" transgenic events. These stacked transgenic events can be events that are directed at the same target pest, or they can be directed at different target pests.
- a seed having the ability to express a Cry 3 protein or insecticidal variant thereof also has the ability to express at least one other insecticidal agent including but not limited to a protein that is different from a Cry3 protein and/or an RNA molecule the sequence of which is derived from the sequence of an recombinant virus RNA expressed in a target plant and that forms silencing upon expressing in the seed or cells of a plant grown from the seed, wherein the ingestion of one or more cells of the plant by the target pest results in the suppression of expression of the RNA in the cells of the target pest.
- Figure 1 illustrates a rapid recombinant virus method to screen for insect genes which can lead to mortality when expression is silenced.
- Figure 2 illustrates a transient VIGS method for controlling insects in accordance with one embodiment of the present invention.
- Figure 3 shows sTRV-mediated silencing of cotton bollworm (CBM) genes and control of insect infestation on cotton. Numbers represent mean relative values average mortality after 13 day-feeding with systemic leaves of plants treated with various sTRV vectors from at least 3 independent experiments with standard error. For each feeding experiment, synchronous larvae (2-3 instar) were selected, weighed individually and divided into groups; each group contained 6-18 individuals.
- CBM cotton bollworm
- Figure 4 shows sTRV-mediated silencing of CBM genes and control of insect infestation on N. benthamiana. Numbers represent mean relative values average mortality after 13 day-feeding with systemic leaves of plants treated with various sTRV vectors from at least 3 independent experiments with standard error. For each feeding experiment, synchronous larvae (2-3 instar) were selected, weighed individually and divided into groups; each group contained 6-18 individuals.
- Figure 5 shows sTRV-mediated silencing of CBM genes and control of insect infestation by sense, antisense and hairpin RNA structure on cotton. Numbers represent mean relative values average mortality after 13 day-feeding with systemic leaves of plants treated with various sTRV vectors.
- Figure 6 shows sTRV-mediated silencing of CBM genes and control of insect infestation by sense, antisense and hairpin RNA structure on N. benthamiana. Numbers represent mean relative values average mortality after 13 day-feeding with systemic leaves of plants treated with various sTRV vectors.
- the present invention relates to the field of controlling pests, such as insects, using a virus to express pest genes in hosts. More specifically, the present invention relates to a method for rapidly screening for pest genes which can lead to mortality of the pest when the pest has ingested host tissues expressing virus-linked pest gene sequences. The present invention also relates to a method for controlling pests by viral expression of target pest sequences to modify endogenous expression of pest genes in cells or tissues of the pest.
- the present invention utilizes recombinant DNA technologies to silence or inhibit expression of a target sequences in the cell of a pest, by feeding to the pest one or more viral RNA sequences carrying (a) a portion (part) of a target coding sequence, (b) a portion of a target 5' UTR sequence, (c) a portion of a target 3' UTR sequence, (d) a protion of a target 5' UTR and a portion of a target coding sequence or (e) a portion of a target coding sequence and a portion of a target 4' UTR sequence in (i) sense, (ii) antisense, or (iii) hairpin double stranded structure, thereby controlling the pest.
- the length of the target sequences is in the range of about 50 nucleotides to about 2000 nucleotides and higher. In another embodiment, the length of the target sequences is in the range of about 150 to about 1500 nucleotides. In a further embodiment, the length of the target sequences is about 200 to about 1200 nucleotides. In another embodiment, the length of the target sequences is about 300 to about 1000 nucleotides. In a further embodiment, the length of the target sequences is about 300 to about 800 nucleotides. It is preferred to use a length of the target sequences of about 300 to about 1000 nucleotides.
- compositions containing the RNA nucleotide sequences of the present invention for use in topical applications onto plants or onto animals or into the environment of an animal to achieve the elimination or reduction of a pest is also described.
- the present invention also utilizes a virus as an expression vector to transiently transcribe RNA in order to quickly evaluate one or more nucleic acid molecules and recombinant DNA sequences for controlling pests. Using this method, several insect genes that can lead to mortality when silenced are also described.
- the present invention relates to the use of heterologous virus-induced gene silencing (VIGS) to evaluate genes or target sequences in killing insects reliably and rapidly, and in a high-throughput manner.
- VIPGS heterologous virus-induced gene silencing
- the present invention provides an efficient and reproducible system and procedure for VIGS in insect.
- the present invention provides for the co-silencing of two genes to enhance the efficiency of controlling insects.
- the present invention comprises a method of inhibiting expression of a target gene in an invertebrate pest. Inhibition of expression is also referred to herein as gene silencing. Specifically, the present invention comprises a method of modulating or inhibiting expression of one or more target genes in an invertebrate pest, such as an insect, that cause cessation of feeding, growth, development, reproduction and infectivity and eventually result in the death of the pest. Briefly, this method involves the expression in a host, such as a host plant, of a pest-related sequence contained within a viral RNA sequence (dsRNA or siRNA specific for a pest target sequence).
- dsRNA or siRNA specific for a pest target sequence a viral RNA sequence
- the pest RNA sequence (dsRNA or siRNA) is produced as a result of the replication of a virus containing a nucleic acid comprising a pest target sequence.
- dsRNA or siRNA the pest RNA sequence linked to the viral RNA (dsRNA or siRNA) will accumulate in systemic leaves.
- the host plant can be inoculated by agrobacterium infiltration (such as syringe infiltration or vacuum infiltration), particle bombardment, virus particles directly, vector transmission (such as Bacteria, Fungi, Nematodes, Arthropods and Arachnids), mechanical transmission (such as rubbing virus-containing preparations into the plant parts such as leaves) or other natural methods of transmission.
- agrobacterium infiltration such as syringe infiltration or vacuum infiltration
- particle bombardment such as Bacteria, Fungi, Nematodes, Arthropods and Arachnids
- mechanical transmission such as rubbing virus-containing preparations into the plant parts such as leaves
- the method comprises introduction of recombinant virus carrying pest sequences (expressed dsRNA or its modified forms such as small interfering RNAs (siRNA)) sequences, into the cells or into the extracellular environment of a pest, such as the midgut of an insect, within an invertebrate pest body wherein the viral RNA-pest sequences (dsRNA or siRNA) enters the cells and inhibits expression of at least one or more target genes and wherein inhibition of the one or more target genes causes cessation of feeding, growth, development, reproduction and infectivity and eventually results in the death of the invertebrate pest.
- dsRNA or siRNA the viral RNA-pest sequences
- the methods and compositions of the present will be useful in rapid screening genes useful for limiting or eliminating invertebrate pest infestation in or on any pest host plants, which is also a plant virus host.
- the present invention also relates to a method that, instead of using dsRNA, uses single stranded RNA (ssRNA) (in sense or antisense orientation) in the virus.
- ssRNA single stranded RNA
- the exact mechanism is not known, it is possible, because of the plant virus, that the ssRNA can have q. replication intermediate or a secondary-structure
- RNA silencing in plants can be derived directly from the ssRNA of viral genome or via the action of host-encoded RNA-dependent RNA polymerases (RDRs) to mediate degradation of homologous RNA sequences including the virus genome.
- RDRs host-encoded RNA-dependent RNA polymerases
- the present invention provides a method of screening pest genes to identify pest genes which can lead to mortality of the pest when expression of the pest gene is silenced in the pest.
- a method in accordance with one embodiment of this aspect of the present invention is shown in Figure 1. In accordance with this aspect, the method comprises:
- RNA is toxic to the pest
- pest toxicity identifies the pest gene as a pest gene that leads to mortality of the pest when the pest gene expression is silenced in the pest.
- the RNA is double stranded RNA (dsRNA).
- the RNA is small interfering RNA (siRNA), which may be in the form of a short hairpin RNA (shRNA).
- the RNA is single stranded RNA (ssRNA).
- the RNA may be produced in the host from the modified VIGS vector as described herein. In this aspect of the invention, it is preferred that the RNA is dsRNA.
- the pest is an insect.
- the host is a plant.
- the VIGS vector is derived from a virus that can infect a desired host, such as a plant.
