CN101633957A - Method and kit for detecting small RNA - Google Patents

Method and kit for detecting small RNA Download PDF

Info

Publication number
CN101633957A
CN101633957A CN200910100272A CN200910100272A CN101633957A CN 101633957 A CN101633957 A CN 101633957A CN 200910100272 A CN200910100272 A CN 200910100272A CN 200910100272 A CN200910100272 A CN 200910100272A CN 101633957 A CN101633957 A CN 101633957A
Authority
CN
China
Prior art keywords
primer
rna
single stranded
stranded dna
little rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN200910100272A
Other languages
Chinese (zh)
Inventor
席建忠
姚波
李娟�
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHAOXING INSTITUTE OF TECHNOLOGY COLLEGE OF ENGINEERING PKU
Original Assignee
SHAOXING INSTITUTE OF TECHNOLOGY COLLEGE OF ENGINEERING PKU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHAOXING INSTITUTE OF TECHNOLOGY COLLEGE OF ENGINEERING PKU filed Critical SHAOXING INSTITUTE OF TECHNOLOGY COLLEGE OF ENGINEERING PKU
Priority to CN200910100272A priority Critical patent/CN101633957A/en
Publication of CN101633957A publication Critical patent/CN101633957A/en
Priority to PCT/CN2010/000945 priority patent/WO2010148651A1/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/30—Oligonucleotides characterised by their secondary structure
    • C12Q2525/307—Circular oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay

Abstract

The invention relates to a method and a kit for detecting a small RNA, belonging to the field of detection of small RNAs. The method for detecting the small RNA comprises the following steps: 1. hybridizing an RT-primer and a target small RNA; 2. reversely transcribing; 3. connecting the head and the tail of a reversely transcribed DNA chain to form a ring by the mediation of a bridge probe; and 4. carrying out branch amplification real-time quantitative detection under the actions of DNA polyase, a first primer and a second primer. The method for detecting the small RNA has the advantages of high sensitivity, large dynamic range, high interference resistance, and the like and has wide application prospect in a plurality of fields of scientific experiment, clinical diagnosis, spot test, benchmark test, and the like relevant to the small RNA.

