WO2010148651A1

WO2010148651A1 - Method and kit for detecting small rna

Info

Publication number: WO2010148651A1
Application number: PCT/CN2010/000945
Authority: WO
Inventors: 席建忠; 李娟�; 姚波
Original assignee: Xi Jianzhong; Li Juan; Yao Bo
Priority date: 2009-06-26
Filing date: 2010-06-24
Publication date: 2010-12-29
Also published as: CN101633957A

Abstract

The invention provides a method for detecting small RNA, comprising hybridizing RT-primer to target small RNA; carrying out reverse transcription; connecting the DNA strands obtained by reverse transcription end to end by using bridge probe as a mediate to form a circle; and carrying out ramification amplification real-time quantitative detection under the action of DNA polymerase, the first primer and the second primer. The invention also provides a kit for the detection of small RNA.

Description

The method of Xiao A and

Wood field

Charcoal involves the field of small RqA. Background

Small RqA is a non-copper RqA family o cod g RqA cRqA in the vertical part includes micro RqA coRqA or Rq, small RqA sRqA, small RqA, small RqA pw protein and RqA pR A. To study the role of small RqA in the cells, etc., differentiation, and even the disease, as well as the invasion and invasion of viruses. Small RqA acts in a variety of ways. They can be either A-linked or genetically specific. In the small RqA of each type, the tiny RqA is the most functional one.

Tiny RqA is a non-copper R A of 18-25 acid endogenous to bioremediation. They are distributed in different organs, mainly through RqA and at the level of special mercury.

RqA or suppression. In the past ten years, the seaweed has reached the limit of God's conservative and non-conservative RqA. Many clearly show the role of RqA in a range of organisms such as cell proliferation, differentiation, , , , and viral infections, but little is known about our RqA physiological function. In addition, a large number of studies R A are through their RqA microphysiological functions. Therefore, RqA and quantitative analysis have become an urgent need to understand the physiological functions of RqA.

However, since RqA is very and some RqAs have very similar sequences, such as the e-7 family of series R A is a very productive job. A large number of research work in the field has worked on a series of R A state methods o he ee R. C. Fe ba R. . a d A bos V. 1993. The C. ce ans eeocho c Ge e -4 E codes S a R As w h A se seCo pe e a y o n 4.Ce 75 843 854. 6e e S. Sewe A. agos-Q a a . She da R. Sa de . Gasse F.A Va yk . o C. Sh a S. Che . e a.2005. de fca o O coR As O hehePesv s a y. a ne ehods2 269-276.

(A aw .T. ahbeg J.E. Oso S. d E. Oso . ada W..2004. Q aao O coRqAs sga odFed vade assay. RAH 0 1153-1161.), pn ed L ga on ao ey P. A. Cha o gpo S. So e F. ad se T. W. 2007. A apd Qaa veassay6 d ec deec o O coRqAsa dOhe S a R As s gSp ed ga o . RW 3 930-936. , State method e hods E. oose a W.. ska E. Avaez-Saaveda E. eezkoV EE de o V z . R. a pp e S. ad asek R. . A. 2005. coRqA Expesso zebafs E byo c eveop e . Scence 309 0- . oose a W. P. We ods E. Ede a pp e Sa d asek R. . A.200 . S deec o O coR As aae byos sg A odFedO go ceo depobes. a. Eho small 3 27-29. The average method compared to some TP methods due to the high sensitivity and the gradual m N quantitative analysis of the main method Che C. Rdzo . A. Oo e A. J. Zho Z. ee . . g ye J. T. abs . X . Ahh vaka VR A de se . R. e a.2005. Rea- eq a fca o O coRqAsbySe oopRT PCR.W cec cdsRes.33:e179. Sh R. a dCha g V. .2005. Fac e ea s 6 qayg coRqAexpesso by ea- e CR. o rechnq es 39 519-525. Ray od C. Robe ts . S. Ga e -E gee P. . P. ad Joh so J. 2005. S pe qaa ve pe exe so CR assay 6 d ec oog O coRqAsa dSho ee gR As.RA 1737-1744 ag . Wa g Z. S C. Fa Y. Cha g QS Wa g XX J..Rea- e CR coR Adeec o basedO e zy a cSe -ooppobes ga o . na Che . O :acg00598d pess

