MX2008003647A - Dsrna as insect control agent - Google Patents

Abstract

The present invention relates to methods for controlling pest infestation using double stranded RNA molecules. The invention provides methods for making transgenic plants that express the double stranded RNA molecules, as well as pesticidal agents and commodity products produced by the inventive plants.

Description

ARNds AS AN INSECT CONTROL AGENT FIELD OF THE INVENTION The present invention relates in general terms to the genetic control of pest infestations. More specifically, the present invention relates to. recombinant double-stranded RNA technologies to repress or inhibit the expression of target coding sequences in a pest.

BACKGROUND OF THE INVENTION The environment is full of pests and numerous methods have been tried to control infestations of plants by pests. Compositions for controlling infestations by microscopic pests have been provided in the form of antibiotic, antiviral, and antifungal compositions. Methods for controlling infestations by larger pests, such as nematodes, have typically been in the form of chemical compositions that are applied to the surfaces on which the pests live, or are administered to infested animals in the form of tablets, powders, tablets, pasta, or capsules. Commercial crops are often the target of insect attack. In recent decades a substantial advance has been made towards the development of more efficient methods and compositions for controlling insect infestations in plants. Chemical pesticides have been very effective in eradicating pest infestations. However, there are several disadvantages to the use of chemical pesticides. These are not only potentially harmful to the environment, but chemical pesticides are not selective and may present risks to non-target flora and fauna. Commercial pesticides remain in the environment and are usually metabolized very slowly, if at all, they are metabolized. These accumulate in the food chain, and particularly in the higher predatory species. The accumulation of chemical pesticides results in the development of resistance to the agents and in the species that are higher in the evolutionary chain, these could act as mutagens and / or carcinogens and cause irreversible and harmful genetic modifications. Due to the dangers associated with chemical pesticides, biological strategies have been developed to control infestations by plant pests. For example, the bacterium Bacillus thuringiensis (B.t.) has been commercially available and has been used as environmentally safe and acceptable insecticides for more than 30 years. The reduction in the application of chemical pesticide agents has resulted in cleaner soils and cleaner water flowing from the soil to the currents, rivers, ponds and surrounding lagoons. In addition to these environmental benefits, there has been a notable increase in the numbers of beneficial insects in the fields where transgenic crops resistant to insects are cultivated due to the reduction in the use of chemical insecticide agents. RNA interference (RNAi) provides a potentially powerful tool for controlling gene expression due to its target selection specificity and remarkably high efficiency for suppressing target mRNA. RNAi refers to the gene silencing procedure after transcription, sequence specific mediated by short interfering RNA molecules (siRNA) (Zamore, P. et al., Cell 101: 25-33 (2000); Fire, A. et al., Nature 391: 806 (1998), Hamilton et al., Science 286, 950-951 (1999), Lin et al., Nature 402: 128-129 (1999)). Although the mechanisms underlying the RNAi are not fully characterized, it is believed that the presence of dsRNA in the cells induces the RNAi by activation of the enzyme ribonuclease III "Shredder (Dicer)" (Zamore, P. et al., (2000) Hammond et al., Nature 404, 293 (2000)). The "shredder" enzyme processes the dsRNA in short pieces called short interfering RNA molecules (RNAsi), which are approximately 21 to approximately 23 nucleotides in length and comprise duplexes of 19 base pairs (Zamore et al., (2000); Elbashir et al., Genes Dev., 15, 188 (2001)). After they are delivered to the cells, the siRNA molecules are associated with an endonuclease complex, commonly known as an RNA-induced silencing complex (RISC), which brings together the antisense strand of the siRNA and the gene target. of cellular mRNA. RISC cuts the mRNA, which is then released and degraded. As an important aspect, RISC can then degrade additional copies of the target mRNA. Accordingly, the present invention provides methods and compositions for controlling pest infestation by repressing, delaying, or otherwise reducing the expression of genes within a particular pest.

SUMMARY OF THE INVENTION In one aspect, the invention provides an isolated nucleotide sequence comprising a nucleic acid sequence indicated in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49 -158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240-247, 249, 251, 253, 255, 257, 259 , 275-472, 473, 478, 483, 488, 493, 498, 503, 508-513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605 , 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894 , 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1066-1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101 , 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652 , 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 206 5, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384- 2460, 2461, 2466, 2471, 2476, and 2481. In one embodiment, a double stranded ribonucleotide sequence produced from the expression of a polynucleotide sequence is provided, in which the ingestion of said ribonucleotide sequence by a plant plague inhibits the growth of said pest. In a further embodiment, the ingestion of said sequence inhibits the expression of a nucleotide sequence substantially complementary to said sequence. In another embodiment, a cell with the polynucleotide is transformed. Even in another embodiment, a plant or plant cell is transformed with the polynucleotide. In a further embodiment, a seed or product is produced from the transformed plant. In an even further embodiment, the product is selected from the group consisting of foodstuffs, feed, fiber, paper, products in the form of flour, protein, starch, flour, fodder, coffee, tea, and oil. In another aspect, the invention provides a nucleotide sequence having at least 70% sequence identity with a nucleic acid sequence indicated in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240-247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 508-513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1066-1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, .1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-| 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384- 2460, 2461, 2466, 2471, 2476, and 2481. In one embodiment, a double-stranded ribonucleotide sequence produced from the expression of a polynucleotide sequence is provided, in which the ingestion of said ribonucleotide sequence by a plant pest inhibits the growth of said plague. In a further embodiment, the ingestion of said sequence inhibits the. expression of a nucleotide sequence substantially complementary to said sequence. In another embodiment, a cell is transformed with the polynucleotide. even in another embodiment, a plant or plant cell is transformed with the polynucleotide. In an additional mode, a seed or product is produced from the transformed plant. In an even further embodiment, the product is selected from the group consisting of foodstuffs, feed, fiber, paper, products in the form of flour, protein, starch, flour, fodder, coffee, tea, and oil. In another aspect, the invention provides an ortholog of a gene comprising at least 17 contiguous nucleotides of any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 , 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259 , 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607 , 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896 , 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105 , 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662 , 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075 , 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466 , 2471, 2476, and 2481, or a complement thereof. In one embodiment, a double-stranded ribonucleotide sequence produced from the expression of a polynucleotide sequence is provided, in which the ingestion of said ribonucleotide sequence by a plant pest inhibits the growth of said pest. In a further embodiment, the ingestion of said sequence inhibits the expression of a nucleotide sequence substantially complementary to said sequence. In another embodiment, a cell is transformed with the polynucleotide. Even in another embodiment, a plant or plant cell is transformed with the polynucleotide. In a further embodiment, a seed or product is produced from the transformed plant. In an even further embodiment, the product is selected from the group consisting of foodstuffs, feed, fiber, paper, products in the form of flour, protein, starch, flour, fodder, coffee, tea, and oil. In another aspect, the invention provides a plant comprising a double-stranded ribonucleic acid sequence obtained from a pest species. In one embodiment, the pest is selected from the group consisting of insects, arachnids, crustaceans, fungi, bacteria, viruses, nematodes, flatworms, earthworms, intestinal worms, hookworms, tapeworms, trypanosomes, schistosomes, blowfly, fleas, ticks , mites, and lice. In another modality, the plant is sterile cytoplasmic male. In another embodiment, the sequence inhibits a biological activity of the pest. In another embodiment, the sequence inhibits the expression of an objective sequence. In a further embodiment, the target sequence is a sequence of insect, nematode, bacterium, or fungus. In another aspect, the invention provides a method for controlling pest infestation, comprising providing a pest with plant material comprising a polynucleotide sequence that inhibits a biological activity of the pest. In one embodiment, the polynucleotide sequence is indicated in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160-163 , 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240-247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478 , 483, 488, 493, 498, 503, 508-513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767 , 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041 , 1046, 1051, 1056, 1061, 1066-1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-| 2460, 2461, 2466, 2471, 2476, and 2481, or a complement thereof In another aspect, the invention provides a pesticide comprising a plant that expresses an objective polynucleotide sequence. In another aspect, the invention provides a method for controlling pest infestation, comprising: (a) identifying an objective sequence in a pest; (b) introducing said sequence into a plant; and (c) supplying said plant, or portion thereof, to said pest. In another aspect, the invention provides a method for controlling pest infestation, comprising: (a) identifying an objective sequence in a first pest species; (b) search for an orthologous target sequence in a second pest species; (c) introducing said orthologous sequence into a plant; and (d) supplying said plant, or portion thereof, to said second pest. In another modality, the target is a gene from L. decemlineata and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussel sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, chinese cabbage, citrus, clementine (spanish orange), clove , coffee, corn, cotton, chick-pea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine (gum hemlock), American walnut, cabbage curly, kiwis, kohlrabi (Brassica olerácea Group Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip , pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea (Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, pastures, turnips, grapevine, walnut, watercress , watermelon, wheat, yams, yew tree, and Italian zucchini. In another aspect, the invention provides a method for improving culture performance, comprising: (a) introducing a polynucleotide into a plant; and (b) culturing said plant to allow the expression of polynucleotide, wherein said expression inhibits feeding by a pest and loss of yield due to pest infestation. In one embodiment, the pest is selected from the group consisting of insects, nematodes, and fungi. In another embodiment, the polynucleotide expression produces an RNA molecule that suppresses a target gene in a pest insect that has ingested a portion of said culture plant, in which said target gene plays at least one essential function that is selected to from the group consisting of feeding by the pest, viability of the pest, cellular apoptosis of the pest, differentiation and development of the pest or any cell of the pest, sexual reproduction of the pest, muscle formation, muscle movement , muscle contraction, formation and / or reduction of juvenile hormone, regulation of juvenile hormone, regulation and transport of ions, cell membrane potential maintenance, amino acid biosynthesis, amino acid degradation, sperm formation, pheromone synthesis, pheromone detection, antenna formation, wing formation, leg formation, egg formation, larval maturation, formation digestive enzyme, hemolymph synthesis, maintenance of hemolymph, neurotransmission, transition of the larval stage, pupal formation, emergence of the pupal stage, cell division, energy metabolism, respiration, synthesis and maintenance of the cytoskeletal structure, metabolism of nucleotide, nitrogen metabolism, water use, water retention, and sensory perception.

In another aspect, the invention provides a method for producing a raw material product, comprising: (a) identifying an objective sequence in a pest; (b) introducing said sequence into a cell of the plant; (c) cultivating said plant cell under appropriate conditions to generate a plant; and (d) producing a raw material product from said plant or part thereof. In another modality, the target is a gene from L decemlineata and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beet, birch , beech, blackberry, blueberry, broccoli, Brussels sprout, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), cloves, coffee, corn, cotton, chick-pea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, canadian pine, hickory, kale, kiwi, kohlrabi (Brassíca olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, du razno, peanut, pear, peat, pepper, persimmon, Congo pea (Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow , soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, pastures, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another modality, the target is a gene from P. cochleariae and the plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussel sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, chinese cabbage, citrus, clementine (spanish orange), clove , coffee, corn, cotton, chick-pea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine, American walnut, kale, kiwis, kohlrabi (Brassica olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, durazn or, peanut, pear, peat, pepper, persimmon, Congo pea. { Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, squash, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane sugar, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another modality, said objective is a gene from E. varivetis and the plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussel sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, chinese cabbage, citrus, clementine (spanish orange), clove , coffee, corn, cotton, chick-pea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine, American walnut, kale, kiwis, kohlrabi (Brassica olerácea Group Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or tree decoration, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea. { Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, squash, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane sugar, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another modality, the target is a gene from A. grandis and the plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussel sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, chinese cabbage, citrus, clementine (spanish orange), clove , coffee, corn, cotton, chick-pea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, cascara tomato, Canadian pine, American walnut, kale, kiwis, kohlrabi. { Brassica olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea. { Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, squash, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane sugar, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another modality, the target is a gene from T. castaneum and the plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussel sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, chinese cabbage, citrus, clementine (spanish orange), clove , coffee, corn, cotton, chick-pea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine, American walnut, kale, kiwis, kohlrabi (Brassica olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea (Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy , spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another modality, the target is a gene from M. persicae and the plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussels sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, shell tomato, Canadian pine, American walnut, kale, k.iwis, kohlrabi. { Brassica olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea (Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, pumpkin , Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another modality, the target is a gene from N. lugens and the plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussel sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, chinese cabbage, citrus, clementine (spanish orange), clove , coffee, corn, cotton, chick-pea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine, American walnut, kale, kiwis, kohlrabi (Brassica olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, maidenhair, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, ca cahuate, pear, peat, pepper, persimmon, Congo pea. { Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, squash, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane sugar, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another modality, the target is a gene from C. suppressalis and the plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussel sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, chinese cabbage, citrus, clementine (spanish orange), clove , coffee, corn, cotton, chick-pea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine, American walnut, kale, kiwis, kohlrabi. { Brassica olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea (Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, pumpkin , Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another modality, the target is a gene from P. xylostella and the plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, Brussels sprout, cabbage, cañola, melon, carrot, cassava, cauliflower, Cedar, cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, spruce, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine, American walnut, kale, kiwi, kohlrabi (Brassica olerácea Gongilodes group), larch, lettuce, leek, lemon, lime, carob, pine, cilantro, corn, mango , maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea (Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, squash, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees , triticale, pastures, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another modality, the target is a gene from A. domesticus and the plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussel sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, chinese cabbage, citrus, clementine (spanish orange), clove , coffee, corn, cotton, chick-pea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine, American walnut, kale, kiwis, kohlrabi. { Brassica olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a. plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea (Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato , trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another embodiment, the target is a gene from a fungus and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beet, birch , beech, blackberry, blueberry, broccoli, Brussels sprout, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), cloves, coffee, corn, cotton, chick-pea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, canadian pine, hickory, kale, kiwi, kohlrabi . { Brassíca olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea. { Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, squash, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini. In another embodiment, the invention provides the use of an isolated nucleotide sequence, a double-stranded ribonucleotide sequence, a cell, a plant, or a product, to treat infestations of plants by insects. In another embodiment, the invention provides the use of an isolated nucleotide sequence, a double-stranded ribonucleotide sequence, a cell, a plant, or a product, to treat infestations of plants by nematodes. In another embodiment, the invention provides the use of an isolated nucleotide sequence, a double-stranded ribonucleotide sequence, a cell, a plant, or a product, to treat infestations of plants by fungi.

BRIEF DESCRIPTION OF THE FIGURES Figure 1: Survival of L. decemlineata in artificial diet treated with dsRNA. The insects of the second larval stage are fed a diet treated with 50 μ? of dsRNA solution applied topically (targets or gfp control). The diet is replaced with a new diet that contains dsRNA applied topically after 7 days. The number of insects that survive is evaluated on days 2, 5, 7, 8, 9, and 13. The percentage of larvae that survive is calculated in relation to day 0 (start of the test). Objective LD006: (SEQ ID NO: 178); Objective LD007 (SEQ ID NO: 183); Objective LD010 (SEQ ID NO: 188); Objective LD011 (SEQ ID NO: 193); Objective LD014 (SEQ ID NO: 198); Gfp dsRNA (SEQ ID NO: 235). Figure 2: Survival of L. decemlineata in artificial diet treated with dsRNA. The insects of the second larval stage are fed a diet treated with 50 μ? of dsRNA solution applied topically (targets or gfp control). The diet is replaced with a new diet only after 7 days. The number of insects that survive is evaluated on days 2, 5, 6, 7, 8, 9, 12, and 14. The percentage of larvae that survive is calculated in relation to day 0 (start of the test). Objective LD001 (SEQ ID NO: 163); Objective LD002 (SEQ ID NO: 168); Objective LD003 (SEQ ID NO: 173); Objective LD015 (SEQ ID NO: 215); Objective LD016 (SEQ ID NO: 220); Gfp dsRNA (SEQ ID NO: 235). Figure 3: Average weight of larvae of L. decemlineata on potato leaf discs treated with dsRNA. Insects of the second larval stage are fed with leaf discs treated with 20 μ? of a solution applied topically (10 ng / μ?) of dsRNA (objective LD002 or gfp). After two days the insects are transferred to untreated leaves every day. Figure 4: Survival of L. decemlineata in artificial diet treated with shorter versions of dsRNA of the LD014 target and concatamer dsRNA. The insects of the second larval stage are fed a diet treated with 50 μ? of dsRNA solution applied topically (gfp or targets). The number of insects that survive is evaluated on days 3, 4, 5, 6, and 7. The percentage of larvae that survive is calculated in relation to day 0 (start of the test). Figures 5 (a) to 5 (h): Survival of larvae of L. dece lineata in artificial diet treated with different concentrations of dsRNA of target LD002 (a), target LD007 (b), target LD010 (c), target LD011 ( d), objective LD014 (e), objective LD015 (f), LD016 (g) and objective LD027 (h). The insects of the second larval stage are fed a diet treated with 50 μ? of dsRNA solution applied topically. The diet is replaced with a new diet that contains dsRNA applied topically after 7 days. The number of insects that survive is evaluated at regular intervals. The percentage of larvae that survive is calculated in relation to day 0 (start of the test). Figures 6 (a) -6 (b). Effects of E. coli strains expressing dsRNAs of the LD010 target on the survival of larvae of Colorado potato beetle, Leptinotarsa decemlineata, with respect to time. The two bacterial strains are tested in separate bioassays based on artificial diet: (a) AB309-105; the data points for pGBNJ003 and pGN29 represent average mortality values from 5 different bacterial clones, (b) BL21 (DE3); the data points for pGBNJ003 and pGN29 represent the average mortality values from 5 different bacterial clones and one individual bacterial clone, respectively. The error bars represent standard deviations. Figure 7 (a) -7 (b). Effects of different clones of strains of E. coli (a) AB309-105 and (b) BL21 (DE3) expressing dsRNA of target LD010 on larval survival of Colorado potato beetle, Leptinotarsa dece lineata, 12 days after of the infestation. The data points are average mortality values for each clone for pGN29 and pGBNJ003. Clone 1 of AB309-105 harboring plasmid pGBNJ003 shows 100% mortality for the Colorado potato beetle (CPB) at this point in time. The error bars represent standard deviations. Figure 8 (a) -8 (b). Effects of different clones of strains of E. coli (a) AB309-105 and (b) BL21 (DE3) expressing dsRNA of target LD010 on growth and development of surviving larvae of Colorado potato beetle, Leptinotarsa decemlineata, 7 days after the infestation. The data points are values in percent larval weight for each clone (one clone for pGN29 and five clones for pGBNJ003) based on the data in Table 77. The diet-only treatment represents 100% normal larval weight .

Figure 9. Survival of Colorado potato beetle larvae, Leptinotarsa decemlineata, in potato plants sprayed with double-stranded RNA producing bacteria 7 days after infestation. The number of surviving larvae is counted and expressed in terms of% mortality. The bacterial host strain used is strain AB309-105 deficient in RNase III. The goal of the insect gene is LD010. Figure 10. Delay in the growth / development of surviving larvae of Colorado potato beetle, Leptinotarsa decemlineata, fed with potato plants sprinkled with dsRNA-producing bacteria 11 days after infestation. The bacterial host strain used is strain AB309-105 deficient in RNase III. The figures of the data represented as a percentage of normal larval weight; 100% normal larval weight given for diet only treatment. The target of the insect gene is LD010. The error bars represent standard deviations. Figure 11. Resistance to potato damage caused by Colorado potato beetle larvae, Leptinotarsa decemlineata, by double-stranded RNA producing bacteria 7 days after infestation. Left, plant sprinkled with 7 units of bacteria AB309-105 containing the plasmid pGN29; right, plant sprinkled with 7 units of bacteria Ab309-105 that contains the plasmid pGBNJ003. A unit is defined as the equivalent of 1 ml of a bacterial suspension at an optical density value of 1 to 600 nm. The goal of the insect gene is LD010. Figure 12. Adult survival of L. decemlíneata on potato leaf discs treated with dsRNA. Young adult insects are fed leaf discs treated with double-stranded RNA for the first two days and then placed on untreated potato foliage. The number of insects that survive is evaluated regularly; mobile insects register as insects that are alive and that seem to move in a normal way; Dying insects are recorded as insects that are alive but appear sick and slow moving - these insects can not straighten out by themselves once they are placed on their backs. Objective LD002 (SEQ ID NO: 168); Objective LD010 (SEQ ID NO: 188); Objective LD014 (SEQ ID NO: 198); Objective LD016 (SEQ ID NO: 220); Gfp dsRNA (SEQ ID NO: 235). Figures 13 (a) to 13 (c). Effects of double-stranded RNA from the target produced with bacteria against larvae of L. decemlíneata. Topically 50 ul of an optical density suspension 1 of thermally treated bacteria expressing dsRNA (SEQ ID NO: 188) are applied topically onto the solid artificial diet in each cavity of a 48-well plate. Larvae of L. decemlineata in stage L2 are placed in. each cavity. On day 7, a photograph of the larvae L. decemlineata is taken on a plate containing (a) diet with bacteria expressing double-stranded RNA from target 10, (b) diet with bacteria harboring the empty vector pGN29, and , (c) only diet. Figure 14. Effects on the survival and growth of larvae of L. decemlineata of different amounts of the inactivated strain AB309-105 of E. coli harboring the plasmid pGBNJ003 applied topically to the foliage of potato before insect infestation. Ten Ll larvae are fed with treated potatoes for 7 days. Amount of bacterial suspension sprinkled on the plants: 0.25 U, 0.08 U, 0.025 U, 0.008 U of objective 10 and 0.25 U of pGN29 (negative control, also includes Milli-Q water). One unit (U) is defined as the amount of equivalent bacteria present in 1 ml of culture with an optical density value of 1 to 600 nm. A total volume of 1.6 ml is sprinkled on each plant. The goal of the insect gene is LD010. Figures 15 (a) to 15 (d). Resistance of the potato to damage caused by larvae of L. decemlineata by strain AB309-105 of inactivated E. coli harboring plasmid pGBNJ003 7 days after infestation, (a) water, (b) 0.25 U of E. col i AB309-105 that houses pGN29, (c) 0.025 U of E. col i AB309-105 housing pGBNJ003, (d) 0.008 U of E. coli AB309-105 that hosts pGBNJ003. One unit (U) is defined as the amount of equivalent bacteria present in 1 ml of culture with an optical density value of 1 to 600 nm. A total volume of 1.6 ml is sprinkled on each plant. The goal of the insect gene is LDOlO. Figures 16 (a) -16 (b): Effects of injected dsRNA molecules on the survival and growth of larvae of P. cochleariae. The neonatal larvae are fed with rapeseed discs treated with 25 μ? of solution applied topically of dsRNA 0.1 and.g / pl (targets or control of gfp). After 2 days, the insects are transferred to fresh leaf discs treated with dsRNA. On day 4, larvae from one repetition are collected for each treatment and placed in a Petri dish containing fresh untreated rapeseed foliage. The insects are evaluated on days 2, 4, 7, 9 and 11. (a) Survival of E. varivestis larvae in rapeseed discs treated with dsRNA. The percentage of larvae that survive is calculated in relation to day 0 (start of the test), (b) Average weights of P. cochleariae larvae in rapeseed discs treated with dsRNA. The insects from each repetition are weighed together and the average weight per larva is determined. The error bars represent standard deviations. Objective 1: SEQ ID NO: 473; objective 3: SEQ ID NO: 478; objective 5: SEQ ID NO: 483--; objective 10: SEQ ID NO: 488; objective 14: SEQ ID NO: 493; objective 16: SEQ ID NO: 498; Objective 27: SEQ ID NO: 503; Gfp dsRNA: SEQ ID NO: 235. Figures 17 (a) -17 (b): Survival of P. cochleariae in rapeseed discs treated with different concentrations of dsRNA from (a) target PC010 and (b) target PC027. Neonatal larvae are placed on leaf discs treated with 25 μ? of dsRNA solution applied topically. The insects are transferred to leaf discs treated fresh on day 2. On day 4 for target PC010 and on day 5 for target PC027, insects are transferred to untreated leaves. The number of insects that survive is evaluated on days 2, 4, 7, 8, 9 and 11 for PC010 and 2, 5, 8, 9 and 12 for PC027. The percentage of larvae that survive is calculated in relation to day 0 (start of the test). Figure 18: Effects of strain AB309-105 of E. coli expressing target PC010 dsRNAs on the survival of larvae of the mustard leaf beetle, P. cochleariae, with respect to time. The data points for each treatment represent the average mortality values from 3 different repetitions. The error bars represent standard deviations. Objective 10: SEQ ID NO: 488. Figure 19: Survival of E. varivestis larvae in bean leaf discs treated with dsRNA. The neonatal larvae are fed with bean leaf discs treated with 25 μ? of 1 μ? dRNA solution / μ? applied topically (targets or gfp control). After 2 days, the insects are transferred to leaf discs treated with fresh dsRNA. On day 4, larvae from a treatment are collected and placed in a plastic box containing fresh untreated bean foliage. The insects are evaluated for mortality on days 2, 4, 6, 8 and 10. The percentage of larvae that survive is calculated in relation to day 0 (start of the test). Objective 5: SEQ ID NO: 576; objective 10: SEQ ID NO: 586; objective 15: SEQ ID NO: 591; objective 16: SEQ ID NO: 596; Gfp dsRNA: SEQ ID NO: 235. Figure 20, 21 (a) -21 (e): Effects of target dsRNA molecules ingested on adult survival of E. varivestis and resistance to sudden insect damage of the foliage of the bean. Figure 20 Adult survival of E. varivestis in bean leaves treated with dsRNA. Adults are fed with leaf disks of bean treated with 75 μ? of dsRNA solution 0.1 μ? / μ? applied topically (targets or gfp control). After 24 hours, the insects are transferred to leaf discs treated with fresh dsRNA. After an additional 24 hours, adults from a treatment are collected and placed in a plastic box containing fresh untreated whole bean plants planted in a pot. Insects are evaluated for mortality on days 4, 5, 6, 7, 8, and 11. The percentage of adults who survive is calculated in relation to day 0 (start of the test). Objective 10: SEQ ID NO: 586; objective 15: SEQ ID NO: 591; objective 16: SEQ ID NO: 596; Gfp dsRNA: SEQ ID NO: 235. figure 21 (a) -figure 21 (e): Resistance to bean leaf damage caused by adults of E. varivestis by dsRNA. Complete plants containing insects from a treatment (see fig 20) are visually inspected for leaf damage on day 9. figure 21 (a) objective 10; Figure 21 (b) Goal 15; figure 21 (c) objective 16; Figure 21 (d) gfp dsRNA; Figure 21 (e) without treatment. Figure 22: Survival of larvae of T. castaneum in artificial diet treated with dsRNA of target 14. The neonatal larvae are fed a diet based on a mixture of flour / milk with 1 mg of dsRNA of target 14. The control is water ( without ARNds) in the diet. Four repetitions of the first 10 larvae in the chrysalis stage are performed by repetition for each treatment. Insects are evaluated for survival as average percentage averages on days 6, 17, 31, 45 and 60. The percentage of larvae that survive is calculated in relation to day 0 (start of the test). The error bars represent standard deviations. Objective TC014: SEQ ID NO: 878. Figure 23: Effect of dsRNA of target 27 ingested on the survival of Myzus persicae nymphs. The first pupae are placed in feeding chambers containing 50 μ? of liquid diet with 2 μ? / μ? of dsRNA (objective 27 or control of gfp dsRNA). By treatment, 5 feeding chambers are mounted with 10 pupae in each feeding chamber. The number of survivors is evaluated 8 days after the start of the bioassay. The error bars represent standard deviations. Objective MP027: SEQ ID NO: 1061; Gfp dsRNA: SEQ ID NO: 235. Figure 24 (a) to Figure 24 (d): Survival of Nilaparvata lugens in liquid artificial diet treated with dsRNA. The nymphs from the first to the second larval stage are fed a diet supplemented with 2 mg / ml of dsRNA solution of the targets in separate bioassays: Figure 24 (a) NL002, NL003, NL005, NL010; Figure 24 (b) NL009, NL016; Figure 24 (c) NL014, NL018; Figure 24 (d) NL013, NL015, NL021. The survival of insects in the targets is compared with only diet and diet with control of gfp dsRNA at the same concentration. The diet is replaced with a new diet that contains dsRNA every other day. The number of insects that survive is evaluated every day. Figure 25: Survival of Nilaparvata lugens in an artificial liquid diet treated with different concentrations of dsRNA of the NL002 target. The nymphs from the first to the second larval stage are fed a diet supplemented with 1, 0.2, 0.08, and 0.04 mg / ml (final concentration) of NL002. The diet is replaced with a new diet that contains dsRNA every other day. The numbers of insects that survive are evaluated every day.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides means to control infestations by pests by administering to a pest an objective coding sequence that after transcription represses or inhibits a necessary biological function in the pest, feeding a pest with one or more small interfering ribonucleic acid (RNA) molecules. or double-stranded transcribed from all or a portion of an objective coding sequence that is essential for the support and survival of the pest. Therefore, the present invention relates to sequence-specific inhibition of coding sequences using double-stranded RNA (dsRNA), including small interfering RNA (siRNA), as means for pest control. Until now, it has been impractical to provide dsRNA molecules in the diet of most pest species because RNA molecules are easily degraded by nucleases in the environment and were thought to be unstable in alkaline or light acid environments, such as those found in the digestive tracts of most invertebrate pests. Therefore, there is a need for improved methods for modulating gene expression by repressing, retarding, or otherwise reducing gene expression within a particular pest for the purpose of controlling pest infestation or introducing novel phenotypic traits. . The inventors of the present invention have identified means for controlling pest infestation by supplying dsRNA molecules in the diet of said pest. The sequence of the dsRNA corresponds to a total oval part of an essential gene of the pest and causes the negative regulation of the target pest by means of RNA interference (RNAi). As a result of the negative regulation of mRNA, the dsRNA prevents the expression of the target pest protein and results in one or more (but not limited to) of the following attributes: reduction in feeding by the pest, reduction in the viability of the pest, death of the pest, inhibition of differentiation and development of the pest, absence of, or reduced capacity for, sexual reproduction of the pest, formation of muscle, formation of juvenile hormone, regulation of juvenile hormone, regulation and transport of ions, cell membrane potential maintenance, amino acid biosynthesis, amino acid degradation, sperm formation, pheromone synthesis, pheromone detection, antenna formation, wing formation, leg formation, development and differentiation, formation of eggs, maturation of the larva, formation of digestive enzyme, synthesis of hemolymph, maintenance of hemolymph, neurotransmission , cell division, energy metabolism, respiration, apoptosis, and any component of the cytoskeletal structure of eukaryotic cells, such as, for example, actin and tubulin. Any or any combination of these attributes can result in the effective inhibition of infestation by pest law, and in the case of a plant pest, the inhibition of plant infestation. All the technical terms used in this description are commonly used in Biochemistry, Molecular Biology and Agriculture; therefore, these are understood by experts in the field to which this invention pertains. These technical terms can be found, for example, in: MOLECULAR CLONING: A LABORATORY MANUAL, 3rd ed., Vol. 1-3, ed. Sambrook and Russel, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 2001; CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, ed. Ausubel et al., Greene Publishing Associates and Wiley-Interscience, New York, 1988 (with periodic updates); SHORT PROTOCOLS IN MOLECULAR BIOLOGY: A COMPENDIUM OF METHODS FROM CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, 5th ed., Vol. 1-2, ed. Ausubel et al., John Wiley & Sons, Inc., 2002; GENOME ANALYSIS: A LABORATORY MANUAL, vol. 1-2, ed. Green et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1997. The methodology involving plant biology techniques is described in the present invention and is also described in greater detail in treaties such as METHODS IN PLANT MOLEULAR BIOLOGY: A LABORATORY COURSE MANUAL, ed. Maliga et al, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1995. Several techniques using PCR are described, for example, in Innis et al., PCR PROTOCOLS: A GUIDE TO METHODS AND APPLICATIONS, Academic Press, San Diego , 1990 and in Dieffenbach and Dveksler, PCR PRIMER: A LABORATORY MANUAL, 2nd ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2003. Primer pairs for PCR can be obtained from known sequences by known techniques such as the use of computer programs designed for such purpose, for example, Primer, Version 0.5, 1991, Whitehead Institute for Biomedical Research (Whitehead Institute for Biomedical Research), Cambridge, MA. Methods for chemical synthesis of nucleic acids are discussed, for example, in Beaucage and Caruthers, Tetra. Letts. 22: 1859-62 (1981), and Matteucci and Caruthers, J. Am. Chew. Soc. 103: 3185 (1981). Restriction enzyme digestions, phosphorylations, ligations, and transformations are carried out as described in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd ed. (1989), Cold Spring Harbor Laboratory Press. All reagents and materials used for the growth and maintenance of bacterial cells are obtained from Aldrich Chemicals (Milwaukee, Wis.), DIFCO Laboratories (Detroit, Mich.), Invitrogen (Gaithersburg, Md.), Or Sigma Chemical Company ( St. Louis, Mo.) unless otherwise specified. Agrobacterium or bacterial transformation: as is well known in the field, the Agrojacteri that are used to transform plant cells are unarmed and virulent derivatives of, usually, Agrobacterium turnefaciens, Agrobacterium rhizogenes, which contain a vector. The vector typically contains a desired polynucleotide that is located between the edges of an AND-T. However, any bacteria that can transform a plant cell, such as Rhizobium trifolii, Rhizobium leguminosarum, Phyllobacterium myrsinacearum, SinoRhizobium meliloti, and MesoRhizobium loti, can be used. Angiosperm: vascular plants that have seeds enclosed in an ovary. Angiosperms are seed plants that produce flowers that bear fruit. The angiosperms are divided into dicotyledonous and monocotyledonous plants. Biological activity refers to the behavior and biological effects of a protein or peptide and its manifestations in a pest. For example, an RNAi of the invention can prevent translation of a particular mRNA, thereby inhibiting the biological activity of the protein encoded by the mRNA or other biological activity of the pest. In the present description, an RNAi molecule can inhibit a biological activity in a pest, which results in one or more of the following attributes: reduction in feeding by the pest, reduction in the viability of the pest, death of the plague, inhibition of the differentiation and development of the pest, absence of or reduced capacity for sexual reproduction by the pest, muscle formation, juvenile hormone formation, juvenile hormone regulation, regulation and transport of ions, maintenance of the cell membrane potential, amino acid biosynthesis, amino acid degradation, sperm formation, pheromone synthesis, pheromone detection, antenna formation, wing formation, leg formation, development and differentiation, egg formation, larval maturation, formation of digestive enzyme, hemolymph synthesis, maintenance of hemolymph, neurotransmission, cell division, metabolism ism of energy, respiration, apoptosis, and any component of a structure of the cytoskeleton of eukaryotic cells, such as, for example, actin and tubulin.

