WO2010134686A2 - Soluble myostatin pro-domain recombinant protein having myostatin inhibitory activity and use thereof - Google Patents

Soluble myostatin pro-domain recombinant protein having myostatin inhibitory activity and use thereof Download PDF

Info

Publication number
WO2010134686A2
WO2010134686A2 PCT/KR2010/001385 KR2010001385W WO2010134686A2 WO 2010134686 A2 WO2010134686 A2 WO 2010134686A2 KR 2010001385 W KR2010001385 W KR 2010001385W WO 2010134686 A2 WO2010134686 A2 WO 2010134686A2
Authority
WO
WIPO (PCT)
Prior art keywords
prodomain
myostatin
seq
protein
soluble
Prior art date
Application number
PCT/KR2010/001385
Other languages
French (fr)
Korean (ko)
Other versions
WO2010134686A3 (en
Inventor
진형주
이상범
Original Assignee
강릉원주대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020100017002A external-priority patent/KR20100125171A/en
Application filed by 강릉원주대학교산학협력단 filed Critical 강릉원주대학교산학협력단
Publication of WO2010134686A2 publication Critical patent/WO2010134686A2/en
Publication of WO2010134686A3 publication Critical patent/WO2010134686A3/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/142—Amino acids; Derivatives thereof
    • A23K20/147—Polymeric derivatives, e.g. peptides or proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a soluble myostatin prodomain recombinant protein having myostatin inhibitory activity and its use. More specifically, the present invention relates to a soluble myostatin that inhibits the function of myostatin prepared using various expression vectors and E. coli. The present invention relates to a recombinant protein of ostatin prodomain and a feed additive for promoting muscle growth or improving a growth rate of plants and animals using the same, or to prevent and treat muscle-related diseases such as muscular dystrophy or muscular dystrophy.
  • Myostatin a muscle growth regulator, is also called a growth and differentiation factor (GDF-8), regulates cell proliferation and differentiation, and belongs to the TGF-b family.
  • GDF-8 growth and differentiation factor
  • mice that are knocked out of myostatin muscles are increased 2-3 times than normal mice, and recently, it is known that muscle accumulation increases and fat accumulation decreases.
  • Myostatin of the higher organisms known to date is very similar in structure, and generally myostatin is composed of three exons and two introns, and the myostatin gene is about 3.1 kb.
  • RNA is known to exist in and most muscles.
  • Myostatin mRNA produces a myostatin protein consisting of about 375 amino acids, and myostatin protein is largely divided into three parts: a signal peptide region, a propeptide (prodomain) region; 28 kDa, N-terminus] and mature region (12 kDa, C-terminus).
  • Myostatin undergoes three major post-translational processing in cells.
  • the propeptide and the mature moiety are disulfide bonds with each other, thereby maintaining the shape of the homer dimeric protein.
  • the proteolytic part As the proteolytic part is cleaved, it is divided into a propeptide zone and a mature zone. After cleavage, the propeptide region binds to the mature region via non-covalent binding. Then, as it is secreted out of the cell, the mature zone binds to and becomes phosphorylated with activin type II receptors, passing the signal back to the activin type I receptor, Signals are delivered to receptor-regulated proteins Smad2 and Smad3, and Smad2 and Smad3 bind co-Smad4 to regulate transcription of the gene of interest.
  • myostatin research shows that by inhibiting the function of myostatin, a large amount of muscle production and low fat, ie, double-muscle individuals, are rapidly reduced in weight, such as AIDS patients. Research into the mechanism of myostatin is being used, such as regeneration of myotubes and muscle atrophy of unused muscles.
  • myostatin substantially loses its function by degrading all of the propeptide regions of myostatin.
  • follistatin when a protein belonging to the TGF-b family is secreted, it is reported that the muscle increases due to the failure to control the growth of the muscle by binding.
  • Anti-myostatin monoclonal antibodies against the mature myostatin of chickens were produced and injected directly into the fertilized eggs of the chickens, and the weight and muscle mass of the chickens were measured. Increased. Callis et al. Reported that microRNAs play an important role in muscle development.
  • Republic of Korea Patent No. 10-0872042 'cell surface expression vector expressing myostatin and the microorganism transformed by the vector' includes a polynucleotide encoding myostatin mature protein and polygamma inducing the surface expression of the microorganism
  • a feed additive or vaccine comprising a cell surface expression vector containing a gene encoding a glutamic acid synthase complex, a microorganism transformed with the vector and a myostatin mature protein prepared by culturing the transformed microorganism as an active ingredient.
  • Korean Patent Application No. 10-2008-7008707 'Anti-myostatin antibody' has a high affinity useful for increasing muscle mass, increasing bone density, or treating various disorders in mammalian and avian species. Chimeric, humanized or fully human antibodies, immunoconjugates of antibodies or antigens thereof Anti-myostatin antibodies that can be -binding fragments are disclosed.
  • the present invention used prodomain recombinant protein, which is one of the methods of inhibiting the function of myostatin.
  • myostatin has 7-9 cysteines, and thus, mammalian cells are used to produce recombinant proteins having the function of myostatin.
  • the present inventors have developed a method for producing recombinant proteins of soluble myostatin prodomains that inhibit the function of myostatin using various expression vectors and E. coli, and thus, marine animals, including higher animals, higher plants, and zooplankton. Applied to marine plants, including phytoplankton, it was confirmed that the present invention can be applied to dual muscle-forming higher organisms, marine organisms and medicines, and completed the present invention.
  • an object of the present invention is to provide a recombinant protein production method of soluble myostatin prodomains that inhibits the function of myostatin using various expression vectors and E. coli.
  • An object of the present invention as described above is to clone the halibut myostatin prodomain gene using PCR from myostatin cDNA of halibut muscle tissue as a biological myostatin prodomain, and insert it into the expression vectors pET32a and pMALc2x.
  • E. coli Rogetta-gami2 (DE3) pLyss effectively expressed soluble myostatin prodomain, a water-soluble protein, and was purified using metal binding affinity and amylose resin affinity chromatography. , 30 ug of purified soluble myostatin prodomain, respectively, from 250 mL of culture.