Description

Be used to detect method and the test kit of little RNA
Technical field
The present invention relates to the detection range of little RNA.
Background technology
Little RNA is (the noncoding RNA of non-coding RNA family, abbreviation ncRNA) important component part in, comprise Microrna (microRNA or miRNA), small-sized RNA interfering (siRNA), small nuclear rna, hour preface RNA, piwi protein binding RNA (piRNA) etc.Discover little RNA growth, growth, the differentiation of cell, tissue etc. in vivo, even aspect performance crucial effects such as the invasion of the generation of disease and virus and defence.The mode that little RNA plays a role also is varied, and they both can pass through modifying DNA direct regulation and control expression of gene, also can wait the proteic amount or the like of regulating by the stability that changes gene transcript.And in various types of little RNA, Microrna is again that function is of paramount importance a kind of.
Microrna is that the endogenous length of organism is a kind of non-coding RNA molecule of 18-25 Nucleotide.They are distributed in the different organs widely, mainly are by on post-transcriptional level expression of gene being carried out negative regulation with the complementary pairing of said target mrna, causing the degraded of mRNA or translation to suppress.In the past decade, scientists from the marine alga to the animal body in isolation identification gone out thousands of kinds of conservative and nonconservative miRNA.Though a lot of evidences clearly illustrate that miRNA serves as very important role in cell proliferation, differentiation, apoptosis, growth, tumour generation, metastases and virus infection or the like a series of biological procedureses, we to the understanding of miRNA physiologic function also seldom.In addition, a large amount of miRNA that discover finely tune by the target mRNA to them to realize its physiological function, thereby, miRNA is carried out accurate, quantitative analysis just become to understand pressing for of miRNA physiologic function.
Yet because miRNA is very short, and has closely similar sequence (for example let-7 family series) between some miRNA members, detecting miRNA is a very challenging job.Scientists has been carried out number of research projects in this field, and developed a series of miRNA detection method, as Northern blotting (Lee, R.C., Feinbaum, R.L.and Ambros, V.1993.The C.elegans Heterochronic Gene lin-4 Encodes Small RNAs withAntisense Complementarity to lin-14.Cell 75:843-854.; Pfeffer, S., Sewer, A., Lagos-Quintana, M., Sheridan, R., Sander, C., Grasser, F.A, van Dyk, L., Ho, C., Shuman, S., Chien, M., et al.2005.Identification of microRNAs of the herpesvirus family.Nature Methods 2:269-276.), infect detection (Allawi, H.T., Dahlberg, J.E., Olson, S., Lund, E., Olson, M.and Ma, W.P.2004.Quantitation ofmicroRNAs using a modified Invader assay.RNA 10:1153-1161.), clamping plate connect (SplintedLigation) (Maroney, P.A., Chamnongpol, S., Souret, F.and Nilsen, T.W.2007.A rapid, quantitative assay for direct detection of microRNAs and other small RNAs using splinted ligation.RNA 13:930-936.), detection method (Weinholds based on the LNA probe, E., Kloosterman, W.P., Miska, E., Alvarez-Saavedra, E., Berezikov, E., Bruijn, E.de, Horvitz, H.R., Kauppinen, S.and Plasterk, R.H.A.2005.MicroRNA Expression in Zebrafish Embryonic Development.Science 309:310-311.; Kloosterman, W.P., Weinholds, E., Bruijn, E.de, Kauppinen, S.and Plasterk, R.H.A.2006.In situ detection of microRNAs in animal embryos using LNA modified oligonucleotide probes.Nat.Methods 3:27-29.) compare with above-mentioned several method, some real-time RT-PCR methods are owing to have very high sensitivity and specificity, become main method (Chen, C., the Ridzon of miRNA quantitative analysis just gradually, D.A., Broomer, A.J., Zhou, Z., Lee, D.H., Nguyen, J.T., Barbisin, M., Xu, N.L., Mahuvakar, V.R., Andersen, M.R., et al.2005.Real-time quantification of microRNAs by stem-loop RT-PCR.Nucleic Acids Res.33:e179.; Shi, R.and Chiang, V.L.2005.Facile means for quantifying microRNA expression by real-time PCR.Bio techniques 39:519-525.; Raymond, C.K., Roberts, B.S., Garrett-Engele, P., Lim, L.P.andJohnson, J.M.2005.Simple, quantitative primer-extension PCR assay for direct monitoring ofmicroRNAs and short-interfering RNAs.RNA 11:1737-1744; Li, J., Yao, B., Huang, H., Wang, Z., Sun, C., Fan, Y., Chang, Q., Li, S., Wang, X., Xi, J..Real-time PCR microRNA detection based onenzymatic stem-loop probes ligation.Anal Chem.DOI:ac900598d (in press)).
Except that the RT-PCR technology, rolling circle amplification (Rolling Circle Amplification, RCA) be a kind of under specific archaeal dna polymerase effect, the novel isothermal dna amplification technique (Lizardi of short single-stranded cyclic DNA molecule is duplicated in rolling, P.M., Huang, X., Zhu, Z., Brayward, P., Thomas, D.C.and Ward, D.C.1998.Mutation detection andsingle-molecule counting using isothermal rolling circle amplification.Nature genetics 19:225-232.; Zhang, D.Y., Brandwein, M., Hsuih, T.C., Li, of target-specific H.1998.Amplification, ligation-dependent circular probe.Gene 211:277-285.).Compare with traditional round pcr, RCA has been proved to be in target dna, mRNA even proteinic a series of detection has advantage.People such as Jonstrup are based on padlock probe (Padlock Probe) and rolling circle amplification (Rolling Circle Amplification, RCA) technology, develop the detection system that a cover miRNA, in this system, target miRNA molecule serves as the media of padlock probe cyclisation and the precursor (Jonstrup of RCA simultaneously, S.P., Koch, J.and Kjems, J.2006.A microRNA detection system based on padlockprobes and rolling circle amplification.RNA 12:1747-1752.).Recently, people such as Cheng is by using the sensitivity that divides branched rolling circle amplification (branched-RCA) technology to improve this method.We know that the single Nucleotide mispairing in mid-way is easy to be connected identification by C-probe (C-probe) usually, but the mispairing of end position then may cause relatively poor discriminating.In addition, tell the similar miRNA (as let-7 series) of one group of height simultaneously and realize remaining a difficult task as specificity only by ligase enzyme itself.
Summary of the invention
Purpose of the present invention provides a kind of little RNA detection kit that is easy to prepare just in order to solve the problems of the technologies described above, and use this test kit detect little RNA simply, highly sensitive, highly accurately and low cost method.
In the present invention, term " little RNA " refers to the less RNA of Nucleotide number, include but not limited to Microrna (microRNA, abbreviation miRNA), small-sized RNA interfering (short interfering RNA, abbreviation siRNA), small nuclear rna (small nuclear RNA, be called for short snRNA), the RNA (Piwi-interacting RNA is called for short piRNA) of hour preface RNA (small temporal RNA is called for short stRNA), the effect of piwi albumen etc.That relate in the embodiments of the invention mainly is miRNA, but those skilled in the art will envision that, detection probes of the present invention and use the method for the little RNA of this probe in detecting to be not limited to miRNA, and should be understood to " little RNA " defined above.
The RT-PCR primer is meant a kind of primer, its contain with the little RNA of target in sequence complementary recognition sequence, except that recognition sequence, other partial sequences of RT-PCR primer there is no particular requirement, its 5 ' end by phosphorylation so that in follow-up Connection Step, form an annular single stranded DNA.
Bridge probe (also claiming C-probe, DNA bridge probe among the present invention) is a kind of probe, it contains and can hold the complementary recognition sequence with the 5 ' end and 3 ' of RT-primer reverse transcription product (promptly hereinafter alleged " single stranded DNA "), thereby after bridge probe and the hybridization of RT-primer reverse transcription product, 5 ' the end and the 3 ' end of RT-primer reverse transcription product are in position adjacent, by the effect of dna ligase, RT-primer reverse transcription product just can DNA annulus of end to end formation.
The RAM primer is branch augmentation (Ramification Amplification, the RAM) primer of Xu Yaoing, two (being the present invention's alleged " first primer " and " second primer ") altogether.