- the modified VIGS vector comprises a single vector that includes the nucleic acid.
- the VIGS vector comprises two vectors, one of which is modified to include the nucleic acid.
- the virus is a DNA virus.
- the virus is an RNA virus.
- the host such as a plant, is inoculated with the modified VIGS vector by inoculation with virus particles.
- the host is inoculated by Agrobacterium infiltration, such as by syringe infiltration or vacuum infiltration.
- the host is inoculated by particle bombardment.
- the host is inoculated by vector transmission, such as by Bacteria, Fungi, Nematodes, Arthropods and Arachnids.
- the host is inoculated by mechanical transmission, such as by rubbing virus containing preparations into host tissue or by other natural methods of transmission.
- Potential pest genes for screening include those that encode an essential protein, such as one involved in development regulation, physiological or metabolic aspects of the pest.
- the predicted function of potential pest genes can be selected from the group consisting metabolic pathways such as energy metabolism and detoxification protein, organ or tissue differentiation and development regulation including small RNA biosynthesis, molting processing, and cytoskeleton protein.
- the present invention provides a method of controlling pests by viral expression of target pest sequences in a host to modify endogenous expression of pest genes in cells or tissues of the pest.
- a method in accordance with one embodiment of this aspect of the present invention is shown in Figure 2. In accordance with this aspect, the method comprises:
- RNA causes gene silencing in the pest upon ingestion of the dsRNA produced in the host, whereby pests are controlled.
- the pest is an insect.
- the host is a plant.
- the VIGS vector is derived from a virus that can infect a desired host, such as a plant.
- the modified VIGS vector comprises a single vector that includes the nucleic acid.
- the VIGS vector comprises two vectors, one of which is modified to include the nucleic acid.
- the virus is a DNA virus.
- the virus is an RNA virus.
- the host such as a plant, is inoculated with the modified VIGS vector by inoculation with virus particles.
- the host is inoculated by Agrobacterium infiltration, such as by syringe infiltration or vacuum infiltration.
- the host is inoculated by particle bombardment.
- the host is inoculated by vector transmission, such as by Bacteria, Fungi, Nematodes, Arthropods and Arachnids.
- the host is inoculated by mechanical transmission, such as by rubbing virus containing preparations into host tissue or by other natural methods of transmission.
- the pest target gene is as described above.
- the RNA is double stranded RNA (dsRNA).
- the RNA is small interfering RNA (siRNA), which may be in the form of a short hairpin RNA (shRNA).
- shRNA short hairpin RNA
- the RNA is single stranded RNA (ssRNA).
- the RNA may be produced in the host from the modified VIGS vector as described herein.
- the present invention uses a recombinant plant virus RNA sequence expressed in host plants to effect heterologous silencing in insect pests which ingest these RNA sequences.
- the invention is not restricted to the use of any single virus, such as TRV, but also includes the use of any plant DNA or RNA virus as described hereing, (e.g., Geminivirus, BSMV, BMV, PVX, CMV, etc) in those crops (such as monocot plants, including rice, wheat, barley, maize, etc. and dicot plants including cotton, Jatropha, tobacco, tomato, potato, soybean etc.) and other plants which may be infected by plant viruses.
- any plant DNA or RNA virus as described hereing, (e.g., Geminivirus, BSMV, BMV, PVX, CMV, etc) in those crops (such as monocot plants, including rice, wheat, barley, maize, etc. and dicot plants including cotton, Jatropha, tobacco, tomato, potato, soybean etc.) and other plants which may be infected
- non-pathogenic, attenuated strains of microorganisms may be used as a carrier for the insect control agents and, in this perspective, the microorganisms carrying such agents are also referred to as insect control agents.
- the microorganisms may be engineered to express a recombinant plant virus nucleotide sequence with an insect target gene to produce RNA molecules comprising RNA sequences homologous or complementary to RNA sequences typically found within the cells of an insect. Exposure of the insects to the microorganisms result in ingestion of the microorganisms and down-regulation of expression of target genes mediated directly or indirectly by the RNA molecules or fragments or derivatives thereof.
- mild strains of viruses which do not elicit any symptoms on host plants but can protect the hosts from subsequent infection by a severe virus strain.
- Such mild virus strains which are said to be attenuated and can confer cross protection have been used in field experiments in several countries for virus resistance.
- These mild strains usually produce a weak suppressor of gene silencing so that viral RNAs are not completely degraded by the host machinery.
- the present invention utilizes a synthetic TRV to demonstate that a mild strain of TRV infection induces no obvious morphological phentoypes in cotton and weak phenotypes in tobacco.
- the present invention utilizes recombinant virus to produce pest sequences in host plants by inoculation with virus particles.
- the host is inoculated by Agrobacterium infiltration, such as by sprayer inoculation, syringe infiltration or vacuum infiltration, or agro- drench or other inoculation methods to generate virus particles through agrobacterium infection as an intermediate step.
- the host is inoculated by particle bombardment.
- the host is inoculated by vector transmission, such as by Bacteria, Fungi, Nematodes, Arthropods and Arachnids.
- the host is inoculated by mechanical transmission or by other natural methods of transmission.
- recombinant virus RNA embedded with target insect gene can be in vitro transcribed and were further used to infected plants to confer plants with insect resistance.
- a transgenic event that produces recombinant virus provides protection from invertebrate pest infestation that is within the preferred effectiveness range against a target pest.
- it is well known to the skilled artisan that there are situations where it is advantageous to have such transgenic events within the preferred range of effectiveness.
- the VIGS vector is a tobacco rattle virus (TRV).
- the nucleic acid is inserted to a TRV RNA2 sequence to produce a modified TRV RNA2 vector.
- TRV RNA2 A mixed Agrobacterium culture of Agrobacterium containing a TRV RNAl vector and Agrobacterium containing the modified TRV RNA2 vector is prepared and used to inoculate the host plant.
- the vector comprising TRV RNA2 and the vector comprising TRV RNAl are synthetic plant vectors.
- the sequence of the first desired gene is the sequence of a sense strand of the gene.
- the sequence of the first desired gene is the sequence of an antisense strand of the gene.
- sequence of the first desired gene is the sequence of hairpin structure of the gene.
- nucleic acid further comprises a sequence of a ( second desired gene to be silenced.
- the second desired gene is host plant virus resistance gene.
- the plant virus resistance gene is selected from the group consisting of RNase III Dicer-like 4 (DCL4) gene, RNase III Dicer-like 2 (DCL2) gene, RNase III Dicer-like 3 (DCL3) gene, ARGONA UTE1 ⁇ AGOl), ARGONA UTE71 ⁇ AG07), RNA-dependent RNA polymerase 1 (RDR1), RNA-dependent RNA polymerase 6 (RDR6), Suppressor of gene silencing 1 (SGS1), Suppressor of gene silencing 3 ⁇ SGS3), and Silencing defective 3 (SDE3).
- the second desired gene is insect small RNA biosynthesis gene.
- the small RNA biosynthesis gene is selected from the group consisting of Dicer-1 (DCR1) gene, Pasha gene, Loquacious gene
- ARGONA UTE1 gene ⁇ AGOl
- ARGONA UTE2 gene ⁇ AG02
- ARGONA UTE3 gene ⁇ AGO 3
- Piwi gene Stellate gene
- Aubergine gene Aub
- the nucleic acid comprises sequences of more than two desired genes to be silenced.
- the present invention relates to a method of inhibiting expression of a target gene in an invertebrate pest.
- the present invention comprises a method of modulating or inhibiting expression of one or more target genes in an invertebrate pest that cause cessation of feeding, growth, development, reproduction and infectivity and eventually result in the death of the insect.
- the method comprises introduction of virus expressed partial single-stranded RNA (ssRNA) or its modified forms such as small interfering RNAs (siRNA) sequences, into the cells or into the extracellular environment, such as the midgut, within an invertebrate pest body wherein the dsRNA or siRNA enters the cells and inhibits expression of at least one or more target genes and wherein inhibition of the one or more target genes exerts a deleterious effect upon the invertebrates pest.