Complementary DNA (cDNA) refers to single-stranded DNA synthesized from a mature mRNA template. Although there are several methods, most of the time the cDNA is synthesized from mature mRNA (fully spliced) using the enzyme reverse transcriptase. This enzyme works on a single strand of mRNA, generating its complementary DNA based on the pairing of the base pairs of RNA (A, U, G, C) with its DNA complements (T, A, C, G). Two nucleic acid strands are substantially complementary when at least 85% of their bases are paired. Desired polynucleotide: A desired polynucleotide of the present invention is a genetic element, such as a promoter, enhancer, or terminator, or gene or polynucleotide that is to be transcribed and / or translated into a transformed cell comprising the desired polynucleotide in its genome . If the desired polynucleotide comprises a sequence encoding a protein product, the coding region can be operably linked to regulatory elements, such as a promoter and a terminator, that produce the expression of a messenger RNA transcript and / or a associated protein product encoded by the desired polynucleotide. Therefore, a "desired polynucleotide" can comprise a gene that is linked in operable form in the 5 'to 3' orientation, a promoter, a gene encoding a protein, and a terminator. Alternatively, the desired polynucleotide may comprise a gene or fragment thereof, in a "sense" or "antisense" orientation, whose transcription produces nucleic acids that can affect the. expression of an endogenous gene in the host cell. A desired polynucleotide can also produce, after transcription, a double-stranded RNA product on which it initiates the RNA interference of a gene to which the desired polynucleotide is associated. A desired polynucleotide of the present invention can be positioned within a vector, such that the sequences of the left and right borders flank or are on either side of the desired polynucleotide. The present invention contemplates the stable integration of one or more desired polynucleotides into the genome of at least one host cell. A desired polynucleotide can be a mutant or a variant of its wild-type sequence. It is understood that all or a part of the desired polynucleotide can be integrated into the genome of a host. It is also understood that the term "desired polynucleotide" encompasses one or more of said polynucleotides. Therefore, a vector of the present invention can comprise one, two, three, four, five, six, seven, eight, nine, ten, or more desired polynucleotides. "Expose" encompasses any method by which a pest may come into contact with a dsRNA, in which the dsRNA comprises fixed complementary strands, one of which has a nucleotide sequence that is complementary to at least part of the sequence of nucleotide of a target gene of a pest that is going to regulate in a negative way. A pest can be exposed to dsRNA by direct absorption (for example by feeding), which does not require the expression of dsRNA within the pest. Alternatively, a pest may come into direct contact with a composition comprising the dsRNA. For example, a pest may come into contact with a surface or material treated with a composition comprising a dsRNA. A dsRNA can be expressed by a host cell or prokaryotic host organism (for example, but not limited to, a bacterium) or eukaryotic (for example, but not limited to, a yeast). Exogenous: "exogenous", with respect to a nucleic acid, means that the nucleic acid is obtained from non-host organisms. In accordance with the present invention, exogenous DNA or RNA represents nucleic acids that occur naturally in the genetic makeup of viruses, mammals, fish or birds, but that do not occur naturally in the host that is going to be transformed. Therefore, an exogenous nucleic acid is one that codes for, for example, a polypeptide that is not naturally produced by the transformed host. A nucleic acid does not have to code for a protein product. Gene: refers to a polynucleotide sequence comprising control and coding sequences necessary for the production of a polypeptide or precursor. The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence. A gene may constitute an uninterrupted coding sequence or this may include one or more introns, joined by the appropriate splice junctions. Also, a gene may contain one or more modifications in either the coding or untranslated regions that may affect the biological activity or chemical structure of the expression product, the rate of expression, or the manner of expression control. Such modifications include, but are not limited to, mutations, insertions, deletions, and substitutions of one or more nucleotides. In this sense, said modified genes can be referred to as "variants" of the "original" gene. Genetic element: a "genetic element" is any discrete nucleotide sequence such as, but not limited to, a promoter, gene, terminator, intron, enhancer, spacer, 5 'untranslated region, 3' untranslated region, or site of Recombinase recognition. Genetic modification: stable introduction of a nucleic acid into the genome of some organisms through the application of molecular and cellular biology methods. "Gene deletion" or "negative regulation of gene expression" or "inhibition of gene expression" are used interchangeably and refer to a measurable or observable reduction in gene expression or the complete elimination of detectable expression of gene, at the level of protein product and / or mRNA product from the target gene. Negative regulation or inhibition of gene expression is "specific" when negative regulation or inhibition of the target gene occurs without manifesting effects on other genes of the pest. Depending on the nature of the target gene, negative regulation or inhibition of gene expression in cells of a pest can be confirmed by phenotypic analysis of the whole cell or pest or by measurement of mRNA or protein expression using molecular techniques such such as hybridization of RNA in solution, nuclease protection, Northern hybridization, reverse transcription, monitoring of gene expression with a microarray, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blot analysis, radioimmunological test (RIA) ), other immunoassays, or fluorescence activated cell (FACS) analysis. Gymnosperm: as used in the present invention, refers to a plant with seeds that carries the seeds without ovaries. Examples of gymnosperms include conifers, cicadas, ginkgos, and ephedra. Homology, as used in the present invention, refers to sequences; the protein or nucleotide sequences are probably homologous if they show a "significant" level of sequence similarity or more preferably sequence identity. The truly homologous sequences are related by divergence from a common ancestor gene. The sequence homologs can be of two types: (i) in cases where the homologs exist in different species these are known as orthologs, for example, the a-globin genes in mouse and human are orthologous; (ii) paralogs are homologous genes within an individual species, for example, the a-globin and ß-globin genes in mice are paralogs. Host cell: refers to a microorganism, a prokaryotic cell, a eukaryotic cell, or cell line cultured as a unicellular entity that can be, or has been, used as a receptor for a recombinant vector or other transfer of polynucleotides, and includes the progeny of the original cell that has been transfected. The progeny of a single cell may not necessarily be completely identical in morphology or in complement of genomic or total DNA as the original precursor due to natural, accidental or deliberate mutation. Introduction: as used in the present invention, it refers to the insertion of a nucleic acid sequence in a cell, by methods that include infection, transfection, transformation or transduction. Insect pests as used in the present invention, including, but not limited to, come from the order: Lepidoptera, for example, Acleris spp. , Adoxophyes spp. , Aegeria spp. , Agrotis spp. , Alabama argillaceae, Amylois spp. , Antícarsia gemmatalis, Archips spp, Argyrotaenia spp. , Autographa spp. , Busseola fusca, Cadra cautella, Carposina nipponensis, Chilo spp. , Choristoneura spp. , Clysia ambiguella, Cnaphalocrocis spp. , Cnephasia spp. , Cochylís spp. , Coleophora spp. , Crocidolomia binotalis, Cryptophlebia leucotreta, Cydia spp. , Diatraea spp. , Diparopsis castanea, Earias spp. , Ephestia spp. , Eucosma spp. , Eupoecilia ambiguella, Euproctis spp. , Euxoa spp. , Grapholita spp. , Hedya nubíferana, Heliothis spp. , Hellula undalis, Hyphantria cunea, Keiferia lycopersicella, Leucoptera scitella, Lithocollethis spp., Lobesia botrana, Ly antria spp., Lyonetia spp. , Malacosoma spp. , Mamestra brassicae, Manduca sexta, Operophtera spp. , Ostrinia nubilalis, Pammene spp. , Pandemis spp. , Panolis flammea, Pectinophora gossypiella, Phthorimaea operculella, Pieris rapae, Pieris spp. , Plutella xylostella, Prays spp. , Scirpophaga spp. , Sesamia spp. , Sparganothis spp. , Spodoptera spp. , Synanthedon spp. , Thaumetopoea spp. , Tortrix spp. , Trichoplusia ni and Yponomeuta spp.; of the order Coleoptera, for example, Agriotes spp., Anthonomus spp. , Atomaria linearis, Chaetocne to tibialis, Cosmopolites spp., Curculio spp., Der estes spp., Epilachna spp. , Ere nus spp. , Leptinotarsa decemlineata, Líssorhoptrus spp. , Melolontha spp. , Orycaephilus spp. , Otiorhynchus spp. , Phlyctinus spp. , Popillia spp. , Psylliodes spp. , Rhizopertha spp. , Scarabeidae, Sitophilus spp., Sitotroga spp., Tenebrío spp., Tribolíum spp. and Trogoderma spp.; of the order Orthoptera, for example, Blatta spp. , Blattella spp. , Gryllotalpa spp. , Leucophaea maderae, Locusta spp. , Periplaneta ssp. , and Schistocerca spp.; of the order Isoptera, for example, Reticulitemes ssp; of the order Psocoptera, for example Líposcelís spp.; of the order Anoplura, for example, Haematopinus spp. , Linognathus spp. , Pediculus spp. , Pemphigus spp. and Phylloxera spp.; of the order Mallophaga, for example, Damalinea spp. and Trichodectes spp.; of the order Thysanoptera, for example, Franklinella spp., Hercinothrips spp., Taeniothrips spp., Thrips palmi, Thrips tabaci and Scirtothrips aurantii; of the order Heteroptera, for example, Cimex spp., Distantiella. theobroma, Dysdercus spp. , Euchistus spp. , Eurygaster spp. , Leptocorisa spp. , Nezara spp. , Piesma spp. , Rhodnius spp. , Sahlbergella singularis, Scotinophara spp. , Triatoma spp. , family Miridae spp. , such as Lygus hesperus and Lygus lineoloris, family Lygaeidae spp. , such as Blissus leucopterus, and family Pentatomidae spp.; of the order Homoptera, for example, Aleurothríxus floccosus, Aleyrodes brassicae, Aonidiella spp. , Aphididae, Aphis spp., Aspidiotus spp., Bemisia tabaci, Ceroplaster spp., Chrysomphalus aonidium, Chrysomphalus dictyospermi, Coccus hesperidum, Epoasca spp. , Eriosoma larigerum, Erythroneura spp. , Gascardia spp. , Laodelphax spp. , Lacanium corni, Lepidosaphes spp., Macrosiphus spp., Myzus spp. , Nehotettix spp. , Nilaparvata spp. , Paratoria spp. , Pemphigus spp. , Planococcus spp. , Pseudaulacaspis spp. , Pseudococcus spp. , Psylla ssp. , Aethiopic pulvinaria, Quadraspidiotus spp. , Rhopalosiphum spp. , Saissetia spp. , Scaphoideus spp. , Schizaphis spp. , Sitobion spp. , Trialeurodes vaporariorum, Trioza erytreae and Unaspis citri; of the order Hymenoptera, for example, Acromyrmex, Atta spp. , Cephus spp. , Diprion spp. , Diprionidae, Gilpinia polytoma, Hoplocampa spp. , Lasius sppp. , Monomorium pharaonis, Neodiprion spp, Solenopsis spp. and Vespa ssp.; of the order Diptera, for example, Aedes spp. , Antherigona soccata, Bibio hortulanus, Calliphora erythrocephala, Ceratitis spp. , Chrysomyia spp. , Culex spp. , Cuterebra spp. , Dacus spp. , Drosophila melanogaster, Fannia spp. , Gastrophilus spp. , Glossina spp. , Hypoderma spp. , Hyppobosca spp. , Liriomysa spp. , Lucilia spp. , Melanagromyza spp. , Musca ssp. , Oestrus spp. , Orseolia spp. , Oscinella frit, Pegomyia hyoscyami, Phorbia spp. , Rhagoletís pomonella, Sciara spp. , Stomoxys spp. , Tabanus spp. , Tannia spp. and Typula spp. , of the order Syphonaptera, for example, Ceratophyllus spp. and Xenopsylla cheopis and of the order Thysanura, for example, Lepisma saccharina. Monocotyledonous (monocotyledonous) plant is a flowering plant that has embryos with a cotyledon or seed leaf, parallel leaf veins, and floral parts in multiples of three. Examples of monocots include, but are not limited to, grass, corn, rice, oats, wheat, barley, sorghum, orchids, lily, lily, onion, and palm trees. Plague or target pest refers to insects, arachnids, crustaceans, fungi, bacteria, viruses, nematodes, flatworms, earthworms, intestinal worms, hookworms, tapeworms, trypanosomes, schistosomes, blowflies, fleas, ticks, mites, and lice and the like they are invaders in the human environment. A pest may ingest or come in contact with one or more cells, tissues, or products produced by an organism transformed with an agent for suppression of double-stranded gene, as well as a material or surface treated with an agent for suppression of double gene chain. Nematodes, or earthworms, are one of the most common phyla of animals, with almost 20,000 different described species (about 15,000 are parasitic). These are ubiquitous in freshwater, marine, and terrestrial environments, where they often outnumber other animals in both individual and species counts, and are found in sites as diverse as Antarctica and ocean trenches. In addition, there are many parasitic forms, including pathogens in most plants and animals. Nematode-like pests of particular interest include, for example, A. caninum, A. ceylancium, H. contortus, O. ostertagi, C. elegans, C. briggsae, P. pacificus, S. stercoralis, S. ratti, P. trichosuri, M. arenaria, M. chiLwoodi, M. hapla, M. incognita, M. javanica, M. paraensis, G. rostochiensis, G. pallida, H. glycines, H. schattii, P. penetrans, P. vulnus, R. similis, Z. punctata, A. suum, T. canis, B. malayi, D. immitis, O. volvulus, T. vulpis,? spiralis, X. Index. A. duodenale, A. lu bricoides, as well as species from the following genera: Aphelenchoides, Nacobbus, Ditylenchus, Longidorus, Trichodorus, and Bursaphelenchus. "Normal cell" refers to a cell of an untransformed phenotype or exhibiting a morphology of an untransformed cell of the type of tissue being examined. Linked in operable form: combining two or more molecules so that in combination they work properly in a cell. For example, a promoter is operably linked to a structural gene when the promoter controls the transcription of the structural gene. Orthologs are genes that are related by vertical descent from a common ancestor and that code for proteins with the same function in different species. Due to their separation after a species establishment event (speciation), orthologs may diverge, but they generally have similarity in sequence and structural levels. Two genes that are derived from a common ancestor and that code for proteins with similar function are referred to as orthologs. The identification of orthologs is critical for reliable predictions of gene function of genomes to which their sequence has recently been determined.

"Agent for pest control", or "agent for gene suppression" refers to a particular RNA molecule comprising a first segment of RNA and a second segment of RNA, wherein the complementarity between the first and the second RNA segments results in the ability of the two segments to hybridize in vivo and in vitro to form a double-stranded molecule. It may generally be preferable to include a third RNA segment that binds and stabilizes the first and second sequences so that a trunk (stem) linked together at one end of each of the first and second segments can be formed by the third segment to form a loop, such that the entire structure is configured as a stem and loop structure, or even structures that hybridize more tightly can be configured as a woven stem-loop structure. Alternatively, a symmetrical fork can be formed without a third segment in which there is no designed loop, but for steric reasons a fork could create its own loop when the stem is long enough to stabilize itself. The first and second RNA segments are usually within the length of the RNA molecule and are repeats substantially inverted one from the other and linked together by the third RNA segment. The first and second segments correspond invariably and not respectively to a sense sequence and an antisense sequence with respect to the target RNA transcribed from the target gene in the target insect pest that are suppressed by the ingestion of the dsRNA molecule. The pest control agent can also be a substantially purified (or isolated) nucleic acid molecule and more specifically nucleic acid molecules or nucleic acid fragment molecules thereof from a genomic DNA (gDNA) or cDNA library . Alternatively, the fragments may comprise smaller oligonucleotides having from about 15 to about 250 nucleotide residues, and more preferably, from about 15 to about 30 nucleotide residues. Pesticide refers to any substance or mixture of substances intended to prevent, destroy, repel, or lessen any pest. A pesticide can be a chemical or biological agent used against pests including insects, pathogens, weeds, nematodes, and microbes. They compete with humans for food, destroy property, spread disease, or are a nuisance. Phenotype is a distinguishing feature or characteristic of an organism, which can be altered in accordance with the present invention by integrating one or more "desired polynucleotides" and / or markers susceptible to screening and / or selection in the genome of at least one cell. a transformed organism. The "desired polynucleotide (s)" and / or markers can confer a change in the phenotype of a transformed organism, by modification of any of a number of genetic, molecular, biochemical, physiological, characteristics or properties, or morphological changes of the transformed cell or of the organism as a whole. Plant and plant tissue: a "plant" is any of several multicellular organisms, eukaryotes, that present photosynthesis of the Plantae kingdom that as a characteristic produce embryos, contain chloroplasts, and have cellulose cell walls. A part of a plant, ie, a "plant tissue" may be treated in accordance with the methods of the present invention to prevent pest infestation in the plant or part of the plant. Many suitable plant tissues can be treated in accordance with the present invention and include, but are not limited to, somatic embryos, pollen, leaves, stems, calluses, stolons, microtubers, and shoots. Therefore, the present invention contemplates the treatment of angiosperm and gymnosperm plants such as acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beet, birch, beech, blackberry, blueberry, broccoli, Brussels sprout, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), cloves, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine (gum hemlock), American walnut, kale , ki is, kohlrabi (Brassica olerácea Group Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea (Cajanus cajan), pine, pineapple, plantain, plum , pomegranate, potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, vine, walnut, watercress, watermelon, wheat, yams, yew tree , and Italian zucchini. In accordance with the present invention "plant tissue" also encompasses plant cells. Plant cells include suspension cultures, callus, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, seeds and microspores. Plant tissues can be in various stages of maturity and can be grown in liquid or solid culture, or in soil or appropriate medium in pots, greenhouses or fields. A plant tissue also refers to any clone of said plant, seed, progeny, propagule whether generated sexually or asexually, and descendants of any of these, such as cuts or seed. Promoter is meant to mean a nucleic acid, preferably DNA that binds RNA polymerase and / or other transcriptional regulatory elements. As with any promoter, the promoters of the present invention can facilitate or control the transcription of DNA or RNA to generate a mRNA molecule from a nucleic acid molecule that is operably linked to the promoter. As indicated above, the generated RNA can encode a protein or polypeptide or can code for an interfering RNA, or antisense molecule. Polynucleotide is a nucleotide sequence, comprising a sequence encoding a gene or a fragment thereof, a promoter, an intron, an enhancer region, a polyadenylation site, a translation start site, 5 'or 3' regions not translated, a reporter gene, a marker that can be selected similarly. The polynucleotide may comprise single-stranded or double-stranded DNA or RNA. The polynucleotide may comprise modified bases or a modified base structure. The polynucleotide can be genomic, an RNA transcript (such as an mRNA) or a processed nucleotide sequence (such as a cDNA). The polynucleotide can comprise a sequence in any of the sense or antisense orientations. An isolated polynucleotide is a polynucleotide sequence that is not in its original state, for example, the polynucleotide is constituted by a nucleotide sequence not found in Nature or the polynucleotide is separated from the nucleotide sequences with which it is typically present. proximity or is close to nucleotide sequences with which it is typically not in proximity. "Recombinant nucleotide sequence" refers to a nucleic acid molecule containing a genetically engineered modification through manipulation by mutagenesis, restriction enzymes, and the like. RNA interference (RNAi) refers to sequence-specific or gene-specific deletion of gene expression (protein synthesis) that is mediated by short interfering RNA (A Nsi). Sequence identity: as used in the present invention"Sequence identity" or "identity" in the context of two nucleic acid sequences includes reference to the residues in the two sequences that are the same when aligned for maximum correspondence through a specified region. As used in the present invention, percentage of sequence identity means the value determined by comparing two sequences aligned optimally through a comparison window, in which the portion of the polynucleotide sequence in the comparison window it may comprise additions or deletions (i.e., spaces) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions in which the identical nucleic acid bases are presented in both sequences to obtain the number of equalized positions, dividing the number of equalized positions among the total number of positions in the comparison window and multiplying the result by 100 to obtain the percentage of sequence identity. "Sequence identity" has a recognized significance in the art and can be calculated using published techniques. See COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, ed. (Oxford University Press, 1988), BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, ed. (Acaderaic Press, 1993), COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin &; Griffin, eds. , (Humana Press, 1994), SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, Von Heinje ed., Academic Press (1987), SEQUENCE ANALYSIS PRIMER, Gribskov & Devereux, eds. (Macmillan Stockton Press, 1991), and Carillo & Lipton, SIAM J. Applied Math. 48: 1073 (1988). Methods commonly used to determine the identity or similarity between two sequences include but are not limited to those described in GUIDE TO HUGE COMPUTERS, Bishop, ed., (Academic Press, 1994) and Carillo & Lipton, supra. The methods for determining identity and similarity are encoded in computer programs. Methods in preferred computer programs for determining the identity and similarity between two sequences include but are not limited to the GCG program package (Devereux et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul et al., J. Mol. Biol. 215: 403 (1990)), and FASTDB (Brutlag et al., Co. App. Biosci., 6: 237 (1990)).

Short-hair RNAs (shRNAs) are short single-stranded RNA molecules that have a high degree of secondary structure such that a portion of the RNA strand forms a short hairpin loop. Short interfering RNA (siRNA) refers to double-stranded RNA molecules of about 10 to about 30 nucleotides long so named for their ability to specifically interfere with gene protein expression. "Target sequence" refers to a nucleotide sequence in a pest that is selected for suppression or inhibition using double-stranded RNA technology. An objective sequence codes for an essential biological characteristic or activity within a pest. Transcription terminators: The expression DNA constructs of the present invention typically have a transcription termination region at the opposite end of the transcription initiation regulatory region. The transcription termination region can be selected, for stability of the mRNA to increase the expression and / or for the addition of polyadenylation tails added to the gene transcription product. Translation of an incipient polypeptide undergoes termination when any of the three chain termination codons enters site A in the ribosome. The translation termination codons are UAA, UAG, and UGA. Transformation: A procedure by which a nucleic acid is inserted stably into the genome of an organism. The transformation can occur under natural or artificial conditions using various methods well known in the art. The transformation can be based on any known method for the insertion of nucleic acid sequences in a prokaryotic or eukaryotic host cell, including microorganism-mediated transformation, viral infection, by means of minute metal filaments (whiskers), electroporation, microinjection, polyethylene glycol treatment, thermal shock, lipofection, and particle bombardment. Transgenic organism comprises at least one cell in which an exogenous nucleic acid has been stably integrated. A transgenic organism according to the invention is, for example, a host cell or bacterial host organism, or eukaryotic, such as a yeast. The bacterium can be chosen from the group comprising Gram-negative and Gram-positive bacteria, such as, but not limited to, Escherichia spp. (for example E. coli), Bacillus spp. (for example B. thuringiensis), Rhizobium spp., Lactobacillus spp., Lactococcus spp., etc. The yeast can be chosen from the group comprising Saccharomyces spp., Etc.

Variant: it is understood that a "variant", as used in the present invention, means a nucleotide sequence that deviates from the standard amino acid or nucleotide sequence, or given, of a particular gene or protein. The terms, "isoform", "isotype", and "analogue" also refer to "variant" forms of a nucleotide sequence. "Variant" may also refer to a "mixed gene" (shuffled gene) such as those described in the patents assigned to Maxygen. It is understood that the present invention is not limited to the methodology, protocols, vectors, and particular reagents, etc., described in the present invention, since these may vary. It should also be understood that the terminology used in the present invention is used for the purpose of describing only particular embodiments, and is not intended to limit the scope of the present invention. It should be noted that as used in the present invention and in the appended claims, the singular forms "a" "an" and "the" include the plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "a gene" is a reference to one or more genes and includes equivalents thereof known to those skilled in the art, etc.

I. Target Pests The present invention provides methodology and constructs for controlling infestations by pests by administering, or otherwise exposing, a pest to a target coding sequence that represses or inhibits in a post-translational manner a necessary biological function in the pest. As used in the present invention, the term "pest" refers to insects, arachnids, crustaceans, fungi, bacteria, viruses, nematodes, flatworms, earthworms, intestinal worms, hookworms, tapeworms, trypanosomes, schistosomes, blowfly, fleas. , ticks, mites, and lice and the like that are invaders in the human environment. A pest may ingest or come in contact with one or more cells, tissues, or products produced by an organism transformed with an agent for suppression of double-stranded gene, as well as a surface or material treated with an agent for suppression of double gene chain. A "pest resistance" trait is a characteristic of a transgenic host that makes the host resistant to attack from a pest that typically inflicts host damage. Such resistance to pests may arise from a natural mutation or more typically from the incorporation of recombinant DNA that confers resistance to pests. To impart resistance to pests to a transgenic host, for example, a recombinant DNA molecule can be transcribed into an RNA molecule that forms a dsRNA molecule within the tissues or fluids of the recombinant host. The dsRNA molecule is constituted in part by a segment of RNA that is identical to a corresponding RNA segment encoded from a DNA sequence within a pest that prefers to be fed with the recombinant host. The expression of the gene within the target pest is suppressed by the dsRNA, and the suppression of gene expression in the target pest results in the host being resistant to the pest. Appropriate pests include any organism that causes damage to another organism. The invention contemplates in particular insect, nematode, and fungal pests. Insect as used in the present invention can be any insect, meaning any organism that belongs to the Animal kingdom, more specifically to the Phylum Arthropoda, and to the Insecta Class or the Arachnida Class. The methods of the invention can be applied to all insects and that are susceptible to gene silencing by RNA interference and that are capable of internalizing double-stranded RNA from their immediate environment. In one embodiment of the invention, the insect may belong to the following orders: Acari, Araneae, Anoplura, Coleoptera, Collembola, Dermaptera, Dictyoptera, Diplura, Diptera, Embioptera, Ephemeroptera, Grylloblatodea, Hemiptera, Homoptera, Hymenoptera, Isoptera, Lepidoptera, Mallophaga, Mecoptera, Neuroptera, Odonata, Orthoptera, Phasmida, Plecoptera, Protura, Psocoptera, Siphonaptera, Siphunculata, Thysanura, Strepsiptera, Thysanoptera, Trichoptera, and Zoraptera. In preferred but not limiting embodiments and methods of the invention, the insect is chosen from the group consisting of: (1) an insect that is a plant pest, such as but not limited to Nilaparvata spp. (for example N. lugens); Laodelphax spp. (for example L. striatellus); Nephotettix spp. (for example N. virescens or N. cínctíceps, or N. nigropictus); Sogatella spp. (for example S. furcifera); Blissus spp. (for example B. leucopterus leucopterus); Scotinophora spp. (for example S. vermidulate); Acrosternum spp. (for example A. hilare); Parnara spp. (for example P. goifctata); Chilo spp. (for example C. suppressalis, C. auricilius, or C. polychrysus); Chilotraea spp. (for example C. polychrysa); Sesamia spp. (for example S. inferens); Tryporyza spp. (for example T.

Innotata, or T. Incertulas); Cnaphalocrocis spp. (for example C. medinalis); Agromyza spp. (for example A. oryzae, or A. parvicornis); Diatraea spp. (for example D. saccharalis, or D. grandiosella); Narnaga spp. (for example N. aenescens); Xanthodes spp. (for example X. transverse); Spodcptera spp. (for example S. frugiperda, S. exigua, S. littoralis or S. praefica); Mythi na spp. (for example Mythmna { Pseudaletia) seperata); Helicoverpa spp. (for example H. zea); Colaspís spp. (for example C. jbrunnea); Lissorhoptrus spp. (for example L. oryzop ilus); Echinocnemus spp. (for example E. squamos); Díclodíspa spp. (for example D. armigera); Oulema spp. (for example O.

Oryzae); Sitophilus spp. (for example S. oryzae); Pachydiplosis spp. (for example P. oryzae); Hydrellia spp. (for example H. griseola, or H. sasakii); Chlorops spp. (for example C. oryzae); Ostrinia spp. (for example O. nubilalis); Agrotis spp. (for example A. εilon); Elasmopalpus spp. (for example E. lignosellus); Melanotus spp .; Cyclocephala spp. (for example C. jorealis, or C. iiTTmaculata); Popillia spp. (for example, P. japonica); Chaetocnema spp. (for example C. pulicaria); Sphenop orus spp. (for example S. maidis); Rhopalosiphum spp. (for example i?. maidis); Anuraphis spp. (for example A. maidiradicis); Melanoplus spp. (for example M. f emurriL ruin, M. differentialis or M. sanguinipes); Hylemya spp. (for example H. platura); Anaphothrips spp. (for example A. obscrurus); Solenopsis spp. (for example S. milesta); or spp. (for example T. urticae, T. cinnabarinus); Helicoverpa spp. (for example H. zea, or H. armígera); Pectinophora spp. (for example P. gossypiella); Earias spp. (for example E. vittella); Heliothis spp. (for example H. virescens); Antho.no/7ius spp. (for example A. granáis); Pseudatomoscelis spp. (for example P. seriatus); Trialeurodes spp. (for example T. ajutiloneus, T. vaporar! orun?); Bemisía spp. (for example B. argentifolii); Aphis spp. (for example A. _9? 33.}. ?, A. ellifera); Lygus spp. (for example L. lineolaris or L. hesperus); Euschistus spp. (for example E. conspersus); Chlorochroa spp. (for example C. sayi); Atezara spp. (for example N. viridula); Thrips spp. (for example G. tabaci); Frankliniella spp. (for example, fusca, or F. occidentalis); Leptinotarsa spp. (for example L. decemlineata, L. juncta, or L. texana); Lemma spp. (for example L. trilineata); Epitrix spp. (for example E. cucu eris, E. hirtipennis, or E. tuberis); Epícauta spp. (for example E. vi t tata); Empoasca spp. (for example E. fabae); Myzus spp. (for example M. persicae); Paratrioza spp. (for example P. cockerelli); Conoderus spp. (for example C. fallí, or C. vespertinus); Phthorimaea spp. (for example P. operculella); Macrosiphum spp. (for example M. euphorbiae); Thyanta spp. (for example G. pallidovirens); Phthorímaea spp. (for example P. operculella); Helicoverpa spp. (for example H. zea); Keiferia spp. (for example K. lycopersicella); Limonius spp .; Manduca spp. (for example M. sixth, or M. quinquemaculata); Liriomyza spp. (for example L. sativae, L. trifolli or L. huidobrensis); Drosophilla spp. (for example D. melanogaster, D. yakuba, D. pseudoobscura or D. simulans); Carabus spp. (for example C. granulatus); Chironomus spp. (for example C. tentanus); Ctenocephalides spp. (for example C. felis); Diaprepes spp. (for example D. abbreviatus); Ips spp. (for example J. pini); Tríbolium spp. (for example T. castaneiun); Glossina spp. (for example G. norsitans); Anopheles spp. (for example A. gambiae); Helicoverpa spp. (for example H. armigera.); Acyrthosiphon spp. (for example A. pisum); Apis spp. (for example A. melifera); Homalodisca spp. (for example H. coagulate); Aedes spp. (for example Ae aegypti); Bombyx spp. (for example B. morí, B. mandarina); Locusta spp. (for example L. migratoria); Boophilus spp. (for example B. icroplus); Acanthoscurria spp. (for example A. gomesiana); Diploptera spp. (for example D. punctata); Heliconius spp. (for example H. erato or H. melpomene); Curculio spp. (for example C. glandium); Plutella spp. (for example P. xylostella); Amblyomma spp. (for example A. variegatum); Anteraea spp. (for example A. yamamai); Belgium spp. (for example B. antarctica), Be isa spp. (for example B. tabaci), Bicyclus spp., Biphillus spp., Collosobruchus spp., Choristoneura spp., Cicindela spp., Culex spp., Culicoides spp., Diaphorina spp., Diaprepes spp., Euclidia spp., Glossina spp. ., Gryllus spp., Hydropsyche spp., Julodis spp., Lonomia spp., Lutzomyia spp., Lysiphebus spp., Meladema spp., Mycetophagus spp., Nasonia spp., Oncometopia spp., Papilius spp., Pediculus spp., Plodia spp. ., Rhynchosciara spp., Sphaerius spp., Toxoptera spp., Trichoplusa spp., And Armigeres spp. (for example A. subalbatus); (2) an insect that can infest or damage humans and / or animals such as, but not limited to those with perforating-sucking mouthparts, such as those found in Hemiptera and some Hymenoptera and Diptera such as mosquitoes, bees, wasps, lice, fleas and ants, as well as members of the Arachnidae class such as ticks and mites, or family Acariña (ticks and mites) for example, representatives of the families Argasidae, Dermanyssidae, Ixodidae, Psoroptidae or Sarcoptidae and representatives of the species Amblyomma spp., Anocentor spp., Argas spp., Boophilus spp., Cheyletiella spp., Chorioptes spp., Demodex spp., Der acentor spp., Dermanyssus spp., Haemophysalis spp., Hyalomma spp., Ixodes spp., Lynxacarus spp., Mesostigmata spp., Notoedres spp., Ornithodoros spp., Ornithonyssus spp., Otobius spp., otodectes spp., Pneumonyssus spp., Psoroptes spp., Rhipicephalus spp., Sarcoptes spp., or Trombicula spp .; Anoplura (sucking lice and teethers) for example representatives of the species Bovicola spp., Llaematopinus spp., Linognathus spp., Menopon spp., Pediculus spp., Pe phigus spp., Phylloxera spp., Or Solenopotes spp.; Diptera (flies) for example representatives of the species Aedes spp., Anopheles spp., Calliphora spp., Chryso yia spp., Chrysops spp., Cochliomyia spp., Culex spp., Culicoides spp., Cuterebra spp., Dermatobia spp. , Gastrophilus spp., Glossina spp., Haematobia spp., Haematopota spp., Hippobosca spp., Hypoderma spp., Lucilia spp., Lyperosia spp., Melophagus spp., Oestrus spp., Phaenicia spp., Phleboto us spp., Phormia spp., Sarcophaga spp., Simuliu spp., Sto oxys spp., Tabanus spp., Tannia spp. or Typula spp .; Mallophaga (biting lice) for example representatives of the species Damalina spp., Felicola spp., Heterodoxus spp. or Trichodectes spp .; or Siphonaptera (non-winged insects) for example representatives of the species Ceratophyllus spp., spp., Pulex spp., or Xenopsylla spp .; Cimicidae (true bugs) for example representatives of the species Cimex spp., Tritomínae spp., Rhodíníus spp., Or Triatoma spp. and (3) an insect that causes unwanted damage to substrates or materials, such as insects that attack edibles, seeds, wood, paint, plastic, clothing, etc. The methods of the invention can be applied to all nematodes and that are susceptible to gene silencing by RNA interference and that are capable of internalizing double-stranded RNA from their immediate environment. In one embodiment of the invention, the nematode may belong to the family of Heteroderidae, which encompasses the genera Heterodera and Globodera. In the preferred, but non-limiting, embodiments and methods of the invention the insect is selected from the group comprising but not limited to: (1) a nematode that is a pathogenic plant nematode, such as but not limited to: Meloidogyne spp. (for example M. incognita, M. javanica, M. graminicola, M. arenaria, M. chitwoodi, M. hapla or M. paranaensis); Heterodera spp. (for example H. oryzae, H. glycines, H. zeae or H. schachtii); Globodera spp. (for example G. pallida or G. rostochiensis); Rotylenchulus spp. (for example R. reniformis); Pratylenchus spp. (for example P. coffeae, P. zeae or P. goodeyi); Radopholus spp. (for example R. similis); Hirsch aniella spp. (for example H. oryzae); Ancylostoma spp. (for example A. caninum, A. ceylanicum, A. duodenale or A. tubaeforme); Anisakid; Aphelenchoides spp. (for example A. besseyi); Ascarids; Ascaris spp. , (for example A. suum or A. lumbridoides); Bclonolaimus spp .; Brugia spp. (for example B. malayi or B. pahangi); Bursaphelenchus spp .; Caenorhabditis spp. (for example C. elegrans, C. briggsae or C. remanei); Clostridium spp. (for example C. aceto £ &utylicum); Cooperia spp. (for example C. oncophora); Criconemoides spp .; Cyathostomum spp. (for example C. catinatum, C. coronatum or C. pateratum); Cylicocyclus spp. (for example C. insigne, C. nassatus or C. radiatus); Cylcostephanus spp. (for example C. goldi or C. longibursatus); Diphyllobothrium; Dirofilaria spp. (for example D. immitis); Ditylenchus spp. (for example D. dipsaci, D. destructor or D. angustus); Enterobius spp. (for example E. vermicularis); Haemonchus spp. (for example H. contortus); Helicotylenchus spp .; Hoplolaimus spp .; Litomosoides spp. (for example L. sigmodontis); Longidorus spp. (for example L. macrosoma); iVecator spp. (for example JV americanus); Nippostrongylus spp. (for example N. brasiliensis); Onchocerca spp. (for example O. volvulus); Ostertagia spp. (for example O. ostertagrí); Parastrongyloides spp. (for example P. trichosuri); Paratrichodorus spp. (for example P. miror or P. teres); Parelaphostrongylus spp. (for example P. tenuis); Radophulus spp .; Scutellonerna spp .; Strongyloides spp. (for example S. ratti or S. stercoralis); Teladorsagia spp. (for example T. circumcincta); Toxascaris spp. (for example T. leonina); Toxocara spp. (for example T. canis or T. cati); Trichinella spp. (for example T. brítovi, T. spíralis or T. spirae); Trichodorus spp. (for example T. similis); Trichuris spp. (for example T. muris, T. vulpis or T. trichiura); rylenc ulus spp .; Tylenchorhyrichus spp .; CTncinaría spp. (for example U. ster¡ocepha2a); uchereria spp. (for example W. bancrofti); Xiphinema spp. (for example X. Index or X. americanum). (2) a nematode that can infest humans such as, but not limited to: Enterobius vermicularis, the intestinal worm that causes enterobiasis; Ascaris lumbridoides, the large round intestinal worm that causes ascariasis; Necator and Ancylostoma, two types of hookworms that cause hookworm; Trichuris trichiura, the trichina causing trichuriasis; Strongyloides stercoralis causing strongyloidiasis; and Trichonella spirae that causes trichinosis; Brugia malayi and Wuchereria bancrofti, the filarias associated with earthworm infections known as lymphatic filariasis and its obvious manifestation, elephantiasis, and Onchocerca volvulus that causes river blindness. The transfer of nematodes to humans can also occur through mosquitoes that feed on blood that have been fed with infected animals or humans; (3) a nematode that can infest animals such as, but not limited to: dogs (hookworms for example Ancylostoma caninum or Uncinaria stenocephala, Ascaridae for example Toxocara canis or Toxascaris leonina, or trichinae for example Trichuris vulpis), cats (hookworms for example) Ancylostoma tubaeforme, Ascaridae for example Toxocara cati), fish (herring worms or cod worms for example Anisakid, or tapeworms for example Diphyllobothrium), sheep (common worms (Wire worms) for example Haemonchus contortus) and cattle (gastrointestinal worms) for example Ostertagia ostertagi, Cooperia oncophora); (4) a nematode that causes unwanted damage to substrates or materials, such as nematodes that attack edibles, seeds, wood, paint, plastic, clothing, and so on. Examples of such nematodes include but are not limited to Meloidogyne sp. (for example M. incognita, M. javanica, M. arenaria, M. graminicola, M. chitwoodi or M. hapla); Heterodera spp. (for example H. oryzae, H. glycines, H. zeae or H. schachtii); Globodera spp. (for example G. pallida or G. rostochiensis); Ditylenchus spp. (for example D. dipsaci, D. destructor or D. angustus); Belonolaimus spp .; Rotylenchulus spp. (for example R. reniformis); Pratylenchus spp. (for example P. coffeae, P. goodeyi or P. zeae); Radopholus spp. (for example R. si ilis); Hirsch aniella spp. (for example H. oryzae); Aphele-nchoides spp. (for example A. besseyí); Criconemoides spp .; Longidorus spp .; Helicotylenc us spp .; Hoplolaimus spp .; Xíphínema spp .; Paratric odorus spp. (for example P. minor); Tylenchorhynchus spp; (5) virus transmitting nematodes (for example Longidorus macrosoma: transmits the necrotic annular spot virus of the plum tree, Xiphinema americanu - transmits the tobacco ring spot virus, Paratrichadorus teres-, transmits the early pea tanning virus, or Trichodorus similis: transmits tobravirus (tubaceous rattle virus) Fungal pests of particular interest include but are not limited to the following: In one embodiment of the invention, the fungus may be a mold, or more particularly a filamentous fungus In other embodiments of the invention, the fungus may be a yeast In one embodiment the fungus may be an a.scomycete fungus, that is, a fungus belonging to Phylum Ascomycota.In preferred, but non-limiting, embodiments of the invention The fungal cell is selected from the group consisting of: (1) a fungal cell of, or a cell obtained from, a pathogenic plant fungus, such as but not limited to Acremoniella spp. , Alternate spp. (for example Alternaria brassicola or Alternaría solaní), Ascochyta spp. (for example Ascochyta pisí), Botrytis spp. (for example Botrytis cinerea or Botryotinia fuckeliana), Cladosporium spp., Cercospora spp. (for example Cercospora kíkuchíí or Cercospora zaea-maydís), Cladosporium spp. (for example Cladosporium fulvum), Colletotrichum spp. (for example Colletotrichum lindemuthianum), Curvularia spp., Diplodia spp. (for example Diplodia maydis), Erysiphe spp. (for example Erysiphe graminis f.graminis, Erysiphe graminis f.sp.hordei or Erysiphe pisi), Erwinia armylovora, Fusarium spp. (for example Fusarium nivale, Fusarium sporotrichioides, Fusarium oxysporum, Fusarium graminearum, Fusarium germinearum, Fusarium culmorum, Fusarium solani, Fusarium moniliforme or Fusarium roseum), Gaeumanomyces spp. (for example Gaeumanomyces graminis f.sp. tritici), Gihberella spp. (for example Gibberella zeae), Hel inthosporium spp. (for example Hel / ninthosporium turcicum, Helminthosporium carbonum, Helminthosporium mavdis or Helminthosporium sígmoideum), Leptosphaeria salvinii, Macrophomina spp. (for example Macrophomina phaseolina), Magnaportha spp. (for example Magnaporthe oryzae), Mycosphaerella spp., Nectria spp. (for example Nectria heamatococca), Peronospora spp. (for example Peronospora manshurica or Peronospora tabacina), Phoma spp. (for example Phoma betae), Phakopsora spp. (for example Phakopsora pachyrhizi), Phymatotrichum spp. (for example Phymatotrichum omnivorum), Phytophthora spp. (for example Phytophthora cinna omi, Phytophthora cactorum, Phytophthora phaseoli, Phytophthora parasitica, Phytophthora citrophthora, Phytophthora megasperma f.sp.soiae or Phytophthora infestans), Plasmopara spp. (for example Plasmopara viticola), Podosphaera spp. (for example Podosphaera leucotricha), Puccinia spp. (for example Puccinia sorghi, Puccinia striiformis, Puccinia graminis f.sp. tritici, Puccinia asparagi, Puccinia recóndita or Puccinia arachidis), Pythium spp. (for example Pythium aphanidermatum), Pyrenophora spp. (for example, Pyrenophora tritici- repentns or Pyrenophora teres), Pyricularia spp. (for example Pyricularia oryzae), Pythium spp. (for example Pythium ulti um), Rhincosporium secalis, Rhizoctonia spp. (for example Rhizoctonia solani, Rhizoctonia oryzae or Rhizoctonia cerealis), Rhizopus spp. (for example Rhizopus chinensid), Scerotium spp. (for example Scerotium rolfsii), Sclerotinia spp. (for example Sclerotinia sclerotiorum), Septoria spp. (for example Septoria lycopersici, Septoria glycines, Septoria nodorum or Septoria tritici), Thielaviopsis spp. (for example Thielaviopsis basicola), Tilletia spp., Trichoderma spp. (for example Trichoderma virde), Uncinula spp. (for example Uncinula necator), Ustilago mayáis (for example corn blight), Venturia spp. (for example Venturia inaequalis or Venturia pirina) or Vertícillium spp. (for example Verticillium dahliae or Verticillium albo-atru); (2) a fungal cell of, or a cell obtained from, a fungus that can infest humans such as, but not limited to, Canáida spp., Particularly Candida albicans; Dermatophytes including Epiáermophyton spp., Trichophyton spp, and Microsporum spp .; Aspergillus spp. (particularly Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger or Aspergillus terreus); Blastomyces dermati tidis; Paracoccidioides brasiliensis; Coccidioides im itis; Cryptococcus neoformans; Histoplasma capsulatu var. capsulatum or var. duboisii; Sporothrix schenckii; Fusarium spp .; Scopulariopsis brevicaulis; Fonsecaea spp .; Penicilliu spp .; or the group of fungi Zygomycetes (particularly Absidia corymbifera, Rhizomucor pusillus or Rhizopus arrhizus); (3) a fungal cell of, or a cell obtained from, a fungus that can infest animals such as, but not limited to Candida spp., Microsporum spp. (particularly Microsporum canis or Microsporu gypseum), Trichophyton mentagrophytes, Aspergillus spp. , or Cryptococcus neoforman, - and (4) a fungal cell of, or a cell obtained from, a fungus that causes unwanted damage to substrates or materials, such as fungi that attack edibles, seeds, wood, paint, plastic, clothing, etc. Examples of such fungi are molds, including but not limited to Stachybotrys spp., Aspergillus spp., Alternaria spp., Cladosporium spp., Penicillium spp. or Phanerochaete chrysosporium.

