WO2011023801A1 - Vecteurs navettes de réplicon de vhc ns3/4a - Google Patents

Vecteurs navettes de réplicon de vhc ns3/4a Download PDF

Info

Publication number
WO2011023801A1
WO2011023801A1 PCT/EP2010/062571 EP2010062571W WO2011023801A1 WO 2011023801 A1 WO2011023801 A1 WO 2011023801A1 EP 2010062571 W EP2010062571 W EP 2010062571W WO 2011023801 A1 WO2011023801 A1 WO 2011023801A1
Authority
WO
WIPO (PCT)
Prior art keywords
hcv
protein
restriction enzyme
polynucleotide sequence
replicon
Prior art date
Application number
PCT/EP2010/062571
Other languages
English (en)
Inventor
Samir Ali
Milloni B. Chhabra
Maria Jolanta Ilnicka
Wen-Rong Jiang
Isabel Najera
Original Assignee
F. Hoffmann-La Roche Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by F. Hoffmann-La Roche Ag filed Critical F. Hoffmann-La Roche Ag
Publication of WO2011023801A1 publication Critical patent/WO2011023801A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24211—Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24211—Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24241—Use of virus, viral particle or viral elements as a vector
    • C12N2770/24243—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • This invention pertains to novel HCV NS3-4A replicon shuttle vectors which are useful for screening, testing and evaluating HCV protease and helicase inhibitors.
  • Hepatitis C virus is a major health problem and the leading cause of chronic liver disease throughout the world. (Boyer, N. et al. J. Hepatol. 2000 32:98-112). Patients infected with HCV are at risk of developing cirrhosis of the liver and subsequent hepatocellular carcinoma and hence HCV is the major indication for liver transplantation.
  • HCV has been classified as a member of the virus family Flaviviridae that includes the genera ⁇ aviviruses, pestiviruses, and hepaciviruses which includes hepatitis C viruses (Rice, C. M., Flaviviridae: The viruses and their replication, in: Fields Virology, Editors: Fields, B. N., Knipe, D. M., and Howley, P. M., Lippincott-Raven Publishers, Philadelphia, Pa., Chapter 30, 931-959, 1996).
  • HCV is an enveloped virus containing a positive-sense single-stranded RNA genome of approximately 9.4 kb.
  • the viral genome consists of a 5 '-untranslated region (UTR), a long open reading frame encoding a polyprotein precursor of-approximately 3011 amino acids, and a short 3' UTR.
  • the 5' UTR is the most highly conserved part of the HCV genome and is important for the initiation and control of polyprotein translation.
  • HCV Haptenas virus
  • Each genotype contains a series of more closely related subtypes which show a 20-25 % divergence in nucleotide sequences (Simmonds, P. 2004 J. Gen. Virol. 85:3173- 88) . More than 30 subtypes have been distinguished.
  • Type Ib is the most prevalent subtype in Asia. (X. Forns and J. Bukh, Clinics in Liver Disease 1999 3:693-716; J. Bukh et al, Semin. Liv. Dis. 1995 15:41-63).
  • Type 1 infections are less responsive to the current therapy than either type 2 or 3 genotypes (N. N. Zein, Clin. Microbiol. Rev., 2000 13:223-235).
  • Nonstructural protein portion of the ORF of pestiviruses and hepaciviruses possess a single large open reading frame (ORF) encoding all the viral proteins necessary for virus replication. These proteins are expressed as a polyprotein that is co- and post-translationally processed by both cellular and virus-encoded proteinases to yield the mature viral proteins.
  • ORF open reading frame
  • the viral proteins responsible for the replication of the viral genome RNA are located towards the carboxy-terminal. Two-thirds of the ORF are termed nonstructural (NS) proteins.
  • the mature nonstructural (NS) proteins in sequential order from the amino -terminus of the nonstructural protein coding region to the carboxy-terminus of the ORF, consist of p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B.
  • the NS proteins of pestiviruses and hepaciviruses share sequence domains that are charac- teristic of specific protein functions.
  • the NS3 proteins of viruses in both groups possess amino acid sequence motifs characteristic of serine proteinases and of helicases (Gor- balenya et al. Nature 1988 333:22; Bazan and Fletterick Virology 1989 171 :637-639; Gor- balenya et al. Nucleic Acid Res. 1989 17.3889-3897).
  • the NS5B proteins of pestiviruses and hepaciviruses have the motifs characteristic of RNA-directed RNA polymerases (Koonin, E. V. and Dolja, V. V. Crit. Rev. Biochem. Molec. Biol. 1993 28:375-430).
  • NS3 serine proteinase is responsible for all proteolytic processing of polyprotein precursors downstream of its position in the ORF (Wiskerchen and Collett Virology 1991 184:341-350; Bartenschlager et al. J. Virol. 1993 67:3835-3844; Eckart et al. Biochem. Biophys. Res. Comm. 1993 192:399-406; Grakoui et al. J. Virol. 1993 67:2832-2843; Grakoui et al. Proc. Natl. Acad. Sci.
  • the NS3 protein of both viruses also functions as a helicase (Kim et al. Biochem. Biophys. Res. Comm. 1995 215: 160-166; Jin and Peterson Arch. Biochem. Biophys. 1995, 323:47-53; Warrener and Collett J. Virol. 1995 69:1720-1726).
  • the NS5B proteins of pestiviruses and hepaciviruses have the predicted RNA-dependent RNA polymerase activity (Behrens et al. EMBO 1996 15:12-22; Lechmann et al. J. Virol. 1997 71 :8416-8428; Yuan et al. Biochem. Biophys. Res. Comm.