RT-PCR outside the wood o gC ceA fc o RCA is a novel isothermal A wood z d P. . a g X. zh Z. a ad P. Tho as . C. a dWad . C. 1998. a o deec o a d s ge- oec e Co g s g sohe a o g C ce a p fca o . a ne encrcs 9 225-232. zha g . Y. a dwe . s h T. C. .1998.A p fca o O age-specfc ga o -depe de C c a pobe. Gene2 :277-285. The PCR is compared to RCA in a range of states of A RqA and even protein. Jo s p et al.

Padock obe and o gC ceA p fc o RCA wood exhibited a set of R A systems in the system R A in the same medium and RCA's predecessor Jo s pp S. P. och J. a d□e s J.2006.A coRqAdeec o Syse basedO padock pobes a d o gC cea p fca o .RW 2 1747 1752. Recently, Che G et al. used the branch b ched-R to change the sensitivity of the method. We know that usually the same position is easily picked up by C-C-pobe, but it may be worse. In addition, it distinguishes a highly similar RqA e-7 series.

Still one for each. content

The purpose of charcoal is to solve the problem of the small RqA provided by the wood and the height, height and low wood of the small RqA.

In the charcoal Mingmu small RqA" refers to less RqA including but not limited to micro RqA coR RqAX, small RA ho e 6e gRqA sR, small RqA sa cea RqA s R , small RqAs ae po a RqA sRqA pw protein action RqA w- e ac gR A pRqA, etc. The main concern of charcoal is RA, but the wood field can be used for charcoal and the method of using this small RqA is not limited to RqA but the small RqA is still understood. .

T P refers to a sequence containing a sequence in a small N. The other part of the sequence of the T P is specifically required to be phosphorylated at the 5th end to form a DN in the subsequent step.

In charcoal Mingzhong, DN is a sequence of 5 and 3 which contains T anti-mercury, ie DN" below, and T and anti-metahydrate of T-Turcury are 5 and 3 T anti-metahydrates can be connected end to end to form a dielectric DN.

It is the branch of am ca on mp ca on and the first is the first "and second" of charcoal.

Charcoal is a wooden plan that weeping as follows. Each of the rests containing small N may be any H that contains a small N, such as N-wood, N-wood, cell extracts, intact cells, extracts, or Hume's Mercury Counter. The synthetic T T has a sequence of sequences that can be part of a small N. A sequence of 3 ends of the T object is a sequence of small N 5 ends. In one step does not contain T

The nucleic acid of the sequence is in a step which is not to be excluded from T and the small N forms T under the action of DN polymerization to synthesize a small N sequence with a small N template anti-mercury to obtain N DN . So far all of the sequence of small N is specifically shifted to a small N in the N DN of the nucleic acid on T to obtain a DN DN including a part of the sequence from T and another part from the anti-special mercury of the small N template. If the DN is connected end to end, that is, 5 3 will form a DN synthesis. Some or all of the sequences are part of the DN including the sequence. The DN will be added to the DN containing the upper DN to make the DN end to end to form a DN. The reason why it is forceful"

The DN is due to the fact that the DN of the DN is connected because she is relatively close. Since DN 5 3 is close to each other under the action of DN, 5 3 is easy to form a new phosphoric acid to form a DN of the DN formed by our combined DN". One step is to eliminate the non-small N because of some of the same series. The small N sequence is very similar, for example, the mouse at the e 7a3 end of the 2 5 sequence e 7d 3 end of the 1 4 sequence is identical 2 and 4B if the T sequence of the sequence e 7a rises and

5 below, both of them are all anti-special mercury, but in

In the step of e 7d, 5 e 7a is different. 4B e 7d will not form a release DN and e 7d will be excluded in this step 4 . The next DN line Quantitative branch

Ra fca o A p fca o This DN polymerization and at least one of the first and second forests, respectively, such as the first sequence

A part or all of the sequence in the DN and derived from the small N can be used to eliminate the remaining non-small N in one step. The sequence of e 7a e 7 5 and 3 is the same. She is not the same as the one in the middle 2 and 4B e 7a. The e 7 e 7a function cannot be divided. In e 7a, she is in the middle of e 7a. She is in the upper step. She is in DN.