The present invention realizes by the following technical solutions.Preparation comprises the system of the little RNA of target, and this system can be any system that comprises the little RNA of target, for example can be the RNA sample of separate purifying, total RNA sample, cell extract, complete cell, tissue extract or in-vitro transcription reaction product etc.Design and synthesize the RT-primer, this RT-primer has one section recognition sequence, this recognition sequence can with a part of sequence complementary pairing of the little RNA of target.Preferably, one section sequence complementary pairing holding of one section recognition sequence of 3 ' of RT-primer end and the little RNA 5 ' of target.In this step, do not comprise can with the nucleic acid molecule of the sequence of RT-primer complementary pairing can not with the RT-primer hybridization, thereby be excluded, can not enter again in the follow-up detection step, and the little RNA of target will with RT-primer complementary pairing, form the hybridization product, this hybridization product is under the effect of archaeal dna polymerase, with the little RNA of target is that template is carried out reverse transcription, synthesizes the complementary strand of the little RNA unpaired nucleotide of target sequence, thereby obtains RNA-DNA hybridization chain (referring to Figure 1A).So far, the information of the nucleotide sequence of the little RNA of target all is transferred on the RT-primer, decompose the little RNA of target in the RNA-DNA hybridization chain with rnase, thereby (this single stranded DNA comprises two portions sequence to obtain single stranded DNA, a part is from the RT-primer, and another part is from being the reverse transcription of template with the little RNA of target).If with this single stranded DNA end to end (promptly 5 ' end with 3 ' end join), will form a DNA annulus, design and synthesize a bridge probe, the part or all of sequence of this bridge probe can with a part of sequence complementation that comprises tie point of above-mentioned dna circle.After adding this bridge probe in the system that contains above-mentioned single stranded DNA, the bridge probe will be hybridized with single stranded DNA, make annulus of the end to end formation of single stranded DNA, obtain open bridge probe-single stranded DNA hybridization product.Why be called " open " bridge probe-single stranded DNA hybridization product, be because 5 ' end of single stranded DNA wherein really is not connected by chemical bond with 3 ' end, and only be owing to being in more close position with the bridge probe hybridization.Because 5 ' end of single stranded DNA is closer to each other with 3 ' end, under the effect of dna ligase, thereby 5 ' end just is easy to form the ring that new phosphodiester bond forms a closure with 3 ' end, and the hybridization product that dna circle that we are closed with this and bridge probe form is called " closed bridge probe-single stranded DNA hybridization product " (Figure 1A).To further exclude the little RNA of non-target with this step of bridge probe hybridization, this is because some isonomic little RNA sequence is very similar, 1-4 the nucleotide sequence identical (table 2 and Fig. 4 B) held of 2-5 nucleotide sequence of the let-7a 3 ' of mouse end and let-7d 3 ' for example, if the recognition sequence of RT-primer is below 5 from 3 ' end beginning and the few nucleotide of let-7a, then the both can and can both carry out subsequently reverse transcription with the RT-primer hybridization, but in subsequently and the step bridge probe hybridization, since the first Nucleotide of 5 ' end of let-7d just with (Fig. 4 B) inequality of let-7a, let-7d can not form open bridge probe-single stranded DNA hybridization product with the bridge probe hybridization, thereby let-7d will be excluded away (Fig. 4 A) in this step.Next the closed bridge probe-single stranded DNA hybridization product that is obtained is carried out real-time quantitative branch augmentation (Ramification Amplification) and detects, this process need archaeal dna polymerase and two primers (being called first primer and second primer), preferably, have at least in two primers do not join in the sequence of a primer (for example first primer) and the closed bridge probe-single stranded DNA hybridization product to and be derived from part or all nucleotide sequence complementation of the little RNA of target, can exclude further like this through preceding twice screening and remain the little RNA of non-target that gets off.For instance, let-7a is identical with the nucleotide sequence of let-7f 5 ' end and 3 ' end, only be a Nucleotide (table 2 and Fig. 4 B) inequality that mediates,, then still let-7f and let-7a can not be made a distinction if let-7a is carried out above-mentioned detection.Be in the mid-way of let-7a among the let-7a with the different Nucleotide of let-7f, after having carried out above-mentioned two steps, be in circular ssdna do not join to and the nucleotides sequence that is derived from the little RNA of target list, therefore at this section nucleotide sequence design needed first primer of real-time quantitative branch augmentation (or second primer), then first primer (or second primer) can only combine with the closed bridge probe that obtains based on let-7a-single stranded DNA hybridization product, thereby have only when having let-7a in the system, the fluorescent signal that branch augmentation just can occur, so the primer of branch augmentation has further improved the specificity of little RNA detection method of the present invention.
As mentioned above, little RNA detection method of the present invention is by the screening of RT-primer, bridge probe and three steps of RAM primer (first primer or second primer), make little RNA detection method of the present invention have very high sensitivity, can will only there be a different little RNA of Nucleotide to make a distinction, and mature rna and their corresponding precursor can be made a distinction, use the little RNA detection method of the present invention can be to few to 10 3The little RNA of individual (zeptomole) carries out detection by quantitative.Little RNA detection method of the present invention has the potential using value owing to have very high sensitivity, very strong specificity and very wide dynamicrange in a lot of fields such as medical diagnosis analysis, benchmark test and on-the-spot test.
Technical solution of the present invention is summarized as follows:
1. a method that is used to detect the little RNA of known array is characterized in that this method comprises the steps:
(1) system that will comprise the little RNA of target contacts with the RT-primer, described RT-primer comprise can with at least a portion sequence complementary recognition sequence of the little RNA of target, thereby at least a portion sequence complementary pairing of described recognition sequence and the little RNA of target;
(2) under the effect of first archaeal dna polymerase, be that template is carried out reverse transcription with the little RNA of target, synthesize the complementary strand of the little RNA unpaired nucleotide of target sequence, thereby obtain RNA-DNA hybridization chain;
(3) decompose target RNA in the RNA-DNA hybridization chain that step 2 obtains with rnase, thereby obtain single stranded DNA;
(4) single stranded DNA that step 3 is obtained contacts with the bridge probe, after described single stranded DNA is end to end, comprise tie point a part of sequence can with at least a portion sequence complementation of described bridge probe, thereby obtain open bridge probe-single stranded DNA hybridization product;
(5) under the effect of dna ligase, the breach sealing in the open bridge probe that step 4 obtains-single stranded DNA hybridization product, thus obtain closed bridge probe-single stranded DNA hybridization product;
(6) under the effect of second archaeal dna polymerase and first primer and second primer, closed bridge probe-single stranded DNA hybridization product that step 5 is obtained carries out the real-time quantitative branch augmentation.
2. according to the 1st the described method that is used to detect the little RNA of known array, it is characterized in that not joining right at least a portion nucleotide sequence complementation in the sequence of first primer and/or second primer and the closed bridge probe-single stranded DNA hybridization product.