  • HCV replication Despite advances in understanding the genomic organization of the virus and the functions of viral proteins, fundamental aspects of HCV replication and pathogenesis remain unknown.
  • a major challenge in gaining experimental access to HCV replication is the lack of an efficient cell culture system that allows production of infectious virus particles. Although infection of primary cell cultures and certain human cell lines has been reported, the amounts of virus produced in those systems and the levels of HCV replication have been too low to permit detailed analyses.
  • HCV RNAs that replicate with minimal efficiency in the human hepatoma cell line Huh-7 have been reported.
  • Lohman et al. reported the con- struction of a replicon (1 377/NS3-3') derived from a cloned full-length HCV consensus genome (genotype Ib) by deleting the C-p7 or C-NS2 region of the protein- coding region (Lohman et al., Science 1999 285: 110-113).
  • the replicon contained the following elements: (i) the HCV 5 ⁇ - UTR fused to 12 amino acids of the capsid encoding region; (ii) the neomycin phosphotrans- ferace gene (NPTII); (iii) the IRES from encephalomyocarditis virus (EMCV), inserted down- stream of the NPTII gene and which directs translation of HCV proteins NS2 or NS3 to NS5B; and (iv) the 3"-UTR. After transfection of Huh-7 cells, only those cells supporting HCV RNA replication expressed the NPTII protein and developed resistance against the drug G418.
  • NPTII neomycin phosphotrans- ferace gene
  • EMCV encephalomyocarditis virus
  • the present invention features the development of a novel HCV replicon shuttle vector in which unique restriction enzyme sites are introduced at the 5" end of the NS3 gene and the 3" end of the NS4A gene such that full length NS3/4A sequences derived from the samples of HCV-infected patients can be cloned in the shuttle vector and the resulting replicons be evaluated for replication fitness and susceptibility to HCV NS3 protease inhibitors and to HCV RNA helicase inhibitors.
  • the use of the shuttle vector of the present invention would allow the characterization of specific patient- derived NS3/4A variants and the sensitivity or resistance of these variants to drug treatment.
  • the present invention provides an HCV replicon shuttle vector comprising an HCV polynucleotide sequence wherein the HCV polynucleotide sequence contains unique restriction enzyme sequences flanking the 5" end of the NS3A gene and the 3" end of the NS4A gene.
  • the HCV polynucleotide sequence comprises, in order, a unique restriction enzyme sequence placed between 15 nucleotides 5" and 5 nucleotides 3" from the 5" end of a polynucleotide sequence encoding a NS3 protein; a polynucleotide sequence encoding the NS3 protein; a polynucleotide sequence encoding a NS4A protein; a unique restriction enzyme sequence placed between 5 nucleotides 5" and 15 nucleotides 3" from the 3" end of a polynucleotide sequence encoding the NS4 protein; a polynucleotide sequence encoding a NS4B protein; a polynucleotide sequence encoding a NS5A protein; and a polynucleotide sequence en- coding a NS5B protein.
  • the unique restriction enzyme sequence at the 5" end of the polynucleotide sequence encoding the NS3 protein recognizes AsiSI and the unique restriction enzyme sequence at the 3" end of the polynucleotide sequence encoding the NS4A protein recognizes FspAI or Fsel.
  • the HCV repli- con shuttle vector comprises an HCV polynucleotide sequence selected from SEQ ID NO: 5 or SEQ ID NO:8.
  • a further embodiment of the present invention provides a method for assessing the effec- tiveness of an HCV NS3 protease inhibitor or an HCV RNA helicase inhibitor to control an
  • HCV infection in a subject comprising the steps of providing a sample from the subject infected with HCV, PCR-amplifying polynucleotide sequences encoding the NS3 protein and the NS4A protein from a plurarity of HCV quasispecies present in the sample with the use of a sense-strand primer which comprises a unique restriction enzyme sequence, and an anti-sense strand primer which comprises a different unique restriction enzyme sequence, cloning said PCR-amplifed polynucleotide sequences into an HCV replicon shuttle vector to produce chimeric HCV replicon plasmids, linearizing said chimeric HCV replicon plasmids and subjecting said linearized plas- mids to in vitro transcription to produce chimeric HCV replicon RNAs, and transfecting a Huh7 cell line with said HCV replicon RNAs and measuring replication level of said HCV replicon RNAs in the presence or absence of the HCV NS3
  • a still further embodiment of the present invention provides a method for assessing the effectiveness of an HCV NS3 protease inhibitor or an HCV RNA helicase inhibitor to control an HCV infection in a subject comprising the steps of providing a sample from the subject infected with HCV, PCR-amplifying polynucleotide sequences encoding the NS3 protein and the NS4A protein from a plurarity of HCV quasispecies present in the sample with the use of a sense-strand primer which comprises a unique restriction enzyme sequence, and an anti-sense strand primer which comprises a different unique restriction enzyme sequence, cloning said PCR-amplifed polynucleotide sequences into an HCV replicon shuttle vector to produce chimeric HCV replicon plasmids, transforming said plasmids into cells to generate a plurarity of colonies of transformed cells, pooling said colonies and isolating chimeric HCV replicon plasmids from the pooled colonies, linear