- ssRNA virus expressed partial single-stranded RNA
- siRNA small interfering RNAs
- the present invention is useful in rapidly screening genes to identify those useful for limiting or eliminating invertebrate pest infestation in or on any host, such as a plant.
- the present invention is illustrated herein with reference to cotton bollworm
- the present invention is also illustrated using cotton or tobacco as the host plant. However, it is understood that the invention is applicable to any host plant, such as those disclosed herein.
- the present invention is further illustrated using TRV as the VIGS system. However, it is understood that the invention can use any VIGS system, such as those disclosed herein.
- dsRNA virus-related small interfering RNAs
- dsRNA either derived from a replication intermediate or a secondary-structure characters of some single-stranded viral RNA region
- the dsRNA may be formed by annealing of overlapping complementary transcripts (Baulcombe, 2004).
- Virus-induced gene silencing (VIGS) (Ruiz et al, 1998; Burch-Smith et al, 2004) offers an attractive alternative as it allows the investigation of gene functions without plant transformation.
- Recombinant viruses can be constructed carrying an inserted partial sequence of a candidate gene.
- Such recombinant viruses can move systemically in plants, producing dsRNA (which can be modified to siRNA) including the inserted fragment of candidate gene that can mediate degradation of the endogenous gene transcripts (Brigneti et al, 2004; Burch-Smith et al, 2004), resulting in silencing of the candidate gene expression in inoculated plants.
- dsRNA which can be modified to siRNA
- the effects on endogenous gene expression can usually be assayed 1-2 weeks after virus infection.
- VIGS can be used as an efficient reverse genetics tool for gene/gene family knock-down in a rapid and high-throughout fashion (Nasir et al, 2005).
- this method can be used to access functions of genes whose deficiency may cause embryo lethality (Burch-Smith et al , 2004).
- VIGS has been shown to function in different organs, such as leaves (Liu et al, 2002; Burch-Smith et al, 2006), roots (Valentine et al, 2004; Bhattarai et al, 2007), flowers (Liu et al, 2004; Chen et al , 2005) and even fruits (Fu et al. , 2005).
- TRV VIGS system has been successfully applied to assay for gene functions in herbaceous plants, such as Tobacco Rattle Virus in tobacco (Ratcliff et al,
- TRV VIGS system has been successfully applied in some plants such as Arabidopsis (Burch-Smith et al., 2006), Capsicum annuum (Chung et al., 2004), Lycopersicon esculentum (Liu et al., 2002; Dinesh Kumar et al., 2007), Petunia hybrida (Chen et al., 2005), Nicotiana benthamian (Liu et al., 2002), Solarium tuberosum (Brigneti et al., 2004), Jatropha curcas (U.S. Provisional Patent Application No.
- VIGS systems that can be used in accordance with the present invention include, but are not limited to, Tobacco Rattle Virus in tobacco (Ratcliff et al., 2001), pepper (Chung et al., 2004), tomato (Liu et al., 2002), Jatropha (US Provisional Patent Application No. 61/143,484), cotton (US Provisional Patent Application No.
- Insects that may cause damage in plants generally belong to three categories based upon their methods of feeding and these three categories are, respectively, chewing, sucking and boring insects that belong to the Orders Coleoptera, Lepidoptera, Diptera, Orthoptera, Heteroptera, Ctenophalides, Arachnidiae, and Hymenoptera. It has been found that the present method is useful to protect seeds and plants against a wide array of agricultural insect pests.
- pests include but are not limited to: from the order Lepidoptera, for example, Acleris spp.,
- Adoxophyes spp. Aegeria spp., Agrotis spp., Alabama argillaceae, Amylois spp., Anticarsia gemmatalis, Archips spp, Argyrotaenia spp., Autographa spp., Busseola fusca, Cadra cautella, Carposina nipponensis, Chilo spp., Choristoneura spp., Clysia ambiguella, CnaphalocroCis spp..
- Lissorhoptrus spp. Melolontha spp., Oycaephilus spp., Otiorhynchus spp., Phlyctinus spp., Popillia spp., Psylliodes spp., Rhizopertha spp., Scarabeidae, Sitophilus spp., Sitotroga spp., Tenebrio spp., Tribolium spp. and Trogoderma spp.;
- Psocoptera for example, Liposcelis spp.
- Thysanoptera for example, Franklinella spp., Hercinothrips spp., Taeniothrips spp., Thrips palmi, Thrips tabaci and Scirtothrips aurantii;
- Quadraspidiotus spp. Rhopalosiphum spp., Saissetia spp., Scaphoideus spp., Schizaphis spp., Sitobion spp., Trialeurodes vaporariorum, Triozae treae and Unaspis cirri;
- Hymenoptera for example, Acromyrmex, Atta spp., Cephus spp., Diprion spp., Diprionidae, Gilpinia polytoma, Hoplocampa spp., Lasius spp., Monomorium pharaonis, Neodiprion spp, Solenopsis spp. and Vespa ssp.;
- Thysanura for example, Lepisma saccharina.
- compositions of the present invention can be incorporated within the seeds of a plant species either as a product of expression from a recombinant gene incorporated into a genome of the plant cells, or incorporated into a coating or seed treatment that is applied to the seed before planting.
- the plant cell containing a recombinant gene is considered herein to be a transgenic event.
- the present invention also includes seeds and plants having more that one transgenic event. Such combinations are referred to as "stacked" transgenic events. These stacked transgenic events can be events that are directed at the same target pest, or they can be directed at different target pests.
- a seed having the ability to express a Cry3 protein or insecticidal variant thereof also has the ability to express at least one other insecticidal agent including but not limited to a protein that is different from a Cry3 protein and/or an RNA molecule the sequence of which is derived from the sequence of an recombinant virus RNA expressed in a target plant and that forms silencing upon expressing in the seed or cells of a plant grown from the seed, wherein the ingestion of one or more cells of the plant by the target pest results in the suppression of expression of the RNA in the cells of the target pest.
- RNA Interference Technology From Basic Science to Drug Development, Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice, Wiley-VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts ofsiRNA Technology, DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology), Human Press, Totowa, NJ, 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application, CRC, 2004.
- Plant seedlings Tobacco (Nicotiana benthamiana) and cotton (Gossypium hirsutum L. cv. Coker 312) seeds were propagated in Singapore and were germinated in a greenhouse. Plants of tobacco and cotton were grown in presterilized soil at 25°C on a 16-h-day/8-h-night cycle. Tobacco seedlings with 3-5 true leaves were used for agroinjection and cotton seedlings with 2-3 true leaves were used for vacuum
- Cotton bollworm Cotton bollworm (Helicoverpa armigera) eggs were obtained from Chinese Academy of Agricultural Sciences and reared in the laboratory at 25 °C and 70% relative humidity on a 14-h-day/10-h-night cycle. The larvae were fed on a modified artificial diet as described. Leaves of tobacco plants (1-2 weeks post- agroinjection) or cotton plants (2-3 weeks post vaccum-infiltration) were used for feeding experiments. For each feeding experiment, synchronous larvae were selected, weighed individually and divided into groups; each group contained 6-12 individuals. After feeding on different diets for indicated days, larvae were weighed and death of each individual was recorded. Statistics of data was performed with student t-test in the Excel program.
- Synthetic TRVRNA1 expression vector Synthetic TRV1 vector full length (7756bp) sequence including: SphI site, T-DNA right border sequence (152bp), the duplicated cauliflower mosaic virus (CaMV) 35S enhancer region (752bp) (Shi et al., 1997) the TRV Ppk20 strain RNA1 (6791 bp), Subterranean Clover Mottle Virus satellite RNA ribozyme sequence (46bp) and Smal site sequence. This full length sequence was divided into two parts by an endogenous Sail site.
- the two parts were separately synthesized and cloned into pGH vector to give two vectors pGH-YeJ-Vl-1 and pGH-YeJ-Vl-2.
- the synthetic TRV RNA1 fragments, Vl-1, released from pGH- YeJ-Vl-1 by treatment with SphI and Sail enzymes, and VI -2, released from pGH-YeJ- VI -2 by treatment with Sail and Smal enzymes, were linked with the pBIN121 vector treated with SphI and EcoICRI enzymes.