3. according to the 2nd the described method that is used to detect the little RNA of known array, it is characterized in that being derived from the sequence of first primer and/or second primer and the closed bridge probe-single stranded DNA hybridization product at least a portion nucleotide sequence complementation of the little RNA of target.
4. according to any described method that is used to detect the little RNA of known array of 1-3 item, it is characterized in that described RT-primer recognition sequence can with at least a portion sequence complementation of the little RNA 3 ' end of target.
5. according to the described method that is used to detect the little RNA of known array of the 1st or the 4th, it is characterized in that the described system that comprises the little RNA of target is selected from separates the RNA sample of purifying, total RNA sample, cell extract, complete cell, tissue extract or in-vitro transcription reaction product.
6. a test kit that is used to detect the little RNA of known array is characterized in that this test kit comprises RT-primer, first archaeal dna polymerase, rnase, bridge probe, dna ligase, second archaeal dna polymerase, is used for first primer of branch augmentation and the working instructions of second primer and this test kit; Described RT-primer comprise can with at least a portion sequence complementary recognition sequence of the little RNA of target, first archaeal dna polymerase is used for the reverse transcription of the little RNA of target, rnase is used for the target RNA of degradation of rna-DNA hybridization chain to obtain single stranded DNA, after single stranded DNA is end to end, comprise tie point a part of sequence can with at least a portion sequence complementation of bridge probe, thereby can obtain open bridge probe-single stranded DNA hybridization product, dna ligase is used for the breach sealing with open bridge probe-single stranded DNA hybridization product, thereby can obtain closed bridge probe-single stranded DNA hybridization product, second archaeal dna polymerase and first primer and second primer can carry out branch augmentation to closed bridge probe-single stranded DNA hybridization product.
7. detect the test kit of the little RNA of known array according to the 6th be used to, it is characterized in that unpaired at least a portion nucleotide sequence complementation in the sequence of first primer and/or second primer and the closed bridge probe-single stranded DNA hybridization product.
8. detect the test kit of the little RNA of known array according to the 7th be used to, it is characterized in that being derived from the sequence of first primer and/or second primer and the closed bridge probe-single stranded DNA hybridization product at least a portion nucleotide sequence complementation of the little RNA of target.
Description of drawings
Sensitivity and dynamicrange (B) when Fig. 1 little RNA detection method synoptic diagram of the present invention (A) and detection let-7a
Sensitivity and dynamicrange when Fig. 2 uses little RNA detection method of the present invention to detect mir-1
Sensitivity and dynamicrange when Fig. 3 uses little RNA detection method of the present invention to detect mir-122
Fig. 4 little RNA detection method of the present invention has the principle schematic (A) of high specific and detects let-7 series miRNA figure (B) as a result
Fig. 5 little RNA detection method of the present invention is to the anti-interference test of total RNA sample figure as a result
Dynamicrange figure when Fig. 6 little RNA detection method of the present invention is directly used in total RNA pattern detection
Fig. 7 little RNA detection method of the present invention detects mir-122, mir-1, mir-150 and mir-143 in 12 kinds of different tissues of mouse
Figure (ht: heart as a result; Lv: liver; Sp: spleen; In: lung; Kd: kidney; Thy: thymus gland; Co: colon; Ov: ovary; Ts: testis; Br: brain; Pan: pancreas; Sm: skeletal muscle).Simultaneously with commercially produced product Ncode TMThe RT-PCR method has been done comparative analysis.
Fig. 8 little RNA detection method of the present invention detects in 12 kinds of different tissues of mouse let-7a figure as a result.Simultaneously with commercially produced product Ncode TMThe RT-PCR method has been done comparative analysis.
Little RNA detection method among Fig. 9 the present invention and traditional RT-PCR are to the U6 expression level detected result figure in 12 kinds of histocytes in the mouse body.While is with regard to the detection of snoRNA135 and mir-191, little RNA detection method and commercially produced product Ncode among the present invention TMThe RT-PCR method has been done comparative analysis.
Embodiment
Below will the present invention be described, but these specific embodiments not should be understood to limitation of the present invention, some details is made amendment and will still be fallen within protection scope of the present invention by specific embodiment.
Material and method
1. ripe miRNA, miRNA precursor, probe and primer.The nucleotide sequence of ripe miRNA such as let-7 series, mir-122, mir-1, mir-143, mir-150 and mir-191 and precursor thereof be selected from Sanger Center miRbase ( Http:// microrna.sanger.ac.uk/sequences), and the sequence of snoRNA 135 and U6 from ncbi database ( Http:// www.ncbi.nlm.nih.gow) obtain.Ripe synthetic miRNA buys from Shanghai Ji Ma company (Shanghai GenePharma), and all miRNA precursors are by in-vitro transcription method preparation (seeing Table 1).
All dna probes and primer are all available from Invitrogen company (Chinese Shanghai).Oligonucleotide polyacrylamide gel electrophoresis purifying, its nucleotide sequence is listed in table 2 and table 3.(MA USA) measures at the absorption reading of 260 nanometers the concentration of nucleic acid for ND-100, ThermoFisher by the NanoDrop spectrophotometer.
2. tissue preparation and total RNA extract.The specification sheets that provides with reference to producer, use TRNzol reagent (Cat# DP405-02, Tiangen, China, Beijing) to 8 weeks big mouse the organ of choppings such as heart, intestines, liver, spleen, lung, kidney, thymus gland, colorectal carcinoma, ovary, testis, brain, pancreas and skeletal muscle extract, to obtain total RNA sample.Briefly, 50 to 100 milligrams of tissue samples fully are distributed in the 1mL TRNzol reagent; Then, add the 0.2mL chloroform in every 1mL TRNzol reagent, the sample thorough mixing was also at room temperature cultivated 2-3 minute in 15 seconds; Sample centrifugation 15 minutes under 4 ℃, 12,000 * g under the situation of not disturbance bottom material, is transferred to upper solution in the new test tube carefully; Adding is with the Virahol of volume and mix; Sample was hatched 20 minutes and centrifugation 10 minutes under 4 ℃, 12,000 * g at 15-30 ℃; After the centrifugation, supernatant liquor is removed totally, the RNA throw out is with twice of 75% washing with alcohol.At last, the RNA throw out is air-dry and spend nucleic acid water (nuclease-free water) dissolving.All animal programs are all with reference to the regulation execution of " management of laboratory animal and the use council (Institutional Animal Care and Use Committee, IACUC) " and " Organization for Economic Cooperation and Development (OECD) ".
3.dsDNA the preparation of template.The DNA oligomer of 50pmol is hatched at 75 ℃ and was annealed in 5 minutes, slow then cool to room temperature (about 30 minutes).The reaction of preparation dsDNA template is to contain 10mM Tri(Hydroxymethyl) Amino Methane Hydrochloride (Tris HCl), 50mM NaCl, 10mM MgCl 2, 1mM dithiothreitol (DTT) (DTT), 25 μ M dNTPs and 5UKlenow Fragment (3 '-5 ' exo) (New England BioLabs, Eastwin Scientific, China) 20-μ L volume in, keep carrying out in one hour at 37 ℃.Then, reaction mixture is heated to 75 ℃ and keeps making enzyme deactivation in 20 minutes, and slowly cools to room temperature so that dsDNA annealing.
4. in-vitro transcription reaction.The above-mentioned dsDNA template mixture of 20 μ L joins 30 μ L and contains 0.5mM NTPs, 40mMTris-HCl, 6mM MgCl 2, 10mM DTT, 2mM spermidine, 40-200U ribonuclease inhibitor (RibonucleaseInhibitor (TAKARA, China, and 50 U T7 RNA polymerase (New England BioLabs Dalian)), EastwinScientific, China) in the in-vitro transcription buffer reagent, be reflected at 37 ℃ and carried out 4 hours.After this, add 1U not the DNase I of qiagen rnase enzyme (RNase-free) (Fermentas, China, Shenzhen) with the dna digestion template.Use phenol/chloroform that unnecessary salt and protein are carried out extraction treatment with the miRNA precursor in the purifying responsive transcription mixture at last.Transcribe the miRNA precursor of finishing and detect with 2% sepharose, concentration is determined by the absorption of using NanoDrop spectrophotometric determination 260nm place.