  • Figure 1 shows plasmid maps of the replicon shuttle vector
  • HCV replicon refers to a nucleic acid from the Hepatitis C virus that is capable of directing the generation of copies of itself.
  • the term “replicon” includes RNA as well as DNA, and hybrids thereof.
  • double-stranded DNA versions of HCV genomes can be used to generate a single-stranded RNA transcript that constitutes an HCV replicon.
  • the HCV replicons can include full length HCV genome or HCV subgenomic contructs also referred as a "subgenomic replicon".
  • the subgenomic replicons of HCV described herein contain most of the genes for the non-structural proteins of the virus, but are missing most of the genes coding for the structural proteins.
  • Subgenomic replicons are capable of directing the expression of all of the viral genes necessary for the replication of the viral subge- nome, replication of the sub-genomic replicon, without the production of viral particles.
  • a basic HCV replicon is a subgenomic construct containing an HCV 5 "-untranslated (UTR) region, an HCV NS3-NS5B polyprotein encoding region, and a HCV 3"-UTR.
  • Other nucleic acid regions can be present such as those providing for HCV NS2, structural HCV protein(s) and non-HCV sequences.
  • the HCV 5"-UTR region provides an internal ribosome entry site (IRES) for protein trans- lation and elements needed for replication.
  • the HCV 5"-UTR region includes naturally occurring HCV 5"-UTR extending about 36 nucleotides into a HCV core encoding region, and functional derivatives thereof.
  • the 5"-UTR region can be present in different locations such as site downstream from a sequence encoding a selection protein, a reporter, protein, or an HCV polyprotein.
  • non-HCV IRES elements can also be present in the replicon.
  • the non-HCV IRES elements can be present in different locations including immediately upstream the region encoding for an HCV polyprotein. Examples of non-HCV IRES elements that can be used are the EMCV IRES, poliovirus IRES, and bovine viral diarrhea virus IRES.
  • the HCV 3"-UTR assists HCV replication.
  • HCV 3" UTR includes naturally occurring HCV 3"-UTR and functional derivatives thereof.
  • Naturally occurring 3"-UTRs include a poly U tract and an additional region of about 100 nucleotides.
  • the NS3-NS5B polyprotein encoding region provides for a polyprotein that can be proc- essed in a cell into different proteins.
  • Suitable NS3-NS5B polyprotein sequences that may be part of a replicon include those present in different HCV strains and functional equivalents thereof resulting in the processing of NS3-NS5B to produce a functional replication machinery. Proper processing can be measured for by assaying, for example, NS5B RNA dependent RNA polymerase.
  • a "vector" is a piece of DNA, such as a plasmid, phage or cosmid, to which another piece of DNA segment may be attached so as to bring about the replication, expression or integration of the attached DNA segment.
  • a "shuttle vector” refers to a vector in which a DNA segment can be inserted into or excised from a vector at specific restriction enzyme sites.
  • the segment of DNA that is inserted into shuttle vector generally encodes a polypeptide or RNA of interest and the restriction enzyme sites are designed to ensure insertion of the DNA segment in the proper reading frame for transcription and translation.
  • vectors can be used to express a nucleic acid molecule.
  • Such vectors include chromosomal, episomal, and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, including yeast artificial chromosomes, from viruses such as baculoviruses, papovaviruses such as SV40, vaccinia viruses, adenoviruses, poxviruses, pseudorabies viruses, herpes viruses, and retroviruses.
  • viruses such as baculoviruses, papovaviruses such as SV40, vaccinia viruses, adenoviruses, poxviruses, pseudorabies viruses, herpes viruses, and retroviruses.
  • Vectors may also be derived from combinations of these sources, such as those derived from plasmid and bacteriophage genetic elements, e.g., cosmids and phagemids.
  • Appropriate cloning and expression vectors for prokaryotic and eukaryotic hosts are described in Sambrook et al, (1989) Molecular Cloning: A Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA.
  • a vector containing the appropriate nucleic acid molecule can be introduced into an appropriate host cell for propagation or expression using known techniques.
  • Host cells can include bacterial cells including, but not limited to, E. coli, Streptomyces, and Salmonella typhimurium, eukaryotic cells including, but not limited to, yeast, insect cells, such as Drosophila, animal cells, such as Huh-7, HeLa, COS, HEK 293, MT- 2T, CEM-SS, and CHO cells, and plant cells.
  • Vectors generally include selectable markers that enable the selection of a subpopulation of cells that contain the recombinant vector constructs.
  • the marker can be contained in the same vector that contains the nucleic acid molecules described herein or may be on a separate vector. Markers include tetracycline- or ampicillin-resistance genes for prokaryotic host cells and dihy- dro folate reductase or neomycin resistance for eukaryotic host cells. However, any marker that provides selection for a phenotypic trait will be effective.