And derived from the sequence of small N, thus the first or second first or second of the sequence of quantitative branches can only be obtained from e 7a

DN combines only the existence of e 7a in the rest of the branch, so the branch further improves the charcoal's small N state method. The small N-state method of charcoal as above T, and the first or second step of the small N-state method that makes charcoal have very high sensitivity, which can have a different small N function and can be mature N. The small N-state method of charcoal can be as small as 10 zep ooe for small N quantification. The small N-state method of charcoal has potential flaws due to its high sensitivity, strong speciality, and very much in analysis and many other fields. Charcoal Mingji wood plan is as follows

1. The method of small N of the known sequence is characterized in that the method comprises the following steps

1 will contain a small N of T T to T contains a sequence of at least a part of the sequence of small N and at least a part of the sequence of small N

2 N DN is obtained by synthesizing a small N sequence with a small N template anti-mercury under the action of the first DN polymerization

3 N in the N DN obtained in step 2 of the nucleic acid to obtain DN 4. The DN obtained in step 3 is ligated to the DN end-to-end to include at least a part of the sequence of a part of the sequence to obtain the DN 5 under the action of DN Step 4 obtained the gap in the release DN to get the DN

6 obtained under the action of the polymerization and the first and second substances

DN line security quantitative branch.

2. The method of small N of the known sequence is characterized by at least a portion of the sequence of the first and second sequence DN.

3. The method of small N of the known sequence is characterized in that at least a part of the sequence of small N is derived from the sequence DN of the first substance and the second substance.

4. Any of the small N's of the known sequence of 1 3 is characterized by at least a portion of the sequence of the small N 3 terminus of the T object.

5. The 1 or 4 method of the small N of the known sequence is characterized by the inclusion of a small N of N-pure, N-wood, N-cell extract, cell extract, intact cells, extract or Hume. 6. The small N of the known sequence consists of a sequence comprising T, a first DN polymer, a nucleic acid, a DN, a polymer, a first and a second of the branch, and a sequence comprising at least a portion of the sequence comprising a small N. The first DN is polymerized in the N of the N-inverse mercury in the N DN, and the DN DN is connected end to end. At least a portion of the sequence can be obtained by the release DN DN connected to the gap of the DN to obtain the DN polymerization and the first and second DN branches.

7. The small N of 6 of the known sequence is characterized by at least a portion of the sequence of the first and second sequence DN.

8. The small N of 7 of the known sequence is characterized in that at least a part of the sequence of small N is derived from the sequence DN of the first substance and the second substance. 1 The small RqA state method of charcoal indicates the sensitivity and sensitivity of 囤 A and e-7a

2 Small RqA state method using charcoal - the sensitivity and

3 using the charcoal of the small RqA state method - 2 sensitivity and

4 charcoal small RqA state method with high specificity principle 囤 A and e-7 series RqA 5 charcoal small RqA state method RqA wood

6 charcoal small RqA state method and connected to RqA wood

7 charcoal small RqA state method mouse 12 gods different - 2 - - and - 3 h v Sp kd hy thymus Co Ov egg nest b pa S skeletal muscle. The assimilation code RT-PCR method was compared and analyzed.

8 charcoal small RqA state method mouse 12 gods different in e-7a. The assimilation code RT-PCR method was compared and analyzed.

The small RqA state method in 9 charcoal Ming and the 6 levels in the RT-PCR mouse Hugh 12 cells. A comparative analysis was carried out with the small RqA state method code RT-PCR method for the s oR A 5 and - 9 charcoal.

Hugh way

The following will be Hugh's charcoal but Hugh's lack of understanding of the limitations of charcoal will still be included in the charcoal. Materials and Method

1. Mature R R before the break, and . The sequence of mature RA and its predecessor such as e-7 series, - 2 - , - 3 - 0 and - 9 from a ge Ce e ase hp:// o a.sa ea . k/seq e es and s oRqA 135 Sequence of 6 C

h :// . c . . h. ow got. Mature synthesis R A Shanghai company ha gha Ge ePha a All RqA pre-hit external mercury method

All A and since v oge companies in Shanghai. Polypropylene was purified for its sequence at 2 and 3. The ao op spectrophotometric of the nucleic acid resembles - The oFshe A SA absorbs her at 260 nm.