  • the present invention provides a method for cloning a myostatin prodomain gene using myostatin of a biological tissue, inserting the biomyostatin prodomain into an expression vector, and expressing the expression vector-binding myostatin prodomain in E. coli. Transforming to express a recombinant protein of soluble myostatin prodomain, and purifying the recombinant protein of the transformed soluble myostatin prodomain, and the soluble myostatin pro inhibiting the function of myostatin. It provides a method for producing a recombinant protein of the domain.
  • the myostatin prodomain is preferably a cow, a rat, for example, a rat and a mouse, a pig, a chicken, a turkey, a sheep, a human, a dog, a mallard, a quail, a monkey, for example, the Philippines.
  • Terrestrial animals such as monkeys and roland gorillas, abalones, flounders, e.g. stone flounder, flounder, zodiac rock, tilapia, sea bream, e.g. sea bream and black sea bream, puffer fish, e.g. trout, trout, salmon, catfish, flounder or Myostatin prodomains of marine animals such as rotifers.
  • the expression vector may be selected from the group consisting of pET32a, pET43.a, pMALp2x and pMALc2x, preferably pET32a and pMALc2x.
  • the E. coli may be selected from the group consisting of BL21 (DE3), BL21 (DE3) pLyss, origami2 (DE3), Origami2 (DE3) pLyss, and Rogetta-gami2 (DE3) pLyss, preferably Rogetta- gami2 (DE3) pLyss.
  • the present invention provides a recombinant protein of soluble myostatin prodomains that inhibits the function of myostatin of an organism produced by the above method.
  • An organism capable of inhibiting myostatin function using the recombinant protein of the soluble myostatin prodomain according to the present invention may be any living organism on the earth, and in particular, a superhero animal belonging to a higher animal, for example, an invertebrate animal.
  • Marine animals including toxins, fishes, amphibians, reptiles, birds, mammals, etc. belonging to vertebrates, tonics, tortoises, molluscs, arthropods, and vertebrates, including, for example, flowering plants and zooplankton And all marine plants, including phytoplankton.
  • the recombinant protein of soluble myostatin prodomains that inhibits the function of myostatin of the organism according to the present invention is preferably a pMALc2x-prodomain protein or a pET32a-prodomain protein.
  • Pro domains of pMALc2x-prodomain protein or pET32a-prodomain protein that inhibit the function of myostatin in organisms according to the present invention may be used in cattle, rats, mice, pigs, chickens, turkeys, sheep, humans, dogs, mallards, It may be a quail, Philippine monkey, Roland gorilla, abalone, stone flounder, flounder, zodiac rock, tilapia, red snapper, black sea bream, purple lobster, rainbow trout, salmon, catfish, rotifer or halibut myostatin prodomain.
  • the mamiostatin prodomain according to the present invention is described in SEQ ID NOs: 1-26.
  • the pMALc2x-prodomain protein that inhibits the function of myostatin of the organism according to the present invention may be any one of the pMALc2x-prodomain proteins of SEQ ID NOs: 27 to 52.
  • the pET32a-prodomain protein that inhibits the function of myostatin of the organism according to the present invention may be any one of the pET32a-prodomain proteins of SEQ ID NOs: 53-78.
  • the present invention provides a feed additive composition for promoting muscle growth or improving the growth rate of a flora and fauna containing the recombinant protein of the soluble myostatin prodomain.
  • the feed additive is a generic term for substances added in a small amount to the feed for nutritional or specific purposes of animals and plants.
  • the present invention provides a pharmaceutical composition for the prevention and treatment of muscle diseases, such as muscular dystrophy, muscular dystrophy, muscular loss disease, including a recombinant protein of soluble myostatin prodomain as an active ingredient to inhibit the activity of mamistatin.
  • muscle diseases such as muscular dystrophy, muscular dystrophy, muscular loss disease
  • a recombinant protein of soluble myostatin prodomain as an active ingredient to inhibit the activity of mamistatin.
  • the present invention provides a health food composition for improving muscle growth containing the recombinant protein of the soluble myostatin prodomain as an active ingredient.
  • active ingredient includes a substance or a group of substances (a pharmacologically active ingredient or the like which is expected to express the efficacy effect of the drug directly or indirectly by intrinsic pharmacological action). Means a main component).
  • compositions of the present invention may further comprise suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions.
  • Dosage forms of the pharmaceutical compositions of the present invention may be used in the form of their pharmaceutically acceptable salts, and may be used alone or in combination with other pharmaceutically active compounds as well as in a suitable collection.
  • Health functional food as defined in the present invention means a food manufactured and processed using raw materials or ingredients having functional properties useful for the human body according to the Health Functional Food Act No. 6767, and "functional” means a human body It means the ingestion for the purpose of obtaining a useful effect in health use such as nutrient control or physiological action on the structure and function of.
  • Recombinant pMALc2x-prodomain protein and pET32a-prodomain protein according to the present invention showed an inhibitory effect on myostatin activity through luciferase analysis, and the recombinant soluble myostatin prodomain thus expressed is higher animals, higher plants.
  • marine animals including zooplankton, and marine plants, including phytoplankton, may be used to inhibit myostatin, thereby inducing double-muscle or low-fat higher organisms and marine organisms, and in medicine for muscle-related diseases. It is feed.
  • feed additives for promoting muscle growth or improving body weight of plants and animals containing the active ingredient of E. coli expressing soluble myostatin prodomain may also be used for the prevention and treatment of muscle-related diseases such as muscular dystrophy and muscular dystrophy.
  • Myostatin prodomain recombinant proteins pMALc2x-prodomain protein and pET32a-prodomain protein according to the present invention has an inhibitory effect on myostatin activity, marine animals, including higher animals, higher plants and zooplankton, It can be applied to marine plants containing phytoplankton to inhibit the function of myostatin to induce double-muscle or low fat higher organisms and marine organisms, and to promote muscle growth of plants and animals by using soluble myostatin prodomain recombinant protein.
  • the present invention may be used for the preparation of a feed additive for improving the growth rate, or for the preparation and treatment of muscle-related diseases such as muscular dystrophy or muscular dystrophy.
  • FIG. 1 is a diagram showing the expression results of pET32a poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
  • Figure 2 is a diagram showing the expression results of pMALc2x poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
  • Figure 3 is a diagram showing the expression results of pET32a prodomain (1), pMALc2x prodomain (2), pET43.1a prodomain (3) induced in E. coli strain Rogetta-gami2 (DE3) pLyss at 37 degrees.