  • polynucleotide or “nucleic acid molecule” generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • Polynucleotides include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. “Polynucleotide” also embraces relatively short polynucleotides, often referred to as oligonucleotides.
  • DNA molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms.
  • double-stranded DNA found, inter alia, in linear DNA molecules (e.g., restriction fragments), vi- ruses, plasmids, and chromosomes.
  • linear DNA molecules e.g., restriction fragments
  • vi- ruses e.g., SV-like molecules
  • plasmids e.g., plasmids
  • chromosomes e.g., chromosomes
  • sequences may be described herein according to the normal convention of giving only the sequence in the 5" to 3" direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
  • RNA molecule refers to the polymeric form of ribonucleotides in its either single- stranded form or a double-stranded helix form.
  • sequence may be described herein according to the normal convention of giving the sequence in the 5' to 3' direction.
  • restriction enzyme sequence refers to a specific double stranded-DNA sequence which is recognized and cut by bacterial enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.
  • the restriction enzyme "AsiSI” recognizes the sequence 5'GCGAT T CGC 3' and cuts the double-stranded DNA at the indicated 3'CGC A TAGCG 5' nucleotide position (shown with ⁇ A ).
  • restriction enzyme "FspAI” recognizes the sequence 5 'RTGC ⁇ GCAY 3 'where “R” represents “A” or “G” and “Y” represents “C” or “T” and cuts the.3 'YACG A CGTR 5 'double-stranded DNA at the indicated nucleotide position.
  • restriction enzyme "Fsel” recognizes the sequence 5'GGCCGG T CC 3' and cuts the
  • primer refers to an oligonucleotide, either RNA or DNA, either single-stranded or double-stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically which, when placed in the proper environment, is able to functionally act as an initiator of template-dependent nucleic acid synthesis.
  • the primer When presented with an appropriate nucleic acid template, suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as a suitable temperature and pH, the primer may be extended at its 3" terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product.
  • the primer may vary in length depending on the particular conditions and requirement of the application. For example, in PCR reactions, the primer is typically 15-25 nucleotides or longer in length.
  • the primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, i.e.
  • the primer sequence represent an exact complement of the desired template.
  • a non- complementary nucleotide sequence e.g. a restriction enzyme recognition sequence
  • non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template-primer complex for the synthesis of the extension product.
  • chimeric as used herein means a molecule of DNA that has resulted from DNA from two or more different sources that have been fused or spliced together.
  • the term "quasispecies” means a collection of micro variants of a predominant HCV genome sequence (i.e. genotype), said microvariants being formed in a single infected subject or even in a single cell clone or even in a single cell clone as a result of high mutation rate during HCV replication.
  • subject refers to vertebrates, particular members of the mammalian species and includes, but not limited to, rodents, rabbits, shrews, and primates, the latter including humans.
  • sample refers to a sample of tissue or fluid isolated from a subject, including but not limited to, for example, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs, and also samples of in vitro cell culture constituents (including but not limited to, conditioned medium resulting from the growth of cultured cells, putative Iy viral infected cells, recom- binant cells, and cell components).
  • a cell has been "transformed” or “transfected” by exogenous or heterologous DNA or RNA when such DNA or RNA has been introduced inside the cell.
  • the transforming or trans- fecting DNA or RNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
  • the transforming DNA may be maintained on an episomal element such as a plasmid.
  • a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication.
  • the RNA molecule e.g., an HCV RNA molecule
  • Huh-7 cells carrying the HCV replicons are detected either by the presence of a selection marker or a reporter gene present on the replicon.
  • a "clone” refers to a population of cells derived from a single cell or common ancestor generally by the pro cess o f mito sis .
  • the transient HCV GT-Ib Conl replicon vector (rep PI-luc/ET) was obtained from R. Bartenschlager. Briefly, it includes the poliovirus internal ribosome entry site (IRES), which controls the translation of the firefly luciferase gene. Downstream of the firefly luciferase gene, the IRES from the encephalomyocarditis virus (EMCV) controls the translation of the HCV nonstructural genes (NS3, NS4A, NS4B, NS5A and NS3/4A). The repPI-luc/ET vector was modified to replace the pBR322 backbone with the pUC18 backbone to generate replicon pPI- luc/ET/SC.