2. Each and RqA are extracted. References provided by the family using TR zo1 ! Ca# P405-02 Ta ge in Beijing 8-week-old mice with minced organs such as heart, , , , , thymus, ovary, and skeletal muscle extracted with RqA wood. Ground sinking 50 to 100 mg of wood is fully dispersed into TRqzo1 and TR is added to TR zo1. .

Chloroform will be mixed thoroughly at room temperature 2-3 at 4C, 20 xg under the conditions of 15%. Under no circumstances carefully transfer the solution to a new one to join the rest.

The propanol is mixed evenly at -30 ° C 20 at 4C, 20 xg under 10 million to remove RqA with 75% ethanol. Most of the RqA is dissolved in the nucleic acid water cease ee wae. All reference management and use of all s o a A Caea d seCo ee AC C " and cooperation

OEC ".

3. Each of the s A templates. 5 p o of A is annealed at 75 ° C 5 and then to room temperature 30 . The inverse of each ds A template is in the presence of 1 amino group.

T s C , 5 aC , gC also TT , 25 4d TPs 5 e owFag e -5 exo ewE ga d o abs Easw Sce fc in 20-Hugh. .

Keep a small one at 37C. However, the mixture is heated to 75 C to keep 20

That is, to room temperature to anneal ds A.

4. Hugh's mercury is reversed. 20 on the ds A template mixture added to 3 contains 0. TPs 4 T s- C, m gC TT 2 40-2 nucleic acid bo cease hb o TA AARA medium large 5 T7 RqA polymerization like ew E ga d o abs Easw .

In the Sce fc, the mercury in the Hugh is in the 37C 4 small. Add it without The nucleic acid qase- ee ase Fe e as in Shenzhen to digest A template. The most used / chloroform excess and protein extracts her to purify the RA in the anti-hybrid mixture. Special mercury completed RqA pre-week 2 using ao op spectrophotometric 26 her absorption.

5. Phosphorylation and anti-special mercury counter. 5 Rephosphorylation of RT-R before R A anti-special mercury.

.

Will be 0. o RT-7 Heat 5 C Keep 5 While freezing on ice before her. The reverse of 5 contains 5 T s- C p 8.0 , 1 gC 5 T , and ATP 2 T4.

TA A4R in the big and A this will be reversed at 37C 2 small. Most at 20 ° C at 65 ° C.

The anti-special mercury of RA to c A is reversed in the anti-interruption of 10 containing 1 RqA wood, 5 -phosphorylated RT-, 2 eSc p anti-special mercury TA A4RA large 5 d TPs 1 anti-p. 3 5 m T s- C 75 C 3 gC2 Hold Hugh at 41 C for 30 °. Then add 2.5 nucleic acid Fe e as medium depth.

Shenzhen at 37C, she drops 20 R R-A in Rq

. 6. C-connected. The mixture of 10 anti-mercury 10 4 was heated at 95 C to room temperature to form a C-form. Each of the anti-solutions containing 2 m T s-C p 7.6, 2 AAc gAc, A.1% of T o X- 00, and H2 is added to it, and nag A is similar to ewE ga d .

o abs Easw Sce fc Neutral and get the release C- at 55 C reverse 45 to make the gap in C-.

7. RAA. Isothermal reaction 25 which includes 1 Zhuang mixture, 1 and 2 each 1.2 0 d TPs 2 T s- C p 8.8 C, S gS 0.1% T o X- 00 6% 6 x SY ee Dye o- so Neutralization 6.4 s A large fragment age 6ag e aggregation like ew E ga do North s Easw Sce fc. Anti-Hugh In a 96-we, incubate at 65 C p co 2 AE g e o-Rad North o ao es CA SA 25 One cycle 100 . All counters are 3 .

The fraction of the intensity of C.