- the new synthetic TRV RNAl vector was named psTRV 1001.
- the sequence of the synthetic psTRV 1001 is set forth in SEQ ID NO:l.
- the synthetic TRV RNAl sequence is the same as the published TRV RNAl sequence.
- Synthetic TRVRNA2 expression vector Synthetic TRV2 vector full length (2915bp) sequence including: Hindlll site, the duplicated cauliflower mosaic virus (CaMV) 35S enhancer region (752bp) (Shi et al., 1997) the TRV strain ppk20 RNA2 5'- sequence (1639bp), multiple cloning site (61bp), the TRV strain ppk20 RNA2 3'- sequence (396bp), Hpal site.
- the full length sequence was synthesized and cloned into pGH vector give pGH-YeJ-V2.
- the synthetic TRV RNA2 fragment V2 was linked into the pCAMBIA0390 by Hindlll and Hpal sites.
- the new synthetic TRV RNA2 vector was named psTRV2001.
- the sequence of the synthetic psTRV2002 is set forth in SEQ ID NO:2.
- Gene cloning and vector construction Gene sequences of three genes HaGSTl, HaCHT, HaCYP6AE14, were obtained from the GenBank. Another four genes were cloned by PCR using designed primers of conserved regions shared by homologous gene sequences of Drosophila melanogaster (HaDCRl, HaCG4572, HaTub and HaVATP) or plant (NbDCL4). For single gene VIGS, all candidate genes were amplified by PCR from cDNA products of H. armigera (CBM) whole body samples, and cloned into the Xbal and BamHI sites of the synthetic vector psTRV2001.
- CBM H. armigera
- cDNA fragment of the second gene was inserted into Kpnl and Xhol sites of the vector.
- the primers used in cloning the genes are set forth in Table 1, which also includes reference to the sequence of the cloned gene.
- Jatropha curcin gene encoded for Jatropha-specific toxin, was used as a non-insect sequence control in CBM larval feeding experiments (U.S. Provisional Patent Application No. 61/143,484, filed on 9 January 2009; International Patent Application No. PCT/SG2009/000481 filed on 16 December 2009 and published as WO 2010/080071).
- DCS ⁇ -cadinene synthase gene
- Antisense and hairpin structure construction Antisense sequence of HaTub, which is set forth as SEQ ID NO:29, was PCR-amplifed using designed primers as set forth in SEQ ID NO:27 and SEQ ID NO:28 (see Table 1) when the psTRV2:Hat «6 plasmid as template. The amplified PCR product was further cloned into the Xbal and BamHI sites of the synthetic vector psTRV2001.
- sense fragment was amplifed by PCR with PCR primers set forth as SEQ ID NO:30 and SEQ ID NO:31 (see Table 1 ) and further cloned into the BamHI and EcoRI sites of pSK-intron (Guo et al., 2003), followed insertion of the antisense fragment amplified with PCR primers set forth as SEQ ID NO:32 and SEQ ID NO:33 (see Table 1).
- the hpHatub hairpin structure was subcloned into the BamHI and Xhol sites of psTRV2001 to give psTRY hpHaTub.
- HaCYP6A F aatatctagacctccgcgaagatgaagaacatgttcc (3) 859 bp (5) E14 R: ctccggatccgggaagaactccggg (4) GenBank:
- HaVATP F ggaatctagacgacgctgggtatcgtgcaa (6) 763 bp (8)
- HaTub F ataattctagacaagcctcttacccggtcgcgc (9) 506 bp (11)
- HaCG457 F ctatggtacccagttcttctggtactttccygc (12) 1075 bp (14) 2 R: ccatctcgagccatgtgtcccgcgttcctgaccatgayctccac (13)
- HaCHTl F aaaatctagacctgctccgtacaccaatgctactg (15) 693 bp (17)
- HaDCRl F caatggtaccgtgccgaaggtcctcagcgacatattcga (18) 330 bp (20)
- NbDCL4 F acatggtaccaagaaaacaattgctgatatagttga (21) 395 bp (23)
- HaGSTl F aatatctagaggcacgaagggcgaatcaca (24) 641 bp (26)
- HaAnti-tub F ctagtctagaagtgcctcaccgaaggagtggaag (27) 506 bp (29)
- RNA extraction and cDNA synthesis 100 mg leaf or CBM tissues was ground in liquid N2 and extracted with Trizol (Invitrogen). Reverse transcription (RT) reactions were performed to get cDNA as described (Qu et al., 2007).
- Agrobacterium infiltration Synthetic psTRVl, psTRV2 vectors and its derivatives were introduced into Agrobacterium strain AGL1 by electroporation. A 3 ml culture was grown for 24 hr at 28° C in 50 mg/L kanamycin and 25 mg/L rifarnpicin. On the following day, the culture was inoculated into LB medium containing 50 mg/L kanamycin, 10 mM acid (MES) and 20 ⁇
- MES mM acid
- acetosyringone and grown overnight in a 28° C shaker.
- Agrobacterial cells were collected by centrifugation and resuspended in MMA solution (10 mM MES, 10 mM MgCl 2 , 200 ⁇ acetosyringone) to a final OD 600 of 1.5.
- the agrobacterial suspension was left at room temperature for 3-4hr without shaking. Before infiltration,
- Agrobacterium culture containing the psTRVl or psTRV2 vectors was mixed in a 1:1 ratio.
- Tobacco plants were infiltrated with cultures by syringe infiltration.
- agrobacterial-inocula were delivered into the underside of three or four youngest fully-expanded leaf using a 1 ml needleless syringe.
- whole plants were submerged into agrobacterial-inocula and subjected to 80-90 kPa vacuum for 2 min, and then quickly releasing the vacuum, letting the inoculum rapidly enter pl ⁇ nt tissues.
- excess agrobacterial cell suspension was used to drench the root system of infiltrated plants. Infiltrated plants were grown in a growth chamber at 25° C with 16 hr light/8 hr dark photoperiod cycle.
- This example illustrates the identification of nucleotide sequences that, when inserted into the VIGS vector to produce recombinant virus replicating in the host plants, which can be a diet of a cotton bollworm (CBM), are useful for controlling a CBM species insect pest.
- CBM cotton bollworm
- This example shows that the VIGS system can be used to rapidly screen for genes useful for controlling insects with RNAi technology.
- Insect P450 monooxygenases play a central role in adaptation to plant defense compounds arid in developing insecticide resistance.
- Cotton bollworm requires an elevated level of a gossypol-induced cytochrome P450 (HaCYP6AE14) to detoxify gossypol when they grow on cotton, downregulation of HaCYP6AE14 might reduce larval tolerance of gossypol if larvae are fed plant material that expresses VIGS vector against a target of interest.
- HaCYP6AE14 gossypol-induced cytochrome P450
- a CYP6AE14 gene coding sequence derived from GenBank was used to construct a nucleotide sequence encoding in a single strand inserted VIGS vector.
- a 859 bp coding sequence as set forth in SEQ ID NO:5 encoding a part of a CYP6AE14 sequence was used to construct a primer pair for use in a thermal amplification reaction using CBM cDNA product generated as Example 1.
- the primer pair as set forth at SEQ ID NO: 3 and SEQ ID NO:4 enabled the amplification of a double stranded coding sequence DNA amplicon, one strand of which exhibited the sequence as set forth in SEQ ID NO:5.
- SEQ ID NO:3 and SEQ ID NO:4 correspond respectively to forward and reverse genome amplification primers for use in producing a fragment from cotton bollworm cDNA product.
- DNA fragment sequence as set forth in SEQ ID NO: 5 was inserted into psTRV2 in the sense orientation to give psTRY2 HaCYP6AE14.
- a mixture of Agrobacterium cultures containing psTRVl with psTRV2 • JcCurcin (as a non-insect sequence control) or ps TKV2:GhDCS (see Example 1 as a positive control) or psTRV2:HaCYP6AE14 vector was vacuum infiltrated into 2-3 true leaf cotton plants.