  • Figure 4 shows the expression results of pET32a prodomain (1), pMALc2x prodomain (2), pET43.1a prodomain (3) induced in E. coli strain Rogetta-gami2 (DE3) pLyss at 12.5 degrees.
  • FIG. 5 is a diagram showing the results of expression over time after IPTG addition of pET32a poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
  • FIG. 6 is a diagram showing the results of expression over time after IPTG addition of pMALc2x poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
  • Figure 7 shows the affinity chromatography results for pET32a poMSTN prodomain in E. coli strain Rogetta-gami2 (DE3) pLyss.
  • FIG. 8 shows affinity chromatography results for pMALc2x poMSTN prodomain in E. coli strain Rogetta-gami2 (DE3) pLyss.
  • Figure 9 shows the results of size exclusion chromatography of the pET32a poMSTN prodomain.
  • FIG. 10 is a diagram showing the size exclusion chromatography results of pMALc2x poMSTN prodomain.
  • FIG. 11 is a diagram showing the expression and purification results of pET32a poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
  • FIG. 12 is a diagram showing the results of expression and purification of pMALc2x poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
  • FIG. 13 is a diagram showing inhibition of myostatin activity by recombinant prodomains (pET32a-prodomain and pMALc2x-prodomain) (A) and (B).
  • FIG. 14 is a diagram showing the weight variation and biochemical analysis by myostatin activity inhibition after applying recombinant prodomains (pET32a-prodomain and pMALc2x-prodomain) to fish for one month.
  • LB liquid medium was prepared with 1.2% tryptone, 0.6% yeast extract, and 0.8% NaCl at pH 7.0.
  • Antibiotic plate medium for selection of strains was BL21 (DE3) Escherichia coli, and the final concentration of ampicillin (Amp, Sigma) was 50.
  • ug / mL and Origami2 (DE3) Escherichia coli were prepared with ampicillin (Amp, Sigma) and tetracycline (tetracycline; Tet, Sigma) at a final concentration of 50 ug / mL and 12.5 ug / mL, respectively.
  • Protein expression strains and protein expression plasmids used in this Example are shown in Table 1 below.
  • Table 1 Vector, expressed structure, detected MW, promoter, strain and place of purchase of this example vector pET32a pET43.1a pMAL-p2x pMAL c2x Expression structure 6x his poMSTN prodomain 6x his poMSTN prodomain MBP poMSTN Pro Domain MBP poMSTN Pro Domain Expected MW 54 kDa 97 kDa 80 kDa 80 kDa Promoter T7 / lac T7 / lac tac tac tac
  • Escherichia coli BL21 (DE3), BL21 (DE3) pLyss, origami2 (DE3), Origami2 (DE3) pLyss and Rogetta-gami2 (DE3) pLyss were purchased from Novagen.
  • pET32a and pET43.a were purchased from Novagen and pMALp2x and pMALc2x were purchased from New England BioLab.
  • Oligonucleotide primers synthesized based on the nucleotide sequence of the olive flounder myostatin gene (GeneBank Accession No. DQ412048) ') was amplified for the myostatin prodomain using an iCycler thermal cycler (Bio-Rad, USA).
  • the restriction position of the side of the primer is EcoR I, 3 'expression vector pET32a, pET43.1a, pMALp2x and pMAL to c2x vector using the 5-side of the primer contains a restriction enzyme and the termination codon position of the Hind III Designed.
  • the composition of the polymerase chain reaction (PCR) reaction mixture consisted of 2 ⁇ l cDNA, 2.5 ⁇ l 10x buffer, 1 ⁇ l 25 mM MgCl 2 , 0.5 ⁇ l 10 mM dNTP, 0.5 ⁇ l 10 pM forward primer, 0.5 ⁇ l 10 pM reverse primer, GoTaq (5 U / ⁇ l, promega) 0.1 ⁇ l and DDW 18.4 ⁇ l were added to make the total volume 25 ⁇ l.
  • the PCR reaction was carried out for 35 cycles of 94 ° C. 3 minutes [pre-denaturation], 94 ° C. 40 seconds, 56 ° C. 40 seconds, 72 ° C. for 1 minute, and at 10 ° C. for 10 minutes at final extension. . After the reaction was confirmed and separated by 1.0% agarose gel electrophoresis. Genes isolated from the gel were purified by gel cleaning kit (Bioneer).
  • the E. coli expression system of the cloned flounder myostatin gene was prepared as follows. My halibut amplified by PCR O statin gene of pro domain site and the E. coli expression vector pET32a with T7 promoter and restrict pMALp2x pMALc2x and having a tac promoter and pET43.1a enzymes EcoR I and Hind III 3 hours of reaction at 37 ° to the After cutting, the mixture was separated by agarose gel electrophoresis.
  • the isolated vector and the structural gene were linked using T4 DNA ligase to prepare an expression plasmid of recombinant myostatin.
  • the resulting pET32a-prodomain, pET43-prodomain, pMALp2x-prodomain and pMALc2x-prodomain were transformed with E. coli DH5 ⁇ .
  • From the cultured cells of transformed DH5 ⁇ pET32a-prodomain, pET43-prodomain, pMALp2x-prodomain and pMALc2x-prodomain plasmid were obtained.
  • Expression vectors obtained at this time were identified by agarose gel electrophoresis and DNA sequencing to identify myostatin prodomains.
  • the purified halibut myostatin prodomain region gene and protein expression vectors pET32a, pET43.1a, pMALp2x and pMAL c2x were digested with restriction enzymes EcoR I (promega) and Hind III (promega) at 37 ° C for 3 hours, followed by T4. Recombinant myostatin prodomain expression plasmid was prepared using ligase.
  • the protein inducer IPTG was administered to a final concentration of 0.2 mM to induce protein expression at 37 ° C.
  • the molecular weights of the recombinant olive flounder myostatin protein expressed by the expression vectors pET32a-prodomain and pMALc2x-prodomain were identified at 54 kDa and 80 kDa positions in SDS-PAGE, respectively (see FIGS. 1 and 2).