II. Identification of target sequences The present invention provides a method for identifying and obtaining a nucleic acid comprising a nucleotide sequence to produce a dsRNA or siRNA. For example, said method comprises: (a) probing a cDNA or genomic DNA library with a probe for hybridization comprising all or a portion of a nucleotide sequence or a homologue thereof from a pest chosen as a target; (b) identifying a DNA clone that hybridizes with the probe for hybridization; (c) isolating the DNA clone identified in step (b); and (d) determining the sequence of the cDNA fragment or genomic DNA comprising the clone isolated in step (c) in which the nucleic acid molecule to which the sequence is determined transcribes all or a substantial portion of the sequence of RNA nucleic acid or a homologue thereof. Additionally, the present invention contemplates a method for obtaining a nucleic acid fragment comprising a nucleotide sequence to produce a substantial portion of a dsRNA or siRNA comprising: (a) synthesizing the first and second oligonucleotide primers corresponding to a portion of one of the nucleotide sequences from a pest chosen as target; and (b) amplifying a template of cDNA or genomic DNA in a cloning vector using the first and second oligonucleotide primers of step (a) in which the amplified nucleic acid molecule transcribes a substantial portion of a dsRNA or siRNA from the present invention. In the practice of the present invention, a target gene can be obtained from any pest that causes damage to another organism. Various criteria can be used in the selection of the preferred target genes. The gene is one whose protein product has a rapid turnover rate, such that the inhibition of dsRNA results in a rapid reduction in protein levels. In some embodiments, it is convenient to select a gene for which a small fall in the level of expression results in deleterious effects for the recipient pest. If it is desired to target a wide range of insect species, for example, a gene that is highly conserved throughout said species is selected. On the contrary, for the purposes of conferring specificity, in some embodiments of the invention, a gene is selected that contains regions that are poorly conserved between individual insect species, or between insects and other organisms. In some embodiments it may be desirable to select a gene that has no known counterparts in other organisms. As used in the present invention, the term "derived from" refers to a specified nucleotide sequence that can be obtained from a particular source or specified species, although not necessarily directly from said source or species specified In one embodiment, a gene that is expressed in the insect's intestine is selected. Selecting genes expressed in the intestine as target avoids the need for the dsRNA to be distributed within the insect. Target genes for use in the present invention may include, for example, those that share substantial homologies with the nucleotide sequences of known genes expressed in the intestine that encode protein components of the plasma membrane proton V-ATPase (Dow et al. al., 1997; Dow, 1999). This protein complex is the only energizer of epithelial ion transport and is responsible for the alkalinization of the midgut lumen. V-ATPase is also expressed in the Malpighi tubule, a branch of the hindgut of the insect that functions in fluid balance and detoxification of foreign compounds in a manner analogous to a kidney of a mammal. In another embodiment, a gene that is essentially involved in the growth, development, and reproduction of an insect is selected. Exemplary genes include but are not limited to the structural subunits of the ribosomal proteins and a beta monomeric cover unit gene (beta-coatámer), CHD3 gene. Ribosomal proteins such as S4 (RpS4) and S9 (RpS9) are structural constituents of the ribosome involved in the biosynthesis of proteins and which are components of the small ribosomal subunit of the cytosol, ribosomal proteins such as L9 and L19 are structural constituents of the ribosome involved in protein biosynthesis that are located in the ribosome. The beta-coatamer gene in C. elegans codes for a protein that is a subunit of a multimeric complex that forms a membrane vesicle envelope. Similar sequences have been discovered in various organisms such as Arabidopsis thaliana, Drosophila melanogaster, and Saccharomyces cerevisiae. Related sequences are found in diverse organisms such as Leptinotarsa decemlineata, Phaedon cochleariae, Epilachna varivetis, Anthonomus granáis, Tribolium castaneum, Myzus persicae, Nilaparvata lugens, Chilo suppressalis, Plutella xylostella and Acheta domesticus. Other target genes for use in the present invention can include, for example, those that play important roles in viability, growth, development, reproduction, and infectiousness. These target genes include, for example, maintenance genes, factors of. transcription, and insect-specific genes or lethal deletion mutations in Caenorhabdi tis or Drosophila. The target genes for use in the present invention can also be those that come from other organisms, for example, from the nematode (for example, Meloidogyne spp., Or Heterodera spp.), Other insects or arachnids (for example Leptinotarsa spp., Phaedon spp., Epilachna spp., Anthonomus spp., Trijolium spp., Myzus spp., Nilaparvata spp., Chilo spp., Plutella spp., Or Acheta spp. Additionally, the nucleotide sequences for use as a target sequence in the present invention they can also be obtained from viral, bacterial, fungal, insect or fungal genes whose functions have been established from the literature and whose nucleotide sequences share substantial similarity with the target genes in the genome of an insect For many of the insects that are potential targets for control by the present invention, there could be limited information regarding the sequences of most genes or the phenotype which results from the mutation of particular genes. Therefore, genes can be selected on the basis of available information concerning the corresponding genes in a model organism, such as Caenorhabditis or Drosophila, or in some other insect species. Genes can also be selected based on sequence information available for other species, such as a nematode or fungal species, in which the genes have been characterized. In some cases it may be possible to obtain the sequence of a corresponding gene from a target insect through research in databases, such as GenBank, using either the name of the gene or the sequence of the gene. Once the sequence is obtained, PCR can be used to amplify an appropriately selected segment of the gene in the insect for use in the present invention.

In order to obtain a segment of DNA from the corresponding gene in an insect species, for example, PCR primers can be designed on the basis of the sequence as found in C. elegans or Drosophila, or an insect from the which gene has already been cloned. The primers are designed to amplify a DNA segment of sufficient length for use in the present invention. The amplification conditions are selected such that the amplification occurs even if the primers do not exactly match the target sequence. Alternatively, the gene, or a portion thereof, can be cloned from a genomic DNA library or cDNA prepared from the insect pest species, using an insect gene known as a probe. The techniques for carrying out PCR and cloning from libraries are known. The examples provide additional details of the procedure by which DNA segments from the target pest insect species can be isolated based on the sequence of genes previously cloned from an insect species. The person skilled in the art will recognize that a variety of techniques can be used to isolate gene segments from insect species that correspond to previously isolated genes from other species.

III. Methods for inhibiting or suppressing an objective gene The present invention provides methods for inhibiting gene expression of a gene or multiple target genes in a target pest using stabilized dsRNA methods. The invention is particularly useful for modulating the expression of eukaryotic genes, in particular for modulating the expression of genes present in pests exhibiting a pH level of the digestive system ranging from about 4.5 to about 9.5, more preferred from about 5.0 to about 8.0 , and even more preferred from about 6.5 to about 7.5. For pests with a digestive system having pH levels outside these ranges, delivery methods for use that do not require the ingestion of dsRNA molecules may be desired. The methods of the invention encompass the simultaneous or sequential provision of two or more double-stranded RNA molecules or RNA constructs to the same insect, so that negative regulation or inhibition of multiple target genes is obtained or a more potent inhibition of a single target gene. Alternatively, multiple targets are affected (hit) by the provision of a double-stranded RNA that affects multiple target sequences, and a single target is more efficiently inhibited by the presence of more than one copy of the double-stranded RNA fragment. chain corresponding to the target gene. Therefore, in one embodiment of the invention, the construction of double-stranded RNA comprises multiple regions of dsRNA, at least one chain of each dsRNA region comprises a nucleotide sequence that is complementary to at least part of a sequence of target nucleotide of an insect target gene. According to the invention, the dsRNA regions in the RNA construct may be complementary to the same target genes or to different target genes and / or the dsRNA regions may be complementary to targets from the same insect species or species. different from insects. The use of said dsRNA constructs in a plant host cell thus establishes a more potent resistance towards a single species of or towards multiple species of insects in the plant. In one embodiment, the double-stranded RNA region comprises multiple copies of the nucleotide sequence that is complementary to the target gene. Alternatively, the dsRNA affects more than one target sequence of the same target gene. The invention therefore encompasses isolated double-stranded RNA constructs comprising at least two copies of said nucleotide sequence complementary to at least part of a nucleotide sequence of an insect target. The ARNds that affect more than one of the aforementioned objectives, or a combination of different dsRNAs against objectives different from the aforementioned objects are developed and used in the methods of the present invention. The dsRNA nucleotides and the appropriate dsRNA constructs are descr by the applicant in WO2006 / 046148, which is incorporated in the present invention in its entirety. The terms "affect (hit)", "affect", and "affect" are alternative words to indicate that at least one of the dsRNA chains is complementary to, and as such may be attached to, the gene or nucleotide sequence. objective. The modulating effect of dsRNA can be applied to a variety of genes expressed in pests including, for example, endogenous genes responsible for cellular metabolism or cellular transformation, including maintenance genes, transcription factors, and other genes encoding polypeptides involved in the cellular metabolism. As used in the present invention, the phrase "inhibiting gene expression" or "inhibiting the expression of a target gene in a pest cell" refers to the absence (or observable reduction) in the protein level. and / or mRNA product from the target gene. Specificity refers to the ability to inhibit the target gene without manifesting effects on other genes in the cell and without any effect on any gene within the cell that is producing the dsRNA molecule. The inhibition of gene expression of the target gene in the pest may result in novel phenotypic traits in the pest. "Gene suppression" refers to any of the well-known methods for reducing gene transcription levels for mRNA and / or subsequent translation of the mRNA. "Gene suppression" is also intended to mean the reduction of protein expression from a gene or a coding sequence including gene deletion subsequent to transcription and deletion during transcription. The post-transcription gene deletion is mediated by the homology between the whole or a part of a mRNA transcr from a gene or coding sequence chosen as target for suppression and the corresponding double-stranded RNA used for suppression, and refers to the substantial and measurable reduction in the amount of mRNA available in the cell for binding by ribosomes. The transcr RNA may be in the sense orientation to effect what is known as co-suppression, in antisense orientation to effect what is known as antisense suppression, or in both orientations producing a dsRNA to effect what is known as antisense interference. RNA (RNAi). Deletion in transcription is mediated by the presence in the cell of an agent for suppression of dsRNA gene that presents substantial sequence identity to a promoter DNA sequence or complement thereof to effect what is known as trans deletion. of promoter. Gene suppression may be effective against an original host gene associated with a trait, for example, to provide the host with reduced levels of one. protein encoded by the original gene or with reduced or increased levels of an affected metabolite. Gene suppression may also be effective against target genes in pests that can ingest or come in contact with material containing gene suppression agents, specifically designed to inhibit or suppress the expression of one or more homologous or complementary sequences in the cells of the plague. A beneficial method of post-transcription gene deletion in hosts uses transcr RNA oriented in both the sense direction and the antisense direction, which is stabilized, for example, as a hairpin and stem structure and loop. A preferred DNA construct for effecting post-transcription gene deletion is one in which a first segment encodes an RNA having an antisense orientation that exhibits substantial identity with a segment of a gene chosen as target for deletion, which is linked to a second segment in sense orientation that codes for an RNA that presents substantial complementarity with the first segment. Said construction forms a stem and loop structure by hybridization of the first segment with the second segment and a loop structure from the nucleotide sequences that link the two segments (see WO94 / 01550, WO98 / 05770, US 2002/0048814). , and US 2003/0018993). In accordance with one embodiment of the present invention, a nucleotide sequence is provided, for which expression in vitro results in the transcription of a stabilized RNA sequence that is substantially homologous to an RNA molecule of a gene chosen as a target in a pest comprising an RNA sequence encoded by a nucleotide sequence within the genome of the pest. Therefore, after the pest absorbs the stabilized RNA sequence, or is otherwise exposed to the dsRNA, a negative regulation of the nucleotide sequence corresponding to the target gene is effected in the cells of a target pest. Inhibition of a target gene using the stabilized dsRNA technology of the present invention is sequence specific in the sense that the nucleotide sequences corresponding to the duplex region of the RNA are chosen as targets for genetic inhibition. For inhibition, RNA containing a nucleotide sequence identical to a portion of the target gene is preferred. It has also been found that RNA sequences with insertions, deletions, and single point mutations relative to the target sequence are effective for inhibition. In the performance of the present invention, it is preferred that the inhibitor dsRNA and the target gene portion share at least about 80% sequence identity, or about 85% sequence identity, or about 90% sequence identity, or about 95% sequence identity, or about 99% sequence identity, or even about 100% sequence identity. Alternatively, the RNA duplex region can be defined functionally as a nucleotide sequence that can hybridize to a portion of the transcript of the target gene. A sequence of less than complete length exhibiting a greater homology compensates with respect to a longer less homologous sequence. The length of the identical nucleotide sequences can be at least about 25, 50, 100, 200, 300, 400, 500 or at least about 1000 bases. Normally, a sequence greater than 20-100 nucleotides should be used, although a sequence of more than about 200-300 nucleotides could be preferred, and a sequence greater than about 500-1000 nucleotides, depending on the size of the target gene, could be especially preferred. . The invention has the advantage of being able to tolerate sequence variations that could be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. It is not necessary that the introduced nucleic acid molecule is of absolute homology, it is not necessary that it be of full length, relative to either the primary transcription product or mRNA processed completely from the target gene. Therefore, those skilled in the art will appreciate that, as described in the present invention, 100% sequence identity between the RNA and the target gene is not necessary to practice the present invention.

IV. Methods for preparing dsRNA dsRNA molecules can be synthesized in vivo or in vitro. The dsRNA may be formed by a single strand of self-complementary RNA or from two complementary RNA strands. Endogenous RNA polymerase in the cell can mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vivo or in vi tro. Inhibition can be directed by specific transcription in an organ, tissue, or cell type; stimulation of an environmental condition (for example, infection, stress, temperature, chemical inducers); and / or genetically manipulated transcription in a stage or age of development. The RNA strands may or may not be polyadenylated; the RNA strands may or may not be capable of being translated as a polypeptide by the translation apparatus of a cell. One skilled in the art can chemically or enzymatically produce an RNA, dsRNA, siRNA, or miRNA of the present invention through manual or automated reactions or in vivo in another organism. RNA can also be produced by partial or total organic synthesis; any modified ribonucleotide can be introduced by organic or enzymatic synthesis in vitro. The RNA can be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3, T7, SP6). The use and production of an expression construct are known in the art (see, for example, WO 97/32016, patents E.U.A. Nos. ,593,874; 5,698,425; 5,712,135; 5,789,214, and 5,804,693). If it is synthesized chemically or by enzymatic synthesis in vitro, the RNA can be purified before it is introduced into the cell. For example, the RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, the RNA can be used without purification or with a minimum of purification to avoid losses due to sample processing. The RNA can be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to promote fixation, and / or stabilization of the double chains.

V. Polynucleotide Sequences Nucleotide sequences are provided according to the invention, the expression of which results in an RNA sequence that is substantially homologous to an RNA molecule of a target gene in a pest comprising an encoded RNA sequence. by a nucleotide sequence within the pigeon's genome. Therefore, after ingestion of the dsRNA sequence, a negative regulation of the nucleotide sequence of the target gene can be obtained in the cells of the pest which results in a detrimental effect on maintenance, viability, proliferation, reproduction, and infestation of the plague. Each "nucleotide sequence" indicated in the present invention is presented as a sequence of deoxyribonucleotides (abbreviated A, G, C and T). However, "nucleotide sequence" of a nucleic acid molecule or polynucleotide is intended, for a DNA molecule or polynucleotide, to be a deoxyribonucleotide sequence, and for an RNA molecule or polynucleotide, the corresponding sequence of ribonucleotides (A, G, C and U) wherein each deoxynucleotide thymidine (T) in the specified deoxynucleotide sequence is replaced by the ribonucleotide uridine (U). As used in the present invention, "Nucleic acid" refers to a single or double chain polymer of deoxyribonucleotide or ribonucleotide type bases that are read from the 5 'end to the 3' end. A nucleic acid may also optionally contain nucleotide-type bases not present in nature or altered that allow correct reading thereon by a polymerase and which do not reduce the expression of a polypeptide encoded by said nucleic acid. "Nucleotide sequence" or "nucleic acid sequence" refers to both the sense and antisense strands of a nucleic acid either as single strands or in the duplex. The term "ribonucleic acid" (AR) is inclusive of RNAi (inhibitory RNA), DsRNA (double-stranded RNA), siRNA (small interfering RNA), mRNA (messenger RNA), miRNA (micro-RNA), tRNA (transfer RNA, either loaded or unloaded with a corresponding acylated amino acid), and mRNA ( Complementary RNA) and the term "deoxyribonucleic acid" (DNA) includes cDNA and genomic DNA and DNA-RNA hybrids. The words "nucleic acid segment", "nucleotide sequence segment", or more generally "segment" will be understood by those skilled in the art as a functional term that includes both genomic sequences, ribosomal RNA sequences, Transfer RNA, messenger RNA sequences, operon sequences or smaller genetically engineered nucleotide sequences that express or can be adapted to express, proteins, polypeptides or peptides. Accordingly, the present invention relates to an isolated nucleic molecule comprising a polynucleotide having a sequence that is selected from the group consisting of any of the polynucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 16 86, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481. The invention also provides functional fragments of the polynucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 1 4 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730- 2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481. The invention also provides complementary nucleic acids, or fragments thereof, for any of the polynucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 4 78, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481, as well as a nucleic acid, comprising at least 15 contiguous bases, which hybridizes to any of the polynucleotide sequences of SEQ ID. NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481. The present invention also provides orthologous sequences, and complements and fragments thereof, of the polynucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481 of the invention. Accordingly, the invention encompasses target genes that are insect orthologs of a gene comprising a nucleotide sequence as represented in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384- 2460, 2461, 2466, 2471, 2476 and 2481. A mane For example, insect orthologs may comprise a nucleotide sequence as represented in any of SEQ ID NOs: 49-123, 275-434, 533-562, 621-738, 813-852, 908-1010, 1161- 1437, 1730-1987, 2120-2290, 2384-2438, or a fragment thereof of at least 15, 16, 17, 18, 19, , 21, 22, 23, 24, 25, 26 or 27 nucleotides. A non-limiting list of genes or orthologous insect or arachnid sequences comprising at least one fragment of 15, preferably at least 17 bp of one of the sequences of the invention is provided in Tables 33-42. The invention also encompasses target genes that are nematode orthologs of a gene comprising a nucleotide sequence as represented in any of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045 , 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368 , 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476, and 2481 of the invention. By way of example, the nematode orthologs may comprise a nucleotide sequence as represented in any of SEQ ID NOs: 124-135, 435-446, 563, 564, 739-751, 853, 854, 1011-1025, 1438 -1473, 1988-2001, 2291-2298, 2439-2440 of the invention, or a fragment of at least 15, 16, 17, 18, 19, 20 or 21 nucleotides thereof. According to another aspect, the invention therefore encompasses any of the methods described in the present invention to control nematode growth in an organism, or to prevent infestation by nematodes of an organism susceptible to nematode infection, which comprises contacting nematode cells with a double-stranded RNA, in which the double-stranded RNA comprises fixed complementary strands, one of which has a nucleotide sequence that is complementary to at least part of the nucleotide sequence of a gene target comprising a fragment of at least 17, 18, 19, 20 or 21 nucleotides of any of the sequences as represented in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576 , 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868 , 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089 , 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622 , 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039 , 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364 , 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481, in which the double-stranded RNA is absorbed by the fungus and thus controls the growth prevent or prevent infestation. The invention also relates to transgenic nematode resistant plants comprising a fragment of at least 17, 18, 19, 20 or 21 nucleotides of any of the sequences as represented in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 16 96, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120- 2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481. A non-limiting list of genes or orthologous nematode sequences comprising at least one fragment of 15, preferably at least 17 bp of one of the sequences of the invention is provided in Tables 43-52. According to another embodiment, the invention encompasses target genes which are fungal orthologs of a gene comprising a nucleotide sequence as represented in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15 , 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251 , 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596 , 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888 , 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097 , 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, .1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1 702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481 of the invention. By way of example, fungal orthologs may comprise a nucleotide sequence as represented in any of SEQ ID NOs: 136-158, 447-472, 565-575, 752-767, 855-862, 1026-1040, 1474- 1571, 2002-2039, 2299-2338, 2441-2460, or a fragment of at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides thereof. According to another aspect, the invention therefore encompasses any of the methods described in the present invention for controlling fungal growth in a cell or an organism, or for preventing fungal infestation of a cell or an organism susceptible to fungal infection, which comprises contacting fungal cells with a double-stranded RNA, in which the double-stranded RNA comprises fixed complementary strands, one of which has a nucleotide sequence that is complementary to at least part of the nucleotide sequence of an objective gene comprising a fragment of at least 17, 18, 19, 20 or 21 nucleotides of any of the sequences as represented in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576 , 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868 , 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1. 1.03, 1105, 1107, 1109, 1111, 1113, 1161 -1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481, in which the double-stranded RNA is absorbed by the fungus and thus controls growth or prevents infestation. The invention also relates to fungal resistant transgenic plants comprising a fragment of at least 17, 18, 19, 20 or 21 of any of the sequences as represented in SEQ ID NOs: 1, 3, 5, 7, 9 , 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230 , 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533- 575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813- 862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 -2460, 2461, 2466, 2471, 2476 and 2481. A non-limiting list of genes or fungal orthologous sequences comprising at least one fragment of 15, preferably at least 17 bp of one of the sequences of the invention is provided in Tables 53-62. In a further embodiment, a dsRNA molecule of the invention comprises any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160 , 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478 , 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768 , 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046 , 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113 , 1161-1571, 1572, .1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481, although the sequences indicated in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198 , 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517 , 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799 , 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079 , 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647 , 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060 , 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 -2460, 2461, 2466, 2471, 2476 and 2481 are not limiting. A dsRNA molecule of the invention can comprise any contiguous target gene from a pest species (eg, from about 15 to about 25 or more, or about 15, 16, 17, 18, 19, 20, 21, 22, 23 , 24, or 25 or more contiguous nucleotides). By the phrase "isolated" nucleic acid molecule (s) is meant a nucleic acid molecule, DNA or RNA, which has been removed from its original environment. For example, recombinant DNA molecules contained in a DNA construct are considered as isolated for the purposes of the present invention. Additional examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or DNA molecules purified (partially or substantially) in solution. Isolated RNA molecules include in vitro RNA transcripts of the DNA molecules of the present invention. Isolated nucleic acid molecules, in accordance with the present invention, also include those molecules that are produced by synthesis. The nucleic acid molecules of the present invention can be in the form of RNA, such as mRNA, or in the form of DNA, including, for example, cDNA and genomic DNA obtained by cloning or produced by synthesis. The DNA or RNA can be double stranded or single stranded. The single-stranded DNA can be the coding strand, also known as the sense strand, or it can be the non-coding strand, also known as the antisense strand.

SAW . Sequence analysis Unless indicated otherwise, all nucleotide sequences determined by sequence determination of a DNA molecule in the present invention are determined using an automated DNA sequence determination apparatus (such as model 373 of Applied Biosystems, Inc.). Therefore, as is known in the art, for any DNA sequence whose sequence is determined by this automated strategy, any nucleotide sequence determined in the present invention may contain some errors. The nucleotide sequences determined by automation are typically at least about 95% identical, more typically at least about 96% up to at least about 99.9% identical to the actual nucleotide sequence of the DNA molecule to which it is attached. determines its sequence. The actual sequence can be determined more accurately using other strategies including manual DNA sequence determination methods well known in the art. As is also known in the art, a single insertion or deletion in a given nucleotide sequence compared to the actual sequence may result in a frame shift in the translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a The given nucleotide sequence can be completely different from the amino acid sequence actually encoded by the DNA molecule to which its sequence is determined, starting at the point of said insertion or deletion. In another aspect, the invention provides an isolated nucleic acid molecule comprising a polynucleotide that hybridizes under stringent a hybridization conditions. a. portion of the polynucleotide in a nucleic acid molecule of the invention described above. By the phrase, a polynucleotide that hybridizes to a "portion" of a polynucleotide is meant a polynucleotide (either DNA or RNA) that hybridizes to at least about 15 nucleotides, and more preferred to at least about 20 nucleotides, and even more preferred at least about 30 nucleotides, and even more preferably more than 30 nucleotides of the reference polynucleotide. These fragments that hybridize to the reference fragments are useful as diagnostic probes and as primers. For the purposes of the present invention, two sequences hybridize when they form a double-stranded complex in a hybridization solution of 6X SSC, 0.5% SDS, Denhardt 5X solution and 100 iq of non-specific carrier DNA. See Ausubel et al., Section 2.9, supplement 27 (1994). The sequences can be hybridized to a "moderate stringency", which is defined as a temperature of 60 ° C in a 6X SSC hybridization solution, 0.5% SDS, 5X Denhardt's solution and 100 g of non-specific carrier DNA. For hybridization to "high astringency", the temperature increases to 68 ° C. After the hybridization reaction to moderate astringency, the nucleotides are washed in a solution of 2X SSC plus 0.05% SDS for five times at room temperature, with subsequent washes with 0. IX SSC plus 0.1% SDS at 60 ° C during 1 hour. For high astringency, the wash temperature increases to 68 ° C. For purposes of the invention, hybridized nucleotides are those that are detected using 1 ng of a radiolabelled probe having a specific radioactivity of 10,000 cpm / ng, in which the annealed nucleotides are clearly visible after exposure to a lightning film. X at -70 ° C for no more than 72 hours. The present application is directed to said nucleic acid molecules which are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99 % or 100% identical to a nucleic acid sequence described in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472 , 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621 -767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040 , 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109 , 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672 , 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085 , 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476 and 2481. However, it is preferred n Nucleic acid molecules that are at least 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence shown in SEQ ID NOs: 1, 3, 5, 7, 9 , 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230 , 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581 , 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873 , 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091 , 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627 , 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040 , 2045, 2050, 2055, 2060, 20 65, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384- 2460, 2461, 2466, 2471, 2476 and 2481. Differences between two nucleic acid sequences can occur at the 5 'or 3' terminal positions of the reference nucleotide sequence or anywhere between said terminal positions, interspersed either individually between the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. As a practical matter, the fact that any particular nucleic acid molecule is at least 95%, 96%, 97%, 98% or 99% identical to a reference nucleotide sequence refers to a comparison made between two molecules using standard algorithms well known in the art and can be determined in conventional manner using publicly available computer programs such as the BLASTN algorithm. See Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997). In one embodiment of the invention, a nucleic acid comprises an antisense strand having from about 15 to about 30 (eg, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, or 30) nucleotides, in which the antisense strand is complementary to an RNA sequence or a portion thereof that codes for a protein that controls the cell cycle or homologous recombination, and in which said A if it also comprises a sense string having from about 15 to about 30 (for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , or 30) nucleotides, and wherein said sense strand and said antisense strand are distinct nucleotide sequences in which at least about 15 nucleotides in each strand are complementary to the other strand. In one embodiment, the present invention provides double-stranded nucleic acid molecules that mediate gene silencing by RNA interference. In another modality, the siRNA molecules of the invention consist of double nucleic acid molecules containing about 15 to about 30 base pairs between the oligonucleotides comprising about 15 to about 30 (eg, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides. In yet another embodiment, the ANsi molecules of the invention comprise double nucleic acid molecules with pendant ends of from about 1 to about 32 (e.g., about 1, 2, or 3) nucleotides, e.g., double molecules of about 21. nucleotides with approximately 19 base pairs and pendant portions of mononucleotides, dinucleotides, and 3 'terminal trinucleotides. Even in another embodiment, the A molecules of the invention comprise double nucleic acid molecules with blunt ends, where both ends are blunt, or alternatively, where one end is blunt. An ANsi molecule of the present invention can comprise modified nucleotides and at the same time maintain the ability to mediate AR i. The modified nucleotides can be used to improve in vitro or in vivo characteristics such as stability, activity, and / or bioavailability. For example, an ANsi molecule of the invention can comprise modified nucleotides as a percentage of the total number of nucleotides present in the ANsi molecule. Therefore, an ANsi molecule of the invention can generally comprise from about 5% to about 100% modified nucleotides (e.g., about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of modified nucleotides). The actual percentage of modified nucleotides present in a given ANSI molecule will depend on the total number of nucleotides present in the ANsi. If the ANSI molecule is single stranded, the percent modification can be based on the total number of nucleotides present in the single stranded ANSi molecules. Similarly, if the A molecule is double-stranded, the percent modification can be based on the total number of nucleotides present in the sense strand, antisense strand, or both sense and antisense strands.

VII. Nucleic acid constructs A recombinant nucleic acid vector can be, for example, a linear plasmid or a closed circular plasmid. The vector system can be a single vector or plasmid or two or more vectors or plasmids that together contain the total nucleic acid that will be introduced into the genome of the bacterial host. In addition, a bacterial vector can be an expression vector. Nucleic acid molecules as indicated in SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 161, 162, 163 , 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240-246, 247, 249, 251, 253, 255, 257, 259, 275-472, 473 , 478, 483, 488, 493, 498, 503, 508-512, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609 , 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908 -1040, 1041, 1046, 1051, 1056, 1061, 1066-1070, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103 , 1105, 1107, 1109,, mi, 1113, 1161 -1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384- 2460, 2461, 2466, 2471, 2476 and 2481, or fragments thereof may be inserted in an appropriate manner, for example, into a vector under the control of an appropriate promoter that functions in one or more microbial hosts to control the expression of a ligated coding sequence or other DNA sequence. Many vectors are available for this purpose, and the selection of the appropriate vector depends mainly on the size of the nucleic acid to be inserted into the vector and of the particular host cell that will be transformed with the vector. Each vector contains several components depending on its function (DNA amplification or DNA expression) and the particular host cell with which it is compatible. The vector components for bacterial transformation usually include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more selectable marker genes, and an inducible promoter that allow the expression of exogenous DNA.