- sTKV:GhDCS whose include a cotton ⁇ -cadinene synthase gene (DCS), an enzyme important for biosynthesis of insect inhibitory toxic phytochemicals gossypol.
- DCS cotton ⁇ -cadinene synthase gene
- This example illustrates the identification of nucleotide sequences that, when inserted into the VIGS vector produces recombinant virus replicating in the host plants, which can be a diet of a cotton bollworm, are useful for controlling a cotton bollworm species insect pest.
- V-ATPase vacuolar H + -ATPase
- the vacuolar H + -ATPase (V-ATPase) is one of the most fundamental enzymes in nature. It functions in maintaining sufficient levels of ATP in almost every eukaryotic cell and energizes a wide variety of organelles and membranes. Null mutations in genes encoding V-ATPase subunits are likely to be lethal for most eukaryotic cells because primary energization of the vacuolar system by this enzyme drives vital secondary transport processes across membranes of vacuolar- derived organelles. Disruption of genes encoding V-ATPase subunits in Drosophila is also lethal. Therefore, V-ATPase may be a useful target for VIGS mediated inhibition of insect.
- V-ATPase is consisting of several subunits.
- Subunit A the 68-kDa subunit A binds ATP and catalyzes its hydrolysis.
- VATPase gene in insect growth we first cloned putative V-ATPase subunit A cotton bollworm gene homologue.
- Cotton bollworm EST sequences BU038734 and EE399876 showed significant homology to hornworm V-ATPase catalytic subunit A. Based on this information, we got a contig with 896 bp encoded C terminal domain cotton bollworm V-ATPase subunit A protein.
- the nucleotide sequence of putative cotton bollworm VATP-A gene was listed as SEQ ED NO:34.
- the nucleotide sequence analysis of HaVATP-A gene show 89.4% identity in coding region.
- Amino acid sequence analysis of cotton bollworm V-ATPase subunit A shows 86.3% identity and 93.9% similarity to hornworm VATPase subunit A gene.
- a VATP-A gene coding sequence was used to construct a nucleotide sequence encoding Ha VATP-A in a single strand inserted VIGS vector.
- a 763 bp coding sequence as set forth in SEQ ID NO: 8 encoding a part of a VATP-A sequence was used to construct a primer pair for use in a thermal amplification reaction using CBM cDNA product generated as in Example 1.
- the primer pair as set forth at SEQ ID NO: 6 and SEQ ID NO: 7 enabled the amplification of a double stranded coding sequence DNA amplicon, one strand of which exhibited the sequence as set forth in SEQ ID NO:8.
- SEQ ID NO:6 and SEQ ID NO:7 correspond respectively to forward and reverse genome amplification primers for use in producing a fragment from cotton bollworm cDNA product.
- DNA fragment sequence as set forth in SEQ ID NO:8 was inserted into psTRV2 in the sense orientation to give OsTRY2:HaVATP.
- a mixture of Agrobacterium cultures containing psTRVl with psTRV2 -JcCurcin (as a non-insect sequence control) or psTRV2: GhDCS (see Example 1 as a positive control) or psTKV2:HaVATP vector was vacuum infiltrated into 2-3 true leaf cotton plants or 5-6 true leaf tobacco plants.
- Chitin is a ⁇ (1 *4) homopolymer of N-acetylglucosamine and composes the insect exoskeletons. In insect, chitin supports the cuticles of the epidermis and trachea as well as the peritrophic matrices lining the gut epithelium. Insect growth and
- Chitinases are digestive enzymes that break down glycosidic bonds in chitin. Therefore, suppression of chitinase protein formation may be a useful target for VIGS mediated inhibition of insect.
- genes and cDNAs encoding insect chitinases have been identified and characterized from several lepidopteran, dipteran, and coleopteran insects. Even though only one (or occasionally two) chitinase gene had been previously identified in studies involving many insect species, database searches of fully sequenced genomes from Drosophila, Anopheles, and, more recently, Tribolium, have revealed that each of these insects has a rather large family of genes encoding chitinase and chitinase-like proteins with 16-23 members, depending on the species. With our rapid VIGS system in insect, we can quickly evaluate them and identify the gene's function individually.
- chitinase gene homologue In order to study the inhibitory role of chitinase gene silencing in insect growth, we cloned one chitinase gene homologue. We searched in GenBank and found at least 5 chitinase genes in the bollworm genome. We chose one chitinase gene (GenBank accession number: AY325496) as an example. This chitin gene full length cDNA sequence set forth in SEQ ID NO:35.
- a chitin gene coding sequence was used to construct a nucleotide sequence encoding in a single strand inserted VIGS vector.
- a 693 bp coding sequence as set forth in SEQ ID NO: 17 encoding a part of a chitin sequence was used to construct a primer pair for use in a thermal amplification reaction using CBM cDNA product generated as in Example 1.
- the primer pair as set forth at SEQ ID NO: 15 and SEQ ID NO: 16 enabled the amplification of a double stranded coding sequence DNA amplicon, one strand of which exhibited the sequence as set forth in SEQ ID NO: 17.
- SEQ ID NO: 15 and SEQ ID NO: 16 correspond respectively to forward and reverse genome
- amplification primers for use in producing a fragment from cotton bollworm cDNA product.
- DNA fragment sequence as set forth in SEQ ID NO: 17 was inserted into psTRV2 in the sense orientation to give psTRV2:HaCHT.
- a mixture of Agrobacterium cultures containing psTRVl with psTRV2 -JcCurcin (as a non-insect sequence control) or psTRV2: G ⁇ DCS (see Example 1 as a positive control) or psTRV2 :HaCHTl vector was vacuum infiltrated into 2-3 true leaf cotton plants or 5-6 true leaf tobacco plants.
- This example illustrates the identification of nucleotide sequences that, when inserted into the VIGS vector produces recombinant virus replicating in the host plants, which can be a diet of a cotton bollworm, are useful for controlling a cotton bollworm species insect pest.
- a glutathione-S-transferase GSTs catalyse the conjugation of reduced glutathione via a sulfhydryl group to electrophilic centers on a wide variety of substrates.
- This de-toxin activity may function as a transport protein to detoxify endogenous toxin to help insect survival in the living environment filled with phytoalexin. Therefore, suppression of this protein formation may be a useful target for VIGS mediated inhibition.
- We chose one GST1 gene (GenBank accession number: EF033109) as an example. This GST1 gene full length cDNA sequence set forth in SEQ ID NO:36.
- a GST1 gene coding sequence was used to construct a nucleotide sequence encoding in a single strand inserted VIGS vector.
- a 641 bp coding sequence as set forth in SEQ ID NO:26 encoding a part of a GST1 sequence was used to construct a primer pair for use in a thermal amplification reaction using CBM cDNA product generated as in Example 1.
- the primer pair as set forth at SEQ ID NO:24 and SEQ ID NO:25 enabled the amplification of a double stranded coding sequence DNA amplicon, one strand of which exhibited the sequence as set forth in SEQ ID NO:26.
- SEQ ID NO:24 and SEQ ID NO:25 correspond respectively to forward and reverse genome amplification primers for use in producing a fragment from cotton bollworm cDNA product.
- DNA fragment sequence as set forth in SEQ ID NO:26 was inserted into psTRV2 in the sense orientation to give psTRV2 HaGSTl .
- a mixture of Agrobacterium cultures containing psTRVl with psTRV2 JcCurcin (as a non-insect sequence control) or psTKV2:GhDCS (see Example 1 as a positive control) or psTKV2:HaGSTl vector was vacuum infiltrated into 2-3 true leaf cotton plants or 5-6 true leaf tobacco plants.
- This example illustrates the identification of nucleotide sequences that, when inserted into the VIGS vector produces recombinant virus replicating in the host plants, which can be a diet of a cotton bollworm, are useful for controlling a cotton bollworm species insect pest.
- the cytoskeleton is a cellular "scaffolding" or "skeleton" contained within the cytoplasm.
- Tubulin proteins are important structural components of many cellular structures in all eukaryote cells and principally in the formation of microtubules. Inhibition of microtubule formation in cells results in severe phenotypes, such as blocking cell division and.the like, leads to stopping growth. Therefore, suppression of tubulin protein formation may be a useful target for VIGS mediated inhibition.