  • the expression levels of recombinant halibut myostatin according to each time were examined after culturing for 12 hours, 24 hours, 36 hours, and 48 hours. As a result, the expression amount increased up to 24 hours, but when cultured for 48 hours, the expression amount gradually decreased, and there was almost no difference in the expression amount between 24 hours and 36 hours (see FIGS. 5 and 6).
  • the optimum expression condition of recombinant halibut myostatin in Escherichia coli was optimally incubated at 12.5 degrees for 24 hours after administration of 0.2 mM IPTG, a protein inducer, when the culture medium had an OD600 of 0.4-0.5.
  • IPTG was used as the expression inducing agent, but Lactose of 0.001-10% may be used, and the temperature range is described as 12.5 ° C.-37 ° C. in this example, but 0 ° C.-15 ° for pET32a-prodomain.
  • ° C and pMALc2x-prodomain water-soluble proteins were expressed at 0 ° C to 50 ° C, respectively.
  • the concentration of IPTG was 0.2 mM as the expression inducing agent, but depending on the experimental method, it may be used up to 0.001-10 mM.
  • expression vectors and the like were transformed in E. coli, but it is obvious that even if transformed in yeast or the like falls within the scope of the present invention.
  • affinity) column Na-NTA agarose, Qiagen. Wash thoroughly with 20 mM phosphate (pH 8.0), 300 mM NaCl, 10 mM imidazole buffer to remove unnecessary protein in the column, then 20 mM phosphate (pH 8.0) containing 30 mM imidazole, Eluted with 300 mM NaCl buffer (see FIG. 7).
  • Recombinant protein solutions were adsorbed onto amylose resin (New England BioLab) equilibrated with 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA buffer for protein purification in the transformed pMALc2x-prodomain water soluble fraction. Wash thoroughly with 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA buffer to remove unnecessary protein in the column, then 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA buffer containing 10 mM maltose. Eluted (see FIG. 8).
  • SEGC Size exclusion gel chromatography
  • A204 cells were seeded with 30,000 cells per 100 uL in 96-well plates and grown for 24 hours in DMEM containing 10% fetal calf serum. After 24 hours, 0.15 ug of pGL3 (CAGA) 12 DNA and 1 uL of Fugene (trade name) were transfected. After 24 hours, 2.5 ng / mL myostatin (GDF-8, R & D Systems) and various concentrations of pET32a-prodomain and pMALc2x-prodomain protein were added. Luciferase activity was measured 24 hours after the addition of myostatin and recombinant prodomain protein (Luciferase Assay System, Promega).
  • Recombinant pMALc2x-prodomain protein was found to decrease myostatin activity from 31 ng / mL, and completely inhibited myostatin activity at 1 ug / mL.
  • Recombinant pET32a-prodomain protein decreased luciferase activity at 1, 2, and 4 ug / mL. This suggests that recombinant pET32a-prodomain protein inhibits myostatin activity but does not inhibit 100% myostatin activity.
  • pET32a-prodomain was shown to have myostatin inhibitory activity lower than that of pMALc2x-prodomain (see FIG. 13).
  • coli was crushed using an ultrasonic crusher, and then a supernatant containing a water-soluble recombinant protein was obtained using a centrifuge. The obtained supernatant was used for the rainbow trout growth experiment.
  • the cells were cleaned using siphon, and then, the water of the culture tank was adjusted to 1 L, and the supernatant containing the prepared recombinant proteins (pET32a-prodomain and pMALc2x-prodomain) was added. .
  • the concentration of recombinant protein in the treatment group was 0.05 mg and 0.1 mg of the recombinant protein in 1 L of water, respectively. The control was allowed to give a supernatant of untransformed E.
  • pMALc2x-prodomain protein In the pMALc2x-prodomain protein, 0.05 mg treatment group gained 126% weight after 4 weeks, and 0.1 mg treatment group increased 142% (p ⁇ 0.05). In addition, in the case of protein content (mg / g), the experimental group treated with 0.05 mg was increased by 3 mg per g, and the experimental group treated with 0.1 mg 6 mg per g compared to the control (p ⁇ 0.05). However, although the fat content appeared to be insignificant, the mean value seems to decrease slightly (p> 0.05). pMALc2x-prodomains showed much higher growth effects and higher protein content than pET32a-prodomains.
  • pMALc2x-prodomain protein inhibited myostatin activity more than pET32a-prodomain protein in vitro experiments as well as in vitro (see FIG. 14).
  • the water-soluble recombinant pET32a-prodomain and pMALc2x-prodomain proteins showed in vivo and in vitro assays to inhibit the activity of myostatin protein, increasing the growth effect and protein content.
  • soluble myostatin prodomains in Escherichia coli Rogetta-gami2 (DE3) pLyss by inserting them into expression vectors pET32a and pMALc2x to promote muscle growth or increase the weight gain of plants and animals, or to reduce atrophy as well as low fat feed additives. It can be used as a pharmaceutical composition for the prevention and treatment of muscle-related diseases such as muscular dystrophy.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Polymers & Plastics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Food Science & Technology (AREA)
  • Toxicology (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Animal Husbandry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to a soluble myostatin pro-domain recombinant protein having a myostatin inhibition activity. The recombinant protein having a myostatin prodomain, such as pMALc2x-prodomain and pET32a-prodomain, has an inhibitory effect on myostatin activity. Administration of the protein to higher animals and plants, marine animals including zooplankton, and oceanophytes including phytoplankton inhibits the function of myostatin, thereby producing doubl-muscle or low-fat higher organisms or marine organisms. Said soluble myostatin pro-domain recombinant proteins can be used in manufacturing animal feed additives for enhancing the muscle growth and rate of gain of animals and plants, and medicines for the prevention and treatment of muscle-related diseases such as muscular atrophy or muscular dystrophy.

Description

마이오스타틴 억제 활성을 갖는 가용성 마이오스타틴 프로도메인 재조합 단백질 및 그의 용도Soluble myostatin prodomain recombinant protein having myostatin inhibitory activity and use thereof
본 발명은 마이오스타틴 억제 활성을 갖는 가용성 마이오스타틴 프로도메인 재조합 단백질 및 그의 용도에 관한 것으로, 보다 구체적으로는 다양한 발현벡터와 발현 대장균을 이용하여 제조된 마이오스타틴의 기능을 억제하는 가용성 마이오스타틴 프로도메인의 재조합 단백질 및 이를 이용하는 동식물의 근육성장 촉진 또는 증체율 향상용 사료첨가제 또는 근위축증이나 근이영양증등 근육관련질환 예방 및 치료제에 관한 것이다.The present invention relates to a soluble myostatin prodomain recombinant protein having myostatin inhibitory activity and its use. More specifically, the present invention relates to a soluble myostatin that inhibits the function of myostatin prepared using various expression vectors and E. coli. The present invention relates to a recombinant protein of ostatin prodomain and a feed additive for promoting muscle growth or improving a growth rate of plants and animals using the same, or to prevent and treat muscle-related diseases such as muscular dystrophy or muscular dystrophy.