  • IRES poliovirus internal ribosome entry site
  • EMCV encephalomyocarditis virus
  • Mutations were introduced into pPI-luc/ET/SC in order to put in unique restriction enzyme sequences at the 5" end of the NS3 gene and at the 3" end of the NS4A gene by using the Quik- Change site-directed mutagenesis kit following the manufacturer's instructions (Stratagene, La Jolla, CA, USA).
  • An AsiSI restriction enzyme sequence was introduced at the end of the IRES sequence, immediately upstream of the 5" end of the NS3 gene by using the following primers:
  • Sense primer 5" CGGGGACGTGGTTTTCCTTTGAAAAACGCGATCGC ACCATGG- CGCC TATTACG-3' (SEQ ID NO:1)
  • Anti-sense primer 5' CGTAATAGGCGCCATGGTGCGATCGCGTTTTTCAAAG-
  • Anti-sense primer 5 CGATGTAAGGGAGGTGTGAGGC 515 CGGCCCTTCCATCTCATC- 3' (SEQ ID NO:4)
  • lacZ beta-galactosidase
  • AsiSI and Fsel restriction enzyme sequences were introduced at the 5" end and at the 3" end of the lacZ gene, respectively, by PCR amplification and resulted in generating the shuttle vector,
  • NS3/4A shuttle vector with a FspAI restriction enzyme sequence replacing the Fsel restriction enzyme sequence at the 3" end of the NS4A gene was generated using pSC_lb_NS3/4A/lacZ_AsiSI_FseI as the template and the following primers: Sense primer: 5 ⁇ -GTCTCCGGG AGCTGGGTGC * GC ATC AC ACCTCCCTT AC A-3 ⁇
  • Anti-sense primer 5 -TGTAAGGGAGGTGTGATGC 515 GCACCCAGCTCCCGGAGAC- 3' (SEQ ID NO:7)
  • DNA sequences encoding the NS3/4A protein were generated from plasma obtained from patients infected with HCV using reverse transcription of RNA followed by PCRamplification of the reverse-transcribed product.
  • Reverse transcription of RNA was performed using Taqman Reverse Transcription Reagents (Applied Biosystems, Foster City, CA, USA) using the primer, 5 -ACCAGGTCCTCSGTGGAGG-S' (SEQ ID NO:9) and according to the manufacturers' protocol.
  • the synthesized cDNA was then PCR-amplified with the GC RICH PCR system (Roche Applied Science) to ensure high fidelity and robust yields. Annealing temperatures in the range of 50-52 C were used depending on patient sample and primer combinations.
  • Two PCR reactions with two independent primer sets used for the first round PCR were as follows: The first set of primers used for the first round PCR were as follows:
  • the second set of primers used for the first round PCR were as follows: Sense primer 5 ' -GGCAGACACCGCGGCGTGTGG-S ' (SEQ ID NO: 12) Anti-sense primer 5 ' -TTCCACATGTGCTTCGCCC-S ' (SEQ ID NO: 13)
  • the first round PCR products were then subject to a second PCR using primers that intro-ucked an AsiSI restriction enzyme sequence at the 5' end of the NS3 gene and either an Fsel or FspAI restriction enzyme sequence at the 3' end of the NS4A gene.
  • the sense primer used to introduce the AsiSI restriction enzyme sequence was 5'- CTGTCTGTCTGCGATCGCAC- CATGGCGCCT ATT ACGGCCT ACTC-3' (SEQ ID NO: 14).
  • the anti-sense primer used to introduce an FspAI restriction enzyme sequence was 5' AGGGAGGTGTGATGCGCACTCTTC CATC-3' (SEQ ID NO: 15).
  • the anti-sense primer used to introduce an Fsel restriction enzyme sequence was 5 ' -CGCACTCTTCCATCTCATCGAACTC-S ' (SEQ ID NO: 16)
  • Patient NS3/4A PCR amplicons were then purified using Qiagen PCR purification Columns, digested with the restriction endonuclease AsiSI and re-purified.
  • the FspAI containing amplicon was then digested with FspAI.
  • the final product was gel purified using Qiagen's Gel Extraction Kit.
  • the shuttle replicon pSC_lb_NS3-4A-AsiSI-FseI_lacZ or pSC_lb_NS3-4A-AsiSI- FspAI lacZ were prepared by digestion with restriction endonucleases AsiSI and Fsel (New England Bio labs, Ipswitch, MA, USA) or FspAI (Fermentas, Burlington, Ontario, Canada ).
  • the Fsel vector was further treated with Klenow (New England Bio labs).
  • the vectors were sepa- rated from digested insert by 1% agarose gel electrophoresis and the vector was gel purified using Qiagen's Gel Extraction Kit. Purified vectors were then treated with Shrimp Alkaline Phosphatase (Roche Applied Science).
  • shuttle vector Twenty- five ng of shuttle vector were ligated with the digested patient amplicons using T4 DNA ligase (Roche Applied Science) overnight at 14-16 0 C. Vector to insert ratio of 1 :2 to 1 :4 were routinely used. After overnight ligation, 5 ⁇ l of the reaction were transformed into 100 ul of One Shot OmniMAX 2 T Phage-Resistant Cells (Invitrogen, Carlsbad, CA, USA) and plated after 1 hour of shaking at 37 C.
  • Heterogeneous 96-clone pool plasmid DNA was submitted for sequencing to confirm the identity of patient samples and to screen for potential contaminating DNA prior to the in vitro transcription reaction. Fifty to one-hundred nanograms of plasmid DNA and 4 pmol of sequencing primers were routinely used.
  • Cured hepatoma cell line Huh7 was obtained from R. Bartenschlager. Cells were cultured at 37 C in a humidified atmosphere with 5 % CO 2 in Dulbecco's Modified Eagle Medium (DMEM) supplemented with Glutamax and 100 mg/ml sodium pyruvate (Cat# 10569-010). The medium was further supplemented with 10 % (v/v) FBS (Cat# 16000-036) and 1 % (v/v) penicillin/streptomycin (Cat# 15140-122). All reagents were from Invitrogen.
  • DMEM Dulbecco's Modified Eagle Medium
  • RLU represents level of firefly luciferase signal observed after 4 hours or 96 hours following transfection