Promoters "Operably linked", as used with reference to a regulatory sequence and a structural nucleotide sequence, means that the regulatory sequence causes regulated expression of the ligated structural nucleotide sequence. "Regulatory sequences" or "control elements" refer to nucleotide sequences located toward the 5 'end (5' non-coding sequences), within, or toward the 3 'end (3' untranslated sequences) of a nucleotide sequence structural, and which influences the synchronization and level or amount of transcription, processing or stability of the RNA, or translation of the associated structural nucleotide sequence. Regulatory sequences may include promoters, translation leader sequences, introns, enhancers, stem-loop structures, repressor-binding sequences, and polyadenylation recognition sequences and the like. An expression vector for producing an mRNA can also contain an inducible promoter which is recognized by the host bacterial organism and which is operably linked to the nucleic acid encoding, for example, the nucleic acid molecule encoding the mRNA or fragment. of interest of D. v. virgifera of interest. Suitable inducible promoters for use with bacterial hosts include the β-lactamase promoter, the PL and PR promoters of the phage? of E. coli, and the E. coli galactose promoter, arabinose promoter, alkaline phosphatase promoter, tryptophan (trp) promoter, and the lactose operon promoter and variations thereof and hybrid promoters such as the tac promoter. However, other known inducible bacterial promoters are suitable. In some embodiments, genes can be obtained from different insects in order to broaden the range of insects against which the agent is effective. When multiple genes for deletion or a combination of expression and deletion are targeted, a polycistronic DNA element can be manufactured as illustrated and described in Fillatti, Application Publication No. US 2004-0029283.

Selectable marker genes A vector or recombinant DNA construct of the present invention typically comprises a selectable marker that confers a selectable phenotype on the transformed cells. Selectable markers can also be used to select cells containing the exogenous nucleic acids encoding the polypeptides or proteins of the present invention. The label can encode for resistance to biocide, such as resistance to antibiotics (for example, kanamycin, G418 bleomycin, hygromycin, etc.). Examples of selectable markers include, but are not limited to, a neo gene which codes for kanamycin resistance and can be selected to utilize kanamycin, G418, etc., a bar gene which codes for resistance to bialaphos; a nitrilase gene which confers resistance to bromoxynil, and a DHFR gene resistant to methotrexate. Examples of such selectable markers are illustrated in US Patents Nos. 5,550,318; 5,633,435; 5,780,708 and 6,118,047. A recombinant vector or construct of the present invention may also include a marker that can be screened. Markers susceptible to screening can be used to monitor expression. Examples of markers that can be screened include a β-glucuronidase or uidA (GUS) gene which codes for an enzyme for which various chromogenic substrates are known (Jefferson, 1987; Jefferson et al., 1987); a ß-lactamase gene (Sutcliffe et al., 1978), a gene encoding an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin); a luciferase gene (Ow et al., 1986) a xylE gene (Zukowsky et al., 1983) which codes for a catechol dioxygenase that can convert the chromogenic catechols; an α-amylase gene (Ikatu et al., 1990); a tyrosinase gene (Katz et al., 1983) which codes for an enzyme that can oxidize tyrosine to DOPA and dopaquinone which in turn condenses to melanin; an α-galactosidase, which catalyzes a chromogenic substrate of α-galactose. A transformation vector can easily be prepared using methods available in the art. The transformation vector comprises one or more nucleotide sequences which can / can be transcribed as an RNA molecule and which is / are substantially homologous and / or complementary to one or more nucleotide sequences encoded by the insect genome, so that after absorbing the RNA there is a negative regulation of the expression of at least one of the respective nucleotide sequences of the pest genome. VIII. Methods for genetic engineering The present invention contemplates the introduction of a nucleotide sequence in an organism to achieve pest inhibitory levels of the expression of one or more dsRNA molecules. The polynucleotides and polypeptides of the invention can be introduced into a host cell, such as a bacterial or yeast cell, using standard procedures known in the art to introduce recombinant sequences into a target host cell. Such methods include, but are not limited to, transfection, infection, transformation, natural absorption, calcium phosphate, electroporation, biolistic microinjection, and transformation protocols mediated by microorganisms. The methods chosen vary with the host organism. A transgenic organism of the present invention is one that comprises at least one cell its genome in which an exogenous nucleic acid has been stably integrated. Therefore, a transgenic organism may contain only genetically modified cells in certain parts of its structure. Accordingly, the present invention also encompasses a transgenic cell or organism comprising any of the nucleotide sequences or recombinant DNA constructs described in the present invention. The invention also encompasses prokaryotic cells (such as, but not limited to, Gram-positive and Gram-negative bacterial cells) and eukaryotic cells (such as, but not limited to, yeast cells or plant cells). For example, the present invention contemplates introducing a target gene into a bacterium, such as Lactobacillus. The nucleic acid constructs can be integrated into a bacterial genome with a vector for integration. The vectors for integration typically contain at least one sequence homologous to the bacterial chromosome that allows the vector to be integrated. The integrations appear to result from recombinations between the homologous DNA in the vector and the bacterial chromosome. For example, integration vectors constructed with DNA from several strains of Bacillus are integrated into the Bacillus chromosome (EP 0 127,328). Vectors for integration can also be constituted by bacteriophage or transposon sequences. Suicidal vectors are also known in the art. The construction of appropriate vectors containing one or more of the components listed above utilizes standard recombinant DNA techniques. Isolated plasmids or DNA fragments are cut, designed, and religated in the desired form to generate the required plasmids. Examples of suitable bacterial expression vectors include, but are not limited to, the multifunctional cloning and expression vectors of E. coli such as Bluescript ™ (Stratagene, La Jolla, CA), in which it can be ligated, for example, a protein or fragment thereof of D. v. virgifera, in the frame vector with sequences for the Met and the subsequent 7 amino-terminal residues of β-galactosidase so as to produce a hybrid protein; pIN vectors (Van Heeke and Schuster, 1989); and similar. The invention also contemplates introducing an objective gene into a yeast cell. A recombinant yeast construct can typically include one or more of the following: a promoter sequence, fusion partner sequence, leader sequence, transcription termination sequence, a selectable marker. These elements can be combined in an expression cassette, which can be maintained in a replicon, such as an extrachromosomal element (eg, plasmids) having stable maintenance capability in a host, such as yeast or bacteria. The replicon can have two replication systems, thus allowing it to be maintained, for example, in yeast for expression and in a prokaryotic host for cloning and amplification. Examples of such yeast-bacterium shuttle vectors include YEp24 (Botstein et al., 1979), pCl / 1 (Brake et al., 1984), and YRpl7 (Stinchcomb et al., 1982). In addition, a replicon may be a plasmid with high copy number or low copy number. A plasmid with high copy number can usually have a copy number ranging from about 5 to about 200, and typically from about 10 to about 150. A host containing a plasmid with high copy number preferably can have at least about 10, and most preferably at least about 20. Useful yeast promoter sequences can be obtained from genes encoding enzymes in the metabolic pathway. Examples of such genes include alcohol dehydrogenase (ADH) (EP 0 284044), enolase, glucokinase, glucose-6-phosphate isomerase, glyceraldehyde-3-phosphate dehydrogenase (GAP or GAPDH), hexokinase, phosphofructokinase, 3-phosphoglycerate mutase, and pyruvate kinase (PyK) (EP 0 3215447). The yeast PH05 gene, which codes for acid phosphatase, also provides useful promoter sequences (Myanohara et al., 1983). In addition, synthetic promoters that do not occur in Nature also function as yeast promoters. Examples of such hybrid promoters include the ADH regulatory sequence linked to the transcription activation region of GAP (US Patents Nos. 4,876,197 and 4,880,734). Examples of transcription terminator sequences and other termination sequences recognized by yeast, such as those encoding glycolytic enzymes, are known to those skilled in the art. Alternatively, the expression constructs can be integrated into the yeast genome with an integration vector. Integration vectors typically contain at least one sequence homologous to a yeast chromosome that allows the vector to integrate, and preferably contains two homologous sequences flanking the expression construct. The integrations appear to be the result of recombinations between the homologous DNA in the vector and the chromosome of the yeast (Orr-Weaver et al., 1983). An integration vector can be directed towards a specific locus in the yeast by selecting the appropriate homologous sequence for inclusion in the vector. See Orr-Weaver et al., Supra. One or more expression constructs can be integrated, possibly affecting the levels of recombinant protein produced (Riñe et al., 1983).

IX. Quantification of the inhibition of expression of the target gene The inhibition of expression of the target gene can be quantified by measuring either the endogenous target RNA or the protein produced by the translation of the target RNA and the consequences of the inhibition can be confirmed by examining the external properties of the cell or organism. Techniques for quantifying RNA and proteins are well known to the person skilled in the art. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamicin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, spectinomycin, rifampicin, and tetracycline, and the like. In some embodiments gene expression is inhibited by at least 10%, preferably by at least 33%, more preferred by at least 50%, and even more preferred by at least 80%. In particularly preferred embodiments of the invention gene expression is inhibited by at least 80%, more preferred by at least 90%, more preferably by at least 95%, or by at least 99% within the cells in the pest so that significant inhibition occurs. "Significant inhibition" is intended to refer to sufficient inhibition resulting in a detectable phenotype (eg, cessation of larval growth, paralysis or mortality, etc.) or a detectable decrease in RNA and / or protein corresponding to the target gene that is being inhibited . Although in some embodiments of the invention the. inhibition occurs substantially in all cells of the pest, in other preferred embodiments the inhibition occurs only in a subset of cells expressing the gene. For example, if the target gene plays an essential role in the cells in the insect's alimentary tract, the inhibition of the gene within these cells is sufficient to exert a detrimental effect on the insect.

X Exposure of the pest to ARNds A pest can be exposed to a dsRNA in any appropriate manner that allows the dsRNA to be administered to the pest. For example, the pest can be contacted with the dsRNA in pure or substantially pure form, for example an aqueous solution containing the dsRNA. In one embodiment, the insect can simply be "soaked" or "sprinkled" with an aqueous solution comprising the dsRNA. Alternatively, the pest can be "sprayed" with a solution comprising a dsRNA. Alternatively, the dsRNA can be ligated to a food component of the pest, such as a food component for a mammalian pest pathogen, in order to increase the absorption of the dsRNA by the insect. Ingestion by the pest allows the supply of pest control agents to the pest and results in negative regulation of a target gene in the host. Methods for oral introduction may include, for example, directly mixing dsRNA with the food of a pest, as well as genetic manipulation strategies in which a species that is used as a food is genetically engineered to express the dsRNA or siRNA, then the plague that is going to be affected is fed. For example, a bacterium, such as Lactobacillus, can be transformed with an objective sequence and then fed with it to a pest. In one embodiment, for example, dsRNA or siRNA molecules can be incorporated, or coated, in the insect's diet. In other embodiments, the pest may be contacted with a composition containing the dsRNA of the invention. The composition may contain, in addition to the dsRNA, excipients, diluents or additional vehicles. The dsRNA can also be incorporated into the medium in which the pest grows or infests. For example, a dsRNA can be incorporated into a food container or protective wrap as a means to inhibit infestation of the pest. Wood, for example, can be treated with a solution comprising a dsRNA to avoid infestation by the pest. In other embodiments, the dsRNA is expressed in a cell, bacterial or fungal and the bacterial or fungal cell is absorbed or ingested by the insect species. As illustrated in the examples, the bacteria can be genetically engineered to produce either dsRNA or the dsRNA constructs of the invention. These bacteria can be ingested by the insect species. When absorbed, the dsRNA can initiate an RNAi response, which leads to the degradation of the target mRNA and to the weakening or annihilation of the insect that takes it as food. Alternatively, the bacterial or yeast cells producing the dsRNA can be sprayed directly onto the cultures. Some bacteria have a very close interaction with the host plant, such as, but not limited to, Rhizobium which forms symbiosis with the Legminosea (eg soybean). Said recombinant bacterium can be mixed with the seeds (for example as a coating) and used as soil improvers. A virus such as a baculovirus which specifically infects insects can also be used. This ensures safety for mammals, especially humans, because the virus does not infect mammals, so there are no unwanted effects of RNAi. Possible applications include intensive greenhouse crops, for example crops that are less interesting from a GMO point of view, as well as wider field crops such as soybeans. This strategy has several advantages, for example: because the problem of possible comminution (dicing) by a host plant is not present, it allows the supply of large fragments of dsRNA in the lumen of the intestine of the pest that is being fed; the use of bacteria as insecticides does not imply the generation of transgenic crops, especially for some crops in which transgenic variants are difficult to obtain; there is a broad and flexible application in the sense that different crops can be treated simultaneously in the same field and / or or different pests can be targeted simultaneously, for example by combining different bacteria that produce different dsRNA molecules.

XI. Products The present invention provides numerous products that may include a dsRNA for use in the control of pests. For example, the invention provides pharmaceutical or veterinary compositions for treating or preventing a disease or infection by pests of humans or animals, respectively. Said compositions comprise at least one dsRNA or RNA construct, or nucleotide sequence or recombinant DNA construct that codes for dsRNA or RNA construction, in which the RNA comprises fixed complementary strands, one of which has a sequence of nucleotide corresponding to a target nucleotide sequence of a target gene of a pest causing the disease or infection, and at least one vehicle, excipient, or diluent suitable for pharmaceutical use. Alternatively, a pharmaceutical or veterinary composition can be used as a composition suitable for topical use, such as application on the skin of an animal or human. For example, a dsRNA can be used in a liquid composition that is applied to the skin as drops, gel, spray, cream, ointment, etc. Additionally, a dsRNA can be integrated into a transdermal patch or other medical device to treat or prevent a disease or condition. Other conventional pharmaceutical dosage forms can also be produced, including tablets, capsules, ovules, transdermal patches, suppositories, etc. The chosen form depends on the nature of the target pest and therefore on the nature of the disease to be treated. Oral vaccines, for example, can be produced using the constructions and methods of the invention. For example, a vaccine can be constructed by producing a dsRNA in bacteria (e.g., lactobacillus) which can be included in the feed and functions as an oral vaccine against insect infection. Accordingly, the invention provides constructs and methods for treating and / or preventing a disease or condition caused by a pest, which comprises administering to an individual in need of said treatment and / or prevention, any of the compositions as described in the present invention. , said composition comprises at least one double-stranded RNA or double-stranded RNA construct comprising fixed complementary strands, one of which has a nucleotide sequence that is complementary to at least part of a nucleotide sequence of a gene target of a pest that causes the disease or condition. Although the compositions of the invention can be used to treat a disease or condition in a patient, the compositions and methods can also be used as a means to protect a substrate or material against infestation by pests. The nature of the excipients included in the composition and the physical form of the composition may vary depending on the nature of the substrate to be treated. For example, said composition can be a coating or a powder that can be applied to a substrate as means for protecting the substrate against infestation by an insect and thus preventing the damage induced by the pest to the substrate or material. Therefore, in one embodiment, the composition is in the form of a coating on an appropriate surface which adheres to, and is eventually ingested by, an insect that comes into contact with the coating. Said composition can be used to protect any substrate or material that is susceptible to infestation by or damage caused by a pest, for example edibles and other perishable materials, and substrates such as wood. For example, the composition can be a liquid that is applied with a brush or sprayed on or stamped on the material or substrate to be treated. Therefore, a human user can spray the insect or the substrate directly with the composition. For example, houses and other wood products can be destroyed by termites, powder post beetles, and carpenter ants. By treating the wood or house siding material with a composition comprising a dsRNA, it may be possible to reduce the infestation caused by the pest. In the same way, the trunk of a tree can be treated with a composition comprising a dsRNA.

Flour beetles, grain weevils, ground cereal moths, and other pests feed on stored grains, cereals, pet food, chocolate powder, and almost anything found in the kitchen pantry that is not protected. Accordingly, the present invention provides means for treating cereal boxes and other containers and wrappings for food storage with a composition comprising a target ARNds. The larvae of the clothes moths are eaten clothing made from animal products, such as fur, silk and wool. Therefore, it would be desirable to treat clothes hangers, closet organizers, and clothing bags with the dsRNA of the invention. Book lice and silverfish are pests of libraries because they eat the starch glue in the pasting of books. Accordingly, the present invention provides compositions for treating books against infestation and destruction caused by pests. In one embodiment, the composition is in the form of a bait. The bait is designed to attract the insect to come into contact with the composition. After it comes in contact with it, the composition is then internalized by the insect, for example by ingestion and mediates the RNAi in order to annihilate the insect in this way. The bait may depend on the species that is being targeted. An attractant can also be used. The attractant can be a pheromone, such as, for example, a male or female pheromone. The attractant acts to attract the insect to the bait, and may be targeted for a particular insect or may attract a full range of insects. The bait may be in any suitable form, such as a solid, paste, tablet or powder. The bait can also be transported by the insect back to the colony. The bait can then act as a food source for other members of the colony, thereby providing effective control of a large number of insects and potentially a complete colony of the insect pest. This is an advantage associated with the use of double-stranded RNA or of the bacterium that expresses the dsRNA of the invention, because the delayed action of RNAi-mediated effects on pests allows the bait to be transported back to the host. colony, thus providing the maximum impact in terms of exposure to insects. The baits can be provided in an appropriate "shelter" or "trap". Such housings and traps are commercially available and existing traps can be adapted to include the compositions of the invention. The housing or trap can be box-shaped, for example, and can be provided in a prefabricated condition or can be formed, for example, from folding cardboard. Suitable materials for a housing or trap include plastics and cardboard, particularly corrugated cardboard. The interior surfaces of the traps can be lined with an adhesive substance in order to restrict the movement of the insect once it is inside the trap. The housing or trap may contain an appropriate channel within which the bait may be held in place. A trap is distinguished from a housing because the insect can not easily leave a trap after it enters, while a housing acts as a "feeding station" which provides the arachnid insect with a preferred environment in which they can be trapped. Feed and feel safe from predators. It is evident that numerous products and substrates can be treated with the compositions of the invention to reduce pest infestation. Of course, the nature of the excipients and the physical form of the composition may vary depending on the nature of the substrate to be treated. For example, the composition can be a liquid that is applied by brush or sprayed on or stamped onto the material or substrate to be treated, or a coating that is applied to the material or substrate to be treated. Specific examples of methods for identifying target sequences and for introducing the sequences into various cells and compositions are presented below. These are intended to be only examples and not limitations of the present invention.

EXAMPLE 1 Silencing of C. elegans target genes in C. elegans in high-throughput screening A genome-wide library of C. elegans in the pGN9A vector (WO 01/88121) is prepared between two identical T7 promoters and terminators, which control their expression in the sense and antisense directions after expression of the T7 polymerase. , which is induced by IPTG. This library is transformed into the bacterial strain AB301-105 (DE3) in 96-well plate format. For genome-wide screening, these bacterial cells are fed to the nuc-1 strain. { el392) of C. elegans deficient in nuclease. The feeding of the dsRNA produced in the bacterial strain AB301-105 (DE3), to nuc-1 worms. { e! 392) of C. elegans, is carried out in a 96-well plate format as follows: nuc-1 eggs are transferred to a separate plate and allowed to hatch simultaneously at 20 ° C for generation Ll synchronization. The 96-well plates are filled with 100 μl of liquid growth medium comprising IPTG and with 10 μ? of bacterial cell culture AB301-105 (DE3) to D06ool from the C. elegans dsRNA library each carrying a vector with a genomic fragment of C. elegans for expression of the dsRNA. To each cavity, 4 of the synchronized Ll worms are added and incubated at 25 ° C for at least 4 to 5 days. These experiments are done in quadruplicate. In the screening 6 controls are used: - pGN29 - negative control, wild type - pGZl = unc-22 = trembling phenotype (twitcher) - pGZ18 = chitin synthetase = embryonic lethal - pGZ25 = pos-1 = embryonic lethal - pGZ59 = bli-4D = acute lethal - ACC = acetyl co-enzyme A carboxylase = acute lethal After 5 days, the phenotype of the worms is compared nuc-1 (el 392) of C. elegans, fed with the bacteria that produce dsRNA, with the phenotype of worms fed with the empty vector (pGN29) and the other controls. The worms that were fed with the dsRNA are screened for res; ecto to lethality (acute or larval) lethality for the progenitor generation (Po), lethality (embryonic) for the first filial generation (Fl), or regarding the growth retardation of Po as follows: (i) Po acute lethality: The Ll do not develop and die, this phenotype never gives progeny and the cavity looks completely empty; (ii) Lethality (larval) of Po: Po dies at a later stage than Ll, this phenotype also never gives progeny. Dead larvae or dead adult worms are found in the cavities; (iii) Lethality for Fl: The Ll develop until the adult stage and continue alive. This phenotype has no progeny. This can be due to sterility, embryonic lethality (dead eggs at the bottom of the cavity), embryonic arrest or larval arrest (eventually ends up being lethal): (iv) Stop growth and delay / delay growth: Compared with a cavity with normal development and normal progeny number. For the target sequences presented in Table 2, it is concluded that the silencing of the target gene of C. elegans mediated by dsRNA in nematodes, such as C. elegans, has a fatal effect on the growth and viability of the worm. After the previous dsRNA silencing experiment, a more detailed phenotype determination experiment is carried out in C. elegans in a high performance format in 24 cavity plates. The dsRNA library produced in bacterial strain AB301-105 (DE3), as described above, is used to feed nuc-1 (el392) worms of C. elegans into 24-well plates as follows: nuc eggs are transferred -1 to a separate plate and allowed to hatch simultaneously at 20 ° C for synchronization of the Ll generation. Subsequently, 100 of the synchronized Ll worms are soaked in a mixture of 500 μ? of complete S feeding medium, comprising 5 g / ml of cholesterol, 4 μg / ml of PEG and 1 mM of IPTG, and 500 μ? of bacterial cell culture of AB301-105 (DE3) to DOSool of the C. elegans dsRNA library each carrying a vector with a genomic fragment of C. elegans for expression of the dsRNA. The soaked Ll worms are dried (rolled) for 2 hours at 25 ° C. After centrifuging and removing 950 μ? of the supernatant, 5 μ? of the remnant and of the re-suspended tablet (comprising approximately 10 to 15 worms) in the center of each cavity of a 24-well plate, filled with a layer of LB broth agar. The inoculated plate is incubated at 25 ° C for 2 days. In the adult stage, an adult worm is separated and incubated at 25 ° C for 2 days to inspect its progeny. The other adult worms are inspected in situ on the original 24-well plate. These experiments are done in quadruplicate. This detailed phenotypic screening is repeated with a second batch of worms, the only difference being that the worms of the second batch are incubated at 20 ° C for 3 days. The phenotype of the worms fed with C. elegans dsRNA is compared to the phenotype of the nuc-1 (el392) worms of C. elegans fed with the empty vector. Based on this experiment, it is concluded that the silencing of the target genes of C. elegans as shown in Table 2 has a fatal effect on the growth and viability of the worm and that the target gene is essential for the viability of the nematodes .

Therefore, these genes are suitable target genes to control (annihilate or prevent growth) nematodes by silencing the gene mediated by dsRNA. Accordingly, the present invention encompasses the use of nematode orthologs of the above target gene of C. elegans to control nematode infestation in a variety of organisms and materials.

EXAMPLE 2 Identification of orthologs of D. melanogaster As described above in Example 1, numerous lethal sequences of C. elegans are identified and can be used to identify orthologs in other species and genera. For example, the lethal sequences of C. elegans can be used to identify orthologous sequences of D. melanogaster. That is, each sequence of C. elegans can be investigated against a public database, such as GenBank, regarding orthologous sequences in D. melanogaster. Potential orthologs of D are selected. melanogaster that share a high degree of sequence homology (E value preferably less than or equal to 1E-30) and the sequences are the best BLAST reciprocal hits, this last means that sequences from different organisms (eg C . elegans and D. melanogaster) are the maximum hits BLAST one with respect to the other. For example, the C sequence of C. elegans is compared against the sequences in D. melanogaster using BLAST. If the sequence C has the sequence D of D. melanogaster as the best success and when D is compared with all the C. elegans sequences, it also turns out to be the sequence C, so D and C are the best reciprocal hits. This criterion is often used to define orthology, and means similar sequences of different species, which have a similar function. The identifiers of the sequence of D. melanogaster are shown in Table 2.

EXAMPLE 3 Leptinotarsa decemlineata (Colorado potato beetle) A. Cloning of partial gene sequences of Leptinotarsa decemlineata High quality intact RNA is isolated, starting from 4 different larval stages of Leptinotarsa decemlineata (Colorado potato beetle, source: Jeroen van Schaik, Entocare CV Biologische Gewasbescherming, Postbus 162, 6700 AD Wageningen, The Netherlands) using the TRIzol reagent (Cat No. 15596-026) / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation is removed by treatment with DNase following the manufacturer's instructions (Cat No. 1700, Promega). The cDNA is generated using a commercially available kit (Superscript ™ III reverse transcriptase, Cat No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of the LD001, LD002, LD003, LD006, LD007, LD010, LD011, LD014, LD015, LD016 and LD018 genes, a series of PCR reactions are performed with degenerate primers using Amplitaq Gold ( Cat No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are given in Table 12, which presents the Leptíntars decemlineata target genes including the primer sequences and the obtained cDNA sequences. These primers are used in the respective PCR reactions under the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragments are analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned into vector pCR8 / GW / topo (Cat. No. K2500 20 , Invitrogen), and their sequence is determined. The sequences of the resulting PCR products are represented by the respective SEQ ID NOs provided in Table 12 and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by the respective SEQ ID NOs provided in Table 23, wherein the start of the reading frame is indicated in parentheses.

B. Production of dsRNA of the genes of Leptinotarsa decemlineata The dsRNA is synthesized in milligram quantities using the commercially available kit "System for T7 Ribomax ™ Express RNAi (Cat No. P 1700, Promega) First, two separate promoter templates of 5 'RNA polymerase are generated. Individual T7 in two separate PCR reactions, each reaction contains the target sequence in a different orientation relative to the T7 promoter.For each of the target genes, the T7 sense template is generated using primers towards the 5 'end of T7 specific and towards the specific 3 'end The sequences of the respective primers to amplify the sense template for each of the target genes are given in Table 64. The conditions in the PCR reactions are as follows: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The anti-sense T7 template is generated using primers towards the specific 5 'end and towards the 3' end of specific T7 in a PCR reaction with the same conditions as described above. The sequences of the respective primers for amplifying the antisense template for each of the target genes are provided in Table 64. The resulting PCR products are analyzed on agarose gel and purified using the purification kit for PCR (Purification kit for PCR Qiaquick, Cat No. 28106, Qiagen) and precipitation with NaC104. The templates towards the 5 'end and towards the 3' end of T7 generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of maker. The sense strand of the resulting dsRNA for each of the target genes is provided in Table 64. Table 64 shows sequences for preparing dsRNA fragments of target sequences and concatamer-de sequences from Leptinotarsa dece lineata, including the primer sequences.

C. Screening of dsRNA targets using artificial diet for activity against Leptinotarsa decemlineata The artificial diet for Colorado potato beetle is prepared as follows (adapted from Gelman et al., 2001, J. Ins. Se, vol. , No. 7, 1-10): the water and agar are autoclaved, and the remaining ingredients (shown in the following Table 1) are added when the temperature drops to 55 ° C. At this temperature, the ingredients are mixed well before aliquots of the diet are transferred to plates of 24 cavities (Nunc) with an amount of 1 ml of diet per cavity. The artificial diet is allowed to solidify by cooling to room temperature. The diet is stored at 4 ° C for up to three weeks.

TABLE 1 Ingredients for the artificial diet 50 μ? of a solution of dsRNA at a concentration of 1 mg / ml on the artificial solid diet in the cavities of the multiple cavity plate. The diet is dried in a laminar flow hood. By treatment, twenty-four larvae (2nd stage) of the Colorado potato beetle are analyzed, with two insects per cavity. The plates are stored in the breeding chamber of insects at 25 ± 2 ° C, 60% relative humidity, with a photoperiod of 16: 8 hours of light: dark. Beetles are evaluated as alive or dead every 1, 2 or 3 days. After seven days, for the targets LD006, LD007, LD010, LD011, and LD014, the diet is replaced with fresh diet with dsRNA applied topically at the same concentration (1 mg / ml); For objectives LD001, LD002, LD003, LD015, and LD016, the diet is replaced with fresh diet only. The objectives of dsRNA are compared with diet alone or diet with topically applied dsRNA corresponding to a fragment of the sequence coding for GFP (green fluorescent protein) (SEQ ID NO: 235). Feed larvae of L. decemlineata with artificial diet containing intact nude dsRNA molecules. as a result, significant increases in larval mortality as indicated in two separate bioassays (Figures 1 and 2). All the dsRNAs analyzed finally gave 100% mortality after 7 to 14 days. The diet with or without GFP dsRNA keeps the insects through the bioassays with little or no mortality. Typically, in all the trials observed, the second stage larvae of Colorado potato beetle are normally fed with the diet with or without dsRNA for 2 days and they move to the third larval stage. In this new larval stage it is observed that CPB significantly reduces or completely stops feeding, with an increase in mortality as a result.

D. Density targeting bioassay using potato leaf discs for activity against Leptinotarsa deceuilineata An alternative bioassay method is used using foliar potato material instead of artificial diet as a source of food for CPB. Discs of approximately 1.1 cm in diameter (or 0.95 cm2) are cut from leaves of potato plants from 2 to 3 weeks of age using a properly sized cork punch. Leaf treated discs are prepared by applying 20 μ? of a solution of 10 ng / μ? of the LD002 target dsRNA or control of gfp dsRNA on the adaxial surface of the leaf. The leaf discs are allowed to dry and are placed individually in 24 cavities of a 24 cavity multiplate (Nunc). A single CPB is placed in the second larval stage in each cavity, which is then covered with tissue paper and a plastic cap for multiple cavities. The plate containing the insects and the leaf discs is kept in an insect chamber at 28 ° C with a photoperiod of 16 light hours / 8 dark hours. The insects are allowed to feed on the leaf discs for 2 days after which the insects are transferred to a fresh plate containing fresh treated leaf discs. After this, the insects are transferred to a plate containing untreated leaf discs every day until day 7. Mortality and insect weight scores are recorded. Feeding larvae of L. decemlineata with potato leaf discs with naked dsRNA, intact of the LD002 target applied on the surface results in a significant increase in larval mortalities (ie on day 7 all insects are dead; 100% of mortality) while the control of dsRNA of gfp has no effect on the survival of CPB. The dsRNA of the LD002 target severely affects the growth of the larvae after 2 to 3 days while the larvae that are fed gfp dsRNA at the same concentration develop as normal (Figure 3).

E. Screening of shorter versions of dsRNA molecules using artificial diet for activity against T ptinotarsa decemlineata This example exemplifies the finding that shorter dsRNA fragments (60 or 100 bp) by themselves or as concatamer constructs are sufficient to cause toxicity to the Colorado potato beetle. For this example LD014 is selected, an objective that is known to induce lethality in Colorado potato beetle. This gene codes for an E subunit of V-ATPase (SEQ ID NO:: 15). A fragment of 100 base pairs, LD014_F1, at position 195-294 in SEQ ID NO :: 15 (SEQ ID NO: 159) and a fragment of 60 base pairs, LD014_F2, at position 235-294 are also selected. in SEQ ID NO: 15 (SEQ ID NO: 160). See also Table 63. Two concatemers of 300 base pairs, LD014_C1 and LD014_C2 (SEQ ID NO :: 161 and SEQ ID NO: 162) are designed. LD014_C1 contains 3 repeats of the 100 base pair fragment described above (SEQ ID NO: 159) and LD014_C2 contains 5 repeats of the 60 base pair fragment described above (SEQ ID NO: 160). See also Table 63. The fragments LD014_F1 and LD014_F2 are synthesized as sense and antisense primers. These primers are set to create the double-stranded DNA molecules before cloning. Xbal and Xmal restriction sites are included at the 51 and 3 'ends of the primers, respectively, to facilitate cloning. Concatamers are made as synthetic genes of 300 base pairs. Xbal and Xmal restriction sites are included at the 5 'and 3' ends of the synthetic DNA fragments, respectively, to facilitate cloning. The 4 DNA molecules, ie the 2 individual units (LD014_F1 and LD014_F2) and the 2 concatamers (LD014_C1 and LD014_C2), are digested with Xbal and Xmal and subcloned in pBluescriptll SK + linearized by digestions of Xbal and Xmal, which gives as a result the plasmids pl, p2, p3, and p4, respectively.

Production of double-stranded RNA The dsRNA is synthesized using the commercially available kit System for T7 Ribomax ™ EXPRESS RNAi (Cat No. P 1700, Promega). First, two separate individual templates of the 5 'RNA polymerase promoter of T7 are generated in two separate PCR reactions, each reaction containing a target sequence in a different orientation relative to the T7 promoter. For LD014_F1, the sense T7 template is generated using the primer to the 51 end of T7 specific OGBM159 and the primer to the 3 'end specific OGBM164 (represented in the present invention as SEQ ID NO: 204 and SEQ ID NO: 205 , respectively) in a PCR reaction with the following conditions: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The antisense template of T7 is generated using the specific primer towards the 5 'end of OGBM163 and the specific T7 primer towards the 3' 0GBMI6O end (represented in the present invention as SEQ ID NO: 206 and SEQ ID NO: 207, respectively ) in a PCR reaction with the same conditions as described above. The resulting PCR products are analyzed on agarose gel and purified using the purification kit for PCR (Qiaquick PCR Purification Kit, cat No. 28106, Qiagen) and NaC104 precipitation. The templates towards the 5 'end and towards the 3' end of T7 generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of maker. The sense strand of the resulting dsRNA is represented in the present invention by SEQ ID NO: 203.

For LD014_F2, the sense template of T7 is generated using the primer to the 5 'end of T7 specific 0GBMI6I and the primer to the specific 3' end 0GBMI66 (represented in the present invention as SEQ ID NO:: 209 and SEQ ID NO: : 210, respectively) in a PCR reaction with the following conditions: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The antisense template of T7 is generated using the primer to the specific 5 'end or GBMl.65 and the primer to the 3' end of specific T7 OGBM162 (represented in the present invention as SEQ ID NO :: 211 and SEQ ID NO: 212, respectively) in a PCR reaction with the same conditions as described above. The resulting PCR products are analyzed on an agarose gel and purified using the purification kit for PCR (Qiaquick PCR purification kit, cat No. 28106, Qiagen) and NaC10 precipitation. The templates towards the 5 'end and towards the 3' end of T7 generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of maker. The sense strand of the resulting dsRNA is represented in the present invention by SEQ ID NO: 208. In addition for the concatamers, separate templates are generated from the 5 'RNA polymerase promoter of T7 in two separate PCR reactions, each reaction containing the sequence objective in a different orientation in relation to the promoter of T7. The recombinant p3 and p4 plasmids containing LD014_C1 and LD014_C2 are linearized with Xbal or Xmal, the two linear fragments for each construct are purified and used as a template for the in vitro transcription test, using the T7 promoters flanking the sites of cloning Double-stranded RNA is prepared by in vitro transcription using the R7 RiboMAX ™ EXPRESS RNAi System (Promega). The sense strands of the resulting dsRNA for LD014_C1 and LD014_C2 are represented in the present invention by SEQ ID NO: 213 and 2114, respectively. The shorter sequences of the LD014 target and the concatamers can induce lethality in Leptinotarsa decemlineata, as shown in Figure 4.

F. Screening of dsRNA molecules at different concentrations using artificial diet for activity against Leptinotarsa decemlineata 50 μ? of a solution of dsRNA at serial concentrations of 10 times from 1 pg / μ? (for objective LD027 from 0.1 μ? / μ?) to 0.01 ng / μ? in the artificial solid diet in the cavities of a plate of 24 cavities (Nunc). The diet is dried in a laminar flow hood. By treatment, twenty-four larvae of Colorado potato beetle (2 * stage) are analyzed, with two insects per cavity. The plates are stored in the insect breeding chamber at 25 + 2 ° C, 60% relative humidity, with a photoperiod of 16: 8 light hours: dark. The beetles are evaluated as alive or dead at regular intervals until day 14. After seven days, the diet is replaced with fresh diet with dsRNA applied topically at the same concentrations. The objectives of dsRNA are compared against only diet. Feeding larvae of L. decemlineata with an artificial diet containing intact naked dsRNA molecules of different targets results in high mortalities of larvae at concentrations as low as 0.1 to 10 ng dsRNA / μ? as shown in Figures 5 (a) to 5 (h).

G. Cloning a CPB gene fragment into an appropriate vector for bacterial production of insect-active double-stranded RNA Although any efficient bacterial promoter can be used, a DNA fragment corresponding to an MLB gene target is cloned into a vector for the expression of double-stranded RNA in a bacterial host (see O 00/01846). The sequences of the specific primers used for the amplification of target genes are provided in Tables 64 through 73. The template used is the pCR8 / G / topo vector containing any of the target sequences. The primers are used in a PCR reaction under the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on agarose gel, purified (QIAquick gel extraction kit, No. of ca. 28706, Qiagen), cloned with blunt ends in vector pGNA49A linearized with Srf I (reference to WO00188121A1 ), and the sequence is determined. The sequence of the resulting PCR product corresponds to the respective sequence as given in Tables 64 to 73. The recombinant vector harboring this sequence is named pGBNJ003. The sequences of the specific primers used for the amplification of the target gene fragment LD010 are provided in Tables 64 to 73 (initiator to the 5 'end SEQ ID NO :: 191 and initiator to the 3' end SEQ ID NO :: 190). The template used is the vector pCR8 / GW / mole containing the sequence of LD010 (SEQ ID NO: 11). The primers are used in a PCR reaction under the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned by blunt ends in the pGNA49A vector linearized with Srf I (reference to WO document). 00/188121 Al), and the sequence is determined. The sequence of the resulting PCR product corresponds to SEQ ID NO:: 188 as provided in Tables 64 to 73. The recombinant vector harboring this sequence is named pGBNJ003.

H. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB309-105, and, (2) BL21 (DE3) The procedures described below are followed in order to express appropriate levels of RNA of double active chain in insect of objective LD010 in bacteria. A strain deficient in RNAasalII, AB309-105, is used in comparison with wild-type bacteria containing RNAasalII, BL21 (DE3).

Transformation of AB309-105 and BL21 (DE3) Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 or BL21 (DE3) of frost chemically competent E. coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. Four hundred fifty μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the bacterial cell suspension to a 500 ml conical flask containing 150 ml of Luria-Bertani liquid broth (LB) supplemented with 100 g / ml of the carbenicillin antibiotic. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB309-105 and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in the bacterial strain AB309-105 or BL21 (DE3) is made possible due to to which all the genetic components for controlled expression are present. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions. The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete medium S (medium SNC plus 5 and g / ml of cholesterol) supplemented with 100 pg / ml of carbenicillin and 1 mM of IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial tablet is resuspended in 1.5 ml of MilliQ water and the suspension is transferred to a microcentrifuge tube. Several tubes are prepared and used in the bioassays for each renewal. The tubes are stored at -20 ° C until later use.

I. Laboratory tests to analyze Escherichia coli expressing dsRNA of the LD010 target against Leptinotarsa decemlineata Two bioassay methods are used to analyze the double-stranded RNA produced in Escherichia coli against Colorado potato beetle larvae: (1) diet-based bioassay artificial, and, (2) plant-based bioassay.

Bioassays based on artificial diet The artificial diet for Colorado potato beetle is prepared as previously described in example 4. Half a milliliter of diet is dispensed into each of the cavities of a 48 cavity multiple cavity test plate (Nunc) For each treatment, fifty μ? of a suspension with DO 1 of heat treated bacteria (which is equivalent to approximately 5 x 107 bacterial cells) expressing dsRNA on the solid diet in the cavities and the plates are allowed to dry in a laminar flow hood. By treatment, forty-eight larvae are analyzed in the 2nd stage of the Colorado potato beetle, one in each cavity that contains diet and bacteria. Each row of a plate (ie 8 cavities) is considered as a repetition. The plates are kept in the insect breeding chamber at 25 ± 2 ° C, 60 ± 5% relative humidity, with a photoperiod of 16: 8 light hours: dark. After every 4 days, the beetles are transferred to a fresh diet containing topically applied bacteria. The beetles are evaluated as alive or dead every one or three days after the infestation. For survivors, growth and development are recorded in terms of larval weight on day 7 after infestation. For strain AB309-105 of E. coli deficient in RNAasalII, bacteria containing the plasmid pGBNJ003 and those containing the empty vector pGN29 (reference to WO 00/188121 Al) in bioassays for CPB toxicity are analyzed. Bacteria harboring plasmid pGBNJ003 show a clear increase in insect mortality over time, while very little or no mortality is observed for pGN29 and control with only diet (Figures 6 (a) and 7 (a)). The growth and development of larval survivors of the Colorado potato beetle, 7 days after feeding them with an artificial diet containing bacteria expressing dsRNAs of the LD010 target, are severely impeded (Table 77, Figure 8 (a)). For strain BL21 (DE3) of E. coli, the bacteria containing the plasmid pGBNJ003 and those containing the empty vector pGN29 against the larvae of the Colorado potato beetle are analyzed. Similar detrimental effects are observed in larvae fed with diet supplemented with BL21 (DE3) bacteria than those of the strain deficient in ARNasalII, AB309-105 (figures 6 (b) and 7 (b)). However, the number of survivors for the five clones is higher for BL21 (DE3) than for AB309-105; on day 12, the average mortality values are approximately 25% lower for this strain compared to the strain deficient in RNAasalII. In addition, the average weights of survivors fed a diet containing BL21 (DE3) expressing dsRNA corresponding to the LD010 target are severely reduced (Table 77, Figure 8 (b).

The delay in the growth and development of CPB larvae fed with diet containing any of the two bacterial strains that harbor the plasmid pGBNJ003 is directly correlated with feeding inhibition because no tabs (frass) are observed in the cavities of plaques renewed from day 4 onwards when compared with bacteria harboring the pGN29 empty vector or with the diet-only plate. This observation is similar to that in which CPB is fed with double-stranded RNA transcribed in vitro applied topically to the artificial diet (see 3D example); in this case, cessation of feeding occurs from day 2 onwards in the diet treated.

Plant-based bioassays Intact potato plants are sprayed with suspensions of chemically induced bacteria that express dsRNA before using the plants to feed CPB larvae. Potato plants of the variety "line 5" are grown from tubers to the stage of leaf 8-12 not deployed in a quarter chamber for plant growth with the following conditions: 25 + 2 ° C, 60% relative humidity, photoperiod of 16: 8 light hours: darkness. The plants are enclosed placing a 500 ml plastic bottle face down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut and covered with a fine nylon mesh to allow aeration, reduce condensation inside and prevent larvae from escaping. Fifteen larvae of Colorado potato beetle in stage Ll are placed in each plant treated in the cage. The plants are treated with a suspension of E. coli AB309-105 harboring plasmids pGBNJ003 (clone 1, Figure 7 (a)) or plasmid pGN29 (clone 1, see Figure 7 (a)). Different amounts of bacteria are applied to the plants: 66, 22, and 7 units, where one unit is defined as 109 bacterial cells in 1 ml of a bacterial suspension at an optical density value of 1 at a wavelength of 600 nm. In each case, a total volume of 1.6 ml is sprinkled on the plant with the help of a vaporizer. In this test a plant is used per treatment. The number of survivors is counted and the weight of each survivor is recorded. Spraying the plants with a suspension of the E. coli bacterial strain AB309-105 expressing the target dsRNA of pGBNJ003 leads to a dramatic increase in insect mortality when compared to the pGN29 control. The mortality count is maintained when the amount of bacterial cell suspension is diluted 9 times (Figure 9). The average weights of larval stage survivors on day 11 in plants sprinkled with bacteria harboring the vector pGBNJ003 are approximately 10 times lower than those of pGN29 (Figure 10). The feeding damage caused by CPB larvae of potato plants sprinkled with bacteria containing the plasmid pGBNJ003 is much reduced when compared to the damage inflicted on a potato plant sprinkled with bacteria containing the empty vector pGN29 (Figure 11 ). These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in bacterial expression systems either wild-type or deficient in RA asalII is toxic to the insect in terms of substantial increases in insect mortality and delayed growth / development for larval survivors. It is also evident from these experiments that an example is provided for the effective protection of plants / crops against insect damage by the use of a spray of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target. of insect gene.

J. Analysis of several culture suspension densities of Escherichia coli expressing target dsRNA LD010 against Leptinotarsa decemlineata Preparation and bacterial treatments are described in example 31. Triple serial dilutions of cultures (starting from 0.25 equivalent units) of strain AB309-105 of Escherichia coli deficient in RNAasalII expressing the double-stranded RNA of the LD010 target are applied to foliages of the potato plant of the variety "Bintje" in the stage of leaf 8-12 not deployed. Ten Ll larvae of L. decemlineata are placed in the plants treated with one plant per treatment. The qualification for insect mortality and development impediment is made on day 7 (ie, 7 days after the infestation). As shown in Figure 14, a high mortality of CPB larvae (90 to 100%) is recorded after 1 week when the insects are fed with potato plants treated with a topical application by fine spraying heat-inactivated cultures. E. coli harboring plasmid pGBNJ003 (for expression of target 10 dsRNA) at densities of 0.25, 0.08 and 0.025 bacterial units. At 0.008 units, approximately one third of the insects die, however, the insects that survive are significantly smaller than those in the control groups (E. coli that houses the empty vector pGN29 and only water). Feeding damage caused by CPB larvae of the potato plant sprinkled with bacteria containing the plasmid pGBNJ003 at concentrations of 0.025 or 0.008 units is much reduced when compared to the damage inflicted on a potato plant sprinkled with bacteria containing to the empty vector pGN29 (Figures 15 (a) to 15 (d)).

K Adults are extremely susceptible to orally ingested dsRNA corresponding to target genes The example below highlights the finding that adult insects (and not only larval stage insects) are extremely susceptible to orally ingested dsRNA corresponding to target genes. For this experiment four objectives are chosen: objectives 2, 10, 14 and 16 (SEQ ID NOs: 168, 188, 198 and 220, respectively). As a control, GFP fragment dsRNA is used (SEQ ID NO: 235). Young adults (2 to 3 days old) are randomly chosen from the culture raised in the laboratory without any inclination towards the genus of the insect. Ten adults are chosen per treatment. Adults are previously left without food for at least 6 hours before the start of treatment. On the first day of treatment, each adult is fed with four potato leaf discs (diameter 1.5 was2) which are previously treated with a topical application of 25 μ? of 0.1 μ? / μ? of target dsRNA (synthesized as described in example 3A; topical application as described in example 3E) per disc. Each adult is confined to a small Petri dish (3 cm in diameter) in order to ensure that all insects ingest equal amounts of food and therefore receive equal doses of dsRNA. The next day, each adult is fed again with four leaf discs treated as described above. On the third day, all ten adults are collected by treatment and placed together in a cage consisting of a plastic box (dimensions 30 cm x 20 cm x 15 cm) with a fine nylon mesh incorporated in the lid to provide good aeration. Inside the box, some moistened filter paper is placed in the base. Some potato foliage (untreated) is placed on top of the paper to keep the adults during the experiment. From day 5, regular evaluations are made to count the number of dead, live (mobile) and dying insects. To assess how dying insects are, adults lie on their backs to confirm whether they can straighten out on their own or not; an insect is considered moribund only if it can not turn over its front. In this experiment, evident specific toxic effects of double-stranded RNA are shown corresponding to different targets towards adults of the Colorado potato beetle, Leptinotarsa decemlineata, (Figure 12). The double-stranded dsRNA corresponding to a gfp fragment shows no adult toxicity of CPB on the day of the final evaluation (day 19). This experiment clearly shows that adult survival of CPB is severely reduced only after a few days of exposure to dsRNA when administered orally. For example, for objective 10, on day 5, 5 of the 10 adults are moribund (sick and slow moving); on day 6, 4 of the 10 adults are dead with three of the dying survivors; On day 9 it is observed that all adults are dead. As a consequence of this experiment, the application of target double-stranded RNA molecules against insect pests can be extended to include the two life stages of an insect pest (ie larvae and adults) which can cause extensive damage to the insect. cultivation, as is the case with Colorado potato beetle.

EXAMPLE 4 Phaedon cochleariae (mustard leaf beetle) A. Cloning of a partial sequence of the PCOOl, PC003, PC005, PC010, PC014, PC016 and PC027 genes of Phaedon cochleariae (mustard leaf beetle) by family PCR. High quality, intact RNA is isolated from the third larval stage of Phaedon cochleariae (mustard leaf beetle, source: Dr. Caroline Muller, Julius-von-Sachs-Institute for Biosciences, Chemical Ecology Group, University of Wuerzburg, Julius-von-Sachs-Platz 3, D-97082 Wuerzburg, Germany) using the TRIzol reagent (Cat No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation is removed by treatment with DNase (Cat No. 1700, Promega) following the manufacturer's instructions. The cDNA is generated using a commercially available kit (Superscript ™ III Reverse Transcriptase, Cat No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of the PCOO1, PC003, PC005, PC010, PC014, PC016 and PC027 genes, a series of PCR reactions are performed with degenerate primers using Amplitaq Gold (Cat No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are provided in Table 14. Table 14 shows the Phaedon cochleariae target genes including the sequences of primers and cDNA sequences obtained. These primers are used in the respective PCR reactions under the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragments are analyzed on agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned into vector pCR4 / T0P0 (Cat No. K4530-20, Invitrogen) and the sequence is determined. The sequences of the resulting PCR products are represented by the respective SEQ ID NO: s as provided in Table 14 and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by the respective SEQ ID NO: s as provided in Table 24. Table 24 provides the amino acid sequences of the cDNA clones, and the start of the reading frame is indicated in parentheses.

B. Production of AR ds of the Phaedon cochleariae genes The dsRNA is synthesized in milligram quantities using the commercially available kit System for TIS Ribomax ™ EX7 RNAi (Cat. No. P 1700, Promega). First, two separate separate templates of the T7 RNA polymerase promoter are generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 sense template is generated using the primers towards the 5 'end of specific T7 and toward the specific 3' end. The sequences of the respective primers to amplify the sense template for each of the target genes are provided in Table 65. Table 65 provides details for preparing dsRNA fragments of the Phaedon cochleariae target sequences, including the primer sequences. The conditions in the PCR reactions are as follows: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C followed by 10 minutes at 72 ° C. The antisense template of T7 is generated by using the primers towards the specific 5 'end and towards the specific 3' end of T7 in a PCR reaction with the same conditions as described above. The sequences of the respective primers for amplifying the antisense template for each of the target genes are provided in Table 65. The resulting PCR products are analyzed on agarose gel and purified using the PCR purification kit (Purification kit of Qiaquick PCR, Cat No. 28106, Qiagen) and precipitation with NaCl04. The T7 templates towards the 5 'end and towards the 3' end generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of maker. The sense strand of the resulting dsRNA for each of the target genes is provided in Table 65.

C. Laboratory tests to analyze dsRNA targets, using rapeseed discs for activity against Phaedon cochleariae larvae The example given below is an example of the discovery that mustard leaf beetle (MLB) larvae are susceptible to orally ingested dsRNA corresponding to the target genes themselves. To analyze the different samples of double-stranded RNA against MLB larvae, a leaf disc test using rape foliar material (Brassica napus variety SW Oban, source: Nick Balaam, Sw Seed Ltd., 49 North Road, Abington, Cambridge, CB1 6AS, UK) as a food source. Insect cultures are maintained in the same variety of rape in the insect chamber at 25 ± 2 ° C and 60 ± 5% relative humidity with a photoperiod of 16 light hours / 8 hours dark. Discs approximately 1.1 cm in diameter (or 0.95 cm2) are cut from the leaves of rapeseed plants from 4 to 6 weeks of age using an appropriately sized cork punch. The double-stranded RNA samples are diluted to 0.1 and g / μ? in Milli-Q water containing 0.05% Triton X-100. The treated leaf discs are prepared by applying 25 μ? of the diluted solution of the dsRNA of the target PC001, PC003, PC005, PC010, PC014, PC016, PC027 and the control of dsRNA of gfp or Triton X-100 0.05% on the adaxial surface of the leaf. The leaf discs are allowed to dry and are individually placed in each of the 24 cavities of a 24-well multiple plate containing 1 ml of 2% gelled agar which helps prevent the leaf disc from drying out. Two neonatal MLB larvae are placed in each cavity of the plate, which is then covered with a plastic cap for multiple cavities. The plate (one treatment contains 48 insects) is divided into 4 repetitions of 12 insects per repetition (each row). The plate containing insects and leaf discs is kept in an insect chamber at 25 + 2 ° C and 60 ± 5% relative humidity with a photoperiod of 16 light hours / 8 dark hours. The insects are fed with leaf discs for 2 days after which they are transferred to a new plate containing freshly treated leaf discs. After that, 4 days after the start of the bioassay, the insects from each repetition are collected and transferred to a Petri dish containing fresh untreated rapeseed leaves. Mortality and average weight of the larvae are recorded on days 2, 4, 7, 9 and 11. Larvae of P. cochleariae fed with rapeseed leaves treated with naked dsRNA from the target result in significant increases in the mortality of the larvae for all the objectives analyzed, as indicated in Figure 1 (a). The double-stranded RNA for target PC010 analyzed leads to 100% mortality of larvae on day 9 and for target PC027 on day 11. For all other objectives, significantly higher mortality values are obtained on day 11 when compared to gfp dsRNA control, 0.05% Triton X-100 alone or only untreated leaf: (average value in percent + confidence interval with alpha 0.05) PC001 (94.4 ± 8.2); PC003 (86.1 ± 4.1); PC005 (83.3 ± 7.8); PC014 (63.9 ± 20.6); PC016 (75.0 ± 16.8); DsRNA of gfp (11.1 ± 8.2); Triton X-100 0.05% (19.4 ± 10.5); only sheet (8.3 + 10.5). Survivors of the larvae are analyzed based on their average weight. For all the objectives analyzed, the larvae of the mustard leaf beetle have average weights reduced significantly after day 4 of the bioassay; insects fed with the control of gfp dsRNA or 0.05% Triton X-100 alone, develop normally, as do larvae fed only leaves (Figure 16 (b)).

D. Laboratory tests to select dsRNA molecules at different concentrations using rapeseed discs for activity against Phaedon cochleariae larvae Twenty-five μ? of a PC010 or PC027 target dsRNA solution at ten-fold serial concentrations from 0.1 μ? / μ? up to 0.1 ng / μ? in the rape leaf disk, as described in the previous example 4D. As a negative control, Triton X-100 is administered only 0.05% to the leaf disk. By treatment, twenty-four neonatal larvae of the mustard leaf beetle are analyzed, with two insects per cavity. The plates are stored in the breeding chamber of insects at 25 ± 2 ° C, 60 ± 5% relative humidity, with a photoperiod of 16: 8 light hours: dark. On day 2, the larvae are transferred to a fresh plate containing fresh leaf discs treated with dsRNA. On day 4 for the PCO10 target and on day 5 for the target PC027, the insects from each repetition are transferred to a Petri dish containing abundant untreated leaf material. Beetles are evaluated as alive or dead on days 2, 4, 7, 8, 9, and 11 for the PCO10 target, and 2, 5, 8, 9, and 12 for target PC027. Feeding larvae of P. cochleariae with rapeseed discs containing intact naked dsRNA molecules of the two different targets, PCOlO and PC027, results in high mortalities at concentrations as low as 1 ng of dsRNA / μ? of solution, as shown in Figures 2 (a) and (b). Average mortality values in percentage ± confidence interval with alpha 0.05 for different concentrations of dsRNA for the PCOlO target on day 11, 0 μ? / Μ? : 8.3 ± 9.4; 0.1 μ? / Μ ?: 100; 0.01 μ? / Μ ?: 79.2 ± 20.6; 0.001 μ? / Μ ?: 58.3 ± 9.4; 0.0001 μ? / Μ ?: 12.5 ± 15.6; and for the target PC027 on day 12, 0 μ? / μ ?: 8.3 ± 9.4; 0.1 μ? / Μ ?: 95.8 ± 8.2; 0.01 ug / μ? : 95.8 ± 8.2; 0.001 g / μ ?: 83.3 ± 13.3; 0.0001 μ? / Μ ?: 12.5 ± 8.2.

E. Cloning an MLB gene fragment into an appropriate vector for the bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to an MLB gene target into a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference to WO0001846). The sequences of the specific primers used for the amplification of target genes are provided in Tables 64 through 73. The template used is the pCR8 / G / topo vector containing any of the target sequences. The primers are used in a PCR reaction under the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned by blunt ends in the pGNA49A vector linearized with Srf I (reference to document O00188121 Al), and its sequence is determined. The sequence of the resulting PCR product corresponds to the respective sequence as provided in Tables 64 to 73. The recombinant vector harboring this sequence is named pGBNJ00 (to be completed). The sequences of the specific primers used for the amplification of the target gene fragment PC010 are provided in Table 65. The template used is the vector pCR8 / GW / mole containing the sequence of PC010 (SEQ ID NO: 253). The primers are used in a PCR reaction of high binding specificity (touchdown PCR) with the following conditions: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C with decrease of the temperature of -0.5 ° C per cycle and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned by blunt ends in the pGNA49A vector linearized with Srf I (reference to WO00188121 Al), and its sequence is determined. The sequence of the resulting PCR product corresponds to SEQ ID NO: 488 as provided in Table 65. The recombinant vector harboring this sequence is named pGCDJOOl.

F. Expression and production of a double-stranded RNA target in two strains of Escherichia coli AB309-105 The procedures described below are followed in order to express appropriate levels of active double-stranded RNA in the insect target in bacteria. In this experiment, the strain deficient in RNAasalII, AB309-105, is used.

Transformation of AB309-105 Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 of E. frost chemically competent coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. Four hundred fifty μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the bacterial cell suspension to a 500 ml conical flask containing 150 ml of Luria-Bertani liquid broth (LB) supplemented with 100 iq / ml of the carbenicillin antibiotic. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in ?? 309-105 The expression of double-stranded RNA from the recombinant vector, pGBNJ003, in bacterial strain AB309-105 is made possible because all the genetic components are present for controlled expression. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions. The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete S medium (SNC medium plus 5 ug / ml of cholesterol) supplemented with 100 μl / ml of carbenicillin and 1 mM of IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 ° C for 20 minutes in a water bath. After the heat treatment, the bacterial tablet is resuspended in a total volume of 50 ml of 0.05% solution of Triton X-100. The tube is stored at 4 ° C until later use G. Laboratory tests to analyze Escherichia coli that expresses objectives of dsRNA against Phaedon cochleariae Leaf disc bioassays The leaf disc bioassay method is used to analyze the double-stranded RNA from the PC010 target produced in Escherichia coli (from the plasmid pGCDJOOl) against mustard leaf beetle larvae. The leaf discs are prepared from rapeseed foliage, as described in example 4. Twenty μ? of a bacterial suspension, with an optical density measurement of 1 to a wavelength of 600 nm, in each disc. The leaf disc is placed in a cavity of a 24-cavity plate containing 1 ml of gelled agar. Two neonatal larvae are added to each leaf disc. For each treatment, 3 repetitions of 16 neonatal larvae are prepared for each repetition. The plates are kept in the insect breeding chamber at 25 + 2 ° C and 60 + 5% relative humidity, with a photoperiod of 16: 8 light hours: dark. On day 3 (ie 3 days after the start of the bioassay), the larvae are transferred to a new plate containing treated fresh leaf discs (same dose). The leaf material is renewed every third day from day 5 onwards. The bioassay is rated in mortality and average weight. Negative controls are leaf discs treated with bacteria harboring plasmid pGN29 (empty vector) and only leaf. An evident increase in mortality of larvae of P. cochleariae is shown with time after the insects are fed with rapeseed leaves treated with a suspension of the E. coli strain AB309-105 deficient in RNAasalII which contains the plasmid pGCDJOOl, while very little or no insect mortality is observed in the case of bacteria with the pGN29 plasmid or the leaf-only control (Figure 18).

Plant-based bioassays Whole plants are sprayed with suspensions of chemically induced bacteria that express dsRNA before using the plants to feed MLB. These are grown in a room chamber for plant growth. The plants are enclosed placing a 500 ml plastic bottle face down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut and covered with a fine nylon mesh to allow aeration, reduce condensation inside and prevent the escape of insects. The MLBs are placed on each treated plant in the cage. The plants are treated with a suspension of E. coli AB309-105 harboring the pGBNJOOl plasmids or the pGN29 plasmid. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit is defined as 109 bacterial cells in 1 ml of a bacterial suspension at an optical density value of 1 at a wavelength 600 nm. In each case, a total volume of between 1 and 10 ml is sprinkled on the plant with the help of a vaporizer. In this test a plant is used per treatment. The number of survivors is counted and the weight of each survivor is recorded. Spraying the plants with a suspension of the E. coli bacterial strain AB309-105 expressing the dsRNA of the pGBNJ003 target leads to a dramatic increase in insect mortality when compared to the control of pGN29. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in bacterial expression systems either wild-type or deficient in RNAasalII is toxic to the insect in terms of substantial increases in insect mortality and retardation. in growth / development for larval survivors. It is also evident from these experiments that an embodiment for the effective protection of plants / crops against insect damage is provided by the use of a spray of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

EXAMPLE 5 Epilachna varivetis (Mexican bean beetle) A. Cloning of partial gene sequences of Epilachna varivetis High quality, intact RNA is isolated from four different larval stages of Epilachna varivetis (Mexican bean beetle), source: Thomas Dorsey, Supervising Entomologist, New Jersey Department of Agriculture, Division of Plant Industry, Bureau of Biological Pest Control, Phillip Alampi Beneficial Insect Laboratory, PO Box 330, Trenton, New Jersey 08625-0330, USA) using the TRIzol reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation is removed by DNase treatment following the manufacturer's instructions (Cat No. 1700, Promega). The cDNA is generated using a commercially available kit (Superscript ™ III Reverse Transcriptase, Cat No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of the EV005, EV009, EV010, EV015 and EV016 genes, a series of PCR reactions are performed with degenerate primers using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are provided in Table 15, which shows the target genes of Epilachna varivetis including the sequences of primers and cDNA sequences obtained. These primers are used in the respective PCR reactions under the following conditions: for EV005 and EV009, 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C (1 minute at 50 ° C and 1 minute 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C; for EV014, 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 53 ° C and 1 minute at 72 ° C, followed by 7 minutes at 72 ° C; for EV010 and EV016, 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 40 seconds at 72 ° C, followed by 7 minutes at 72 ° C. The resulting PCR fragments are analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned into the pCR4 / TOPO vector (Cat No. K4530-20, Invitrogen), and its sequence is determined. The sequences of the resulting PCR products are represented by the respective SEQ ID NO: s as provided in Table 15 and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by the respective SEQ ID NO: s as provided in Table 25, wherein the start of the reading frame is indicated in parentheses.

B. Production of dsRNA from the genes of Epilachna varivetis The dsRNA is synthesized in milligram quantities using the commercially available kit System for RNAi Expri T7 Ribomax ™ (Cat No. P 1700, Promega). First, two separate separate templates of the T7 RNA polymerase promoter are generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 sense template is generated using the primers towards the 5 'end of specific T7 and toward the specific 3' end. The sequences of the respective primers to amplify the sense template for each of the target genes are provided in Table 66. The conditions in the PCR reactions are as follows: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C followed by 10 minutes at 72 ° C ° C. The antisense template of T7 is generated by using the primers towards the specific 5 'end and towards the specific 3' end of T7 in a PCR reaction with the same conditions as described above. The sequences of the respective primers for amplifying the antisense template for each of the target genes are provided in Table 66. The resulting PCR products are analyzed on agarose gel and purified using the PCR purification kit (Purification kit of Qiaquick PCR, Cat No. 28106, Qiagen) and precipitation with NaC104. The T7 templates towards the 5 'end and towards the 3' end generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of maker. The sense strand of the resulting dsRNA for each of the target genes is given in Table 66.

C. Laboratory tests to analyze dsRNA targets using bean leaf discs for activity against Epilachna varivetis larvae The example given below is an example of the discovery that Mexican bean beetle larvae (MBB) are susceptible to ingested dsRNA. orally corresponding to the target genes themselves. To analyze the different samples of double-stranded RNA against MBB larvae, a foliar disk test is used using leaf material of green beans. { Phaseolus v lgaris Montano variety; source: Aveve NV, Belgium) as a food source. The same variety of beans is used to keep insect cultures in the insect chamber at 25 + 2 ° C and 60 + 5% relative humidity with a photoperiod of 16 light hours / 8 dark hours. Discs of approximately 1.1 cm in diameter (or 0.95 cm2) are cut from leaves of 1 to 2 week old bean plants using a cork punch of appropriate size. The double-stranded RNA samples are diluted to 1 μ? / Μ? in Milli-Q water containing 0.05% Triton X-100. The treated leaf discs are prepared by applying 25 μ? of the diluted solution of the dsRNA of the target Ev005, EvOlO, Ev015, Ev016 and the control of dsds of gfp or Triton X-100 0.05% on the adaxial surface of the leaf. The leaf discs are allowed to dry and are individually placed in each of the 24 cavities of a 24-well multiple plate containing 1 ml of 2% gelled agar which helps prevent the leaf disc from drying out. A single neonatal MBB larva is placed in each cavity of a plate, which is then covered with a plastic cap for multiple cavities. The plate is divided into 3 repetitions of 8 insects per repetition (row). The plate containing the insects and the leaf discs is kept in an insect chamber at 25 ± 2 ° C and 60 ± 5% relative humidity with a photoperiod of 16 light hours / 8 dark hours. The insects are fed with the leaf discs for 2 days after which the insects are transferred to a new plate containing freshly treated leaf discs. After that, 4 days after the start of the bioassay, the insects are transferred to a Petri dish containing fresh untreated bean leaves every day until day 10. Insect mortality is recorded on day 2 and every third day after this . Feeding larvae of E. varivestis with green bean leaves containing intact, naked, target dsRNA molecules applied on the surface results in significant increases in larval mortalities, as indicated in Figure 1. The dsRNA of double chain analyzed from the EvOlO, Ev015, and Ev016 targets leads to 100% mortality after 8 days, while the dsRNA of the Ev005 target takes 10 days to kill all the larvae. Most insects fed with treated leaf disks containing the control of gfp dsRNA or only the triton X-100 surfactant are maintained throughout the bioassay (Figure 19).

D. Laboratory tests to analyze dsRNA targets using bean leaf discs for activity against adults of Epilachna varivestis The example given below is a cjmplification of the discovery that adults of Mexican bean beetle are susceptible to the corresponding orally ingested dsRNA. to one's own obj ective genes. In a bioassay assembly similar to that of Mexican bean beetle larvae, adult MBBs are tested against double-stranded RNA molecules applied topically to bean leaf discs. The test dsRNA from each EvOlO, Ev015 and Ev016 target is diluted in 0.05% Triton X-100 to a final concentration of 0.1 pg / μ ?. Bean leaf discs are treated by topical application of 30 μ? of the test solution on each disk. The discs are allowed to dry completely before placing each one on a slice of 2% gelled agar in each cavity of a 24 cavity multiple cavity plate. Three-day-old adults are collected from the culture cages and given nothing to eat for 7-8 hours before placing an adult in each cavity of the bioassay plate (thus 24 adults per treatment) . The plates are kept in the insect breeding chamber (under the same conditions as for MBB larvae for 24 hours) after which the adults are transferred to a fresh plate containing leaf discs treated with fresh dsRNA. After an additional 24 hours, adults are collected from each treatment and placed in a 30 cm x 15 cm x 10 cm plastic box containing two three-week-old bean plants seeded in pot and not treated. Insect mortality is evaluated from day 4 to day 11. All three dsRNA targets (EvOlO, Ev015 and ???? ß) ingested by adults of Epilachna varivestis results in significant increases in mortality from day 4 (4 days after the start of the bioassay), as shown in Figure 20. From day 5, observe dramatic changes in feeding patterns between insects initially fed with bean leaf discs treated with target dsRNA and those that were fed with discs containing control of gfp dsRNA or Triton X-100 surfactant. The reductions in leaf damage by MBB adults of untreated bean plants are clearly visible for all three targets when compared to gpp and surface active agent dsRNA controls alone, albeit at varying levels; the insects fed with objective 15 cause the least damage to the foliage of the bean (Figure 21 (a)).

E. Cloning a fragment of the MBB gene into an appropriate vector for the bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to an MLB gene target into a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference to WO0001846). The sequences of the specific primers used for the amplification of target genes are provided in Table 66. The template used is the pCR8 / GW / topo vector containing any of the target sequences. The primers are used in a PCR reaction under the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on an agarose gel, purified (QlAquick gel extraction kit, Cat No. 28706, Qiagen), cloned by blunt ends in the vector pGNA49A linearized with SfrI (reference to document O00188121 Al ), and its sequence is determined. The sequence of the resulting PCR product corresponds to the respective sequence as provided in Table 66. The recombinant vector harboring this sequence is named pGBNJOOXX.

F. Expression and production of a double-stranded RNA target in two strains of Escherichia col i: (1) AB309-105, and, (2) BL21 (DE3) The procedures described below are followed in order to express appropriate levels of Active double-stranded RNA in insect of insect target in bacteria. A strain deficient in RNAasalII, AB309-105, is used in comparison with wild-type bacteria containing RNAasalII, BL21 (DE3).

Transformation of AB309-105 and BL21 (DE3) Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 or BL21 (DE3) of frost chemically competent E. coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. Four hundred fifty μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the suspension of bacterial cells to a 500 ml conical flask containing 150 ml of liquid broth from Luria-Bertani (LB) supplemented with 100 μg / ml of the antibiotic carbenicillin. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB309-105 and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in the bacterial strain AB309-105 or BL21 (DE3) is made possible due to to which all the genetic components for controlled expression are present. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions.

The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete medium S (medium SNC plus 5 pg / ml of cholesterol) supplemented with 100 g / ml of carbenicillin and 1 mM of IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial tablet is resuspended in 1.5 ml of MilliQ water and the suspension is transferred to a microcentrifuge tube. Several tubes are prepared and used in the bioassays for each renewal. The tubes are stored at -20 ° C until later use.

G. Laboratory tests to analyze Escherichia coli expressing dsRNA targets against Epilachna varivetis Plant-based bioassays Whole plants are sprayed with suspensions of chemically induced bacteria that express dsRNA before using the plants to feed MBB. These are grown in a room chamber for plant growth. The plants are enclosed by placing a 500-ml plastic bottle face down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut and covered with a fine nylon mesh to allow aeration, reduce the condensation inside and prevent the escape of insects. MMB is placed in each treated plant in the cage. The plants are treated with a suspension of E. coli AB309-105 harboring the pGBNJOOl plasmids or the pGN29 plasmid. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit is defined as 109 bacterial cells in 1 ml of a bacterial suspension at an optical density value of 1 at a wavelength 600 nm. In each case, a total volume of between 1 and 10 ml is sprinkled on the plant with the help of a vaporizer. In this test a plant is used per treatment. The number of survivors is counted and the weight of each survivor is recorded. Spraying the plants with a suspension of the E. coli bacterial strain AB309-105 expressing the dsRNA of the pGBNJ003 target leads to a dramatic increase in insect mortality when compared to the control of pGN29. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in bacterial expression systems either wild-type or deficient in RNAasalII is toxic to the insect in terms of substantial increases in insect mortality and retardation. in growth / development for larval survivors. It is also evident from these experiments that an embodiment is provided for the effective protection of plants / crops against insect damage by the use of a spray of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

EXAMPLE 6 Anthonomus granáis (cotton flake weevil) A. Cloning of partial sequences of Anthonomus granáis High quality, intact RNA is isolated from 3 chrysalises of Anthonomus granáis (cotton flake weevil), source: Dr. Gary Benzon, Benzon Research Inc., 7 Kuhn Drive, Carlisle, Pennsylvania 17013, USA) using the TRIzol reagent (Cat No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation is removed by DNase treatment following the manufacturer's instructions (Cat No. 1700, Promega). The cDNA is generated using a commercially available kit (Superscript ™ III Reverse Transcriptase, Cat No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of the AG001, AG005, AG010, AG014 and AG016 genes, a series of PCR reactions are performed with degenerate primers using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions.

The sequences of the degenerate primers used for amplification of each of the genes are provided in Table 16. These primers are used in the respective PCR reactions under the following conditions: for AG001, AG005 and AG016, 10 minutes at 95 ° C , followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 50 ° C and 1 minute and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C; for AG010, 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 2 minutes and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C; for AG014, 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 12 ° C, followed by 7 minutes at 72 ° C. The resulting PCR fragments are analyzed on agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned into vector pCR8 / GW / TOPO (Cat No. K2500-20, Invitrogen) and The sequences of the resulting PCR products are represented by the respective SEQ ID NO: s as provided in Table 16 and are referred to as the partial sequences The corresponding amino acid partial sequences are represented by the respective ones SEQ ID NO: s as provided in Table 26.

B. Production of dsRNAs from the Anthonomus granis genes (cottonseed weevil) The dsRNA is synthesized in milligram quantities using the commercially available kit System for T7 Ribomax ™ Express RNAi (Cat. No. 1700, Promega). First, two separate separate templates of the T7 RNA polymerase promoter are generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 sense template is generated using the primers towards the 5 'end of specific T7 and toward the specific 3' end. The sequences of the respective primers to amplify the sense template for each of the target genes are provided in Table 67. High-binding specificity PCR is performed as follows: 1 minute at 95 ° C, followed by 20 cycles 30 seconds at 95 ° C, 30 seconds at 60 ° C with a decrease in temperature of 0.5 ° C per cycle and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C, The antisense template of T7 is generated by using the primers towards the specific 5 'end and towards the specific 3' end of T7 in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the. Antisense template for each of the target genes are provided in Table 67. The resulting PCR products are analyzed on agarose gel and purified using the PCR purification kit (Qiaquick PCR Purification Kit, Cat no. 28106, Qiagen) and precipitation with NaC104. The T7 templates towards the 5 'end and towards the 3' end generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of maker. The sense strand of the resulting dsRNA for each of the target genes is provided in Table 67.