근육성장조절자 마이오스타틴(myostatin)은 성장 및 분화 인자(Growth and differentiation factor; GDF-8)라고 불리기도 하며, 세포의 증식과 분화를 조절하며, TGF-b계열에 속한다. 이러한 마이오스타틴이 파괴(knock-out)된 쥐의 경우 정상적인 쥐보다 근육이 2-3배정도 증가하였으며, 최근에는 근육이 증가하는 동시에 지방의 축적이 감소하는 것으로 알려져 있다. Myostatin, a muscle growth regulator, is also called a growth and differentiation factor (GDF-8), regulates cell proliferation and differentiation, and belongs to the TGF-b family. In mice that are knocked out of myostatin, muscles are increased 2-3 times than normal mice, and recently, it is known that muscle accumulation increases and fat accumulation decreases.
현재까지 알려진 고등 생물의 마이오스타틴은 그 구조가 아주 유사하며, 일반적으로 마이오스타틴은 3개의 엑손(exon)과 2개의 인트론(intron)으로 구성되어 있으며, 마이오스타틴 유전자는 약 3.1kb의 RNA을 및 대부분 근육에 존재한다고 알려져 있다. 마이오스타틴 mRNA는 약 375개의 아미노산으로 구성된 마이오스타틴 단백질을 생산하며, 마이오스타틴 단백질은 크게 3부분 즉, 신호 펩타이드 구역(signal peptide region), 프로펩타이드 구역[propeptide(prodomain) region; 28kDa, N-terminus] 및 성숙 구역(mature region; 12kDa, C-terminus)으로 나뉘어진다. 마이오스타틴은 3가지의 주된 번역 후 변형(post-translational processing)이 세포 내에서 일어난다. 프로펩타이드와 성숙 부분은 서로 디설파이드 결합을 하고 있으며, 그로 인하여 호머다이머 단백질(homodimeric protein)의 형태를 유지한다. 단백질 분해(proteolytic) 부분이 절단이 되면서, 프로펩타이드 구역과 성숙 구역으로 나뉜다. 절단 후, 프로펩타이드 구역은 비공유성 결합을 통하여 성숙 구역과 결합을 한다. 그런 후, 세포 바깥으로 분비가 되면서, 성숙 구역이 액티빈 II 형 수용체(activin type II receptors)와 결합하여 인산화가 되고 그 신호를 다시 액티빈 I 형 수용체(activin type I receptor)로 전달하고, 그 신호는 수용체 조절 단백질(receptor-regulated protein)인 Smad2와 Smad3로 전달되고, Smad2와 Smad3는 co-Smad4와 결합하여 목적 유전자의 전사를 조절한다. Myostatin of the higher organisms known to date is very similar in structure, and generally myostatin is composed of three exons and two introns, and the myostatin gene is about 3.1 kb. RNA is known to exist in and most muscles. Myostatin mRNA produces a myostatin protein consisting of about 375 amino acids, and myostatin protein is largely divided into three parts: a signal peptide region, a propeptide (prodomain) region; 28 kDa, N-terminus] and mature region (12 kDa, C-terminus). Myostatin undergoes three major post-translational processing in cells. The propeptide and the mature moiety are disulfide bonds with each other, thereby maintaining the shape of the homer dimeric protein. As the proteolytic part is cleaved, it is divided into a propeptide zone and a mature zone. After cleavage, the propeptide region binds to the mature region via non-covalent binding. Then, as it is secreted out of the cell, the mature zone binds to and becomes phosphorylated with activin type II receptors, passing the signal back to the activin type I receptor, Signals are delivered to receptor-regulated proteins Smad2 and Smad3, and Smad2 and Smad3 bind co-Smad4 to regulate transcription of the gene of interest.
마이오스타틴에 대한 연구대상은 대부분 고등동물에 한정이 되어 있으며, 최근에는 해양동물의 마이오스타틴의 존재가 알려지면서 연구가 시작이 되었다. 마이오스타틴에 대한 연구동향은 마이오스타틴의 기능을 억제함으로써 많은 양의 근육 생산 및 저지방, 즉 더블-머슬(double-muscle) 개체를 생산, 의약적으로 AIDS환자등과 같이 체중이 급속히 감소, 마이오튜브(myotube)의 재생, 사용하지 않은 근육의 위축증(muscle atrophy) 등에 활용, 마이오스타틴의 메커니즘에 대한 연구가 진행되고 있다. Most of the studies on myostatin are limited to higher animals, and recently, research has begun as the presence of myostatin in marine animals is known. Myostatin research shows that by inhibiting the function of myostatin, a large amount of muscle production and low fat, ie, double-muscle individuals, are rapidly reduced in weight, such as AIDS patients. Research into the mechanism of myostatin is being used, such as regeneration of myotubes and muscle atrophy of unused muscles.
마이오스타틴의 기능을 상쇄하여 근육의 양을 조절하는 방법에 대한 연구는 다음과 같다. 양(Yang) 등과 이 및 맥페론(Lee and McPherron)의 연구결과에 의하면 마이오스타틴 프로펩타이드 구역을 과별현시킨(overexpression) 결과 마이오스타틴 프로펩타이드 구역이 마이오스타틴 성숙 펩타이드와 결합함으로써 마이오스타틴 성숙 펩타이드의 활성이 상실되어 근육량이 증가하였다고 보고 하였다. 이 및 맥페론이 액티빈 수용체를 과별현시킨 결과, 마이오스타틴 성숙 펩타이드가 액티빈 수용체와 결합하여 기능을 상실함으로써, 이상증식(hyperplasia)(27%)과 이상발달(hypertrophy)(19%)이 나타났으며, 결과적으로 근육이 증가하였다. 또한 최근 카피오(Carpio) 등은 재조합 액티빈 IIB 형을 이용하여 근육성장을 유도하였다. Research on how to regulate the amount of muscle by offsetting the function of myostatin is as follows. According to research by Yang et al. And Lee and McPherron, overexpression of the myostatin propeptide region results in the myostatin propeptide region binding to the myostatin mature peptide. The activity of statin-maturated peptides was lost and muscle mass increased. As a result of this and Macperon's overexpression of activin receptors, myostatin mature peptides bind to activin receptors and lose their function, resulting in hyperplasia (27%) and hypertrophy (19%). Appeared, resulting in an increase in muscle. Recently, Carpio et al. Induced the growth of muscle using recombinant activin IIB.