- tubulin gene in insect growth, we first cloned its alpha-tubulin putative cotton bollworm gene homologue. We used the amino acid sequence of known domestic silkworm ⁇ Bombyx mori) alpha-tubulin
- Cotton bollworm EST clone BU038726 showed significant homology to Bmtub.
- the nucleotide sequence of putative cotton bollworm Hatub gene was 689 bp and listed as SEQ ID NO:37.
- the nucleotide sequence anlysis of Hatub gene shows 89.4% identity in the coding region of silkworm Bmtub.
- Amino acid sequence analysis of cotton bollworm Hatub shows 86.3% identity and 93.9% similarity with Bmtub.
- the amino acid of putative Hatub gene is set forth in SEQ ID NO:38.
- An alpha-tubulin coding sequence was used to construct a nucleotide sequence encoding in a single strand inserted VIGS vector.
- a 506 bp coding sequence as set forth in SEQ ED NO:l 1 including a 5' UTR and coding region encoding a partial alpha-tubulin protein was used to construct a primer pair for use in a thermal amplification reaction using CBM cDNA product generated as in Example 1.
- the primer pair as set forth at SEQ ID NO:9 and SEQ ID NO: 10 enabled the amplification of a double stranded sequence DNA amplicon, one strand of which exhibited the sequence as set forth in SEQ ID NO:l 1.
- SEQ ID NO:9 and SEQ ID NO: 10 correspond respectively to forward and reverse genome amplification primers for use in producing a fragment from cotton bollworm cDNA product.
- DNA fragment sequence as set forth in SEQ ID NO:l 1 was inserted into psTRV2 in the sense orientation to give psTRV2:Hatub.
- a mixture of Agrobacterium cultures containing psTRVl with psTRV2 -JcCurcin (as a non-insect sequence control) or psTRV2: GhDCS (see Example 1 as a positive control) or psTRV2:H «tw& vector was vaccum infiltrated into 2-3 true leaf cotton plants or 5-6 true leaf tobacco plants.
- This example illustrates the synergistic effects of providing in the diet of an invertebrate pest one or more pesticidally effective genes together with single ss-RNA sequences derived from the invertebrate pest.
- Example 6 As indicated in Example 6, providing feeding with plant materials infected with recombinant VIGS virus results in the inhibition of one or more biological functions in the pest and therefore functions to achieve a pesticidal effect, resulting in the mortality of the pest or some other measurable feature that reduces the ability of the pest to infest a particular environment or host.
- the addition of one or more other gene, each different from each other and each functioning to achieve its pesticidal effect by a means different from the different pathway in which the RNA functions to achieve its pesticidal effect may result in achieving an improvement in the level of pest control and would further decrease the likelihood that the pest would develop resistance to any one or more of the pesticidal agents or RNA's when used alone to achieve inhibition of the pest.
- smRNAs Small RNAs regulate processes as diverse as invertebrate development and differentiation.
- smRNAs Small RNAs
- RNA-silencing pathways require the genesis of 18- to 26-nt smRNAs from the cleavage of double-stranded RNA (dsRNA) or highly structured regions within single-stranded viral RNAs.
- MicroRNA is one important kind of smRNAs. miRNAs are naturally occurring triggers of the RNAi pathway and play an important role in gene regulation in many organisms.
- DCR1 Dicer-1
- DCR1 or its homologues in diverse organism is responsible for pre-microRNA to process into mature miRNA.
- DCR1 or its homolog is mutated or downregulated or misreguled, severe development defects, such as embryo-lethal and defects in ovule development in plants, and tumor in human being would result.
- We used the marker gene Hatub was used to examine this possibility.
- a DCR1 gene coding sequence was used to construct a nucleotide sequence encoding in a single strand inserted into an alpha-tubulin gene VIGS vector for co- silencing.
- a 330 bp coding sequence as set forth in SEQ ID NO:20 encoding a part of a DCR1 sequence was used to construct a primer pair for use in a thermal amplification reaction using CBM cDNA product generated as in Example 1.
- the primer pair as set forth at SEQ ID NO: 18 and SEQ ID NO: 19 enabled the amplification of a double stranded coding sequence DNA amplicon, one strand of which exhibited the sequence as set forth in SEQ ID NO:20.
- SEQ ID NO: 18 and SEQ ID NO: 19 correspond respectively to forward and reverse genome amplification primers for use in producing a fragment from cotton bollworm cDNA product.
- DNA fragment sequence as set forth in SEQ ID NO:20 was inserted into psTRV2:Hat «& in the sense orientation to give psTKV2 Hatub+HaDCR 1.
- This example illustrates the synergistic effects of providing in the diet of an invertebrate pest one or more pesticidally effective genes RNA sequences derived from the invertebrate pest together with silencing of plant host gene.
- Example 2 to Example 7 feeding with plant materials infected with recombinant VIGS virus results in the inhibition of one or more biological functions in the pest and therefore functions to achieve a pesticidal effect, resulting in the mortality of the pest or some other measurable feature that reduces the ability of the pest to infest a particular environment or host.
- RNA silencing is one of the natural plant defense mechanisms against virus infection. We hypothesized that the co-silencing of the host viral resistance system using VIGS should result in more efficient VIGS in insect.
- a current model for antiviral silencing in higher plants suggests that dsRNA replication intermediates of viral genomic RNAs or highly structured regions within single-stranded viral RNAs are first cleaved by RNase Ill-type Dicer-like 4 (DCL4) or alternatively by DCL2 to produce 21- or 22- nucleotide (nt) small interfering RNAs (siRNAs) (Baulcombe, 2004).
- DCL4 RNase Ill-type Dicer-like 4
- DCL2 21- or 22- nucleotide (nt) small interfering RNAs (siRNAs) (Baulcombe, 2004).
- nt 21- or 22- nucleotide small interfering RNAs
- TBLASTN Two EST, one tomato EST (GenBank Accesion number BF051638) and one common tobacco EST (GenBank Accesion number AM846087), encode protein sequences containing conseved ribonuclease III domain. PCR primers for N.
- benthamiana DCL4 gene cloning were designed to target the conserved region between these two EST sequences. PCR products were cloned by pGE -T-easy vector
- a 395 bp coding sequence as set forth in SEQ ID NO:23 encoding a part of a NbDCL4 sequence was used to construct a primer pair for use in a thermal amplification reaction using N. benthamiana cDNA product generated as Example 1.
- the primer pair as set forth at SEQ ID NO:21 and SEQ ID NO:22 enabled the amplification of a double stranded coding sequence DNA amplicon, one strand of which exhibited the sequence as set forth in SEQ ID NO:39.
- SEQ ID NO:23 sequence to further find another EST sequence (GenBank Accession number: FM986783) from N. benthamiana cDNA sequence database.
- NbDCL4 One contig of NbDCL4 is as forth in SEQ ID NO:39.
- the NbDCL4 gene coding sequence was used to construct a nucleotide sequence encoding in a single strand inserted into an alpha-tubulin gene VIGS vector for co-silencing.
- DNA fragment sequence as set forth in SEQ ID NO:23 was inserted into psTRW2:Hatub in the sense orientation to give psTRY2:Hatub+NbDCL4 by Kpnl and Xhol sites.
- dsRNA is taken up in Drosophila S2 cells by an active pathway, involving receptor-mediated endocytosis. This pathway is also involved in the antiviral RNAi response against Drosophila C virus and Sindbis virus via a systemic spreading silencing signal that elicits protective RNAi-dependent immunity throughout the organism.
- This pathway in CBM is involved in the RNA-mediated insect controlling also, we selected one gene implicated with dsRNA uptaking and important for R Ai resistance to virus infection: CG4572 by VIGS system used in previous examples.
- a CG4572 gene coding sequence was used to construct a nucleotide sequence encoding in a single strand inserted into an alpha-tubulin gene VIGS vector for co- silencing.