C. Laboratory tests to analyze dsRNA targets, using artificial diet for activity against domestic cricket larvae, Acheta domesticus Domestic crickets, Acheta domesticus, are kept at the facilities of Insect Investigations Ltd. (origin: Blades Biological Ltd., Kent, UK ). The insects are raised with bran tablets and cabbage leaves. Mixed sex nymphs of equal size and no more than 5 days old are selected to be used in the test. Double-stranded RNA is mixed with a wheat-based compressed rodent diet (standard diet for rat and mouse, B &K Universal Ltd., Grimston, Aldbrough, Hull, UK). The diet, BK001P, contains the following ingredients in descending order by weight: wheat, soy, wheat feed, barley, binder for tablets, product "rodent 5 vit min", fat blend, dicalcium phosphate, mold carbohydrate (mold carb ). The compressed rodent diet is finely milled and heat treated in a microwave oven prior to mixing, in order to inactivate any enzyme components. The entire rodent diet is taken from the same batch in order to ensure consistency. The ground diet and the dsRNA are completely mixed and are configured as small tablets of the same weight, which are allowed to dry overnight at room temperature. Samples of double-stranded RNA targets and the control of gfp at concentrations of 10 ug / μ? they are applied in the proportion of 1 g of ground diet plus 1 ml of dsRNA solution, which results in an application rate of 10 mg of dsRNA per gram of tablets. The tablets are changed weekly. The insects are supplied with treated tablets during the first three weeks of the test. After this, untreated tablets are provided. The insects are kept inside covered plastic containers (9 cm in diameter, 4.5 cm deep), ten per container. Each sand contains a treated bait tablet and a water source (moistened cotton wool ball), each placed in a separate small weighing pan. The water is replenished ad lib throughout the entire experiment. Evaluations are made at twice weekly intervals, with no more than four days between evaluations, until all control insects have died or moved to adulthood (84 days). In each evaluation the insects are evaluated as alive or dead, and examined for abnormalities. From day 46 onward, once the moulting to the adult stage begins, all insects (living and dead) are evaluated as nymphs or adults. The insects that survive are weighed on day 55 of the test. Four repetitions are made for each of the treatments. During the test the conditions of the test are 25 to 33 ° C and 20 to 25% relative humidity, with a photoperiod of 12:12 hours of light: dark.

D. Cloning an MLB gene fragment into an appropriate vector for the bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to an MLB gene target into a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference to WO0001846). The sequences of the specific primers used for the amplification of target genes are provided in Tables 64 through 73. The template used is the pCR8 / GW / topo vector containing any of the target sequences. The primers are used in a PCR reaction with the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned by blunt ends in the vector pGNA49A linearized with Srf I (reference to WO00188121 Al), and its sequence is determined. The sequence of the resulting PCR product corresponds to the respective sequence as provided in Tables 64 to 73. The recombinant vector harboring this sequence is named pGBNJOOXX.

E. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB309-105, and, (2) BL21 (DE3) The procedures described below are followed in order to express appropriate levels of RNA of double active chain in insect of insect target in bacteria. A strain deficient in RNAasalII, AB309-105, is used in comparison with wild-type bacteria containing RNAasalII, BL21 (DE3).

Transformation of AB309-105 and BL21 (DE3) Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 or BL21 (DE3) of frost chemically competent E. coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. Four hundred fifty μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the bacterial cell suspension to a 500 ml conical flask containing 150 ml of Luria-Bertani liquid broth (LB) supplemented with 100 μg / ml of the antibiotic carbenicilin. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB309-105 and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in the bacterial strain AB309-105 or BL21 (DE3) is made possible due to to which all the genetic components for controlled expression are present. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions. The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete medium S (medium SNC plus 5 and g / ml of cholesterol) supplemented with 100 vq / ml of carbenicillin and 1 mM of IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial tablet is resuspended in 1.5 ml of MilliQ water and the suspension is transferred to a microcentrifuge tube. Several tubes are prepared and used in the bioassays for each renewal. The tubes are stored at -20 ° C until later use.

F. Laboratory tests to analyze E. coli expressing dsRNA targets against Anthonomus granáis Plant-based bioassays Whole plants are sprayed with suspensions of chemically induced bacteria that express dsRNA before using the plants to feed CBW. These are grown in a room chamber for plant growth. The plants are enclosed by placing a 500-ml plastic bottle face down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut and covered with a fine nylon mesh to allow aeration, reduce the condensation inside and prevent the escape of insects. The CBW are placed in each treated plant in the cage. The plants are treated with a suspension of E. coli AB309-105 harboring the pGBNJOOl plasmids or the pGN29 plasmid. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit is defined as 109 bacterial cells in 1 ml of a bacterial suspension at an optical density value of 1 at a wavelength 600 nm. In each case, a total volume of between 1 and 10 ml is sprinkled on the plant with the help of a vaporizer. In this test a plant is used per treatment. The number of survivors is counted and the weight of each survivor is recorded. Sprinkling the plants with a suspension of the bacterial strain AB309-105 of E. coli expressing the dsRNA of the target of pGBNJ003 leads to a dramatic increase in. insect mortality when compared to the control of pGN29. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in bacterial expression systems either wild-type or deficient in RNAasalII is toxic to the insect in terms of substantial increases in insect mortality and retardation. in growth / development for larval survivors. It is also evident from these experiments that an embodiment for the effective protection of plants / crops against insect damage is provided by the use of a spray of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

EXAMPLE 7 Tribolium castaneum (red flour beetle) A. Cloning of partial sequences of Tribolium castaneum High quality, intact RNA is isolated from all the different insect stages of Tribolium castaneum (red flour beetle, source: Dr. Lara Senior, Insect Investigations Ltd., Capital Business Park, Wentloog, Cardiff, CF3 2PX, Wales, UK) using the TRIzol reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation is removed by DNase treatment following the manufacturer's instructions (Cat No. 1700, Promega). The cDNA is generated using a commercially available kit (Superscript ™ III Reverse Transcriptase, Cat No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of the genes TC001, TC002, TC010, TC014 and TC015, a series of PCR reactions are performed with degenerate primers using Amplitaq Gold (Cat No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are provided in Table 17. These primers are used in the respective PCR reactions under the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 50 ° C and 1 minute and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C (TC001, TC014, TC015); 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 2 minutes and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C (TC010); 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 53 ° C and 1 minute at 72 ° C, followed by 7 minutes at 72 ° C (TC002). The resulting PCR fragments are analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned into vector pCR8 / GW / TOPO vector (Cat No. K2500) -20, Invitrogen), and its sequence is determined. The sequences of the resulting PCR products are represented by the respective SEQ ID NO: s as provided in Table 17 and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by the respective SEQ ID NO: s as provided in Table 27.

B. Production of dsRNAs from the Tribolium castaneum genes The dsRNA is synthesized in milligram quantities using the commercially available kit System for T7 Ribomax ™ Express RNAi (Cat. No. 1700, Promega). First, two separate separate templates of the T7 RNA polymerase promoter are generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter.

For each of the target genes, the T7 sense template is generated using the primers towards the 5 'end of specific T7 and toward the specific 3' end. The sequences of the respective primers to amplify the sense template for each of the target genes are provided in Table 68. The conditions in the PCR reactions are as follows: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C (-0.5 ° C / cycle) and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C ° C, followed by 10 minutes at 72 ° C. The antisense template of T7 is generated by using the primers towards the specific 5 'end and towards the specific 3' end of T7 in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the antisense template for each of the target genes are provided in Table 68. The resulting PCR products are analyzed on agarose gel and purified using the PCR purification kit (Purification kit of PCR Qiaquick, Cat no. 28106, Qiagen) and precipitation with NaC10. The T7 templates towards the 5 'end and towards the 3' end generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of maker. The sense strand of the resulting dsRNA for each of the target genes is provided in Table 68.

C. Laboratory tests to analyze dsRNA targets, using artificial diet for activity against Tribolium castaneu larvae The example given below is an example of the discovery that larvae of the red flour beetle (RFB) are susceptible to orally ingested dsRNA. corresponding to the target genes themselves. The red flour beetles, Tribolium castaneum, are kept in the facilities of Insect Investigations Ltd. (origin: Imperial College of Science, Technology and Medicine, Silwood Park, Berkshire, UK). The insects are grown in accordance with SOP / 251/01 of the company. Briefly, the beetles are housed in tanks or plastic jars. These have an open top end to allow ventilation. A piece of mesh is fitted over the top and secured with a rubber band to prevent escape. The medium for raising larvae (flour) is placed in the container where the beetles can reproduce. The colonies of 28 stored product beetles are kept in a room with controlled temperature at 25 ± 3 ° C with a cycle of 16: 8 hours of light: dark. The double-stranded RNA from target TC014 (with the sequence corresponding to SEQ ID NO: -799) is incorporated in a mixture of flour and milk powder (whole flour: milk powder in a ratio of 4: 1) and Let it dry overnight. Each repetition is prepared separately: 100 μ? of a solution of dsRNA 10] iq /] il (1 mg of dsRNA) to 0.1 g of flour / milk mixture. The dry mix is milled to a fine powder. The insects are kept inside Petri dishes (55 mm in diameter), lined with a double layer of filter paper. The treated diet is placed between the two layers of filter paper. Ten mixed sex larvae are placed in the first chrysalis stage in each Petri dish (repeat). Four repetitions are made for each treatment. The control is Milli-Q water. The evaluations (number of survivors) are carried out on a regular basis. During the test, the conditions of the test are 25-33 ° C and 20-25% relative humidity, with a photoperiod of 12:12 hours of light: dark. The survival of larvae of T. castaneum with respect to time on artificial diet treated with dsRNA of the target TC014 is significantly reduced when compared to the diet-only control, as shown in Figure 1.

D. Cloning a fragment of the RFB gene into a vector suitable for the bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to a target of the RFB gene into a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference to WO0001846). The sequences of the specific primers used for the amplification of target genes are provided in Table 68. The template used is the pCR8 / GW / topo vector containing any of the target sequences. The primers are used in a PCR reaction under the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned by blunt ends in the pGNA49A vector linearized with Srf I (reference to WO00188121A1 ), and its sequence is determined. The sequence of the resulting PCR product corresponds to the respective sequence as provided in Table 68. The recombinant vector harboring this sequence is named pGBNJOO XX.

E. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB309-105, and, (2) BL21 (DE3) The procedures described below are followed in order to express appropriate levels of RNA of double active chain in insect of insect target in bacteria. A strain deficient in RNAasalII, AB309-105, is used in comparison with wild-type bacteria containing RNAasalII, BL21 (DE3).

Transformation of AB309-105 and BL21 (DE3) Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 or BL21 (DE3) of frost chemically competent E. coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. Four hundred fifty μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the bacterial cell suspension to a 500 ml conical flask containing 150 ml of Luria-Bertani liquid broth (LB) supplemented with 100 g / ml of the carbenicillin antibiotic. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in ?? 309-105 and BL21 (DE3) The expression of double-stranded RNA from the recombinant vector, pGBNJ003, in the bacterial strain AB309-105 or BL21 (DE3) is done possible because all the genetic components are present for controlled expression. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions. The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete S medium (SNC medium plus 5 μl / cholesterol) supplemented with 100 g / ml carbenicillin and 1 mM IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial tablet is resuspended in 1.5 ml of MilliQ water and the suspension is transferred to a microcentrifuge tube. Several tubes are prepared and used in the bioassays for each renewal. The tubes are stored at -20 ° C until later use.

F. Laboratory tests to analyze Escherichia coli expressing dsRNA targets against Tribolium castaneum Plant-based bioassays Complete plants are sprayed with suspensions of chemically induced bacteria that express dsRNA before using the plants to feed RFB. These are grown in a room chamber for plant growth. The plants are enclosed placing a 500 ml plastic bottle face down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut and covered with a fine nylon mesh to allow aeration, reduce condensation inside and prevent the escape of insects. The RFBs are placed in each treated plant in the cage. The plants are treated with a suspension of E. coli AB309-105 harboring the pGBNJOOl plasmids or the pGN29 plasmid. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, wherein one unit is defined as 109 bacterial cells in 1 ml of a bacterial suspension at an optical density value of 1 to a length of 600 nm wave. In each case, a total volume of between 1 and 10 ml is sprinkled on the plant with the help of a vaporizer. In this test a plant is used per treatment. The number of survivors is counted and the weight of each survivor is recorded. Spraying the plants with a suspension of the E. coli bacterial strain AB309-105 expressing the dsRNA of the pGBNJ003 target leads to a dramatic increase in insect mortality when compared to the control of pGN29. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in bacterial expression systems either wild-type or deficient in RNAasalII is toxic to the insect in terms of substantial increases in insect mortality and retardation. in growth / development for larval survivors. It is also evident from these experiments that an embodiment for the effective protection of plants / crops against insect damage is provided by the use of a spray of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

EXAMPLE 10 Myzus persicae (green peach aphid) A. Cloning of partial sequences of Myzus persicae High quality, intact RNA is isolated from Myzus persicae nymphs (green peach aphid, source: Dr. Rachel Down, Insect &Pathogen Interactions, Central Science Laboratory, Sand Hutton, York, Y041 1LZ, RU) using the TRIzol reagent (Cat No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation is removed by DNase treatment following the manufacturer's instructions (Cat No. 1700, Promega). The cDNA is generated using a commercially available kit (Superscript ™ III Reverse Transcriptase, Cat No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of the MP001, MP002, MP010, MP016 and MP027 genes, a series of PCR reactions are performed with degenerate primers using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions.

The sequences of the degenerate primers used for amplification of each of the genes are provided in Table 18. These primers are used in the respective PCR reactions under the following conditions: for MP001, MP002 and MP016, 10 minutes at 95 ° C , followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 50 ° C and 1 minute 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C; for MP027, a high binding specificity program is used: 10 minutes at 95 ° C, followed by 10 cycles of 30 seconds at 95 ° C, 40 seconds at 60 ° C with a decrease in temperature of IoC per cycle and 1 minute 10 seconds at 72 ° C, followed by 30 cycles of 30 seconds at 95 ° C, 40 seconds at 50 ° C and 1 minute 10 seconds at 72 ° C, followed by 7 minutes at 72 ° C; for MP010, 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 3 minutes at 72 ° C, followed by 7 minutes at 72 ° C. The resulting PCR fragments are analyzed on agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned into the vector pCR8 / GW / TOPO (Cat. 20, Invitrogen), and its sequence is determined. The sequences of the resulting PCR products are represented by the respective SEQ ID NO: s as provided in Table 18 and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by the respective SEQ ID NO: s as provided in Table 28.

B. Gene dsRNA production of Myzus persicae The dsRNA is synthesized in milligram quantities using the commercially available kit System for T7 Ribomax ™ Express RNAi (Cat. No. 1700, Promega). First, two separate separate templates of the T7 RNA polymerase promoter are generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 sense template is generated using the primers towards the 5 'end of specific T7 and toward the specific 3' end. The sequences of the respective primers to amplify the sense template for each of the target genes are provided in Table 69. High-binding specificity PCR is performed as follows: 1 minute at 95 ° C, followed by 20 cycles 30 seconds at 95 ° C, 30 seconds at 55 ° C (for MP001, MP002, P016, MP027 and gfp) or 30 seconds at 50 ° C (for MP010) with a decrease in temperature of 0.5 ° C per cycle and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 45 ° C and 1 minute at 72 ° C followed by 10 minutes at 72 ° C. The antisense template of T7 is generated using the primers towards the specific 5 'end and towards the specific 3' end of T7 in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the antisense template for each of the target genes are provided in Table 69. The resulting PCR products are analyzed on agarose gel and purified using the PCR purification kit (Purification kit of PCR Qiaquick, Cat no. 28106, Qiagen) and precipitation with NaC104. The T7 templates towards the 5 'end and towards the 3' end generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of maker. The sense strand of the resulting dsRNA for each of the target genes is given in Table 69.

C. Laboratory tests to analyze dsRNA targets using liquid artificial diet for activity against Myzus persicae The liquid artificial diet for the green peach aphid, Myzus persicae, is prepared on the basis of the appropriate diet for pea aphids (Acyrthosiphon pisum), as described by Febvay et al. (1988) [Influence of the amino acid balance on the improvement of an artificial diet for a biotype of Acyrthosiphon pisum (Homoptera: Aphididae). Dog. J. Zool. 66: 2449-2453], but with some modifications. The amino acid component of the diet is prepared as follows: in mg / 100 ml, alanine 178.71, beta-alanine 6.22, arginine 244.9, asparagine 298.55, aspartic acid 88.25, cysteine 29.59, glutamic acid 149.36, glutamine 445.61, glycine 166.56 , histidine 136.02, isoleucine 164.75, leucine 231.56, lysine hydrochloride 351.09, methionine 72.35, ornithine (HC1) 9.41, phenylalanine 293, proline 129.33, serine 124.28, threonine 127.16, tryptophan 42.75, tyrosine 38.63, L-valine 190.85. The amino acids are dissolved in 30 ml of Milli-Q water except tyrosine which dissolves first in a few drops of 1 M HC1 before it is added to the amino acid mixture. The vitamin mix component of the diet is prepared as a stock solution of concentrate 5 x as follows: in mg / L, aminobenzoic acid 100, ascorbic acid 1000, biotin 1, calcium pantothenate 50, choline chloride 500 , folic acid 10, myoinositol 420, nicotinic acid 100, pyridoxine hydrochloride 25, riboflavin 5, thiamine hydrochloride 25. Riboflavin is dissolved in 1 ml of water at 50 ° C and then added to the mixed stock solution. vitamins The vitamin mixture is divided into aliquots of 20 ml and stored at -20 ° C. An aliquot of vitamin mixture is added to the amino acid solution. Sucrose and MgS0 .7H20 are added to the mixture in the following amounts: 20 g and 242 mg, respectively. The trace metal reserve solution is prepared as follows: in mg / 100 ml, CuS04.5H20 4.7, FeCl3.6H20 44.5, MnCl2.4H20 6.5, NaCl 25.4, ZnCl2 8.3. Ten ml of the trace metal solution are added and 250 mg of KH2P04 are added to the diet and Milli-Q water is added to a final liquid diet volume of 100 ml. The pH of the diet is adjusted to 7 with 1 M KOH solution. The liquid diet is sterilized by filtration through a 0.22 μp filter disc. (Millipore). Green aphids of the peach (Myzus persicae, source: Dr. Rachel Down, Insect &Pathogen Interactions, Central Science Laboratory, Sand Hutton, York, Y041 1LZ, UK) are bred with rape from 4 to 6 weeks of age (Brassica napus SW Oban variety, source: Nick Balaam, Sw Seed Ltd, 49 North Road, Abington, Cambridge, CB1 6AS, UK) in aluminum frame cages containing 70 mesh and m in a chamber with controlled environment with the following conditions: 23 + 2 ° C and 60 + 5 ° relative humidity, with a photoperiod of 16: 8 light hours: dark. One day before the start of the bioassay, adults are collected from the breeding cages and placed in fresh detached rapeseed leaves in a Petri dish and left in the insect chamber overnight. The next day, nymphs of first chrysalis are chosen and transferred to the feeding chambers. A feeding chamber is constituted by 10 first chrysalis nymphs placed in a small Petri dish (with a diameter of 3 cm) covered with a single layer of parafilm paper M stretched until it is very thin, on which 50 μ? of the diet. The chamber is sealed with a second layer of parafilm and incubated under the same conditions as those of adult cultures. The diet with dsRNA is renewed every third day and the survival of the insects is evaluated on day 8, ie the eighth day after the start of the bioassay. By treatment, 5 feeding chambers are mounted for the bioassay (repetitions) simultaneously. The test and control dsRNA solutions (gfp) are incorporated into the diet at a final concentration of 2 and g / μ ?. The feeding chambers are maintained at 23 ± 2 ° C and 60 + 5% relative humidity, with a photoperiod of 16: 8 light hours: darkness. A Mann-Whitney test is determined using GraphPad Prism version 4 to establish whether or not medians differ significantly between target 27 (MP027) and gfp-dsRNA. In the bioassay, feed Myzus persicae nymphs with artificial liquid diet supplemented with dsRNA. intact naked of target 27 (SEQ ID NO: 1061) using a feeding chamber, results in a significant increase in mortality, as shown in Figure 1. The average percentages of survivors for target 27, gfp and Diet-only treatment are 2, 34 and 82, respectively. The comparison of objective 027 with gfp dsRNA groups using the Mann-Whitney test results in a P-value of a tail of 0.004 which indicates that the median of goal 027 is significantly different (P <; 0.05) of the largest median expected of gfp dsRNA. The green aphids of the peach in the liquid diet with incorporated target 27 dsRNAs are notably smaller than those that were fed with only diet or with the control of gfp dsRNA (data not shown).

D. Cloning a GPA gene fragment into a vector suitable for the bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to a target of the GPA in a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference to WO0001846). The sequences of the specific primers used for the amplification of target genes are provided in Table 69. The template used is the pCR8 / GW / topo vector containing any of the target sequences. The primers are used in a PCR reaction under the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned by blunt ends in the vector pGNA49A linearized with Srf I (reference to WO00188121 Al), and its sequence is determined. The sequence of the resulting PCR product corresponds to the respective sequence as provided in Table 69. The recombinant vector harboring this sequence is named pGBNJOOXX.

E. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) ?? 309-105, and, (2) BL21 (DE3) The procedures described below are followed in order to express appropriate levels of active double-stranded RNA in insect of insect target in bacteria. A strain deficient in RNAasalII, AB309-105, is used in comparison with wild-type bacteria containing RNAasalII, BL21 (DE3).

Transformation of AB309-105 and BL21 (DE3) Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 or BL21 (DE3) of frost chemically competent E. coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. Four hundred fifty μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the bacterial cell suspension to a 500 ml conical flask containing 150 ml of Luria-Bertani liquid broth (LB) supplemented with 100 μg ml of the carbenicillin antibiotic. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB309-105 and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in the bacterial strain AB309-105 or BL21 (DE3) is made possible due to to which all the genetic components for controlled expression are present. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions. The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete S medium (medium SNC plus 5 g / ml of cholesterol) supplemented with 100 g / ml of carbenicillin and 1 mM of IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial tablet is resuspended in 1.5 ml of MilliQ water and the suspension is transferred to a microcentrifuge tube. Several tubes are prepared and used in the bioassays for each renewal. The tubes are stored at -20 ° C until later use.

F. Laboratory tests to analyze Escherichia coli expressing dsRNA targets against Myzus persicae Plant-based bioassays Complete plants are sprayed with suspensions of chemically induced bacteria that express dsRNA before using the plants to feed GPA. These are grown in a room chamber for plant growth. The plants are enclosed placing a 500 ml plastic bottle face down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut and covered with a fine nylon mesh to allow aeration, reduce condensation inside and prevent the escape of insects. GPAs are placed on each treated plant in the cage. The plants are treated with a suspension of E. coli AB309-105 harboring the pGBNJOOl plasmids or the pGN29 plasmid. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit is defined as 109 bacterial cells in 1 ml of a bacterial suspension at an optical density value of 1 at a wavelength 600 nm. In each case, a total volume of between 1 and 10 ml is sprinkled on the plant with the help of a vaporizer. In this test a plant is used per treatment. The number of survivors is counted and the weight of each survivor is recorded. Spraying the plants with a suspension of the E. coli bacterial strain AB309-105 expressing the dsRNA of the pGBNJ003 target leads to a dramatic increase in insect mortality when compared to the control of pGN29. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in bacterial expression systems either wild-type or deficient in RNAasalII is toxic to the insect in terms of substantial increases in insect mortality and retardation. in growth / development for larval survivors. It is also evident from these experiments that an embodiment for the effective protection of plants / crops against insect damage is provided by the use of a spray of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

EXAMPLE 11 Vilaparvata lugens (Chapulín plant coffee) TO . Cloning of partial sequences of Nilaparvata lugens from total RNA of high quality Nilaparvata lugens (source: Dr. JA Gatehouse, Dept. of Biological Sciences, Durham University, UK) cDNA is generated using a commercially available kit (SuperScript ™ III Reverse Transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) ) following the manufacturer's protocol. To isolate the cDNA sequences comprising a portion of the genes of Nilaparvata lugens NL001, NL002, NL003, NL004, NL005, NL006, NL007, NL008, NL009, NL010, NL011, NL012, NL013, NL014, NL015, NL016, NL018, NL019, NL021, NL022, and NL027, a series of PCR reactions with degenerate primers is carried out using Amplitaq Gold (Cat No. N8080240; Applied Biosystems) following the manufacturer's protocol. The sequences of the degenerate primers used for amplification of each of the genes are provided in Table 19. These primers are used in the respective PCR reactions with the following conditions: for NL001: 5 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C: for NL002: 3 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL003: 3 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 61 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL004: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 51 ° C and 1 minute at 72 ° C; for NL005: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 5 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL006: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C; 1 minute at 55 ° C and 3 minutes 30 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for NL007: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 15 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for NL008: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 53 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL009: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL010: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 2 minutes 30 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for NL011: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C; for NL012: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C; for NL013: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C; 1 minute at 54 ° C and 1 minute 10 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for NL014: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 53 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL015: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 40 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for NL016: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 40 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for NL018: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 35 seconds at 72 ° C, followed by 10 minutes at 72 ° C; for NL019: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL021: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 45 seconds at 72 ° C, followed by 10 minutes at 72 ° C: for NL022: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 45 seconds at 72 ° C, followed by 10 minutes at 72 ° C; and for NL027: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 1 minute 45 seconds at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragments are analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned into vector pCR8 / GW / topo (Cat. No. K2500 20 , Invitrogen), and its sequence is determined. The sequences of the resulting PCR products are represented by the respective SEQ ID NO: s as provided in Table 19 and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by the respective SEQ ID NO: s as provided in Table 29 B. Cloning of a partial sequence of the NL023 gene of Nilaparvata lugens by EST sequence from high quality total RNA Nilaparvata lugens (source: Dr. JA Gatehouse, Dept. of Biological Sciences, Durham University, UK) cDNA is generated using a commercially available kit (Superscript ™ III Reverse Transcriptase, Cat. No. 18080044, Invitrogen, Rockville, Maryland, USA) ) following the manufacturer's protocol. A partial cDNA sequence, NL023, is amplified from Nilaparvata lugens cDNA which corresponds to an EST sequence of Nilaparvata lugens in the Genbank public database with accession number CAH65679.2. To isolate the cDNA sequences comprising a portion of the NL023 gene, a series of PCR reactions are performed with specific primers based on EST using PerfectShot ™ ExTaq (Cat. No. RR005A, Takara Bio Inc.) following the protocol of maker . For NL023, the specific primers OGBKW002 and OGBKW003 (represented in the present invention as SEQ ID NO: 1157 and SEQ ID NO: 1158, respectively) are used in two independent PCR reactions under the following conditions: 3 minutes at 95 ° C, followed by 30 cycles of 30 seconds at 95 ° C, 30 seconds at 56 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR products are analyzed on agarose gel, purified (QIAquick® Gel Extraction Kit; Cat No. 28706, Qiagen), cloned into the pCR4-TOPO vector (Cat No. K4575-40, Invitrogen ) and the sequence is determined. The consensus sequence resulting from the sequence determination of both PCR products is represented in the present invention by SEQ ID NO: 1111 and is referred to as the partial sequence of the NL023 gene. The corresponding partial amino acid sequence is represented in the present invention as SEQ ID NO: 1112.

C. Production of gene dsRNA from Nilaparvata lugens The dsRNA is synthesized in milligram quantities using the commercially available kit System for Ribosx ™ T7 RNAi Expression (Cat. No. 1700, Promega). First, two separate, separate templates of the T7 RNA polymerase promoter are generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the TI promoter. For each of the target genes, the T7 sense template is generated using the primers towards the 5 'end of specific T7 and toward the specific 3' end. The sequences of the respective primers to amplify the sense template for each of the target genes are provided in Table 4. The conditions in the PCR reactions are as follows: for NL001: 4 minutes at 94 ° C, followed by 35 cycles 30 seconds at 9 ° C, 30 seconds at 60 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL002: 4 minutes at 94 ° C, followed by 35 cycles of 30 seconds at 94 ° C, 30 seconds at 60 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL003: 4 minutes at 94 ° C, followed by 35 cycles of 30 seconds at 94 ° C, 30 seconds at 66 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL004: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C (30 seconds at 54 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C, for NL005: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 57 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C, for NL006: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 54 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C, for NL007: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 51 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C, for NL008: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C C, 30 seconds at 54 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C, for NL009: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 54 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL010: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 54 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL011: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 53 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL012: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 53 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL013: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL014: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 51 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL015: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL016: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 57 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL018: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL019: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 54 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL021: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL022: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 53 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; for NL023: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 52 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C; and for NL027: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 52 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The antisense template of T7 is generated by using the primers towards the specific 5 'end and towards the specific 3' end of T7 in a PCR reaction with the same conditions as described above. The sequences of the respective primers for amplifying the antisense template for each of the target genes are provided in Table 39. The resulting PCR products are analyzed on agarose gel and purified using the PCR purification kit (Purification kit from PCR Qiaquick, Cat No. 28106, Qiagen). The T7 templates towards the 5 'end and towards the 3' end generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of manufacturer, but with the following modification: the RNA pipette (RNA peppet) is washed twice in 70% ethanol. The sense strand of the resulting dsRNA for each of the target genes is provided in Table 70. The DNA template used for the PCR reactions with the T7 primers on the control of green fluorescent protein (gfp) is the plasmid pPD96. 12 (the Fire Lab, http://genome-www.stanford.edu/group/fire/), which contains the sequence encoding wild type gfp interspersed by 3 synthetic introns. The double-stranded RNA is synthesized using the commercially available T7 RiboMAX ™ Express RNAi System kit (Cat No. P 1700, Promega). First, two separate separate templates of the T7 RNA polymerase promoter are generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For gfp, the sense template of T7 is generated using the primer to the 5 'end of specific T7 OGAU183 and the primer to the specific 3' end of OGAU182 (represented in the present invention as SEQ ID NO: 236 and SEQ ID NO: 237 , respectively) in a PCR reaction with the following conditions: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The antisense template of T7 is generated using the primer to the specific 5 'end 0GAUI8I and the primer to the 3' end of specific T7 OGAU184 (represented in the present invention as SEQ ID NO: 238 and SEQ ID NO: 239, respectively) in a PCR reaction with the same conditions as described above. The resulting PCR products are analyzed on an agarose gel and purified (QIAquick® PCR Purification Kit; Cat No. 28106, Qiagen). The templates towards the 5 'end and towards the 3' end of T7 generated are mixed so that they are transcribed and the resulting RNA chains are fixed, treated with DNase and RNase, and purified by precipitation with sodium acetate and isopropanol, following the manufacturer's protocol, but with the following modification: the RNA pipette (peppet) is washed twice in 70% ethanol. The sense strands of the resulting dsRNA are represented in the present invention by SEQ ID NO: 235.

D. Laboratory tests to select dsRNA targets using liquid artificial diet for activity against Nilaparvata lugens The artificial liquid diet (MMD-1) for brown rice grasshopper, Nilaparvata lugens, is prepared in the manner described by Koyamá (1988) [Artificial rearing and nutritious physiology of the planthoppers and leafhoppers (Homoptera: Delphacidae and Deltocephalidae) on a holidic diet. JARQ 22: 20-27], but with a change in the final concentration of the sucrose diet component: 14.4% (weight by volume) is used. The components of the diet are prepared as separate concentrates: 10 x mineral reserve solution (stored at 4 ° C), 2 x amino acid reserve solution (stored at -20 ° C) and 10 x vitamins reserve solution ( stored at -20 ° C). The reserve solution components are mixed immediately before the start of a bioassay at a 4/3 x concentration to allow dilution with the dsRNA test solution (4 x concentration), the pH is adjusted to 6.5, and sterilized by Filtration in aliquots of approximately 500 μ ?. Brown rice grasshopper (Nilaparvata lugens) is raised in two to three month old rice plants (Oryza sativa cv Taichung Native 1) in a chamber with controlled environment: 27 + 2 ° C, 80% relative humidity, with a photoperiod of 16: 8 light hours: darkness. A feeding chamber comprises 10 first or second chrysalis nymphs placed in a small Petri dish (with a diameter of 3 cm) covered with a single layer of parafilm M stretched until it is very thin, on which 50 μ? diet. The chamber is sealed with a second layer of parafilm and incubated under the same conditions as those of adult cultures but without exposure to direct light. The diet with dsRNA is changed every third day and the survival of the insects is evaluated daily. By treatment, 5 feeding chambers are simultaneously assembled for bioassay (repetitions). The dsRNA test and control solutions (gfp) are incorporated into the diet to a final concentration of 2 mg / ml. The feeding chambers are maintained at 27 + 2 ° C, 80% relative humidity, with a photoperiod of 16: 8 light hours: dark. The insect survival data are analyzed using the Kaplan-Meier survival curve model and the survival between groups is compared using the logarithmic rank test (logrank test) (Prism version 4.0). Feeding Nilaparvata lugens with artificial liquid diet supplemented with intact naked dsRNA molecules in vitro using a feeding chamber results in significant increases in nymph mortalities as shown in four separate bioassays (Figures 2 (a) -24 (d); Tables la-d-NL). These results demonstrate that the dsRNAs corresponding to different essential genes of BPH show significant toxicity towards rice brown rice.

The effect of gfp dsRNA on the survival of BPH in these bioassays is not significantly different than survival in only diet. Tables 78 to 81 show a summary of the survival of Nilaparvata lugens in artificial diet supplemented with 2 mg / ml (final concentration) of the following targets; in Table 78: NL002, NL003, NL005, NL010; in Table 79 NL009, NL016; in Table 80 NL014, NL018; and in Table 81 NL013, NL015, NL021. In the survival analysis column, the effect of RNAi is indicated as follows: + = significantly reduced survival compared to gfp dsRNA control (alpha <0.05); - = no significant difference in survival compared to the control of gfp dsRNA. The survival curves are compared (between diet and diet only supplemented with test dsRNA, gfp dsRNA and test dsRNA, and only diet and gfp dsRNA) using the logarithmic rank test.

E. Laboratory tests to select dsRNA molecules at different concentrations using diet, artificial for activity against Nilaparvata lugens Fifty μ? of artificial liquid diet supplemented with different concentrations of ARNds of objective NL002, in specific 1, 0.2, 0.08, and 0.04 mg / ml (final concentration), to the chambers of feeding of the brown grasshopper. The diet with dsRNA is changed every third day and the survival of the insects is evaluated daily. By treatment, 5 bioassay feeding chambers (repetitions) are mounted simultaneously. The feeding chambers are maintained at 27 + 2 ° C, 80% relative humidity, with a photoperiod of 16: 8 hours of light: dark. Insect survival data are analyzed using the Kaplan-Meier survival curve model and survival between groups is compared using the logarithmic rank test (Prism version 4.0). Feeding artificial liquid diet supplemented with the intact, naked dsRNA of the NL002 target at different concentrations results in significantly higher BPH mortalities at final concentrations as low as 0.04 mg of dsRNA per ml of diet when compared to survival with only diet, as shown in Figure 25 and Table 9-NL. Table 9-NL summarizes the survival of Nilaparvata lugens in the artificial diet feeding test supplemented with 1, 0.2, 0.08, and 0.04 mg / ml (final concentration) of the NL002 target. In the survival analysis column the effect of RNAi is indicated as follows: + = significantly reduces survival compared to diet-only control (alpha <; 0.05); - = no significant differences in survival compared to diet-only control. Survival curves are compared using the logarithmic rank test.

F. Cloning a BPH gene fragment into a vector suitable for the bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to a target of the BPH gene in a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference to WO0001846). The sequences of the specific primers used for the amplification of target genes are provided in Tables 64 through 73. The template used is the pCR8 / GW / topo vector containing any of the target sequences. The primers are used in a PCR reaction under the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned by blunt ends in the vector pGNA49A linearized with Srf I (reference to WO00188121 Al), and its sequence is determined. The sequence of the resulting PCR product corresponds to the respective sequence as provided in Table 70. The recombinant vector harboring this sequence is named pGBNJOO.

G. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB309-105, and, (2) BL21 (DE3) The procedures described below are followed in order to express appropriate levels of RNA of double active chain in insect of insect target in bacteria. A strain deficient in RNAasalII, AB309-105, is used in comparison with wild-type bacteria containing RNAasalII, BL21 (DE3).