BMP-1/Tolloid 군에 속한 메탈로프로테이나제의 경우는 마이오스타틴의 프로펩타이드 구역을 모두 분해함으로써, 실질적으로 마이오스타틴이 기능을 상실한다고 알려졌다. 폴리스타틴(Follistatin)의 경우는 TGF-b계열에 속하는 단백질이 분비가 되었을 때 결합을 함으로써 근육의 성장을 조절하지 못하게 됨으로써 근육이 증가한다고 보고 하였다. 닭의 성숙 마이오스타틴에 대한 항-마이오스타틴 모노클로날 항체를 생산하여 닭의 수정란에 직접 주입 부화 후, 닭의 중량과 근육량을 측정한 결과, 항체를 주입한 개체군이 주입하지 않은 개체군보다 증가한 것으로 나타났다. 칼리스(Callis) 등의 연구는 microRNA가 근육의 발생에 중요한 역할을 한다고 보고하였다. In the case of metalloproteinases belonging to the BMP-1 / Tolloid group, it is known that myostatin substantially loses its function by degrading all of the propeptide regions of myostatin. In the case of follistatin, when a protein belonging to the TGF-b family is secreted, it is reported that the muscle increases due to the failure to control the growth of the muscle by binding. Anti-myostatin monoclonal antibodies against the mature myostatin of chickens were produced and injected directly into the fertilized eggs of the chickens, and the weight and muscle mass of the chickens were measured. Increased. Callis et al. Reported that microRNAs play an important role in muscle development.
대한민국 등록특허 제10-0872042호 '마이오스타틴을 발현하는 세포표면 발현벡터 및 상기 벡터에 의해 형질전환된 미생물'에는 마이오스타틴 성숙 단백질을 암호화하는 폴리뉴클레오티드와 미생물의 표면발현을 유도하는 폴리감마글루탐산 합성효소 복합체를 코딩하는 유전자를 함유하는 세포표면 발현벡터와, 상기 벡터로 형질전환된 미생물 및 상기 형질전환된 미생물을 배양하여 제조된 마이오스타틴 성숙 단백질을 유효성분으로 포함하는 사료첨가제 또는 백신이 개시되어 있고, 대한민국 특허출원 제10-2008-7008707호 '항-마이오스타틴 항체'에는 근육 질량의 증가, 골 밀도의 증가, 또는 포유류 및 조류 종에서의 다양한 장애의 치료에 유용한 친화력이 높은 것을 특징으로 하고, 키메라, 인간화 또는 완전 인간 항체, 항체의 면역접합체 또는 이의 항원-결합 단편일 수 있는 항-마이오스타틴 항체가 개시되어 있다. Republic of Korea Patent No. 10-0872042 'cell surface expression vector expressing myostatin and the microorganism transformed by the vector' includes a polynucleotide encoding myostatin mature protein and polygamma inducing the surface expression of the microorganism A feed additive or vaccine comprising a cell surface expression vector containing a gene encoding a glutamic acid synthase complex, a microorganism transformed with the vector and a myostatin mature protein prepared by culturing the transformed microorganism as an active ingredient. Korean Patent Application No. 10-2008-7008707 'Anti-myostatin antibody' has a high affinity useful for increasing muscle mass, increasing bone density, or treating various disorders in mammalian and avian species. Chimeric, humanized or fully human antibodies, immunoconjugates of antibodies or antigens thereof Anti-myostatin antibodies that can be -binding fragments are disclosed.
기존의 마이오스타틴 기능을 상쇄하는 방법들은 대부분 고등동물에 주된 초점을 맞추고 있다. 해양생물의 경우 마이오스타틴의 기능을 억제하여 더블-머슬화된(double-muscled) 해양생물을 대량생산하여야 함으로 기존의 방법(RNAi등과 같은 유전자, 포유류 세포주를 이용한 재조합 단백질 등)을 적용하기가 경제적인 측면에서는 거의 무의미한 것이다. 그러므로 해양생물에 적용할 수 있는 보다 쉽고, 경제적인 방법을 찾아야 될 것으로 사료된다. Most of the methods that counteract myostatin function focus on higher animals. In the case of marine organisms, it is necessary to mass-produce double-muscled marine organisms by inhibiting the function of myostatin, so it is difficult to apply existing methods (genes such as RNAi, recombinant proteins using mammalian cell lines, etc.). It is almost meaningless in economic terms. Therefore, we need to find an easier and more economical way to apply to marine life.
마이오스타틴 기능 억제방법 개발은 기존의 방법과 같이 마이오스타틴의 모노크로날 항체, 포유세포로부터 재조합 단백질 제조하여 성숙 마이오스타틴의 기능을 억제하는 방법의 경우 대량생산이 요구되는 고등생물 및 해양생물에 적용하는 것은 경제성에 있어서 부적합하다. 그러므로 대량생산을 위하여 보다 쉽고 경제성이 있는 방법 개발이 필요하다. Development of methods for inhibiting myostatin function involves the production of recombinant proteins from monoclonal antibodies of myostatin and mammalian cells and the inhibition of the function of mature myostatin in higher organisms and oceans that require mass production. Application to living things is inadequate in economics. Therefore, it is necessary to develop an easier and more economical method for mass production.