- To amplify the CG4572 homolog from H. armigera we used the amino acid sequence of Drosophila melanogaster CG4572 protein sequence as seed sequence to search the GenBank insecta EST database using TBLASTN. Two ESTs from
- Heliconius melpomene (GE842295.1) and Heliothis virescens (EY122719.1) were found by this way and further used to design degenerated PCR primers to target conserved sequence motifs of CG4572 from different species of insect.
- a 1075 bp coding sequence as set forth in SEQ ID NO: 14 encoding a part of a CG4572 gene sequence was used to construct a primer pair for use in a thermal amplification reaction using cotton bollworm cDNA product generated as in Example 1.
- the primer pair as set forth at SEQ ID NO: 12 and SEQ ID NO: 13 enabled the amplification of a double stranded coding sequence DNA amplicon, one strand of which exhibited the sequence as set forth in SEQ ID NO: 14.
- SEQ ID NO: 12 and SEQ ID NO: 13 correspond respectively to forward and reverse genome amplification primers for use in producing a fragment from cotton bollworm cDNA product.
- DNA fragment sequence as set forth in SEQ ID NO: 14 was inserted into ipsTRY2:Hatub in the sense orientation to give psTKV2:Hatub+HaCG4572.
- a mixture of Agrobacterium cultures containing psTRVl with psTRV2 JcCurcin (as a non-insect sequence control) or psTRV2 :GhDCS (see Example 1 as a positive control) or psTRV2 :HaVATP vector or p TKV2:Hatub or psTRV2:Hatub+HaCG457> 2 was vacuum infiltrated into 2-3 true leaf cotton plants or 5- 6 true leaf tobacco plants. .
- This example illustrates the inhibitory effect of viral-expressed ansisense RNA in the diet of an invertebrate pest.
- An antisense alpha-tubulin gene sequence was used to construct a nucleotide sequence encoding in a single strand inserted VIGS vector.
- a 506 bp sequence as set forth in SEQ ID NO:29 encoding a partial alpha-tubulin protein was used to construct a primer pair (SEQ ID NO:27 and SEQ ID NO:28) for use in a thermal amplification reaction using psTRV2:Hqtub plasmid generated as in Example 1.
- the antisense Hatub expression viral vector was constructed as introduced as in Example 1.
- An antisense Hatub gene was used to construct a nucleotide sequence encoding in an antisense orientation single strand inserted into the psTRV2001 to form the psTKV2:anti-Hatub.
- a mixture of Agrobacterium cultures containing psTRVl with psTRV2J - cCurcin (as a non-insect sequence control) or psTRV2 :GhDCS (see Example 1 as a positive control) or psTKV2:Hatub vector or psTRV2 Hatub or psTRV2:anti: Hatub was vacuum infiltrated into 2-3 true leaf cotton plants or 5-6 true leaf tobacco plants.
- This example illustrates that not only single strand sense insect RNA, but also antisense insect RNA and hairpin structure dsRNA can be made as a recombinant virus which can replicate in the host plants, can be diet of an insect pest and are useful for controlling an insect pest.
- a similar strategy as used for the sense tubulin sequence was used to amplify the antisense tubulin sequence from CBM.
- the bollworm antisense tub gene for functional analysis using VIGS in cotton and tobacco was amplified from cotton bollworm cDNA using the primer pair as set forth at SEQ ID NO:27 and SEQ ID NO:28 which correspond respectively to forward and reverse genome amplification primers.
- the amplified DNA fragment sequence as set forth in SEQ ID NO:29 was used for producing an antjsense Hatub silencing vector psTKV2 Antisense-Hatub (psTKV2:anti: Hatub) as described in Example 10.
- a hairpin & ⁇ p a-tubulin gene sequence was used to construct a nucleotide sequence encoding in a hairpin structure containg VIGS vector.
- Sense fragment was amplifed by PCR with PCR primers set forth as SEQ ID NO:30 and SEQ ID NO:31 and further cloned into the BamHI and EcoRI sites of pSK-intron (Guo et al., 2003), followed insertion of the antisense fragment amplified with PCR primers set forth as SEQ ID NO:32 and SEQ ID NO:33.
- the Hairpin-Hatub (hpHatub) hairpin structure was subcloned into the BamHI and Xhol sites of psTRV2001 to give psTKV Hairpin- Hatub (psTKV.hpHatub).
- psTRV2:Antsensei-Hatub or psTKV2:Hairpin-Hatub was vacuum infiltrated into 2-3 true leaf cotton plants or 5-6 true leaf tobacco ( . benthamiana) plants.
- RNAi target genes that can lead to mortality when silenced by recombinant viral vector expression in cotton and tobacco plants.
- These cDNA sequences can be used to find potential RNAi target genes in other Insecta order organisms, especially these pests for important crops and they were those that encoded V-ATPase A subunit, alpha-tubulin, chitin, GST and DCRl proteins, the nucleotide sequences of which are as set forth in SEQ ID NOs:8, 11, 17, 26 and 20, respectively.
- the homologs were defined as the most significant matches to the 6 CBM sequences, as indicated by the best expectation value of NCBI Blast searches.
- the CBM cDNA sequences were then matched to the sequence database containing all public cDNAs of various organisms in Insecta order from GenBank. The top 100 matches and alignments were kept. The resulting cDNA clones were further chosed as at least one cDNA contain a 21 -mer consecutively perfect match with the CBM cDNA sequences.
- Seq ID NO: 11 Aedes aegypti XM_001652094
- Seq ID NO:8 Epiphyas EV803951 89.4 HaVATP postvittana
- Faivre-Rampant O. et al. (2004). Potato virus X-induced gene silencing in leaves and tubers of potato. Plant Physiol 134:1308-1316.
- Nicotiana benthmiana causes a striking bleached leaf phenotype.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- Insects & Arthropods (AREA)
- Pest Control & Pesticides (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
SG2012016838A SG179075A1 (en) | 2009-09-29 | 2010-09-15 | Control of pests in plants |
AU2010301171A AU2010301171B2 (en) | 2009-09-29 | 2010-09-15 | Control of pests in plants |
EP10820916.4A EP2483410A4 (en) | 2009-09-29 | 2010-09-15 | Control of pests in plants |
CN201080053979.9A CN102648283B (en) | 2009-09-29 | 2010-09-15 | The preventing and treating of harmful animal in plant |
US13/497,729 US10017774B2 (en) | 2009-09-29 | 2010-09-15 | Control of pests in plants |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US24659709P | 2009-09-29 | 2009-09-29 | |
US61/246,597 | 2009-09-29 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2011040880A1 true WO2011040880A1 (en) | 2011-04-07 |
Family
ID=43826528
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/SG2010/000339 WO2011040880A1 (en) | 2009-09-29 | 2010-09-15 | Control of pests in plants |
Country Status (6)
Country | Link |
---|---|
US (1) | US10017774B2 (en) |
EP (2) | EP2483410A4 (en) |
CN (1) | CN102648283B (en) |
AU (1) | AU2010301171B2 (en) |
SG (1) | SG179075A1 (en) |
WO (1) | WO2011040880A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2019074598A1 (en) * | 2017-10-13 | 2019-04-18 | Pioneer Hi-Bred International, Inc. | Virus-induced gene silencing technology for insect control in maize |
EP3720866A4 (en) * | 2017-11-27 | 2021-09-08 | Devgen NV | Control of plant pests using rna molecules |
Families Citing this family (19)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
BR102012033506A2 (en) * | 2012-12-28 | 2014-08-26 | Univ Fed Do Rio Grande Do Sul | METHOD AND COMPOSITIONS FOR GENETIC CONTROL OF PEST INSECTS IN COTTON PLANT THROUGH LACASE FAMILY GENE SILENCE |
US10450583B2 (en) | 2014-04-23 | 2019-10-22 | The Regents Of The University Of California | Compositions and methods for controlling pests |