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne de nouveaux vecteurs navettes de réplicon VHC NS3/4A, utiles dans le clonage de séquences polynucléotides HCV qui proviennent d’échantillons de patients infectés par le VHC et dans l'analyse des réplicons qui en résultent, pour tester la sensibilité médicamenteuse.
PCT/EP2010/062571 2009-08-31 2010-08-27 Vecteurs navettes de réplicon de vhc ns3/4a WO2011023801A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US23842609P 2009-08-31 2009-08-31
US61/238,426 2009-08-31

Publications (1)

Publication Number Publication Date
WO2011023801A1 true WO2011023801A1 (fr) 2011-03-03

Family

ID=42797378

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/062571 WO2011023801A1 (fr) 2009-08-31 2010-08-27 Vecteurs navettes de réplicon de vhc ns3/4a

Country Status (1)

Country Link
WO (1) WO2011023801A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10961561B2 (en) 2014-05-21 2021-03-30 IntegenX, Inc. Fluidic cartridge with valve mechanism

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997012033A1 (fr) 1995-09-27 1997-04-03 Emory University Replicase recombinee du virus de l'hepatite c
WO2007145894A2 (fr) * 2006-06-08 2007-12-21 Merck & Co., Inc. Procédé rapide pour déterminer la sensibilité aux inhibiteurs de séquences de protéase ns3/4a clonées à partir d'échantillons cliniques
US20080026952A1 (en) 2005-12-21 2008-01-31 Roche Palo Alto Llc HCV replicon shuttle vectors
WO2008148671A1 (fr) * 2007-06-06 2008-12-11 F. Hoffmann-La Roche Ag Vecteurs navettes de réplicon ns3 de vhc
WO2009071488A2 (fr) * 2007-12-07 2009-06-11 F. Hoffmann-La Roche Ag Vecteurs navettes de réplicon de protéase ns3 du vhc