Transformation of AB309-105 and BL21 (DE3) Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 or BL21 (DE3) of frost chemically competent E. coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. Four hundred fifty μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the suspension of bacterial cells to a 500 ml conical flask containing 150 ml of liquid broth from Luria-Bertani (LB) supplemented with 100 μg / ml of the antibiotic carbenicillin. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB309-105 and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in the bacterial strain AB309-105 or BL21 (DE3) is made possible due to to which all the genetic components for controlled expression are present. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions. The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete S medium (medium SNC plus 5 ug / ml of cholesterol) supplemented with 100 g / ml of carbenicillin and 1 mM of IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial tablet is resuspended in 1.5 ml of MilliQ water and the suspension is transferred to a microcentrifuge tube. Several tubes are prepared and used in the bioassays for each renewal. The tubes are stored at -20 ° C until later use.

H. Laboratory tests to analyze Escherichia coli expressing ARNds targets against Nilaparvata l gens Plant-based bioassays Whole plants are sprayed with suspensions of chemically induced bacteria that express dsRNA before using the plants to feed BPH. These are grown in a room chamber for plant growth. The plants are enclosed placing a 500 ml plastic bottle face down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut and covered with a fine nylon mesh to allow aeration, reduce condensation inside and prevent the escape of insects. The BPH are placed in each treated plant in the cage. The plants are treated with a suspension of E. coli AB309-105 harboring the pGBNJOOl plasmids or the pGN29 plasmid. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit is defined as 109 bacterial cells in 1 ml of a bacterial suspension at an optical density value of 1 at a wavelength 600 nm. In each case, a total volume of between 1 and 10 ml is sprinkled on the plant with the help of a vaporizer. In this test a plant is used per treatment. The number of survivors is counted and the weight of each survivor is recorded. Sprinkling the plants with a suspension of the bacterial strain AB309-105 of E. coli expressing the AR ds of the target of pGBNJ003 leads to a dramatic increase in insect mortality when compared to the control of pGN29. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in bacterial expression systems either wild-type or deficient in RNAasalII is toxic to the insect in terms of substantial increases in insect mortality and retardation. in growth / development for larval survivors. It is also evident from these experiments that an embodiment for the effective protection of plants / crops against insect damage is provided by the use of a spray of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

EXAMPLE 10 Chilo suppressalis (striated stem borer) rice) TO . Cloning of partial sequence of genes from Chilo suppressalis by family PCR High quality, intact RNA is isolated from the 4 different larval stages of Chilo suppressalis (striated rice stem borer) using the TRIzol reagent (Cat. No. 15596-026 / 15596-018) , Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation is removed by DNase treatment following the manufacturer's instructions (Cat No. 1700, Promega). The cDNA is generated using a commercially available kit (Superscript ™ III Reverse Transcriptase, Cat No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of the CS001 genes, CS002, CS003, CS006, CS007, CS009, CS011, CS013, CS014, CS015, CS016 and CS018, a series of PCR reactions are carried out with degenerate primers using Amplitaq Gold (Cat No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are provided in Table 20. These primers are used in the respective PCR reactions under the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragments are analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned into the pCR4 / TOPO vector (Cat No. K2500-20, Invitrogen), and its sequence is determined. The sequences of the resulting PCR products are represented by the respective SEQ ID NO: s as provided in Table 20 and are referred to as the partial sequences. The corresponding partial amino acid sequences are represented by the respective SEQ ID NO: s as provided in Table 30.

B. Production of dsRNAs from the genes of Chílo suppressalis The dsRNA is synthesized in milligram quantities using the commercially available kit System for RNAi Expri T7 Ribomax ™ (Cat No. P 1700, Promega). First, two separate separate templates of the T7 RNA polymerase promoter are generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 sense template is generated using the primers towards the 5 'end of specific T7 and toward the specific 3' end. The sequences of the respective primers to amplify the sense template for each of the target genes are provided in Table 71. The conditions in the PCR reactions are as follows: 4 minutes at 95 ° C, followed by 35 cycles of 30 seconds at 95 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C, followed by 10 minutes at 72 ° C. The antisense template of T7 is generated by using the primers towards the specific 5 'end and towards the specific 3' end of T7 in a PCR reaction with the same conditions as described above. The sequences of the respective primers for amplifying the antisense template for each of the target genes are provided in Table 71. The resulting PCR products are analyzed on agarose gel and purified using the PCR purification kit (Purification kit of Qiaquick PCR, Cat No. 28106, Qiagen) and precipitation with NaC104. The T7 templates towards the 5 'end and towards the 3' end generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of maker. The sense strand of the resulting dsRNA for each of the target genes is provided in Table 71.

C. Laboratory tests to analyze dsRNA targets, using artificial diet for activity against Chilo suppressalis larvae Rice striatum stem borers, Chilo suppressalis, (origin: Syngenta, Stein, Switzerland) are kept on a modified artificial diet based on that described by Kamano and Sato, 1985 (in: Handbook of Insect Rearing, Volumes I &II, P Singh and RF Moore, eds., Elsevier Science Publishers, Amsterdam and New York, 1985, pp 448). Briefly, a liter of diet is prepared in the following manner: 20 g of agar are added to 980 ml of Milli-Q water and autoclaved; the agar solution is cooled to approximately 55 ° C and the remaining ingredients are added and mixed thoroughly: 40 g of corn flour (Polenta), 20 g of cellulose, 30 g of sucrose, 30 g of casein, 20 g of wheat germ (toasted), 8 g of Wesson salt mixture, 12 g of Vanderzant vitamin mixture, 1.8 g of sorbic acid, 1.6 g of nipagin (methylparaben), 0.3 g of aureomycin, 0.4 g of cholesterol and 0.6 g of L-cysteine. The diet is cooled to approximately 45 ° C and poured into the trays or breeding vessels. The diet is allowed to rest in a horizontal laminar flow hood. Sections of rice leaf with oviposited eggs are removed from a cage that houses adult moths and are fixed to the solid diet in the breeding container or trays. The eggs are allowed to hatch and the neonate larvae are available for bioassays and for the maintenance of insect crops. During the tests and aging, the conditions are 28 ± 2 ° C and 80 ± 5% relative humidity, with a photoperiod of 16: 8 hours of light: dark. The same artificial diet is used for the bioassays but in this case the diet is poured in equal amounts into plates of 24 multiple cavities, in which each cavity contains 1 ml of diet. Once the diet solidifies, the test formulations are applied to the surface of the diet (2 cm2), at a rate of 50 μ? of dsRNA from the target to 1 μ? / μ ?. The dsRNA solutions are allowed to dry and two larvae of first chrysalis moths are placed in each cavity. After 7 days. , the larvae are transferred to fresh diet treated in plates of multiple cavities. On day 14 (ie 14 days after the start of the bioassay) the number of live and dead insects is recorded and examined for abnormalities. Twenty-four larvae are analyzed in total per treatment. An alternative bioassay is carried out in which the neonate larvae of the striated rice stem borer are fed with treated rice leaves. Small sections of rice leaf are submerged Indica variety Taichung native 1 in 0.05% solution of Triton X-100 containing 1 μ? / Μ? of the target's dsRNAs are allowed to dry and each section is placed in a cavity of a 24-cavity plate containing 2% gelled agar. Two neonates are transferred from the breeding dish to each leaf section treated with dsRNA (24 larvae per treatment). After 4 and 8 days, the larvae are transferred to sections of fresh treated rice leaf. The number of live and dead larvae is evaluated on days 4, 8 and 12; any abnormalities are also recorded.

D. Cloning of an SSB gene fragment into an appropriate vector for the bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to a target of the SSB in a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference to WO0001846). The sequences of the specific primers used for the amplification of target genes are provided in Tables 64 through 73. The template used is the pCR8 / GW / topo vector containing any of the target sequences. The primers are used in a PCR reaction under the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned by blunt ends in the pGNA49A vector linearized with Srf I (reference to WO00188121A1 ), and its sequence is • determined. The sequence of the resulting PCR product corresponds to the respective sequence as provided in Table 71. The recombinant vector harboring this sequence is named pGBNJOOXX.

E. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB309-105, and, (2) BL21 (DE3) The procedures described below are followed in order to express appropriate levels of RNA of double active chain in insect of insect target in bacteria. A strain deficient in RNAasalII, AB309-105, is used in comparison with wild-type bacteria containing RNAasalII, BL21 (DE3).

Transformation of AB309-105 and BL21 (DE3) Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 or BL21 (DE3) of frost chemically competent E. coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. Four hundred fifty μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the bacterial cell suspension to a 500 ml conical flask containing 150 ml of Luria-Bertani liquid broth (LB) supplemented with 100 μg / ml of the carbenicillin antibiotic. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB309-105 and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in the bacterial strain AB309-105 or BL21 (DE3) is made possible due to to which all the genetic components for controlled expression are present. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions. The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete medium S (medium SNC plus 5 and g / ml of cholesterol) supplemented with 100 ug / ml of carbenicillin and 1 mM of IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity to insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial tablet is resuspended in 1.5 ml of MilliQ water and the suspension is transferred to a microcentrifuge tube. Several tubes are prepared and used in the bioassays for each renewal. The tubes are stored at -20 ° C until later use.

F. Laboratory tests to analyze Escherichia coli expressing dsRNA targets against Chilo suppressalis Plant-based bioassays Whole plants are sprayed with suspensions of chemically induced bacteria that express dsRNA before using the plants to feed SSB. These are grown in a room chamber for plant growth. The plants are enclosed placing a 500 ml plastic bottle face down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut and covered with a fine nylon mesh to allow aeration, reduce condensation inside and prevent the escape of insects. SSBs are placed on each treated plant in the cage. The plants are treated with a suspension of E. coli AB309-105 harboring the pGBNJOOl plasmids or the pGN29 plasmid. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit is defined as 109 bacterial cells in 1 ml of a bacterial suspension at an optical density value of 1 at a wavelength 600 nm. In each case, a total volume of between 1 and 10 ml is sprinkled on the plant with the help of a vaporizer. In this test a plant is used per treatment. The number of survivors is counted and the weight of each survivor is recorded. Spraying the plants with a suspension of the E. coli bacterial strain AB309-105 expressing the dsRNA of the pGBNJ003 target leads to a dramatic increase in insect mortality when compared to the control of pGN29. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in bacterial expression systems either wild-type or deficient in RNAasalII is toxic to the insect in terms of substantial increases in insect mortality and retardation. in growth / development for larval survivors. It is also evident from these experiments that an embodiment is provided for the effective protection of plants / crops against insect damage by the use of a spray of a formulation consisting of bacteria expressing double-stranded AR corresponding to a target of insect gene.

EXAMPLE 9 Plutella xylostella (diamond back moth) A. Cloning of a partial sequence of Plutella xylostella High quality intact RNA is isolated from all the different larval stages of Plutella xylostella (diamond back moth), source: Dr. Lara Senior, Insect Investigations Ltd., Capital Business Park, Wentloog, Cardiff, CF3 2PX, Wales, UK) using the TRIzol reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation is removed by DNase treatment following the manufacturer's instructions (Cat No. 1700, Promega). The cDNA is generated using a commercially available kit (Superscript ™ III Reverse Transcriptase, Cat no. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of the genes PX001, PX009, PX010, PX015, PX016, a series of PCR reactions are performed with degenerate primers using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are provided in Table 21. These primers are used in the respective PCR reactions under the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 50 ° C and 1 minute and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C (for PX001, PX009, PX015, PX016); 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 54 ° C and 2 minutes and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C (for PX010).

The resulting PCR fragments are analyzed on agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned into the vector pCR8 / GW / TOPO (Cat. 20, Invitrogen) and the sequence is determined. The sequences of the resulting PCR products are represented by the respective SEQ ID NO: s as provided in Table 21 and are referred to as the partial sequences. The corresponding amino acid partial sequences are represented by the respective SEQ ID NO: s as provided in Table 31.

B. Production of dsRNA from the genes of Plutella xylostella The dsRNA is synthesized in milligram quantities using the commercially available kit System for RNAi Express T7 Ribomax ™ (Cat No. P 1700, Promega). First, two separate separate templates of the T7 RNA polymerase promoter are generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 sense template is generated using the primers towards the 5 'end of specific T7 and toward the specific 3' end. The sequences of the respective primers to amplify the sense template for each of the target genes are provided in Table 72. The conditions in the PCR reactions are as follows: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C (-0.5 ° C / cycle) and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C ° C, followed by 10 minutes at 72 ° C. The antisense template of T7 is generated by using the primers towards the specific 5 'end and towards the specific 3' end of T7 in a PCR reaction with the same conditions as described above. The sequences of the respective primers for amplifying the antisense template for each of the target genes are provided in Table 72. The resulting PCR products are analyzed on agarose gel and purified using the PCR purification kit (Purification kit PCR Qiaquick, Cat No. 28106, Qiagen) and precipitation with NaC10. The T7 templates towards the 5 'end and towards the 3' end generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified, using sodium acetate, following the instructions manufacturer. The sense strand of the resulting dsRNA for each of the target genes is provided in Table 72.

C. Laboratory tests to analyze dsRNA targets, using artificial diet for activity against Plutella xylostella larvae Diamond back moths, Plutella xylostella, are kept at Insect Investigations Ltd. (origin: Newcastle University, Newcastle-upon-Tyne , UK). The insects are raised with cabbage leaves. First mixed pupa larvae (approximately 1 day old) are selected for use in the test. The insects are kept in Eppendorf tubes (1.5 ml capacity). A commercially available diamond back moth diet (Bio-Serv, NJ, USA), which is prepared following the manufacturer's instructions, is placed on the top of each tube (0.25 ml capacity, 8 mm diameter). While it is liquid, the diet presents greater facility to eliminate the excess and produce a uniform surface. Once the diet solidifies, the test formulations are applied to the surface of the diet, at a rate of 25 μ? of undiluted formulation (1 pg / pl of dsRNA of the targets) by repetition. The test formulations are allowed to dry and a first chrysalis moth larva is placed in each tube. The larva is placed on the surface of the diet in the lid and the tube is closed carefully. The tubes are stored upside down, on their covers in such a way that each larva remains on the surface of the diet. Twice a week the larvae are transferred to fresh Eppendorf tubes with fresh diet. The insects are provided with treated diet during the first two weeks of the test and after that with untreated diet. Evaluations are carried out twice a week for a total of 38 days at which time all the larvae are dead. In each evaluation the insects are evaluated as alive or dead and examined for abnormalities. For each of the treatments, forty repetitions are made with individual larvae. During the test the conditions of the test are 23 to 26 ° C and 50 to 65% relative humidity, with a photoperiod of 16: 8 light hours: darkness.

D. Cloning a DBM gene fragment into a vector suitable for the bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to a DBM gene target into a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference to document O0001846). The sequences of the specific primers used for the amplification of target genes are provided in Table 72. The template used is the vector pCR8 / GW / topo that contains any of the target sequences. The primers are used in a PCR reaction under the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned by blunt ends in the vector pGNA49A linearized with Srf I (reference to WO00188121 Al), and its sequence is determined. The sequence of the resulting PCR product corresponds to the respective sequence as provided in Table 72. The recombinant vector harboring this sequence is named pGBNJOOXX.

E. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB309-105, and, (2) BL21 (DE3) The procedures described below are followed in order to express appropriate levels of RNA of double active chain in insect of insect target in bacteria. A strain deficient in RNAasalII, AB309-105, is used in comparison with wild-type bacteria containing RNAasalII, BL21 (DE3).

Transformation of AB309-105 and BL21 (DE3) Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 or BL21 (DE3) of frost chemically competent E. coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. Four hundred fifty μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the suspension of bacterial cells to a 500 ml conical flask containing 150 ml of Luria-Bertani liquid broth (LB) supplemented with 100 of the carbenicillin antibiotic. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB309-105 and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in the bacterial strain AB309-105 or BL21 (DE3) is made possible due to to which all the genetic components for controlled expression are present. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions. The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete medium S (medium SNC plus 5 and g / ml of cholesterol) supplemented with 100 g / ml of carbenicillin and 1 mM of IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. Nevertheless, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite to induce toxicity towards insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 CC for 20 minutes in a water bath. After the heat treatment, the bacterial tablet is resuspended in 1.5 ml of MilliQ water and the suspension is transferred to a microcentrifuge tube. Several tubes are prepared and used in the bioassays for each renewal. The tubes are stored at -20 ° C until later use.

F. Laboratory tests to analyze Escherichia coli expressing dsRNA targets against Plutella xylostella Plant-based bioassays Whole plants are sprayed with suspensions of chemically induced bacteria that express dsRNA before using the plants to feed DBM. These are grown in a room chamber for plant growth. The plants are enclosed placing a 500 ml plastic bottle face down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut and covered with a fine nylon mesh to allow aeration, reduce condensation inside and prevent the escape of insects. The DBM are placed in each treated plant in the cage. The plants are treated with a suspension of E. coli AB309-105 harboring the pGBNJOOl plasmids or the pGN29 plasmid. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit is defined as 109 bacterial cells in 1 ml of a bacterial suspension at an optical density value of 1 at a wavelength 600 nm. In each case, a total volume of between 1 and 10 ml is sprinkled on the plant with the help of a vaporizer. In this test a plant is used per treatment. The number of survivors is counted and the weight of each survivor is recorded. Spraying the plants with a suspension of the E. coli bacterial strain AB309-105 expressing the dsRNA of the pGBNJ003 target leads to a dramatic increase in insect mortality when compared to the control of pGN29. These experiments show that the double-stranded RNA corresponding to a target sequence of insect gene produced in bacterial expression systems either wild-type or deficient in RNAasalII is toxic to the insect in terms of substantial increases in insect mortality and retardation. in growth / development for larval survivors. It is also evident from these experiments that an embodiment for the effective protection of plants / crops against insect damage is provided by the use of a spray of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

EXAMPLE 12 Acheta domesticus (domestic cricket) A. Cloning of partial sequences of Acheta domesticus High quality, intact RNA is isolated from all the different insect stages of Acheta domesticus (domestic cricket), source: Dr. Lara Senior, Insect Investigations Ltd., Capital Business Park, Wentloog , Cardiff, CF3 2PX, Wales, UK) using the TRIzol reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation is removed by DNase treatment following the manufacturer's instructions (Cat No. 1700, Promega).

The cDNA is generated using a commercially available kit (Superscript ™ III Reverse Transcriptase, Cat No. 18080044, Invitrogen, Rockville, Aryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of the AD001, AD002, AD009, AD015 and AD016 genes, a series of PCR reactions are performed with degenerate primers using Amplitaq Gold (Cat. No. N8080240, Applied Biosystems) following the manufacturer's instructions. The sequences of the degenerate primers used for amplification of each of the genes are provided in Table 22. These primers are used in the respective PCR reactions under the following conditions: 10 minutes at 95 ° C, followed by 40 cycles of 30 seconds at 95 ° C, 1 minute at 50 ° C and 1 minute and 30 seconds at 72 ° C, followed by 7 minutes at 72 ° C. The resulting PCR fragments are analyzed on an agarose gel, purified (QIAquick gel extraction kit, Cat No. 28706, Qiagen), cloned into vector pCR8 / GW / topo (Cat. No. K2500 20 , Invitrogen) and the sequence is determined. The sequences of the resulting PCR products are represented by the respective SEQ ID NO: s as provided in Table 22 and are referred to as the partial sequences. The corresponding amino acid partial sequences are represented by the respective SEQ ID NO: s as provided in Table 32.

B. Production of dsRNAs from the genes of Acheta domesticus The dsRNA is synthesized in milligram quantities using the commercially available kit System for RNAi Express T7 Ribomax ™ (Cat No. P 1700, Promega). First, two separate separate templates of the T7 RNA polymerase promoter are generated in two separate PCR reactions, each reaction containing the target sequence in a different orientation relative to the T7 promoter. For each of the target genes, the T7 sense template is generated using the primers towards the 5 'end of specific T7 and toward the specific 3' end. The sequences of the respective primers to amplify the sense template for each of the target genes are provided in Table 73. The conditions in the PCR reactions are as follows: 1 minute at 95 ° C, followed by 20 cycles of 30 seconds at 95 ° C, 30 seconds at 60 ° C (-0.5 ° C / cycle) and 1 minute at 72 ° C, followed by 15 cycles of 30 seconds at 95 ° C, 30 seconds at 50 ° C and 1 minute at 72 ° C ° C, followed by 10 minutes at 72 ° C. The antisense template of T7 is generated by using the primers towards the specific 5 'end and towards the specific 3' end of T7 in a PCR reaction with the same conditions as described above. The sequences of the respective primers to amplify the antisense template for each of the target genes are provided in Table 73. The resulting PCR products are analyzed on agarose gel and purified using the PCR purification kit (Purification kit of PCR Qiaquick, Cat No. 28106, Qiagen) and precipitation with NaC104. The T7 templates towards the 5 'end and towards the 3' end generated are mixed so that they are transcribed and the resulting RNA strands are fixed, treated with DNase and RNase, and purified using sodium acetate, following the instructions of maker. The sense strand of the resulting dsRNA for each of the target genes is provided in Table 73.

C. Laboratory tests to analyze dsRNA targets, using artificial diet for activity against Acheta domesticus larvae Domestic crickets, Acheta domesticus, are kept in the facilities of Insect Investigations Ltd. (origin: Blades Biological Ltd., Kent, UK). The insects are raised with bran tablets and cabbage leaves. Mixed sex nymphs of equal size and no more than 5 days old are selected to be used in the test. Double-stranded RNA is mixed with a wheat-based compressed rodent diet (standard diet for rat and mouse, B &K Universal Ltd., Grimston, Aldbrough, Hull, UK). The diet, BK001P, contains the following ingredients in descending order by weight: wheat, soy, wheat feed, barley, binder for tablets, product "rodent 5 vit min", fat mixture, dicalcium phosphate, mold carbohydrate. The compressed rodent diet is finely milled and heat treated in a microwave oven prior to mixing, in order to inactivate any enzyme components. The entire rodent diet is taken from the same batch in order to ensure consistency. The ground diet and the dsRNA are completely mixed and are configured as small tablets of the same weight, which are allowed to dry overnight at room temperature. The double-stranded RNA samples of the targets and the control of gfp at concentrations of 10 μg / μ? they are applied in the proportion of 1 g of ground diet plus 1 ml of dsRNA solution, which results in an application rate of 10 mg of dsRNA per gram of tablets. The tablets are changed weekly. The insects are supplied with treated tablets during the first three weeks of the test. After this, untreated tablets are provided. The insects are kept inside covered plastic containers (9 cm in diameter, 4.5 cm deep), ten per container. Each sand contains a treated bait tablet and a water source (moistened cotton wool ball), each one placed in a separate small weighing pan. The water is replenished ad lib throughout the entire experiment. Evaluations are made at twice weekly intervals, with no more than four days between evaluations, until all control insects have died or moved to adulthood (84 days). In each evaluation the insects are evaluated as alive or dead, and examined for abnormalities. From day 46 onward, once the moulting to the adult stage begins, all insects (living and dead) are evaluated as nymphs or adults. The insects that survive are weighed on day 55 of the test. Four repetitions are made for each of the treatments. During the test the conditions of the test are 25 to 33 ° C and 20 to 25% relative humidity, with a photoperiod of 12:12 light hours: dark.

D. Cloning of a HC gene fragment into a vector suitable for the bacterial production of insect-active double-stranded RNA The following is an example of cloning a DNA fragment corresponding to a HC gene target in a vector for the expression of double-stranded RNA in a bacterial host, although any vector comprising a T7 promoter or any other promoter for efficient transcription in bacteria can be used (reference to WO0001846). The sequences of the specific primers used for the amplification of target genes are provided in Tables 64 through 73. The template used is the pCR8 / GW / topo vector containing any of the target sequences. The primers are used in a PCR reaction under the following conditions: 5 minutes at 98 ° C, followed by 30 cycles of 10 seconds at 98 ° C, 30 seconds at 55 ° C and 2 minutes at 72 ° C, followed by 10 minutes at 72 ° C. The resulting PCR fragment is analyzed on agarose gel, purified (QIAquick gel extraction kit, No. of ca. 28706, Qiagen), cloned by blunt ends in vector pGNA49A linearized with Srf I (reference to document O00188121A1 ), and its sequence is determined. The sequence of the resulting PCR product corresponds to the respective sequence as provided in Table 73. The recombinant vector that hosts this sequence is named pGBNJOOXX.

E. Expression and production of a double-stranded RNA target in two Escherichia coli strains: (1) ?? 309-105, and, (2) BL21 (DE3) The procedures described below are followed in order to express appropriate levels of active double-stranded RNA in insect of insect target in bacteria. A strain deficient in RNAasalII, AB309-105, is used in comparison with wild-type bacteria containing RNAasalII, BL21 (DE3).

Transformation of AB309-105 and BL21 (DE3) Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 or BL2KDE3) of frost chemically competent E. coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. Four hundred fifty μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the bacterial cell suspension to a 500 ml conical flask containing 150 ml of Luria-Bertani liquid broth (LB) supplemented with 100 g / ml of the carbenicillin antibiotic. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB309-105 and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in the bacterial strain AB309-105 or BL21 (DE3) is made possible due to to which all the genetic components for controlled expression are present. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions. The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete S medium (SNC medium plus 5 μg / ml cholesterol) supplemented with 100 carbenicillin and 1 mM IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. Nevertheless, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial tablet is resuspended in 1.5 ml of MilliQ water and the suspension is transferred to a microcentrifuge tube. Several tubes are prepared and used in the bioassays for each renewal. The tubes are stored at -20 ° C until later use.

F. Laboratory tests to analyze Escherichia coli expressing dsRNA targets against Acheta domesticus Plant-based bioassays Whole plants are sprayed with suspensions of chemically induced bacteria that express dsRNA before using the plants to feed HC. These are grown in a room chamber for plant growth. The plants are enclosed placing a 500 ml plastic bottle face down on the plant with the neck of the bottle firmly placed in the ground in a pot and the base cut and covered with a fine nylon mesh to allow aeration, reduce condensation inside and prevent the escape of insects. HC are placed in each treated plant in the cage. The plants are treated with a suspension of E. coli AB309-105 harboring the pGBNJOOl plasmids or the pGN29 plasmid. Different amounts of bacteria are applied to the plants: for example 66, 22, and 7 units, where one unit is defined as 109 bacterial cells in 1 ml of a bacterial suspension at an optical density value of 1 at a wavelength 600 nm. In each case, a total volume of between 1 and 10 ml is sprinkled on the plant with the help of a vaporizer. In this test a plant is used per treatment. The number of survivors is counted and the weight of each survivor is recorded. Spraying the plants with a suspension of the E. coli bacterial strain AB309-105 expressing the dsRNA of the pGBNJ003 target leads to a dramatic increase in insect mortality when compared to the control of pGN29. These experiments show that double-stranded RNA, corresponding to a target sequence of insect gene produced in bacterial expression systems either wild-type or deficient in RNAasalII is toxic to the insect in terms of substantial increases in insect mortality and delayed growth / development for larval survivors. It is also evident from these experiments that an embodiment is provided for the effective protection of plants / crops against insect damage by the use of a spray of a formulation consisting of bacteria expressing double-stranded RNA corresponding to a target of insect gene.

EXAMPLE 13 Pyricularia grísea (rice blight) TO . Cloning of partial sequences of P. griseous High quality intact RNA is isolated from different growth stages of P. grisease using the TRIzol reagent (Cat. No. 15596-026 / 15596-018, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. The genomic DNA present in the RNA preparation is removed by DNase treatment following the manufacturer's instructions (Cat No. 1700, Promega). The cDNA is generated using a commercially available kit (Superscript ™ III Reverse Transcriptase, Cat No. 18080044, Invitrogen, Rockville, Maryland, USA) following the manufacturer's instructions. To isolate the cDNA sequences comprising a portion of a target gene, PCR with degenerate primers is performed using Amplitaq Gold (Cat No. N8080240, Applied Biosystems) following the manufacturer's instructions. The resulting PCR products are fractionated and the sequence determined.

B. Production of dsRNAs of P. griseum genes The dsRNA is synthesized in milligram quantities using a commercially available kit, such as System for T7 Ribomax ™ EXPRESS RNAi (Cat. No. 1700, Promega), following the manufacturer's instructions. The resulting PCR products are analyzed on an agarose gel and purified using a purification kit for PCR (eg Qiaquick PCR Purification Kit, Cat No. 28106, Qiagen) and NaC104 precipitation. The templates towards the 5 'end and towards the 3' end of T7 generated are mixed and the resulting RNA strands are fixed, then treated with DNase and RNase, and purified using sodium acetate, following the manufacturer's instructions.

C. Expression and production of a double-stranded RNA target in two strains of Escherichia coli: (1) AB309-105, and, (2) BL21 (DE3) The procedures described below are followed in order to express appropriate levels of RNA of double fungal chain of the fungal target in bacteria. A strain deficient in RNAasalII, AB309-105, is used in comparison with wild-type bacteria containing RNAasalII, BL21 (DE3).

Transformation of AB309-105 and BL21 (DE3) Three hundred ng of the plasmid are added and mixed gently in a 50 μ aliquot? of strain AB309-105 or BL2KDE3) of frost chemically competent E. coli. The cells are incubated on ice for 20 minutes before subjecting them to a heat shock treatment of 37 ° C for 5 minutes, after which the cells are placed back on ice for an additional 5 minutes. 450 μ? of SOC medium at room temperature to the cells and the suspension is incubated in a shaker (250 rpm) at 37 ° C for 1 hour. One hundred μ? of the suspension of bacterial cells to a 500 ml conical flask containing 150 ml of liquid broth from Luria-Bertani (LB) supplemented with 100 pg / ml of the antibiotic carbenicillin. The culture is incubated in an Innova 4430 agitator (250 rpm) at 37 ° C overnight (16 to 18 hours).

Chemical induction of double-stranded RNA expression in AB309-105 and BL21 (DE3) Expression of double-stranded RNA from the recombinant vector, pGBNJ003, in bacterial strain AB309-105 or BL21 (DE3) is made possible due to to which all the genetic components for controlled expression are present. In the presence of the chemical inducer isopropylthiogalactoside, or IPTG, the T7 polymerase can control the transcription of the target sequence in both the antisense and sense directions because they are flanked by T7 promoters oriented in opposite directions. The optical density at 600 nm of the overnight bacterial culture is measured using an appropriate spectrophotometer and adjusted to a value of 1 by the addition of fresh LB broth. 50 ml of this culture is transferred to a 50 ml Falcon tube and the culture is then centrifuged at 3000 g at 15 ° C for 10 minutes. The supernatant is removed and the bacterial tablet is resuspended in 50 ml of fresh complete medium S (medium SNC plus 5 μg / ml of cholesterol) supplemented with 100 μg / ml of carbenicillin and 1 μM of IPTG. The bacteria are induced for 2 to 4 hours at room temperature.

Heat treatment of bacteria Bacteria are killed by heat treatment in order to minimize the risk of contamination of the artificial diet in the test plates. However, heat treatment of bacteria expressing double-stranded RNA is not a prerequisite for inducing toxicity towards insects due to RNA interference. The induced bacterial culture is centrifuged at 3000 g at room temperature for 10 minutes, the supernatant is removed and the tablet is subjected to 80 ° C for 20 minutes in a water bath. After heat treatment, the bacterial tablet is resuspended in 1.5 ml of MilliQ water and the suspension is transferred to a microcentrifuge tube. Several tubes are prepared and used in the bioassays for each renewal. The tubes are stored at -20 ° C until later use.