본 발명은 이러한 문제를 해결하기 위하여 마이오스타틴의 기능을 억제하는 방법 중 하나인 프로도메인 재조합 단백질 이용하였다. 일반적으로 마이오스타틴은 7-9개의 시스테인을 가지고 있어 마이오스타틴의 기능을 가지는 재조합 단백질 생산 시 포유세포를 이용한다. 하지만, 대장균으로부터 생산된 봉입체(inclusion body)를 적용하기 위해서는 반드시 리폴딩(refolding) 과정을 거쳐야 한다. 하지만, 본 발명자들은 다양한 발현벡터와 발현 대장균을 이용하여 마이오스타틴의 기능을 억제하는 가용성 마이오스타틴 프로도메인의 재조합 단백질 생산방법을 개발하여 고등동물, 고등식물 및 동물성플랑크톤을 포함하는 해양동물, 식물성플랑크톤을 포함하는 해양식물에 적용하여 이중 근육형성 고등생물, 해양생물 및 의약품에 응용할 수 있음을 확인하고 본 발명을 완성하게 되었다. In order to solve this problem, the present invention used prodomain recombinant protein, which is one of the methods of inhibiting the function of myostatin. In general, myostatin has 7-9 cysteines, and thus, mammalian cells are used to produce recombinant proteins having the function of myostatin. However, in order to apply the inclusion body produced from Escherichia coli, it must go through a refolding process. However, the present inventors have developed a method for producing recombinant proteins of soluble myostatin prodomains that inhibit the function of myostatin using various expression vectors and E. coli, and thus, marine animals, including higher animals, higher plants, and zooplankton. Applied to marine plants, including phytoplankton, it was confirmed that the present invention can be applied to dual muscle-forming higher organisms, marine organisms and medicines, and completed the present invention.
따라서 본 발명의 목적은 다양한 발현벡터와 발현 대장균을 이용하여 마이오스타틴의 기능을 억제하는 가용성 마이오스타틴 프로도메인의 재조합 단백질 생산방법을 제공하는 것이다.Accordingly, an object of the present invention is to provide a recombinant protein production method of soluble myostatin prodomains that inhibits the function of myostatin using various expression vectors and E. coli.
또한 본 발명의 다른 목적은 상기와 같은 방법을 생산된 마이오스타틴의 기능을 억제하는 가용성 마이오스타틴 프로도메인의 재조합 단백질을 제공하는 것이다.It is another object of the present invention to provide a recombinant protein of soluble myostatin prodomain that inhibits the function of myostatin produced by the above method.
또한 본 발명의 다른 목적은 가용성 마이오스타틴 프로도메인의 재조합 단백질을 유효성분으로 함유하는 동식물의 근육성장 촉진 또는 증체율 향상용 사료첨가제 또는 근위축증이나 근이영양증등 근육관련질환 예방 및 치료제를 제공하는 것이다.It is another object of the present invention to provide a feed additive for promoting muscle growth or improving the growth rate of a flora and fauna containing a recombinant protein of soluble myostatin prodomain or an agent for preventing and treating muscle related diseases such as muscular dystrophy or muscular dystrophy.
상기와 같은 본 발명의 목적은 생물 마이오스타틴 프로도메인으로서 넙치 근육조직의 마이오스타틴 cDNA로부터 PCR을 이용하여 넙치 마이오스타틴 프로도메인 유전자를 클로닝하고, 이를 발현 벡터 pET32a 및 pMALc2x에 삽입시킨 후, 대장균 Rogetta-gami2(DE3)pLyss에서 효과적으로 수용성 단백질인 가용성 마이오스타틴 프로도메인을 발현시켰으며, 금속 결합 친화도(metal binding affinity)와 아밀로오스 수지 친화도(amylose resin affinity) 크로마토그래피를 이용하여 정제하였고, 250 mL의 배양액으로부터 각각 30 ug의 정제된 가용성 마이오스타틴 프로도메인을 수득함으로써 달성되었다.An object of the present invention as described above is to clone the halibut myostatin prodomain gene using PCR from myostatin cDNA of halibut muscle tissue as a biological myostatin prodomain, and insert it into the expression vectors pET32a and pMALc2x. E. coli Rogetta-gami2 (DE3) pLyss effectively expressed soluble myostatin prodomain, a water-soluble protein, and was purified using metal binding affinity and amylose resin affinity chromatography. , 30 ug of purified soluble myostatin prodomain, respectively, from 250 mL of culture.
본 발명은 생물 조직의 마이오스타틴을 이용하여 마이오스타틴 프로도메인 유전자를 클로닝하는 단계, 상기 생물 마이오스타틴 프로도메인을 발현 벡터에 삽입시키는 단계, 상기 발현 벡터 결합 마이오스타틴 프로도메인을 대장균에서 형질전환시켜 가용성 마이오스타틴 프로도메인의 재조합 단백질을 발현시키는 단계, 및 상기 형질전환된 가용성 마이오스타틴 프로도메인의 재조합 단백질을 정제하는 단계로 이루어진 마이오스타틴의 기능을 억제하는 가용성 마이오스타틴 프로도메인의 재조합 단백질 생산방법을 제공한다.The present invention provides a method for cloning a myostatin prodomain gene using myostatin of a biological tissue, inserting the biomyostatin prodomain into an expression vector, and expressing the expression vector-binding myostatin prodomain in E. coli. Transforming to express a recombinant protein of soluble myostatin prodomain, and purifying the recombinant protein of the transformed soluble myostatin prodomain, and the soluble myostatin pro inhibiting the function of myostatin. It provides a method for producing a recombinant protein of the domain.
본 발명에 있어서 상기 마이오스타틴 프로도메인은, 바람직하게는 소, 쥐, 예를 들어 래트 및 마우스, 돼지, 닭, 칠면조, 양, 인간, 개, 청둥오리, 메추라기, 원숭이, 예를 들어, 필리핀원숭이 및 로랜드고릴라 등 육상동물, 전복, 가자미, 예를 들어 돌가가미, 가자미, 조피볼락, 틸라피아, 도미, 예를 들어, 참돔 및 감성돔, 복어, 예를 들어 자주복, 송어, 연어, 메기, 넙치 또는 로티퍼 등 해양동물의 마이오스타틴 프로도메인일 수 있다. In the present invention, the myostatin prodomain is preferably a cow, a rat, for example, a rat and a mouse, a pig, a chicken, a turkey, a sheep, a human, a dog, a mallard, a quail, a monkey, for example, the Philippines. Terrestrial animals such as monkeys and roland gorillas, abalones, flounders, e.g. stone flounder, flounder, zodiac rock, tilapia, sea bream, e.g. sea bream and black sea bream, puffer fish, e.g. trout, trout, salmon, catfish, flounder or Myostatin prodomains of marine animals such as rotifers.