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997012033A1 (fr) 1995-09-27 1997-04-03 Emory University Replicase recombinee du virus de l'hepatite c
US20080026952A1 (en) 2005-12-21 2008-01-31 Roche Palo Alto Llc HCV replicon shuttle vectors
WO2007145894A2 (fr) * 2006-06-08 2007-12-21 Merck & Co., Inc. Procédé rapide pour déterminer la sensibilité aux inhibiteurs de séquences de protéase ns3/4a clonées à partir d'échantillons cliniques
WO2008148671A1 (fr) * 2007-06-06 2008-12-11 F. Hoffmann-La Roche Ag Vecteurs navettes de réplicon ns3 de vhc
WO2009071488A2 (fr) * 2007-12-07 2009-06-11 F. Hoffmann-La Roche Ag Vecteurs navettes de réplicon de protéase ns3 du vhc

Non-Patent Citations (44)

* Cited by examiner, † Cited by third party
Title
BARTENSCHLAGER ET AL., J. VIROL., vol. 67, 1993, pages 3835 - 3844
BARTENSCHLAGER ET AL., J. VIROL., vol. 68, 1994, pages 5045 - 5055
BAZAN; FLETTERICK, VIROLOGY, vol. 171, 1989, pages 637 - 639
BEHRENS ET AL., EMBO, vol. 15, 1996, pages 12 - 22
BLIGHT ET AL., SCIENCE, vol. 290, 2000, pages 1972 - 74
BLIGHT KERIL J: "Allelic variation in the hepatitis C virus NS4B protein dramatically influences RNA replication", JOURNAL OF VIROLOGY, vol. 81, no. 11, June 2007 (2007-06-01), pages 5724 - 5736, XP002604343, ISSN: 0022-538X *
BOYER, N. ET AL., J. HEPATOL., vol. 32, 2000, pages 98 - 112
DI BESCEGLIE, A. M.; BACON, B. R., SCIENTIFIC AMERICAN, October 1999 (1999-10-01), pages 80 - 85
ECKART ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 192, 1993, pages 399 - 406
F. F. POORDAD ET AL.: "Developments in Hepatitis C therapy during 2000-2002", EXP. OPIN. EMERGING DRUGS, vol. 8, no. 1, 2003, pages 9 - 25
FAILLA ET AL., J. VIROL., vol. 68, 1994, pages 3753 - 3760
FORNS; J. BUKH, CLINICS IN LIVER DISEASE, vol. 3, 1999, pages 693 - 716
G. LAKE-BAKAAR: "Current and Future Therapy for Chronic Hepatitis C Virus Liver Disease", CURR. DRUG TARG. INFECT DIS., vol. 3, no. 3, 2003, pages 247 - 253
GOR- BALENYA ET AL., NATURE, vol. 333, 1988, pages 22
GOR- BALENYA ET AL., NUCLEIC ACID RES., vol. 17, 1989, pages 3889 - 3897
GRAKOUI ET AL., J. VIROL., vol. 67, 1993, pages 2832 - 2843
GRAKOUI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 10583 - 10587
ILIJIKATA ET AL., J. VIROL., vol. 67, 1993, pages 4665 - 4675
J. A. WU; Z. HONG: "Targeting NSSB-Dependent RNA Polymerase for Anti-HCV Chemotherapy", CUR. DRUG TARG.-INF. DIS., vol. 3, 2003, pages 207 - 219
J. BUKH ET AL., SEMIN. LIV. DIS., vol. 15, 1995, pages 41 - 63
JIN; PETERSON, ARCH. BIOCHEM. BIOPHYS., vol. 323, 1995, pages 47 - 53
KIM ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 215, 1995, pages 160 - 166
KOONIN, E. V.; DOLJA, V. V., CRIT. REV. BIOCHEM. MOLEC. BIOL., vol. 28, 1993, pages 375 - 430
LECHMANN ET AL., J. VIROL., vol. 71, 1997, pages 8416 - 8428
LOHMAN ET AL., SCIENCE, vol. 285, 1999, pages 110 - 113
M. P. WALKER ET AL.: "Promising Candidates for the treatment of chronic hepatitis C", EXP. OPIN. INVESTIG. DRUGS, vol. 12, no. 8, 2003, pages 1269 - 1280
N. N. ZEIN, CLIN. MICROBIOL. REV., vol. 13, 2000, pages 223 - 235
P. HOFFMANN ET AL.: "Recent patents on experimental therapy for hepatitis C virus infection", EXP. OPIN. THER. PATENTS, vol. 13, no. 11, 2003, pages 1707 - 1723
PAREDES ANNE M ET AL: "A Genetic Interaction between Hepatitis C Virus NS4B and NS3 Is Important for RNA Replication", JOURNAL OF VIROLOGY, vol. 82, no. 21, November 2008 (2008-11-01), pages 10671 - 10683, XP002604342, ISSN: 0022-538X *
Q. M. WANG ET AL.: "Hepatitis C virus encoded proteins: targets for antiviral therapy", DRUGS OF THE FUTURE, vol. 25, no. 9, 2000, pages 933 - 8,944
QI ET AL., ANTIVIRAL RES., vol. 81, 2009, pages 166 - 173
QI XIAOPING ET AL: "Development of a replicon-based phenotypic assay for assessing the drug susceptibilities of HCV NS3 protease genes from clinical isolates", ANTIVIRAL RESEARCH, vol. 81, no. 2, February 2009 (2009-02-01), pages 166 - 173, XP002604341, ISSN: 0166-3542 *
R. DE FRANCESCO ET AL.: "Approaching a new era for hepatitis C virus therapy: inhibitors of the NS3-4A serine protease and the NS5B RNA-dependent RNA polymerase", ANTIVIRAL RES., vol. 58, 2003, pages 1 - 16
R. G. GISH, SEM. LIVER. DIS., vol. 19, 1999, pages 5
RICE, C. M.: "Fields Virology", vol. 30, 1996, LIPPINCOTT-RAVEN PUBLISHERS, article "Flaviviridae: The viruses and their replication", pages: 931 - 959
S.-L. TAN ET AL.: "Hepatitis C Therapeutics: Current Status and Emerging Strategies", NATURE REV. DRUG DISCOV., vol. 1, 2002, pages 867 - 881
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual,2nd edn.", 1989, COLD SPRING HARBOR LABORATORY PRESS
SIMMONDS, P., J. GEN. VIROL., vol. 85, 2004, pages 3173 - 88
TOME ET AL., J. VIROL., vol. 67, 1993, pages 4017 - 4026
WARRENER; COLLETT J., VIROL., vol. 69, 1995, pages 1720 - 1726
WISKERCHEN; COLLETT, VIROLOGY, vol. 184, 1991, pages 341 - 350
XU ET AL., J VIROL., vol. 71, 1997, pages 53 12 - 5322
YUAN ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 232, 1997, pages 231 - 235
ZHONG ET AL., J. VIROL., vol. 72, 1998, pages 9365 - 9369