5. phosphorylation and reverse transcription reaction.Before the miRNA reverse transcription, 5 ' end of RT-primer need carry out phosphorylation modification.0.5nmol RT-primer is heated to 75 ℃ and kept 5 minutes, freezing on ice before handling then with kinases.The reaction volume of 50 μ L contains 50mM Tris-HCl (pH 8.0), 10mM MgCl 2, 5mM DTT, 1mMATP, 20U T4 polynueleotide kinase (TAKARA, China, Dalian) and dna probe, this reaction system was placed 2 hours at 37 ℃.Hatch at 65 ℃ at last and made T4 polynueleotide kinase inactivation in 20 minutes.
ThermoScript II reaction from miRNA to cDNA is what to carry out in the reaction volume of 10 μ L, and this reaction system contains the total RNA sample of 1 μ L, 50nM 5 '-phosphorylation RT-primer, 20U PrimeScript TM(pH 8.3,50mM Tris-HCl, 75mM KCl and 3mMMgCl for ThermoScript II (TAKARA, China, Dalian), 50 μ M dNTPs and 1 * reaction buffer 2), this system was kept 30 minutes down at 41 ℃.Add 2.5U ribonuclease H (Fermentas, China, Shenzhen) then and handle 20 minutes with the miRNA in degradation of rna-DNA hybridization chain at 37 ℃.
6.C-the connection of probe.The mixture of 10 μ L reverse transcription products and the formation of 1 μ L bridge probe (10 μ M) was heated 2 minutes at 95 ℃, slowly cool to room temperature then to form open C-probe hybridization product.Preparation comprises 20mM Tris-HCl (pH 7.6), 25mM KAc, 10mM Mg (Ac) 2, 10mM DTT, 1mM NAD and 0.1% Triton X-100, cumulative volume is the reaction buffered soln portion of 20 μ L, toward wherein adding thermophilic Taq dna ligase (the New EnglandBioLabs of 10U, Eastwin Scientific, China) and the open C-probe hybridization product that obtains above and 55 ℃ of reactions 45 minutes so that the breach sealing in the C-probe.
7. RAM detects in real time.The isothermal amplification volume is 25 μ L, connects product mixtures, primer 1 and primer 2 each 1.2 μ M, 100 μ M dNTPs, 20mM Tris-HCl (pH 8.8), 10mM KCl, 10mM (NH comprising 1 μ L 4) 2SO 4, 2mM MgSO 4, 0.1%Triton X-100,6% dimethyl sulfoxide (DMSO), 6 μ L, 1 * SYBR Green I dyestuff (Bio-Vision, Chinese) and the big fragment of 6.4U Bst DNA (large fragment) polysaccharase (New England BioLabs, EastwinScientific, China).Reaction system is hatched in 96-well dish, under 65 ℃, and (USA) per 25 seconds one-period are monitored 100 circulations in real time for Bio-RadLaboratories, CA with Opticon2 DNA Engine.Institute responds and all carries out 3 times.Critical cycle is counted C TThe mark cycle number of correspondence when being defined as the threshold value that fluorescence intensity surpass to set.
8.Ncode TMRT-PCR and traditional PCR in real time detect.For using real-time PCR method to quantize the expression level of miRNA, adopted NCode TMVILO TMMiRNA cDNA synthetic agent box (Invitrogen, Mao Jian United StarsTechnology, China) has synthesized cDNA.Briefly, in a reaction, all miRNA in total RNA sample or snoRNA 135 use poly A polysaccharase, ATP, SuperScript TMIII RT and a specially designed pervasive RT-primer carry out polyadenylic acidization and reverse transcription.Adopt
Figure G2009101002728D00091
Green ER TMQPCR Mix (Invitrogen, Mao JianUnited Stars Technology, China) carries out the PCR in real time amplification to the cDNA that is obtained by above-mentioned reaction; Pervasive RT-primer is by VILO TMTest kit provides, and sense primer is with reference to NCode TMMiRNA database (http://escience.invitrogen.com/ncode) design.Quantitatively the temperature cycle condition of PCR in real time is: 50 ℃ 2 minutes, 95 ℃ 2 minutes, 95 ℃ following 15 seconds, 60 ℃ were carried out 40 circulations in following 50 seconds.
Small nuclear rna U6 adopts traditional real-time PCR method to carry out quantitatively.Total RNA adopts primer at random to carry out reverse transcription.Comprise total RNA sample, 25nM random primer, 100U PrimeScript TM(pH 8.3,50mM Tris-HCl, 75mM KCl, 3mM MgCl for ThermoScript II (TAKARA, China, Dalian), 0.25mM dNTPs and 1 * reaction buffered soln 2) 20 μ L reaction volumes under 42 ℃, hatched 60 minutes.CDNA adopts
Figure G2009101002728D00092
Green ER TMQPCR Mix carries out the PCR in real time amplification, and loop parameter is identical with the process of miRNA.
9. data processing method.The synthetic miRNA of 10 times of dilution series is used as the standard form as lower curve: transverse axis is the denary logarithm value of miRNA under the different dilute strengths, and the longitudinal axis is corresponding C TValue.Linear regression curve or typical curve make up by following equation: y=ax+b or C T=a (log quantity)+b.Thus, the unknown sample concentration under the same detection just can be determined by the reference standard curve.
Embodiment 1
The detection of let-7a.The nucleotide sequence of let-7a sees Table 2, and the primer 1 in the RT-primer that uses in its detection process, bridge probe and the branch augmentation, the nucleotide sequence of primer 2 see Table 3.Detected result is shown in Figure 1B.By Figure 1B as can be seen, transverse axis of branch augmentation curve (the denary logarithm value of initial miRNA number) and longitudinal axis C TPresent perfect linear relationship (R between the value 2=0.997).As seen from the figure, detection method of the present invention can detect few to 10 3Individual (zeptomole) let-7a molecule, and it has the dynamicrange of at least 7 orders of magnitude to each reverse transcription reaction.
Embodiment 2
The detection of mir-1.The nucleotide sequence of mir-1 sees Table 2, and the primer 1 in the RT-primer that uses in its detection process, bridge probe and the branch augmentation, the nucleotide sequence of primer 2 see Table 3.Detected result is shown in Fig. 2.As seen from Figure 2, transverse axis of branch augmentation curve (the denary logarithm value of initial miRNA number) and longitudinal axis C TPresent good linear relationship (R between the value 2=0.992).As seen from the figure, detection method of the present invention can detect few to 10 4Individual mir-1 molecule, and it has the dynamicrange of at least 6 orders of magnitude to each reverse transcription reaction.
Embodiment 3
The detection of mir-122.The nucleotide sequence of mir-122 sees Table 2, and the primer 1 in the RT-primer that uses in its detection process, bridge probe and the branch augmentation, the nucleotide sequence of primer 2 see Table 3.Detected result is shown in Fig. 3.As seen from Figure 3, transverse axis of branch augmentation curve (the denary logarithm value of initial miRNA number) and longitudinal axis C TPresent good linear relationship (R between the value 2=0.994).As seen from the figure, detection method of the present invention can detect few to 10 4Individual mir-122 molecule, and it has the dynamicrange of at least 6 orders of magnitude to each reverse transcription reaction.
Embodiment 4
The detection of let-7 series miRNA.Mouse let-7 series comprises let-7a～7g and let-7i 8 miRNA altogether, their nucleotide sequence is very near (referring to Fig. 4 and table 2), show part inequality in let-7b～g and the let-7i nucleotide sequence with mark of emphasis among Fig. 4 B with let-7a, by Fig. 4 B as can be known, some miRNA such as let-7c, let-7e etc. have only the base of a position different with let-7a, thereby these 8 miRNA will be detected each other and make a distinction, difficulty is very big.We have designed primer 1, primer 2 in RT-primer separately, bridge probe and the branch augmentation for each miRNA of let-7 series, and its nucleotide sequence sees Table 3.Detected result is listed in Fig. 4 C.By the detected result of Fig. 4 C, the specificity of the little RNA detection method of the present invention is very good.Numerical value among Fig. 4 C calculates like this: with the first behavior example, test kit detection let-7a～g and let-7i with let-7a obtain C separately TValue is with the every group of object (C that surveys TValue is minimum) relative expression quantity be set at 100%, the relative expression quantity of all the other each miRNA is calculated by typical curve.By Fig. 4 C as can be known, except that the test kit with let-7e detected let-7a and the test kit detection let-7f with let-7e, the non-specific signal under other situations was all less than 0.1%.Three steps that cooperatively interact have guaranteed the specificity (Fig. 4 A) of the little RNA detection method of the present invention.In simple terms, the RT-primer can be distinguished the mispairing of little RNA3 ' end, and the ligation at C-probe (being the bridge probe) mediation reverse transcription cDNA down subsequently can be distinguished the mispairing that little RNA5 ' holds, and the primer 1 in the branch augmentation, primer 2 (mainly being primer 1) can further be distinguished the mispairing of little RNA interlude.Therefore, reasonably design primer 1, primer 2 and nucleotide sequence in RT-primer, bridge probe and the branch augmentation, use method of the present invention just can detect the variation in single site in the little RNA sequence.