8. Code RT-PCR and unified PCR. Quantification of the level of RA using the PCR method Code VO RqAC A synthesis v oge ao Ja ed Sas Tech oog synthesized c A. All the RAs in the RqA wood Or s oRqA135 uses poyA polymerization, ATP S pe Sc p RT and a special RT-polyacidification and anti-mercury. SY R Gee ER qPCR xv oge aoJa edSasTech oogy c A from the top of the reverse PCR RT - provided by the VO text reference Code RqA

://esce ce. v oge .com/ code . Quantitative PCR temperature 5 °C 2 95 C 2 95 ° C 15 , 60 C under 50 40 .

Small Rq 6 system PCR method for quantification. Anti-special mercury for RqA. Including RqA wood, 25, 10 eSc pTM anti-mercury TA A4RA medium, 0.2 TPs x anti-solution p .3 5 m T s- C 75m C 3 gC anti-hit 60° at 42C. c A SY R Gee ER qPCR x Line An PCR R A is the same.

9. She is a method. A 10x series of synthetic RqA is used as the following template for the common 佰 C 佰 of RqA at different degrees of force. Or

Weep as follows: ax+b or C a ogg anrr +b. Therefore, the same unknown can be referred to.

1

E-7a. The sequence of e-7a is 2, the RT- used therein, and the sequence of 1 and 2 in the branch. Yu. It can be seen that the RqA purpose of the branch is commonly used.

R 0.997. The state method of charcoal can be as small as 3

10 zepo oe e-7a and anti-special mercury counters have at least 7 orders of magnitude.

2

- of . - The sequence of 2 is the RT- used in it, and the sequence of 1 and 2 in the branch is 3 . At 2. It can be seen from 2 that the branch RqA purpose is commonly used 佰 C 佰 is the same as R 0.992 . It can be seen that the state method of charcoal can be as low as 4

10 - and anti-special mercury has at least 6 orders of magnitude.

3

- 2 of them. - 2 of the sequence where 2 is used in RT-, and 1 in the branch is in the sequence of 3. At 3. Can be seen by 3 The RqA purpose of the branch is usually the same as the C 佰

. From the state method of knowing charcoal can be as little as 4

10 - 2 and anti-special mercury have at least 6 orders of magnitude.

4

E-7 series R A. The mouse e-7 series includes e-7a 79 and e-7 8 Rq. Their sequences are very close to those of 4 and Table 4 4 uses e-7b g and the e-7 sequence differs from e-7a by 4 It can be seen that some RqA e-7c e-7e and the like have only one e-7a different and thus the 8 RqA functions are very large. Each of our e-7 series RqA has its own RT-, and 1, 2 of its branches, its sequence. At 4C. From the 4C point of view, the charcoal small RqA state method is very good. The godliness in 4C is obtained with the first line of force e-7a

E-7a g and e-7 get their respective C 佰 C 佰 most S phase

The force is 100% and the other RqA are obtained. It can be seen from 4C that e-7a of e-7e and non-specials other than e-7e of e-7e are less than 0.1%. The steps of interaction with the charcoal small RqA state method of special 4A.

The RT-function can be divided into small Rq ends and the inverse of the inverse anti-mercury c A at C- is divided into small RqA5 terminals and the branches 1 and 2 are mainly 1 can be divided into small RqA. Therefore, reasonable RT-, and the use of charcoal in the 1, 2, and sequence of branches can be in the small RqA sequence.

5

Charcoal's small RqA state method RqA's ability to take a break. The RqA premature is the RqA containing the mature R A sequence in which its presence may be caused by full-fledged RqA. We have e-7a - 2 and - the predecessor of their phase mature RqA continent in 4 . It can be seen that the RQA's pre-rest is not the full background noise of the mature RqA 0 R A. Therefore, the small RqA state method of charcoal RqA is better than the Taq a RqA state method Che C. Rdzo . A. Oo e A. J. zho Z. ee . . g ye J. T. abs . X . Ah Vaka V.R. A de se . R. e a.2005.Rea- eq a fca o O coRqAsbySe oopRT PCR. cec cdsRes.33:

79. 6

The ability of charcoal for small RqA state methods. At work, the small RqA state method comes from other non-small RqA. If the RqA state method in the small RqA state method is very strong, then the method RqA wood can be used instead of the car first RqA wood. Since - 2 is very high in the middle table and low in other fines, we studied non-RqA wood - 2 in 5 . 5A is different respect

4

10, 10, 10 of -122 are different under 0 5 00 2 g of RqA wood and 5 are different from each other. 10, 10, 10 of -122 are in g from different R, A, and myocardium and RqA wood. It can be seen from the above that the small R A state method of charcoal has a strong ability of not more than 2 g of RqA wood. Therefore, the small RqA state method of charcoal can be connected to RqA wood.

7

The small RqA state method of charcoal is connected to RqA wood. Wood has an old mouse lung RqA wood in e-7a, RqA wood -, medium -122, medium - 0, and ovary -3 at 6. 6 can be found in the continent of RqA wood 0. 5 9 to 5 g have a magnitude of 4 and C 佰 R A wood has a good R >0.990. It can be seen that the small R A state method of charcoal is also very good in RqA wood.

8 Small RqA state methods using charcoal R A in different. Wood has a mouse 12 different in the middle -122 - , - 50 -143 at 7 and e-7a at 8 level. The homologous co e RT-PCR method is compared. The state method of the cell containing 15pg of RqA wood charcoal -122 is mainly in the middle of the cell 30000 - the main table in the heart cell 190000 and skeletal muscle cells 500000

- 0 main table in the middle of cells 22000. Conversely, -143 and e-7a have a lot of fine tolerance. Their surface varies from 50 to 3000 in each cell.

The system codeRT-PCR method has also been similar.

9

Charcoal RqA State Method RT-PCR Quantitative Polymerization Reverse Comparison of RqA in the State. In the quantitative polymerization, the different wood RA phases are internalized in The quantification of RA is very high. Small Rq s R 6 was used to force RqA or other RqA continents. We used a small RqA state method in charcoal, and the level of 6 in cells of 12 RT cells in RT CR rats was 9. 9 It can be seen that the RT R of the small RqA state method of charcoal is very close. Recently, there have been studies on small RqA such as s oR A 135 and R A- for RqAqRT-PCR. The internal R6A method is the same as the small RqA state method with charcoal and the co-RT-PCR in the 12 cells of the mouse. The levels of oR A135 and R A- are very similar to those obtained by the 9 method. A small RqA state method indicating charcoal can be used to quantify small Rq schedules in different cells.

. . . .

e de g edO gO e O d A e pae pepaa O

A A sequence

P e 7a ow d TAATACGACTCACTATAGGGATTCACTGTGGGATGAGGTAGTAGG

Co gT7 TTGTATAGTTTTAGGGTCACACCC

Po oe

Pe-7a-eve se ATCACCTTAGGAAAGACAGTAGATTGTATAGTTATCTCCCAGTGG

TGGGTGTGACCCTAAAAC

Pe- -1 o wad TAATACGACTCACTATAGGGAGCTTGGGACACATACTTCTTTATA

Co a gT7 TGCCCATATGAACC

Po oe

Pe- -1-eve se GCCTGAAATACATACTTCTTTACATTCCATAGCTTAGCAGGTTCA

TATGGGCATATAAA

Pe- -122-owad TAATACGACTCACTATAGGGAAGCTGTGGAGTGTGACAATGGT

Co a gT7 GTTTGTGTCCA

Po oe

Pe- -122-eve se AGCTATTTAGTGTGATAATGGCGTTTGATGGTTTGGACACAAAC

ACCATTGTCACACTC

Fow d AO go e Co a apor o O eq e ce Co pe e o eve e AO go e g g ed bod. 2. The sequence of R 』A oR』A 5 and 6 R 』A used in the present specification