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10961561B2 (en) 2014-05-21 2021-03-30 IntegenX, Inc. Fluidic cartridge with valve mechanism

Similar Documents

Publication Publication Date Title
US8754061B2 (en) Nucleic acid construct containing a nucleic acid derived from the genome of hepatitis C virus (HCV) of genotype 2a, and a cell having such nucleic acid construct introduced therein
EP1801209B1 (fr) Arn genomique du virus humain modifie de l'hepatite c ayant une capacite replicative autonome
EP1801116A1 (fr) Vecteurs navette de replicon du VHC
JP2004516039A (ja) Ｃ型肝炎ウイルスからの自己複製ｒｎａ分子
WO2009071488A2 (fr) Vecteurs navettes de réplicon de protéase ns3 du vhc
US20100068698A1 (en) Production of infectious hepatitis c virus particles in cell culture
JP4573776B2 (ja) 新規ｈｃｖ株由来の核酸、遺伝子、及び該遺伝子を利用したレプリコン複製細胞
US20090004664A1 (en) HCV NS3 replicon shuttle vectors
US20110053160A1 (en) Hcv ns3/4a replicon shuttle vectors
WO2011023801A1 (fr) Vecteurs navettes de réplicon de vhc ns3/4a
US20110245328A1 (en) HCV NS5A Replicon Shuttle Vectors
US20100173281A1 (en) HCV NS3 protease replicon shuttle vectors
WO2002061048A2 (fr) Systeme in vitro pour la replication de virus a arn polymerase arn dependante
WO2011024875A1 (fr) Polynucléotide issu d'une nouvelle souche de virus de l'hépatite c et son utilisation
WO2003091439A1 (fr) Replicon de virus de l'hepatite c selectionnable par le rapporteur
WO2001088161A1 (fr) Vecteur permettant d'analyser le mecanisme de replication d'un virus a arn et utilisation de ce vecteur
AU2002240214A1 (en) In vitro system for replication of RNA-dependent RNA polymerase (RDRP) viruses

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10747215

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10747215

Country of ref document: EP

Kind code of ref document: A1