Embodiment 5
Little RNA detection method of the present invention is to the immunity from interference of miRNA precursor.The miRNA precursor is the stable hairpin structure RNA molecule that comprises whole ripe miRNA sequence, and its existence may cause interference to the detection of ripe miRNA.We have tested the interference of the precursor of let-7a, mir-122 and mir-1 to their corresponding ripe miRNA detections, and the results are shown in Table 4.From the result of table 4 as can be seen, even the concentration of miRNA precursor is 100 times of corresponding ripe miRNA, the miRNA precursor can not surpass the size of background noise to the contribution of detection signal.Therefore, little RNA detection method of the present invention to the immunity from interference of miRNA precursor than TaqMan miRNA detection method (Chen, C., Ridzon, D.A., Broomer, A.J., Zhou, Z., Lee, D.H., Nguyen, J.T., Barbisin, M., Xu, N.L., Mahuvakar, V.R., Andersen, M.R., et al.2005.Real-time quantification of microRNAs by stem-loop RT-PCR.Nucleic Acids Res.33:e179) strong.
Embodiment 6
The immunity from interference of little RNA detection method of the present invention.In actual detected work, little RNA detection method will be in the face of the interference from other non-target small RNA moleculars.If little RNA detection method is very strong to the immunity from interference of the total RNA sample in the various tissues in the organism, then can directly this method be detected total RNA sample, and need not purify to total RNA sample separation in advance.Since mir-122 be considered in liver expression contents very high and in its hetero-organization expression contents very low, we have studied the total RNA sample of non-liver organization to the interference that mir-122 detects, and the results are shown in Fig. 5.Fig. 5 A is a different quantities (10 8, 10 6, 10 4Individual copy) detected result of mir-122 under the total RNA sample of the cerebral tissue of difference amount (0,50,100,200ng) disturbs, Fig. 5 B then is a different quantities (10 8, 10 6, 10 4Individual copy) detected result of mir-122 under 100ng disturbs from the total RNA sample of different tissues (kidney, testis, brain, heart and ovary).By The above results as can be known, little RNA detection method of the present invention has very strong immunity from interference to total RNA sample of no more than 200ng.This shows, little RNA detection method of the present invention can be directly used in the detection of total RNA sample.
Embodiment 7
Dynamicrange when little RNA detection method of the present invention is directly used in total RNA pattern detection.Present embodiment has detected mir-1, the mir-122 in the liver, the mir-150 in the spleen and the mir-143 in the ovary in the total RNA sample of let-7a, heart tissue in the total RNA sample of mouse lung tissue, the results are shown in Fig. 6.From Fig. 6 as seen, the amount of detected total RNA sample has changed 4 orders of magnitude altogether from 0.05ng to 500ng, and C TValue has good linear relationship (R with the amount of total RNA sample in this scope 2＞0.990).Hence one can see that, and little RNA detection method of the present invention also has very wide dynamicrange when being used for total RNA pattern detection.
Embodiment 8
Adopt the miRNA in the little RNA detection method detection different tissues of the present invention.Present embodiment has detected the expression level of mir-122, mir-1, mir-150, mir-143 (being shown in Fig. 7) and let-7a (being shown in Fig. 8) in 12 kinds of different tissues of mouse.Carried out comparison and detection with traditional Ncode RT-PCR method simultaneously.Suppose to contain in each cell total RNA sample of 15pg, find that by detection method of the present invention mir-122 mainly is expressed in (about 30000 copies of each cell) in the liver, mir-1 mainly is expressed in heart (about 190000 copies of each cell) and the skeletal muscle (about 500000 copies of each cell), and mir-150 mainly is expressed in (about 22000 copies of each cell) in the spleen.On the contrary, mir-143 and let-7a then do not have very big tissue according to patience, and they are expressed in the various histocytes widely, and from 50 to 3000 copies of quantity do not wait.Adopt traditional Ncode RT-PCR method also to draw similar result.
Embodiment 9
MiRNA detection method of the present invention and traditional RT-PCR (fluorescent quantitative poly reaction) are in the comparison that detects confidential reference items RNA.In the real time fluorescent quantitative poly chain reaction, it is very crucial for the quantitative assay of miRNA that different sample miRNA are carried out normalization method with respect to confidential reference items.Small nuclear rna (snRNA) U6 often is used as the confidential reference items of traditional miRNA or other RNA detection, we detect the U6 expression level in 12 kinds of histocytes in the mouse body with the little RNA detection method among the present invention and traditional R-T PCR, the results are shown in Fig. 9.As can be seen from Figure 9, little RNA detection method of the present invention detect U6 result and traditional R-T PCR very approaching.Discover that recently little RNA such as snoRNA 135 and miRNA-191 are more stable as the interior reference U6 that miRNA qRT-PCR detects, we use little RNA detection method of the present invention and traditional Ncode equally TMRT-PCR detects snoRNA 135 in 12 kinds of histocytes in the mouse body and the expression level of miRNA-191, and it is similarly closely similar to the results are shown in Figure the result that 9, two kinds of methods draw.This shows that little RNA detection method of the present invention can be used for little RNA in the detection by quantitative different tissues cell.
Subordinate list:
Table 1.User-designed oligomers for dsDNA templates preparation
The DNA oligonucleotide Dna sequence dna
??Pre-7a-forward ??(containing?T7 ??promoter) ??TAATACGACTCACTATAGGGATTCACTGTGGGATGAGGTAGTAGG ??TTGTATAGTTTTAGGGTCACACCC
??Pre-7a-reverse ??ATCACCTTAGGAAAGACAGTAGATTGTATAGTTATCTCCCAGTGG ??TGGGTGTGACCCTAAAAC
??Pre-mir-1?forward ??(containing?T7 ??promoter) ??TAATACGACTCACTATAGGGAGCTTGGGACACATACTTCTTTATA ??TGCCCATATGAACC
??Pre-mir-1-reverse ??GCCTGAAATACATACTTCTTTACATTCCATAGCTTAGCAGGTTCA ??TATGGGCATATAAA
??Pre-mir-122-forward ??(containing?T7 ??promoter) ??TAATACGACTCACTATAGGGAAGCTGTGGAGTGTGACAATGGT ??GTTTGTGTCCA
??Pre-mir-122-reverse ??AGCTATTTAGTGTGATAATGGCGTTTGATGGTTTGGACACAAAC ??ACCATTGTCACACTC
＊Forward?DNA?oligomer?contains?a?portion?of?sequences?complementary?to?reverse?DNA?oligomer，highlightedin?bold.
The miRNA that uses among table 2. the present invention, the nucleotide sequence of snoRNA 135 and U6 snRNA
??ID Sequence
??mmu-let-7a ??UGAGGUAGUAGGUUGUAUAGUU
??mmu-let-7b ??UGAGGUAGUAGGUUGUGUGGUU
??mmu-let-7c ??UGAGGUAGUAGGUUGUAUGGUU
??mmu-let-7d ??AGAGGUAGUAGGUUGCAUAGU
??mmu-let-7e ??UGAGGUAGGAGGUUGUAUAGU
??mmu-let-7f ??UGAGGUAGUAGAUUGUAUAGUU
??mmu-let-7g ??UGAGGUAGUAGUUUGUACAGU
??mmu-let-7i ??UGAGGUAGUAGUUUGUGCUGUU
??mmu-miR-1 ??UGGAAUGUAAAGAAGUAUGUAU
??mmu-mir-122 ??UGGAGUGUGACAAUGGUGUUUG
??mmu-mir-143 ??UGAGAUGAAGCACUGUAGCUCA
??mmu-mir-150 ??UCUCCCAACCCUUGUACCAGUG
??mmu-mir-191 ??CAACGGAAUCCCAAAAGCAGCUG
??snoRNA?135 ??CUAAAAUAGCUGGAAUUACCGGCAGAUUGG ??UAGUGGUGAGCCUAUGGUUUUCUGAAG
??U6?snRNA ??GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGA ??ACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAA ??GGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUU
Table 3.miRNA, snoRNA 135, the RT-primer of U6 snRNA, DNA bridge probe, RAM primer sequence
Figure G2009101002728D00131
Figure G2009101002728D00141
Table 4.let-7a, miRNA-122, the interference that the precursor of miRNA-1 detects corresponding ripe miRNA
Figure G2009101002728D00142
Figure G2009101002728D00151
ND (No Detection, no signal): C T＞80; Mir-122:miRNA122; Mir-1:miRNA-1.