sequence

-e-7a GAGG AG AGG G A AG

-e-7b GAGG AG AGG G G GG

-e-7c GAGG AG AGG G A GG

-e-7d AGAGG AG AGG GCA AG

-e-7e GAGG AGGAGG G A AG

-e-7 GAGG AG AGA G A AG

-e-7g GAGG AG AG G ACAG

-e-7 GAGG AG AG G GC G

- R-1 GGAA G AAAGAAG A G A

122 GGAG G GACAA GG G G

143 GAGA GAAGCAC G AGC CA 50 C CCCAACCC G ACCAG G

9 CAACGGAA CCCAAAAGCAGC G

C AAAA AGC GGAA ACCGGCAGA GG

s oR A135 AG GG GAGCC A GG C GAAG

G GC CGC CGGCAGCACA A AC AAAA GGA ACGA ACAGAGAAGA AGCA GGCCCC GCGCAA

6s R A GGA GACACGCAAA CG GAAGCG CCA A 3. R′A oR』A135 6 R A , A , RA4 sequence mR A P me s sequence

RT-p e

E-7a B dgepobe CTCTCAGACAATCAGTGAGGTAGTAGGAAC

P e 1 GTAAAGCTGAGACATGACG

P e 2 GGCTCAGTGAACTATACAAC

RT-p e

B dgepobe CTCTCAGACAATCAGTGAGGTAGTAGGAAC

P e 1 GTAAAGCTGAGACATGACG

1 7b P e 2 GGCTCAGTGAACCACACAA

RT-p e

B dgepobe CTCTCAGACAATCAGTGAGGTAGTAGGAAC

P e 1 GTAAAGCTGAGACATGACG

E-7c P e 2 GGCTCAGTGAACCATACAAC

RT-p e

B dgepobe CTCTCAGACAATCAGAGAGGTAGTAGGAAC

P e 1 GTAAAGCTGAGACATGACG

1 7d P e 2 GGCTCAGTGACTATGCAAC

RT-p e

B dgepobe CTCTCAGACAATCAGTGAGGTAGGAGGAAC

P e 1 TAAGTGTAAAGCTGAGAC

E-7e P e 2 CAGTGACTATACAACCTC

RT-p e

B dgepobe CTCTCAGACAATCAGTGAGGTAGTAGGAAC

P e 1 GTAAAGCTGAGACATGACG

E-7 P e 2 GGCTCAGTGAACTATACAAT

RT-p e

B dgepobe CTCTCAGAACAATCAGTGAGGTAGTAGAA

P e 1 GTAAAGCTGAGACATGAG

E-7g P e 2 GGCTCAGTGACTGTACAA

RT-p e

E-7 B dgepobe CTGGAGTCAGACAATCACTGAGGTAGTAGAA

4. Mature RA detection of the pre-rest phase of e 7a RA 2 RA

Synthesis m A synthesis m A premature m ACT copy ) copy )

E-7a 1 X 10 17.68

X X

X

1X10 X 17.40 1X10 X 17.92 1X10 X 16.73

1X10 15.15 -1 1

1X1 25.82 1X1 26.66 1X1 27.43 ( oe ec o cf CT 80 -122 R A122 -1 R A-1

Claims

DN line security quantitative branch.

2. The method of claim 1 for the small N of the known sequence is characterized by at least a portion of the sequence of the first and second sequence DNs.

3. The method of claim 2 for small N of the known sequence is characterized in that at least a portion of the sequence of small N is derived from the sequence DN of the first and second species.

4. Any method of requesting a small N of the known sequence of 1 3 is characterized by at least a portion of the sequence of the small N 3 terminus of the T species.

5. The method of claim 1 or 4 of the small N of the known sequence is characterized by the inclusion of a small N-supplemented N-wood, N-wood, cell extract, intact cell, extract or Hume.

6. The small N of the known sequence consists of a sequence comprising T, a first DN polymer, a nucleic acid, a DN, a polymer, a first and a second of the branch, and a sequence comprising at least a portion of the sequence comprising a small N. The first DN is polymerized in the N of the N-inverse mercury in the N DN, and the DN DN is connected end to end. At least a portion of the sequence can be obtained by the release DN DN connected to the gap of the DN to obtain the DN polymerization and the first and second DN branches.

7. The small N of the known sequence of claim 6 is characterized by at least a portion of the sequence of the first and second sequence DN.

8. The small N of the known sequence of claim 7 is characterized in that at least a portion of the sequence of small N is derived from the sequence DN of the first and second species.