Table 2 10 fifteen fifteen fifteen fifteen Table 3 10 15 Table 5 Table 6 fifteen Table 7 Table 8 Table 9 fifteen Table 10 15 Table 2-LD Table 2-PC Table 2-EV GAYATYCTGC AGAATSGGRA AAATITAACGAAATTGTACAGCTCAAGTTATCAGATGGAACAGTTAGGTCTGGA G TCTG CAAGTTITGGAAGTCAGTGGACAGAAGGCGGTTGTCCAAGTTTTTGAAGGCACC TCCGGAATTGATGCTAAAAACACTTTATGTGAATTTACAGGAGATATCTTAAGA ACTCCAGTGTCTGAAGATATGTrGGGTCGTGTGTTTAATGGATCTGGAAAGCCTA TCGATAAAGGGCCGCCAATCTTAGCTGAAGATTTTCTTGACATTCAAGGTCAAC CTATAAATCCTTGGTCTCGTATCTATCCAGAAGAAATGATCCAGACTGGTATTTC TGCGATTGATGTGATGAATTCCATTGCCAGAGGACAAAAGATTCCAATTTTCTCT GCAGCTGGTTTCCCACAATGAAATCGCTGCTCAAATCTGTAGACAAGCTGGT CTTGTCAAAATCCCAGGGAAATCTGTCTTAGATGATCATGAAGACAACTTTGCT ATCGTTTTCGCCGCTATGGGTGTCAATATGGAAACAGCCAGATTCTTCAAGCAA GATTTTGAAGAGAATGGCTCTATGGAAAATGTGTGCCTATT T GAACTTGGCCA ATGATCCTACCAT1OAAAGAATTATAACACCCCGTTTGACTTTAACAGCGGCTG AATTTATGGCATATCAATGTGAGAAGCATGTGTTAGTCATATTGACTGACATGTC ATCTTATGCTGAGGCTTTGCGTGAGGTATCTGCTGCT Table 2-AG Table 2-TC CAGCTBTTCC CGATCAAAG AAAGAGACCGTCTGCATTGTGCTGGCCGACGAAAACTGCCCCGATGAGAAGATCC GHGG CGWCCRAAV GGATGAACAGGATCGTCAGGAATAATCTACGGGTTAGGCTCTCTGACGTCGTCTGG CGACG ATCCAGCCCTGTCCCGACGTCAAATACGGGAAGAGGATCCACGTTTTGCCCATCGA TGACACGGTCGAAGGGCTCGTCGGAAATCTCTTCGAGGTGTACrrAAAACCATACT TCCTCGAAGCTTATCGACCAATCCACAAAGGCGACGrJ TCATCGTCCGTGGTGGC ATGCGAGCCGTTGAATTCAAAGTGGTGGAAACGGAACCGTCACCATATTGTATCGT CGCCCCCGATACCGTCATCCATTGTGACGGCGATCCGATCAAACGAGAAGAAGAG GAGGAAGCCTTGAACGCCGTCGGCTACGACGATATCGGCGGTTGTCGCAAACAAC TCGCACAAATCAAAGAAATGGTCGAATTACCTCTACGCCACCCGTCGCTCTTCAAG GCCATTGGCGTGAAACCACCACGTGGTATCCTCTTGTACGGACCTCCAGGTACCGG TAAAACTTTAATCGCACGTGCAGTGGCCAACGAAACCGGTGCTTTCTTCTTCTTAA TCAACGGTCCCGAAATTATGAGTAAATTAGCCGGCGAATCCGAAAGTAATCTAAG GAAAGCGT CGAAGAAGCCGATAAAAACTCACCGGCTAT ATTTTCATCGATGAAT TGGACGCGATTGCACCGAAACGTGAAAAAACCCACGGCGAAGTCGAACGCCGAAT TGTCTCGCAATTGTTAACACTGATGGACGGCATGAAGAAAAGCTCGCATGTTATCG TGATGGCGGCCACAAATCGCCCGAACTCAATCGATCCGGCTTTGCGTCGGTTCGGT CGCTTTGATCG Table 2-MP Table 2-NL Table 2-PX TTCGCCGCCATGGGAGTCAACATGGAGACCGCCAGGTTCTTCAAGCAGGA CTTCGAGGAGAACGG'iTCCATGGAGAACGTCTGTCTGTTCrTGAACrrGGC CAATGACCCGACCATTGAGAGGATTATCACGCCGAGGTTGGCGCTGACTG CTGCCGAGT CrrGGCCTACCAGTGCGAGAAACACGTGTTGGTAATCTTGA CCGACATGTCTTCATACGCGGAGGCTCTTCGTGAAGTGTCAGCCGCCCGTG AGGAGGTGCCCGGACGACGTGGTTTCCCAGGTTACATGTACACGGATTTG GCCACAATCTACGAGCGCGCCGGGCGAGTCGAGGGCCGCAACGGCTCCAT CACGCAGATCCCCATCCTGACCATGCCCAACGACGACATCACCCACCCCAT CCCCGACTTGACCGGGTACATCACTGAGGGACAGATCTACGTGGACCGTC AGCTGCACAACAGGCAGATCTACCCGCCGGTGAATGTGCTCCCGTCGCTAT CTCGTCTCATGAAGTCCGCCATCGGAGAGGGCATGACCAGGAAGGACCAC TCCGACGTGTCCAACCAACTGTACGCGTGCTACGCCATCGGCAAGGACGT GCAGGCGATGAAGGCGGTGGTGGGCGAGGAGGCGCTCACGCCCGACGAC CTGCTCTACCTCGAGTTCCTCACCAAGTTCGAGAAGAACTTCATCACACAG GGAAGCTACGAGAACCGCACAGTGTTCGAGTCGCTGGACATCGGCTGGCA GCCCCTGCGTATCTTCCCCAAGGAGATG Table 2-AI) Table 3-LD Table 3-MP ? 65 368 ??? 370 371- · I Table 4-PC Table 4-EV Table 4-AG Table 4-TC Table 4-MP Table 4-NL Table 4-CS Table 4-PX Table 4-AD Table 5-LD G Table 5-PC Table 5-EV Table 5-TC Table 5-MP ' Table 5-SNL Table 5-CS Table 5-PX Table 6-LD Table 6-PC Table 6-EV Table 6-MP Table 6- L Table 6-CS Table 6-PX Table 6-AD Table 7-LD Table 8-LD Table 8-PC 1 GGCCAGGGAACGTAGGGAA! PC010 SEQ ID NO: 489 SEQ ID NO: 490 SEQ ID NO: 488 GCTCAGCCTATTA GCGTAATACGACT GCTCAGCCTATTACCGCCCAACGCGTTGATTGGA'rTGATCACGTTCGGA CCGCCCAACGC CACTATAGGATGG AAAATGGTGCAAGTCCACGAACTGGGTACCGAAGGCTGCAGCAAGTCG AAAATGAGTATCT TACGTGTTCTGTGGAACGAAAGATCTCACCGCCAAGCAAGTCCAGGAG GGAAGAAAG SEQ ID NO: 491 ATGTTGGGCATTGGAAAAGGGTCACCAAATCCCCAACAACAGCCAGGG GCGTAATACGACT CAACCTGGGCGGCCAGGGCAGAATCCCCAAGCTGCCCCTGTACCACCG CACTATAGGGCTC SEQ ID NO: 492 GGGAGCAGATTCTTGCAGCCCGTGTCAAAATGCGACATGAACTTGACA AGCCTATTACCGC ATGGAAAATGAGT GATCTGATCGGGGAGTTGCAGAAAGACCCTTGGCCCGTACATCAGGGC CCAACGC ATCTGGAAGAAAG AAAAGACCTCTTAGATCCACAGGCGCAGCATTGTCCATCGCTGTCGGC CTCTTAGAATGCACCTATCCGAATACGGGTGGCAGAATCATGATATTCT TAGGAGGACCATGCTCTCAGGGTCCCGGCCAGGTGTTGAACGACGATT TGAAGCAGCCCATCAGGTCCCATCATGACATACACAAAGACAATGCCA AGTACATGAAGAAGGCTATCAAACATTACGATCACTTGGCAATGCGAG CTGCCACCAACAGCCATTGCATCGACATTTACTCCTGCGCCCTGGATCA GACGGGACTGATGGAGATGAAGCAGTGCTGCAATTCCACCGGAGGGCA CATGGTCATGGGCGAT CCTTCAATTCCTCTCTATTCAAACAAACCTTC CAGCGAGTGTTCTCAAAAGACCCGAAGAACGACCTCAAGATGGCGTTC AACGCCACCTTGGAGGTGAAGTGTTCCAGGGAGTTAAAAGTCCAAGGG GGCATCGGCTCGTGCGTGTCCITGAACGTrAAAAGCCCTCTGGTTTCCG ATACGGAACTAGGCATGGGGAATACTGTGCAGTGGAAACTTTGCACGT TGGCGCCGAGCTCTACTGTGGCGCTGTrCTTCGAGGTGGTTAACCAGCA TTCGGCGCCCATACCACAGGGAGGCAGGGGCTGCATCCAGCTCATCAC CCAGTATCAGCACGCGAGCGGGCAAAGGAGGATCAGAGTGACCACGA T GCTAGAAATTGGGCGGACGCTACTGCCAACATCCACCACATTAGCG CTGGCTTCGACCAAGAAGCGGCGGCAGTTGTGATGGCCCGAATGGCCG GTTACAAGGCGGAATCGGACGAGACTCCCGACGTGCTCAGATGGGTGG ACAGGATGTTGATCAGGCTGTGCCAGAAGTTCGGAGAGTACAATAAAG ACGATCCGAATTCGTTCAGGTTGGGGGAGAACTTCAGTCTGTATCCGCA GTTCATGTACCATT GAGACGGTCGCAGTTTCTGCAGGTGTTCAATAAT TCTCCTGATGAAACGTCGIT'ITATAGGCACATGCTGATGCGTGAGGATT TGACTCAGTCITTGATCATGATCCAGCCGAlTIT'GTACAGTTACAGCrT CAACGGGCCCCCCCGAGCCTGTGTTGTTGGACACAAGCTCTÁTTCAGCC GGATAGAATCCTGCTCATGGACACTI CITCCAGATACTCArrTTCCAT Table 8-NL Table 8-CS AGCAATCCCA CCCGCGGCCACGGGTGTCATGGTTCAAGAACGGGCAGAGGATAGTCAA CTCGAACAAACACGAAATCGTCACGACACATAATCAAACAATACTTAG GGTAAGAAACACACAAAAGTCTGATACTGGCAACTACACGTTGTTGGC TGAAAATCCTAACGGATGCGTCGTCACATCGGCATACCTGGCCGTGGA GTCGCCTCAAGAAACTTACGGCCAAGATCATAAATCACAATACATAAT GGACAATCAGCAAACAGCTGTAGAAGAAAGAGTAGAAGTTAATGAAA AAGCTCTCGCTCCGCAATTCGTAAGAGTCTGCCAAGACCGCGATGTAA CGGAGGGGAAAATGACGCGATTCGATTGCCGCGTCACGGGCAGACCTT ACCCAGAAGTCACGTGGTTCATTAACGATAGACAAATTCGAGACGATT ATWATCATAAGATATTAGTAAACGAATCGTGTAATCATGCACTTATGA TTACAAACGTCGATCTCAGTGATAGTGGCGTAGTATCATGTATAGCACG CAACAAGACCGGCGAAACTTCGTTTCAGTGTAGGCTGAACGTGATAGA GAAGGAGCAAGTGGTCGCTCCCAAATTCGTGGAGCGGTTCAGCACGCT CAACGTGCGCGAGGGCGAGCCCGTGCAGCTGCACGCGCGCGCCGTCGG CACGCCTACGCCACGCATCACATGGCAGAAGGACGGCGTTCAAGTTAT ACCCAATCCAGAGCTACGAATAAATACCGAAGGTGGGGCCTCGACGCT G Table 8-PX Target Primers For ard Primers Reverse dsR To DNA Sequence (sense strand) ID S '? 3 '5' - * 3 'PX001 SEQ ID NO: 2340 SEQ ID NO: 2341 SEQ ID NO: 2339 GCGTAATACGACT CTTGCCGATGATG CGAGGTGCTGAAGATCGTGAAGCAGCGCCTCATCAAGGTGGACGGCAA CACTATAGGCGAG AACACGTTG GGTCCGCACCGACCCCACCTACCCGGCTGGATTCATGGATGTTGTGTCG GTGCTGAAGATCG ATTGAAAAGACCAATGAGCTGTTCCGTCTGATCTACGATGTGAAGGGA TGAAG SEQ ID NO: 2343 CGCTTCACCATCCACCGCATCACTCCCGAGGAGGCCAAGTACAAGCTG SEQ ID NO: 2342 GCGTAATACGACT TGCAAGGTGAAGCGCGTGGCGACGGGCCCCAAGAACGTGCCGTACATC CGAGGTGCTGAAG CACTATAGGCTTG GTGACGCACAACGGCCGCACGCTGCGCTACCCCGACCCGCTCATCAAG ATCGTGAAG CCGATGATGAACA GTCAACGACTCCATCCAGCTCGACATCGCCACCTGCAAGATCATGGAC CGTTG ATCATCAAGTTCGACTCAGGTAACCTGTGCATGATCACGGGAGGGCGT AACTTGGGGCGAGTGGGCACCATCGTGTCCCGCGAGAGGCACCCCGGG AGCTTCGACATCGTCCACATCAAGGACACCACCGGACACACCTTCGCC ACCAGGTTGAACAACGTGTTCATCATCGGCAAG Table 9-LD ATTTCCCAGCCATAGGAATTCACAGAGGAATGGACCAGAAAGAGAGGTTGTCTCGGTATGAGCAGTTCAAAGATTTC CAGAAGAGAATATTGGTAGCTACGAATCTCTTTGGGCGTGGCATGGACATTGAAAGGGTCAACATTGTCTTCA.ACTA TGATATGCCAGAGGACTCCGACACCTACI GCATCGAAGGGCGAATTCACCAGCTTTCTTGTACAAAGTGGTATATC ACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGTG TCAAGCTGACCTGCAAACACGTTAAATGCTAAGAAGTTAGAATATGAGACACGTTAACTGGTATATGAATAAGCT GTAAATAACCGAGTATAAACTCATTAACTAATATCACCTC AAGAGTAGGCTAATGTAAAATCTT ATATATTTCTACAATGTTCAAAGAAACAGTTGCATCTAAACCCCTATGGCCAT CAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACT GGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACC TATAACCAGACCGTTCAGCTGGATA rACGGCCTTITrAAAGACCGTAAAGAAAAATAAGCACAAGT ITATCCGGC CTTTATrCACAT CTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGAT ATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTITCATCGCTCTGGAGTGAATACCA CGACGATT CCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAA AGGGTTTAT GAGAATATGTTTTTCGTCTCAGCCAATC TATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGG CGATTCAGG'Í CATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATG AGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTGCCACC TTATTCAACCATCAAGAAAAAAGCCAAAATT ATGCTACTCTAAGGAAAACTTCACTAAAGAAGACGA TTTTACCAAGAATTTCTGTCATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTAATCTCAT ^ GCTAAAATAAGCATAATTrTAGCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTGGT GGCTCAAATCATAGAAACTTACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCAT CATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCGACCACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTTCG ATGCAAGTAGGTGTCGGAGTCCTCTGGCATATCATAGTTGAAGACAATGTTGACCCTTTCAATGTCCATGCCACGCCC AAAGAGATTCGTAGCTACCAATATTCTCTTCTGGAAATCTTTGAACTGCTCATACCGAGACAACCTCTCTTTCTGGTC CATTCCTCTGTGAATTCCTATGGCTGGGAAATTCTGTTCAGTCAGCAACTGTGCCAAAGCCACACACCTTTGAACGGA CTTCACAAAAATGACCACCTGATTAAAT CGAGAACATCG AGTTTAACGTAATGCTGTTGTAATCCGTGCAACGTCAATTTGGCTTCATCGTCrACATACACCTCCATT ATGAATTTCTTGCACACCGGCCTGATTTCTTTC TTTCrGTAGATTTCCTGGACGTCTCTCC CATATCCAACAGTTCTAACATITrATCGC TCAGGTrCTTGAGGACTAGCTTCCTAGACTTGACAAGCGCCAAAATACGCCCAGGCGTCCCCACAACAATGTGTGGA CATTTGTTITrCAATACTTCTTC ^ ^ TATTTACTGAACCTCTCGTACTCrTTGCTGATTTGGAAAGCCAGTTCACGAGTGTGACACATCACCAAAACGTAAACA ACATTGTCCGCTGGTTCCAATTGTTGCAGTGTCGCCAGAACAA CATAAAATGTCCATGCCAATGACAGCTTGAGGAATACATTCGTGCTGAACTTCTGAAGGGTGTTCAAAACCGCAGTC AACTAl GCTCTTAGAATTrCTGGTTTCAATAAAAAATCTCTGAAGCCTGAACTGTGTATGGATACGTAAGTACCCTT CT CTCACA'ITGGTAAGCCAAGAATTCGGCAGCTGTCAAAGCCAGACG CGTTGGCCAAATTCAAGAACAGGCAGACATTCTCCATAGAACCGTTCTCTTCGAAATCCTGTTTGAAGAACCTAGCT GTTTCCATGTTAACACCCATAGCAGCGAAAACAATAGCAAAGTTATCTTCATGATCATCAAGTACAGATTTACCAGG AATCTTGACTAAACCAGCCTGTCTACAGATCTGGGCAGCAATTTCATTGTGAGGCAGACCAGCTGCAGAGAAAATGG GGATCTTCTGACCACGAGCAATGGAGTICATCACGTCAATAGCTGTAATACCCGTCTGGATCATrrCCrCAGGATAG ATACGGGACCACGGATTGATTGGTTGACCCTGGATGTCCAAGAAGTCITCAGCCAAAATTGGGGGACCTTTGTCGAT GGGTTTTCCTGATCCATTGAAAACACGTCCCAACATATCTTCAGAAACAGGAGTCCTCAAAATATCTCCTGTGAATTC ACAAGCGGTGTTrTTGGCGTCGATTCCTGATGTGCCCTCGAACACTTGAACCACAGCTTTTGACC AACTTGTCCCGAACGTATAGTGCCATCAGCCAGTTTGAGTTGTACGATTTCATTGTACTTGGGGAACT ^ GAGGATTACCAGAGGACCGTTCACACCAGACACAGTCAAGGGCGAATTCACCAGCTTTCTTGTACAAAGTGGTATAT CACTAGTGCGGCCGCCTGCAGGTCGACCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATGCTGTTATGTTCAGT GTCAAGCTGACCTGCAAACACGTrAAATGCTAAGAAGTTAGAATATGGACACACGTTAACTGGTATATGAATAAGC TGTAAATAACCGAGTATAAACTCATTAACTAATATCACCTCTAGAGTATAATATAATCAAATTCGACAATTTGACTTT CAAGAGTAGGCTAATGTAAAATCTI ATATATTTCTACAATGT CAAAGAAACAGTTGCATCTAAACCCCTATGGCC ATCAAATTCAATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCA CTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATT CAGTCAGTTGCTCAATGTA CCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTT TATCCG GCCTTrATTCACAT CTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTG ATATGGGATAGTGTTCACCCTTGTTACACCGTT ^ CACGACGATTTCCGGCAGTTTCTACACATATAT CGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCT AAAGGG1 TATTGAGAATATGTTTITCGTCTC AATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCT GGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCG ATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTGCC ACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTATGCTACTCTAAGGAAAACT CACTAAAGAAGACGATTTAGA GTGTTTTACCAAGAATTTCTGTCATCT ACT ^ TATGCTAAAATAAGTCATAATTTTACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATT GGTGGCTCAAATCATAGAAACITACAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCT CATCATTrCCATGAGGTTGCTTCTGATCCCGCGGGATATCACCACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTT GACTGTGTCTGGTGTGAACGGTCCTCTGGTAATCCTCGAAGATGTTAAGTTCCCCAAGTACAATGAAATCGTACAAC TCAAACTGGCTGATGGCACTATACGTTCGGGACAAGT CTGGAAGTCAGTGGGTCAAAAGCTGTGGTTCAAGTGTTC GAGGGCACATCAGGAATCGACGCCAAAAACACCGCTTGTGAAT CACAGGAGATATTTTGAGGACTCCTGTTTCTGA AGATATGTTGGGACGTGTTTTCAATGGATCAGGAAAACCCATCGACAAA.GGTCCCCCAATTTTGGCTGAAGACTTCT TGGACATCCAGGGTCAACCAATCAATCCGTGGTCCCGTATCTATCCTGAGGAAATGATCCAGACGGGTATTACAGCT ATTGACGTGATGAACTCCATTGCTCGTGGTCAGAAGATCCCCATTTTCTCTGCAGCTGGTCTGCCTCACAATGAAA ^ GCTGCCCAGATCTGTAGACGGCTGGTTTAGTCAAGATTCCTGGTAAATCTGTACTTGATGATCATGAAGATAACTTT GCTATTGTTTrCGCTGCTATGGGTGTTAACATGGAAACAGCTAGGTTCTí'CAAACAGGAlTTCGAAGAGAACGGTTCT ATGGAGAATGTCTGCCTGTTCTTGAATTTGGCCAACGATC ACAGCTGCCGAATTCTTGGCTTACCAATGTGAGAAGCACGTCTTGGTCATCTTGACAGATATGTCTTCGTATGCAGAA GCTT GCGTGAGGTATCTGCTGCCAGAGAAGAGGTGCCTGGTCGTCGTGGTTn CCCAGGTrTACATGTACACCGAT TA GCTACCATCTATGAACGTGCCGGCCGTGTTGAAGGACGTAACGGATCCATCACCCAGATTCCTATATTGACTATGCC CAACGACGACATTACCCATCCTATTCCAAGGGC Table 9-PC AACCGAGTATAAACTCATTAACTAATATCACCTCTAGAGTATAATATAATCAAATTCGACAATTTGACTTTCAAGAGTA GGCTAATGTAAAATCT TATATATTTCTACAATGTTCAAAGAAACAGTTGCA: ATGAACGCTAAGCTGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACC ACCG RGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGA CCGT CAGCTGGATATTACGGCCTTTT AAAGACCGTAAAGAAAAATAAGCACAAGTT ^ XCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGT TCACCCTTGTTACACCGTTTTCCATC ^ ^ CAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTA ATATGTTTTTCGTCTCAGCCAATCCCT GCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCAT GCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCG TAAACGCGTGGATCAGCTTAATATGACTCTCAATAAAGTCTCATACCAACAAGTGCCACCTTATTCAACCATCAAGAA AAAAGCCAAAATT ATGCTACTCTAAGGAAAACTTCACT ^ ^ CATCTTACTAAACAACTAAAGATCGGTGTGATACAAAACCTAATCTCATTAAAGTT ATGCTAAAATAAGCATAATT ACCCACTAAGCGTGACCAGATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATCATAGAAACTTA CAGTGAAGACACAGAAAGCCGTAAGAAGAGGCAAGAGTATGAAACCTTACCTCATCATTTCCATGAGGTTGCTTCTGA TCCCGCGGGATATCACCACTTTGTACAAGAAAGCTGGGTCGAATTCGCCCTTCGCCATTGGGCAATGGTCTCTCCATGG AAAATGAGTATCTGGAAGAAAGTGTCCATGAGCAGGATTCTATCCGGCTGAATAGAGCTTGTGTCCAACAACACAGGC TCGGGCGGCCCGTTGAAGCTGTAACTGTACAAAATCGGCTGGATCATGATCAAAGACTGAGTCAAATCCTCACGCATC AGCATGTGCCTATAAAACGACGTTRCATCAGGAGAATTATTGAACACCTGCAGAAACTGCGACCGTCTCAAATGGTAC. ATGAACTGCGGATACAGACTGAAGTTCTCCCCCAACCTGAACGAAT CGGATCGTC I GTACTCTCCGAACTTCT AT GGCACAGCCTGATCAACATCCTGTCCACCCATCTGAGCACGTCGGGAGTCTCGTCCGATTCCGCCTTGTAACCGGCCAT TCGGGCCATCACAACTGCCGCCGCTTCTTGGTCGAAGCCAGCGCTAATGTGGTGGATGTTGGCAGTAGCGTCCGCCCA ATTTCTAGCAATCGTGGTCACTCTGATCCTCCI TGCCCGCTCGCGTGCTGATACTGGGTGATGAGCTGGATGCAGCCC CTGCCTCCCTGTGGTATGGGCGCCGAATGCTGGTTAACCACCTCGAAGAACAGCGCCACAGTAGAGCTCGGCGCCAAC GTGCAAAGTT CCACTGCACAGTATTCCCCATGCCTAGT CCGTATCGGAAACCAGAGGGCTTITAACGTTCAAGGACA CGCACGAGCCGATGCCCCCTTGGACTTTTAACTCCCTGGAACACTTCACCTCCAAGGTGGCGTTGAACGCCATCTTGAG GTCGTTCTTCGGGTCH TTGAGAACACTCGCTGGAAGGTTT ATGTGCCCTCCGGTGGAATTGCAGCACTGCTTCATCTCCATCAGTCCCGTCTGATCCAGGGCGCAGGAGTAAATGTCGA TGCAATGGCTGTTGGTGGCAGCTCGCATTGCCAAGTGATCGTAATGLTRGATAGCCTTCTTCATGTACTTGGCATTGTCT TTGTGTATGTCATGATGGGACCTGATGGGCTGCTTCAAATCGTCGTTCAACACCTGGCCGGGACCCTGAGAGCATGGTC CTCCTAAGAATATCATGATTCTGCCACCCGTATTCGGATAGGTGCATTCTAAGAGGCCGACAGCGATGGACAATGCTG CGCCTGTGGATCTAAGAGGTCTTTTGCGCTGATGTACGGGCCAAGGGTCTTTCTGCAACTCCCCGATCA GTTCATGTCGCATTTTGACACGGGCTGCAAGAATCTGCTCCCCGGTGGTACAGGGGCAGCTTGGGGATTCTGCCCTGGC CGCCCAGGTTGCCCTGGCTGT GTTGGGGATTTGGTGACCCTTTTCCAATGCCCAACATCTCCTGGACTTGCTTGGCGGT Table 9-MP F GACCGTAAAGAAAAATAAGCACAAGITTTATCCGGCCT AITCACAITCTTGCCCGCCTGATGAATGCTC ATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGT CACCCTTGTTACACCGTTTTCCATGAGC AAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATG TGGCGTGTTACGGTGAAAACCTGGCCT GGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACT ^ ^ ATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTC GGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAACGCGTGGATCAGCTTAAT ATGACTCTCAATAAAGTCTCATACCAACAGTGCCACCTTATTCAACCATCAAGAAAAAAGCCAAAATTTTATG TCTAAGGAAAACTTCACTAAAGAAGACGAT TAGAGTGTTTTACCAAGAATTTCTGTCATCTTACT GATCGGTGTGATACAAAACCTAATCTCATTAAAGTTTATGCTAAAATAAGCATAATTTTACCCACTAAGCGTGACCA GATAAACATAACTCAGCACACCAGAGCATATATATTGGTGGCTCAAATCATAGAAACTTACAGTGAAGACACAGAA AGCCGTAAGAAGAGGCAAGAGTATGAAACC1TACCTCATCATTTCCATGAGGTTGCTTCTGATCCCGCGGGATATCA CCACTTTGTACAAGAAAGCTGGGTCGAAT CGCCCTTGCTCGTTTGTTTCCATCCAGAACT CCCATC GCTCAGAAGATGGTACCGTCAGAATTrGGCAT CTGGTACTTATCGArrAGAATCATCAT AAACTATGGGTTAGAA CGTGTATGGACAATCTGTTGCTTACGGGGATCTAATAATGTAGCTCTAGGTTATGATGAAGGAAGTATAATGGTTAA AGTTGGTCGTGAAGAGCCAGCAATGTCAATGGATGTTCATGGGGGTAAAATTGTI GGGCACGTCATAGTGAAATTC AACAAGCTAACCTTAAAGCGATGCT CAAGCAGAAGGAGCCGAAATCAAAGATGGTGAACGT TACCAATACAAGT TAAAGACATGGGTAGCTGTGAAATTTATCCACAGTCAATATCTCATAATCCGAATGGTAGATTI TAGTAGTATGTGG TGATGGAGAGTATA1TATATATACATCAATGGCTTTGCGTAATAAAGCAT TGGCTCCGCTCAGGATTTTGTATGGTC TTCTGATTCTGAGTATGCCATTAGAGAAAAT CTC ^ TAAACCAGAAGGTGGAGCAGATGGTATTTTTGG TablelO-LD Tables 10-NL (a) = Data were analyzed using Kaplan-Meier survival curve analysis 2alp to < 0.05 Tables 10-NL (b) = Data were analyzed using Kaplan-Meier survival curve analysis ap a < .

Tables 10-NL (c) = Data were analyzed using Kapian-Meier survival curve analysis ap a < .

Tables 10-NL (d) = Data were analyzed using Kaplan-Meier survival curve analysis p.

Table 11- L = Data were analyzed using Kaplan-Meier survivai curve analysis 2alpha < 0.05

Claims (40)

14 NOVELTY OF THE INVENTION Having described the present invention, it is considered as a novelty and therefore the content of the following is claimed as property: CLAIMS

1. - An isolated nucleotide sequence comprising one. nucleic acid sequence indicated in SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240-247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 508-513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1066-1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161- 1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476, and 2481.

2. A nucleotide sequence having at least 70% sequence identity with a nucleic acid sequence indicated in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160-163, 168, 173 , 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240-247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488 , 493, 498, 503, 508-513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621-767, 768, 773 , 778, 783, 788, 793, 795, 797, 799, 801, 8.13-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051 , 1056, 1061, 1066-1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113 , 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682 , 16 84, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476, and 2481.

3. - An ortholog of a gene comprising at least 17 contiguous nucleotides of any of SEQ ID NOs: .1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 49-158, 159, 160, 163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 247, 249, 251, 253, 255, 257, 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 609, 621- 767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 210 2, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476, and 2481, or a supplement from the same.

4. A double-stranded ribonucleotide sequence produced from the expression of a polynucleotide sequence according to any of claims 1-3, characterized in that the ingestion of said ribonucleotide sequence by a plant pest inhibits the growth of said plague.

5. - The ribonucleotide sequence according to claim 4, characterized in that the ingestion of said sequence inhibits the expression of a nucleotide sequence substantially complementary to said sequence.

6. - A cell transformed with the polynucleotide according to any of claims 1-3.

7. - The cell according to claim 6, characterized in that said cell is a plant cell.

8. - A plant transformed with the polynucleotide according to any of claims 1-3.

9. - A seed of the plant according to claim 8, characterized in that said seed comprises said polynucleotide.

10. - A product that is produced from the plant according to claim 8, characterized in that said product comprises a polynucleotide indicated in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 7, 19, 21, 23, 4S • -158, 159, 160 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 230, 240- 247, 249, 251, 253, 255, 257, 259, 275-472, 478, 483, 488, 493, 498, 503, 508-513, 515, 517, 519, 533-575, 576, 581, 586, 591, 596, 601, 603, 605, 607, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 813-862, 863, 868, 873, 878, 883, 888, 890, 892, 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1066- • 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111, 1113, 1161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102, 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384 -2460, 2461, 2466, 2471, 2476, and 2481, or a complement thereof.

11. - The product according to claim 10, characterized in that said product is selected from the group consisting of edibles, feed, fiber, paper, products in the form of flour, protein, starch, flour, fodder, coffee, tea , and oil.

12. - A plant comprising a double-stranded ribonucleic acid sequence obtained from a pest species.

13. - The plant according to claim 12, characterized in that said pest is selected from the group consisting of insects, arachnids, crustaceans, fungi, bacteria, viruses, nematodes, worms flatworms, earthworms, intestinal worms, hookworms, tapeworms , trypanosomes, schistosomes, blowfly, fleas, ticks, mites, and lice.

14. The plant according to claim 12, characterized in that said sequence inhibits a biological activity of the pest.

15. - The plant according to claim 12, characterized in that said sequence inhibits the expression of an objective sequence.

16. - The plant according to claim 15, characterized in that said target sequence is a sequence of insect, nematode, bacteria, or fungus.

17. - The plant according to claim 12, characterized in that said plant is male cytoplasmic sterile.

18. - A method of controlling infestation by pests, comprising providing a pest with plant material comprising a polynucleotide sequence that inhibits a biological activity of the pest.

19. The method according to claim 18, characterized in that said polynucleotide sequence is indicated in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 , 49-158, 159, 160-163, 168, 173, 178, 183, 188, 193, 198, 203, 208, 215, 220, 225, 230, 240-247, 249, 251, 253, 255, 257 , 259, 275-472, 473, 478, 483, 488, 493, 498, 503, 508-513, 515, 517, 519, 521, 533-575, 576, 581, 586, 591, 596, 601, 603 , 605, 607, 609, 621-767, 768, 773, 778, 783, 788, 793, 795, 797, 799, 801, 813-862, 863, 868, 873, 878, 883, 888, 890, 892 , 894, 896, 908-1040, 1041, 1046, 1051, 1056, 1061, 1066-1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099 , 1101, 1103, 1105, 1107, 1109, 1111, 1113, .1.161-1571, 1572, 1577, 1582, 1587, 1592, 1597, 1602, 1607, 1612, 1617, 1622, 1627, 1632, 1637, 1642, 1647, 1652, 1657, 1662, 1667, 1672, 1677, 1682, 1684, 1686 , 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1730-2039, 2040, 2045, 2050, 2055, 2060, 2065, 2070, 2075, 2080, 2085, 2090, 2095, 2100, 2102 , 2104, 2106, 2108, 2120-2338, 2339, 2344, 2349, 2354, 2359, 2364, 2366, 2368, 2370, 2372, 2384-2460, 2461, 2466, 2471, 2476, and 2481, or a complement of the same.

20. - A pesticide comprising a plant expressing a target polynucleotide sequence.

21. - A method to control infestation by pests, comprising: (a) identifying an objective sequence in a pest; (b) introducing said sequence into a plant; and c) supplying said plant, or portion thereof, to said pest.

22. A method for controlling infestation by pests, comprising: a) identifying an objective sequence in a first pest species; b) search for an orthologous target sequence in a second pest species; c) introducing said orthologous sequence into a plant; and d) supplying said plant, or portion thereof, to said second pest.

23. - A method for improving culture performance, comprising: a) introducing a polynucleotide according to any of claims 1-3 in a plant; and b) cultivating said plant to allow the expression of polynucleotide, wherein said expression inhibits feeding by a pest and loss of yield due to infestation by pest.

24. - The method according to claim 23, characterized in that the expression of polynucleotide produces an RNA molecule that suppresses a target gene in a pest insect that has ingested a portion of said culture plant, in which said target gene plays at least one essential function that is selected from the group consisting of feeding by the pest, viability of the pest, cellular apoptosis of the pest, differentiation and development of the pest or any cell of the pest, sexual reproduction of plague, muscle formation, muscle movement, muscle contraction, formation and / or reduction of juvenile hormone, regulation of juvenile hormone, regulation and transport of ions, maintenance of cell membrane potential, amino acid biosynthesis, amino acid degradation, sperm formation, pheromone synthesis, pheromone detection, antenna formation, wing formation, formation of legs, egg formation, larval maturation, digestive enzyme formation, hemolymph synthesis, hemolymph maintenance, neurotransmission, larval stage transition, pupal formation, pupal state emergence, cell division, energy metabolism , respiration, synthesis and maintenance of the cytoskeletal structure, nucleotide metabolism, nitrogen metabolism, water use, water retention, and sensory perception.

25. The method according to claim 23, characterized in that said pest is selected from the group consisting of insects, nematodes, and fungi.

26.- A method to produce a raw material product, comprising: a) identifying an objective sequence in a pest; b) introducing said sequence into a cell, of the. plant; c) cultivating said plant cell under appropriate conditions to generate a plant; and d) producing a raw material product from said plant or part thereof.

27. - A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from L, decemlineata and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, Brussels sprout, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts , shell tomato, Canadian pine, American walnut, kale, kiwi, kohlrabi. { Brassica olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea. { Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, squash, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane sugar, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini.

28. A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from P. cochleariae and said plant is selected from the group consisting of aca.cia, alfalfa. , apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, Brussels sprout, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, shell tomato, Canadian pine, American walnut, kale, kiwi, kohlrabi (Brassica oleracea Gongilodes group), larch, lettuce, leek, lemon, lime, carob, pine, cilantro, corn, mango, maple , melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea [Cajanus cajan], pine, pineapple, plantain, plum, pomegranate , potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, squash, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini.

29. A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from E. varivetis and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussels sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit , peanuts, shell tomato, Canadian pine, American walnut, kale, kiwi, kohlrabi (Brassica olerácea Gongilodes Group), larch, lettuce, leek, lemon, lime, carob, pine, cilantro, corn, mango, maple, melon, Son, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, pea Congo. { Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, pa.pa, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini.

30. A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from A. grandis and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussels sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit , peanuts, shell tomato, Canadian pine, American walnut, kale, kiwi, kohlrabi (Brassica olerácea Gongilodes Group), larch, lettuce, leek, lemon, lime, carob, pine, cilantro, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, naran ja, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea. { Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, squash, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane sugar, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini.

31. A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from T. castaneum and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussels sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit , peanuts, shell tomato, Canadian pine, American walnut, kale, kiwi, kohlrabi. { Brassica olerácea Grupo Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea. { Ca.ja.nus cajan), pine, pineapple, plantain, plum, pomegranate, potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, beet sugar, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini.

32. A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from M. persicae and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, Brussels sprout, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, cascara tomato, canadian pine , American walnut, kale, kiwis, kohlrabi (Brassica olerácea Group Gongilodes), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak , oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea [Ca.ja.nus cajan ), pine, pineapple, plantain, plum, pomegranate, potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, grapevine, walnut, watercress, watermelon , wheat, yams, yew tree, and Italian zucchini.

33.- A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from N. lugens and said plant, is selected from the group consisting of acacia, alfalfa, apple , apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, Brussels sprout, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, cereal , celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine, American walnut, kale, kiwi, kohlrabi (Brassica oleracea Gongilodes Group), larch, lettuce, leek, lemon, lime, carob, pine, cilantro, corn, mango, maple, melon , millet, mushrooms, mustard, walnuts, oak, oats, calalu, onion, orange a, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea. { Ca.ja.nus cajan), pine, pineapple, plantain, plum, pomegranate, potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, beet sugar, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini.

34. - A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from C. suppressalis and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussels sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit , peanuts, rind tomato, Canadian pine, American walnut, kale, kiwi, kohlrabi (Brassica olerácea Gongilodes Group), larch, lettuce, leek, lemon, lime, carob, pine, cilantro, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, khaki, Congo pea (Cajanus cajan), pine, pineapple, plantain, plum, pomegranate , potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale , grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini.

35. A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from P. xylostella and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussels sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, fir, geranium, grape, grapefruit , peanuts, shell tomato, Canadian pine, American walnut, kale, kiwi, kohlrabi (Brassica olerácea Gongilodes Group), larch, lettuce, leek, lemon, lime, carob, pine, cilantro, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, na ranja, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea. { Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, squash, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane sugar, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini.

36. A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from A. domesticus and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot, artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, brussels sprouts, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole., eucalyptus, dill, figs, fir, geranium, grape, Grapefruit, peanuts, shell tomato, Canadian pine, American walnut, kale, kiwis, kohlrabi (Brassica olerácea Gongilodes group), larch, lettuce, leek, lemon, lime, carob, pine, cilantro, corn, mango, maple, melon , millet, mushrooms, mustard, walnuts, oak, oats, calalu, onion, n Orange, a plant or flower or ornamental tree, papaya, palm, parsley, turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea. { Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, squash, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane sugar, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, a vine, walnut, watercress, watermelon, wheat, yams, yew tree, and Italian zucchini.

37. A method according to any of claims 18-19 and 21-26, characterized in that said target is a gene from a fungus and said plant is selected from the group consisting of acacia, alfalfa, apple, apricot , artichoke, ash, asparagus, avocado, banana, barley, beans, beets, birch, beech, blackberry, blueberry, broccoli, Brussels sprout, cabbage, cañola, melon, carrot, cassava, cauliflower, cedar, cereal, celery , chestnut, cherry, Chinese cabbage, citrus, clementine (Spanish orange), clove, coffee, corn, cotton, chickpea, cucumber, cypress, eggplant, elm, escarole, eucalyptus, dill, figs, spruce, geranium, grape, grapefruit, peanuts, rind tomato, Canadian pine, American walnut, kale, kiwi, kohlrabi (Brassica olerácea Gongilodes Group), larch, lettuce, leek, lemon, lime, carob, pine, cilantrillo, corn, mango, maple, melon, millet, mushrooms, mustard, nuts, oak, oats, calalu, onion, orange, a plant or flower or ornamental tree, papaya, palm, parsley , turnip, pea, peach, peanut, pear, peat, pepper, persimmon, Congo pea (Cajanus cajan), pine, pineapple, plantain, plum, pomegranate, potato, pumpkin, Italian chicory, radish, rapeseed, raspberry, rice, rye, sorghum, willow, soy, spinach, spruce, zucchini, strawberry, sugar beet, sugar cane, sunflower, sweet potato, sweet corn, tangerine, tea, tobacco, tomato, trees, triticale, grasses, turnips, grapevine, walnut , watercress, watermelon, wheat, yams, yew tree, and zucchini, Italian. 38.- The use of an isolated nucleotide sequence according to any of claims 1-3, a double-stranded ribonucleotide sequence according to any of claims 4-5, a cell according to any of claims 6 -7, a plant according to any of claims 12-17, or a product according to any of claims 10-11, for treating infestations of plants by insects. 39.- The use of an isolated nucleotide sequence according to any of claims 1-3, a double-stranded ribonucleotide sequence according to any of claims 4-5, a cell according to any of claims 6 -7, a plant according to any of claims 12-17, or a product according to any of claims 10-11, for treating plant infestations by all nem. 40.- The use of an isolated nucleotide sequence according to any of claims 1-3, a double-stranded ribonucleotide sequence according to any of claims 4 -5, a cell according to any of claims 6 -7, a plant according to any of claims 12-17, or a product according to any of claims 10-11, for treating infestations of plants by fungi.