Claims (8)

1. a method that is used to detect the little RNA of known array is characterized in that this method comprises the steps:
(1) system that will comprise the little RNA of target contacts with the RT-primer, described RT-primer comprise can with at least a portion sequence complementary recognition sequence of the little RNA of target, thereby at least a portion sequence complementary pairing of described recognition sequence and the little RNA of target;
(2) under the effect of first archaeal dna polymerase, be that template is carried out reverse transcription with the little RNA of target, synthesize the complementary strand of the little RNA unpaired nucleotide of target sequence, thereby obtain RNA-DNA hybridization chain;
(3) decompose target RNA in the RNA-DNA hybridization chain that step 2 obtains with rnase, thereby obtain single stranded DNA;
(4) single stranded DNA that step 3 is obtained contacts with the bridge probe, after described single stranded DNA is end to end, comprise tie point a part of sequence can with at least a portion sequence complementation of described bridge probe, thereby obtain open bridge probe-single stranded DNA hybridization product;
(5) under the effect of dna ligase, the breach sealing in the open bridge probe that step 4 obtains-single stranded DNA hybridization product, thus obtain closed bridge probe-single stranded DNA hybridization product;
(6) under the effect of second archaeal dna polymerase and first primer and second primer, closed bridge probe-single stranded DNA hybridization product that step 5 is obtained carries out the real-time quantitative branch augmentation.
2. the method that is used to detect the little RNA of known array according to claim 1 is characterized in that not joining right at least a portion nucleotide sequence complementation in the sequence of first primer and/or second primer and the closed bridge probe-single stranded DNA hybridization product.
3. the method that is used to detect the little RNA of known array according to claim 2 is characterized in that being derived from the sequence of first primer and/or second primer and the closed bridge probe-single stranded DNA hybridization product at least a portion nucleotide sequence complementation of the little RNA of target.
4. according to any described method that is used to detect the little RNA of known array of claim 1-3, it is characterized in that described RT-primer recognition sequence can with at least a portion sequence complementation of the little RNA 3 ' end of target.
5. according to claim 1 or the 4 described methods that are used to detect the little RNA of known array, it is characterized in that the described system that comprises the little RNA of target is selected from separates the RNA sample of purifying, total RNA sample, cell extract, complete cell, tissue extract or in-vitro transcription reaction product.
6. a test kit that is used to detect the little RNA of known array is characterized in that this test kit comprises RT-primer, first archaeal dna polymerase, rnase, bridge probe, dna ligase, second archaeal dna polymerase, is used for first primer of branch augmentation and the working instructions of second primer and this test kit; Described RT-primer comprise can with at least a portion sequence complementary recognition sequence of the little RNA of target, first archaeal dna polymerase is used for the reverse transcription of the little RNA of target, rnase is used for the target RNA of degradation of rna-DNA hybridization chain to obtain single stranded DNA, after single stranded DNA is end to end, comprise tie point a part of sequence can with at least a portion sequence complementation of bridge probe, thereby can obtain open bridge probe-single stranded DNA hybridization product, dna ligase is used for the breach sealing with open bridge probe-single stranded DNA hybridization product, thereby can obtain closed bridge probe-single stranded DNA hybridization product, second archaeal dna polymerase and first primer and second primer can carry out branch augmentation to closed bridge probe-single stranded DNA hybridization product.
7. according to the test kit of little RNA that is used to detect known array of claim 6, it is characterized in that unpaired at least a portion nucleotide sequence complementation in the sequence of first primer and/or second primer and the closed bridge probe-single stranded DNA hybridization product.
8. according to the test kit of little RNA that is used to detect known array of claim 7, it is characterized in that being derived from the sequence of first primer and/or second primer and the closed bridge probe-single stranded DNA hybridization product at least a portion nucleotide sequence complementation of the little RNA of target.
CN200910100272A 2009-06-26 2009-06-26 Method and kit for detecting small RNA Pending CN101633957A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN200910100272A CN101633957A (en) 2009-06-26 2009-06-26 Method and kit for detecting small RNA
PCT/CN2010/000945 WO2010148651A1 (en) 2009-06-26 2010-06-24 Method and kit for detecting small rna