CN104232646B (en) * | 2014-09-17 | 2017-01-11 | 中国农业大学 | Glutathione-S-transferase gene dsRNA (double-stranded ribonucleic acid) and application of glutathione-S-transferase gene dsRNA in control of sitobion avenae |
US9592186B2 (en) * | 2014-09-30 | 2017-03-14 | Avon Products, Inc. | Topical compositions and methods for skin lightening |
CN104561055B (en) * | 2015-01-12 | 2018-03-27 | 西南大学 | A kind of Tetranychus cinnabarinus cytochromes p450 genes and its application |
CN104561006A (en) * | 2015-02-03 | 2015-04-29 | 东北林业大学 | Lymantria dispar linnaeus CYP6AN15v1 gene dsRNA and application thereof in nuisanceless control |
GB201510154D0 (en) * | 2015-06-11 | 2015-07-29 | Univ Swansea | Pest control system |
WO2017106171A1 (en) * | 2015-12-14 | 2017-06-22 | The Regents Of The University Of California | Rna interference for control of insect pests |
BR102017001164A2 (en) | 2016-01-26 | 2019-03-06 | Embrapa - Empresa Brasileira De Pesquisa Agropecuária | DOUBLE TAPE RNA COMPOSITIONS FOR CITRI DIAPHORINE CONTROL AND METHODS OF USE. |
CN107236756B (en) * | 2016-03-28 | 2021-04-23 | 中国科学院青岛生物能源与过程研究所 | RNAi vector for nannochloropsis oculata gene silencing and application thereof |
GB201718701D0 (en) | 2017-11-13 | 2017-12-27 | Syngenta Participations Ag | Improvements in or relating to gene silencing |
CN110305893B (en) * | 2018-03-23 | 2022-09-06 | 中国科学院分子植物科学卓越创新中心 | Gossypol biosynthetic pathway gene CYP71BE79 and application thereof |
CN112770761A (en) * | 2018-09-13 | 2021-05-07 | 先正达农作物保护股份公司 | Use of RNA molecules for controlling plant pests |
CN111394371B (en) * | 2020-03-31 | 2022-01-28 | 山西大学 | Migratory locust V-ATPase-V1 structural domain gene and application of dsRNA thereof in pest control |
JP2023545999A (en) | 2020-10-05 | 2023-11-01 | プロタリクス リミテッド | DICER-like knockout plant cells |
CN113862394B (en) * | 2021-08-12 | 2023-10-03 | 北京农业生物技术研究中心 | RPA detection method for tomato infertility virus |
CN115094082B (en) * | 2022-06-16 | 2023-11-14 | 中国农业大学 | VIGS silencing system and method for identifying MsPDS gene |
CN116064644B (en) * | 2022-10-10 | 2023-10-10 | 中国农业科学院生物技术研究所 | SbAGO1b protein and application of coding gene thereof in regulation and control of plant insect resistance |
CN115678903B (en) * | 2022-11-03 | 2024-04-02 | 贵州大学 | Sogatella furcifera Ago1 gene, method for synthesizing dsRNA and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001037654A2 (en) * | 1999-11-24 | 2001-05-31 | Dna Plant Technology Corporation | METHOD OF EXPRESSING dsRNA IN PLANTS TO INHIBIT INSECT PESTS |
Family Cites Families (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20020048814A1 (en) | 2000-08-15 | 2002-04-25 | Dna Plant Technology Corporation | Methods of gene silencing using poly-dT sequences |
WO2003078604A2 (en) | 2002-03-14 | 2003-09-25 | Yale University | Tobacco rattle virus vectors and related compositions and methods |
US20060021087A1 (en) | 2004-04-09 | 2006-01-26 | Baum James A | Compositions and methods for control of insect infestations in plants |
WO2008063203A2 (en) | 2006-01-27 | 2008-05-29 | Whitehead Institute For Biomedical Research | Compositions and methods for efficient gene silencing in plants |
WO2007141790A2 (en) | 2006-06-07 | 2007-12-13 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Plant expression constructs and methods of utilizing same |
CN101195821A (en) | 2006-12-04 | 2008-06-11 | 中国科学院上海生命科学研究院 | Method for improving insect resistance of plant by using RNAi technique |
EP2171065A2 (en) | 2007-06-15 | 2010-04-07 | BASF Plant Science GmbH | Compositions and methods of using rna interference for control of nematodes |
WO2010080071A1 (en) | 2009-01-09 | 2010-07-15 | Temasek Life Sciences Laboratory Limited | Functional analysis of jatropha curcas genes |
-
2010
- 2010-09-15 SG SG2012016838A patent/SG179075A1/en unknown
- 2010-09-15 EP EP10820916.4A patent/EP2483410A4/en not_active Withdrawn
- 2010-09-15 EP EP14153986.6A patent/EP2730657B1/en not_active Not-in-force
- 2010-09-15 US US13/497,729 patent/US10017774B2/en not_active Expired - Fee Related
- 2010-09-15 AU AU2010301171A patent/AU2010301171B2/en not_active Ceased
- 2010-09-15 WO PCT/SG2010/000339 patent/WO2011040880A1/en active Application Filing
- 2010-09-15 CN CN201080053979.9A patent/CN102648283B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001037654A2 (en) * | 1999-11-24 | 2001-05-31 | Dna Plant Technology Corporation | METHOD OF EXPRESSING dsRNA IN PLANTS TO INHIBIT INSECT PESTS |
Non-Patent Citations (3)
Title |
---|
DUBREUIL, G. ET AL.: "Tobacco rattle virus mediates gene silencing in a plant parasitic root-knot nematode", JOURNAL OF EXPERIMENTAL BOTANY, vol. 60, no. 14, 2009, pages 4041 - 4050, XP008157089 * |
See also references of EP2483410A4 * |
VALENTINE, T. A. ET AL.: "Delivery of macromolecules to plant parasitic nematodes using a tobacco rattle virus vector", PLANT BIOTECHNOLOGY JOURNAL, vol. 5, 2007, pages 827 - 834, XP008157112 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2019074598A1 (en) * | 2017-10-13 | 2019-04-18 | Pioneer Hi-Bred International, Inc. | Virus-induced gene silencing technology for insect control in maize |
EP3720866A4 (en) * | 2017-11-27 | 2021-09-08 | Devgen NV | Control of plant pests using rna molecules |
US11198868B2 (en) | 2017-11-27 | 2021-12-14 | Devgen Nv | Control of plant pests using RNA molecules |
Also Published As
Publication number | Publication date |
---|---|
CN102648283B (en) | 2018-02-16 |
AU2010301171B2 (en) | 2015-06-11 |
EP2730657A1 (en) | 2014-05-14 |
EP2483410A4 (en) | 2013-08-28 |
CN102648283A (en) | 2012-08-22 |
EP2483410A1 (en) | 2012-08-08 |
US10017774B2 (en) | 2018-07-10 |
SG179075A1 (en) | 2012-04-27 |
US20120240288A1 (en) | 2012-09-20 |
EP2730657B1 (en) | 2017-07-12 |
AU2010301171A1 (en) | 2012-05-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2010301171B2 (en) | Control of pests in plants | |
US11685930B2 (en) | Compositions and methods for control of insect infestations in plants | |
CN105358695B (en) | Method by dsRNA introduced plant seed to adjust gene expression | |
TWI390037B (en) | Methods for genetic control of insect infestations in plants and compositions thereof | |
US10683505B2 (en) | Methods of introducing dsRNA to plant seeds for modulating gene expression | |
EP2295584A2 (en) | Transgenic plant-based methods for plant pests using RNAi | |
Suhag et al. | Biotechnological interventions for the sustainable management of a global pest, whitefly (Bemisia tabaci) | |
De Nicola | Construction and evaluation of citrus tristeza virus-based gene silencing vectors that target Trioza erytreae and Diaphorina citri | |
MX2008003647A (en) | Dsrna as insect control agent | |
CN104694548A (en) | Insect prothoracicotropic hormone gene and application of insect prothoracicotropic hormone gene to plant pest-resistant aspect |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 201080053979.9 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10820916 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 13497729 Country of ref document: US |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 914/MUMNP/2012 Country of ref document: IN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2010301171 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2010820916 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2010301171 Country of ref document: AU Date of ref document: 20100915 Kind code of ref document: A |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112012007105 Country of ref document: BR |
|
ENP | Entry into the national phase |
Ref document number: 112012007105 Country of ref document: BR Kind code of ref document: A2 Effective date: 20120329 |