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN200910100272A CN101633957A (en) 2009-06-26 2009-06-26 Method and kit for detecting small RNA

Publications (1)

Publication Number Publication Date
CN101633957A true CN101633957A (en) 2010-01-27

Family

ID=41593294

Family Applications (1)

Application Number Title Priority Date Filing Date
CN200910100272A Pending CN101633957A (en) 2009-06-26 2009-06-26 Method and kit for detecting small RNA

Country Status (2)

Country Link
CN (1) CN101633957A (en)
WO (1) WO2010148651A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010148651A1 (en) * 2009-06-26 2010-12-29 Xi Jianzhong Method and kit for detecting small rna
CN106047989A (en) * 2015-04-08 2016-10-26 中国科学院北京基因组研究所 Application of circular RNA to colorectal cancer inspection marker
CN106148495A (en) * 2015-04-08 2016-11-23 中国科学院北京基因组研究所 The application in colorectal cancer biomarker of a kind of circular rna
CN106148494A (en) * 2015-04-08 2016-11-23 中国科学院北京基因组研究所 The application in colorectal cancer biomarker of a kind of circular rna
CN106661632A (en) * 2014-08-19 2017-05-10 生物辐射实验室股份有限公司 RNA amplification methods

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070269799A9 (en) * 1994-06-22 2007-11-22 Zhang David Y Nucleic acid amplification methods
JP2008534015A (en) * 2005-03-31 2008-08-28 ハミルトン ソーン バイオサイエンシーズ インコーポレイテッド Nucleic acid probe capable of circularization and amplification method
GB0703996D0 (en) * 2007-03-01 2007-04-11 Oxitec Ltd Nucleic acid detection
CN101633957A (en) * 2009-06-26 2010-01-27 北大工学院绍兴技术研究院 Method and kit for detecting small RNA

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010148651A1 (en) * 2009-06-26 2010-12-29 Xi Jianzhong Method and kit for detecting small rna
CN106661632A (en) * 2014-08-19 2017-05-10 生物辐射实验室股份有限公司 RNA amplification methods
CN106047989A (en) * 2015-04-08 2016-10-26 中国科学院北京基因组研究所 Application of circular RNA to colorectal cancer inspection marker
CN106148495A (en) * 2015-04-08 2016-11-23 中国科学院北京基因组研究所 The application in colorectal cancer biomarker of a kind of circular rna
CN106148494A (en) * 2015-04-08 2016-11-23 中国科学院北京基因组研究所 The application in colorectal cancer biomarker of a kind of circular rna

Also Published As

Publication number Publication date
WO2010148651A1 (en) 2010-12-29

Similar Documents

Publication Publication Date Title
Chen et al. Quantitation of microRNAs by real-time RT-qPCR
Li et al. One-step ultrasensitive detection of microRNAs with loop-mediated isothermal amplification (LAMP)
Jonstrup et al. A microRNA detection system based on padlock probes and rolling circle amplification
Guerau-de-Arellano et al. miRNA profiling for biomarker discovery in multiple sclerosis: from microarray to deep sequencing
US8314220B2 (en) Methods compositions, and kits for detection of microRNA
ES2541356T3 (en) Quantification procedure for small RNA species
US8632967B2 (en) Cancer marker, method for evaluation of cancer by using the cancer marker, and evaluation reagent
EP2315852B1 (en) Method for determining the origin of a sample
JP2010500867A (en) Nucleic acid detection method
Li et al. A simple molecular beacon with duplex-specific nuclease amplification for detection of microRNA
US20160177376A1 (en) Detection method of micro-rna with high specificity
Yao et al. Quantitative analysis of zeptomole microRNAs based on isothermal ramification amplification
WO2021123282A1 (en) Method of detecting an analyte
Lan et al. Linear-hairpin variable primer RT-qPCR for MicroRNA
Shaffer et al. miRNA profiling from blood—challenges and recommendations
CN101633957A (en) Method and kit for detecting small RNA
Ab Mutalib et al. Molecular profiling and detection methods of microRNA in cancer research
Castoldi et al. 22 Expression Profiling of MicroRNAs by Quantitative Real-Time PCR
WO2010103522A1 (en) Method for detection of nucleic acid sequences
WO2006084201A2 (en) Method of isolating, labeling and profiling small rna and whole-genome transcripts
CN101591709A (en) Be used for the probe groups of little RNA detection and the method that detects little RNA with this probe groups
Zhang et al. Conventional miRNA detection strategies
Wang et al. RT2 miRNA PCR Arrays
WO2015043982A1 (en) Quantification of rna
CZ2016248A3 (en) A method of detecting specific microRNAs using template DNA and a template DNA molecule for use in this method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20100127