본 발명에 있어서 상기 발현 벡터는 pET32a, pET43.a, pMALp2x 및 pMALc2x로 구성된 군으로부터 선택될 수 있고, 바람직하게는 pET32a 및 pMALc2x이다.In the present invention, the expression vector may be selected from the group consisting of pET32a, pET43.a, pMALp2x and pMALc2x, preferably pET32a and pMALc2x.
본 발명에 있어서 상기 대장균은 BL21(DE3), BL21(DE3)pLyss, origami2(DE3), Origami2(DE3)pLyss 및 Rogetta-gami2(DE3)pLyss로 구성된 군으로부터 선택될 수 있고, 바람직하게는 Rogetta-gami2(DE3)pLyss이다.In the present invention, the E. coli may be selected from the group consisting of BL21 (DE3), BL21 (DE3) pLyss, origami2 (DE3), Origami2 (DE3) pLyss, and Rogetta-gami2 (DE3) pLyss, preferably Rogetta- gami2 (DE3) pLyss.
본 발명은 상기 방법으로 생산된 생물의 마이오스타틴의 기능을 억제하는 가용성 마이오스타틴 프로도메인의 재조합 단백질을 제공한다. The present invention provides a recombinant protein of soluble myostatin prodomains that inhibits the function of myostatin of an organism produced by the above method.
본 발명에 따른 가용성 마이오스타틴 프로도메인의 재조합 단백질을 이용하여 마이오스타틴 기능을 억제할 수 있는 생물은 지구상에 생존하는 모든 생물일 수 있고, 특히 고등동물, 예를 들어 무척추동물에 속하는 편형동물, 강장동물, 환형동물, 연체동물, 절지동물 등과 척추동물에 속하는 무악류, 어류, 양서류, 파충류, 조류, 포유류 등, 고등식물, 예를 들어 꽃이 피는 식물 및 동물성플랑크톤을 포함하는 모든 해양동물, 및 식물성플랑크톤을 포함하는 모든 해양식물이다.An organism capable of inhibiting myostatin function using the recombinant protein of the soluble myostatin prodomain according to the present invention may be any living organism on the earth, and in particular, a superhero animal belonging to a higher animal, for example, an invertebrate animal. , Marine animals, including toxins, fishes, amphibians, reptiles, birds, mammals, etc. belonging to vertebrates, tonics, tortoises, molluscs, arthropods, and vertebrates, including, for example, flowering plants and zooplankton And all marine plants, including phytoplankton.
본 발명에 따른 생물의 마이오스타틴의 기능을 억제하는 가용성 마이오스타틴 프로도메인의 재조합 단백질은, 바람직하게는 pMALc2x-프로도메인 단백질 또는 pET32a-프로도메인 단백질이다.The recombinant protein of soluble myostatin prodomains that inhibits the function of myostatin of the organism according to the present invention is preferably a pMALc2x-prodomain protein or a pET32a-prodomain protein.
본 발명에 따른 생물의 마이오스타틴의 기능을 억제하는 pMALc2x-프로도메인 단백질 또는 pET32a-프로도메인 단백질의 프로도메인은 소, 래트, 마우스, 돼지, 닭, 칠면조, 양, 인간, 개, 청둥오리, 메추라기, 필리핀원숭이, 로랜드고릴라, 전복, 돌가가미, 가자미, 조피볼락, 틸라피아, 참돔, 감성돔, 자주복, 무지개송어, 연어, 메기, 로티퍼 또는 넙치의 마이오스타틴 프로도메인일 수 있다.Pro domains of pMALc2x-prodomain protein or pET32a-prodomain protein that inhibit the function of myostatin in organisms according to the present invention may be used in cattle, rats, mice, pigs, chickens, turkeys, sheep, humans, dogs, mallards, It may be a quail, Philippine monkey, Roland gorilla, abalone, stone flounder, flounder, zodiac rock, tilapia, red snapper, black sea bream, purple lobster, rainbow trout, salmon, catfish, rotifer or halibut myostatin prodomain.
본 발명에 따른 상기 마미오스타틴 프로도메인은 서열번호 1 내지 26에 기재되어 있다.The mamiostatin prodomain according to the present invention is described in SEQ ID NOs: 1-26.
본 발명에 따른 생물의 마이오스타틴의 기능을 억제하는 pMALc2x-프로도메인 단백질은 서열번호 27 내지 52의 pMALc2x-프로도메인 단백질 중 어느 하나 일 수 있다.The pMALc2x-prodomain protein that inhibits the function of myostatin of the organism according to the present invention may be any one of the pMALc2x-prodomain proteins of SEQ ID NOs: 27 to 52.
본 발명에 따른 생물의 마이오스타틴의 기능을 억제하는 pET32a-프로도메인 단백질은 서열번호 53 내지 78의 pET32a-프로도메인 단백질 중 어느 하나 일 수 있다.The pET32a-prodomain protein that inhibits the function of myostatin of the organism according to the present invention may be any one of the pET32a-prodomain proteins of SEQ ID NOs: 53-78.
본 발명은 상기 가용성 마이오스타틴 프로도메인의 재조합 단백질을 유효성분으로 함유하는 동식물의 근육성장 촉진 또는 증체율 향상용 사료첨가제 조성물을 제공한다.The present invention provides a feed additive composition for promoting muscle growth or improving the growth rate of a flora and fauna containing the recombinant protein of the soluble myostatin prodomain.
본 발명에 있어서 상기 사료첨가제는 동식물의 영양적 또는 특정 목적을 위하여 사료에 미량으로 첨가되는 물질의 총칭하는 것이다.In the present invention, the feed additive is a generic term for substances added in a small amount to the feed for nutritional or specific purposes of animals and plants.
본 발명은 가용성 마이오스타틴 프로도메인의 재조합 단백질을 유효성분으로 함유하여 마미오스타틴의 활성을 저해하는 근위축증, 근이영양증, 근육소실성 질환 등 근육질환관련 예방 및 치료용 약제학적 조성물을 제공한다.The present invention provides a pharmaceutical composition for the prevention and treatment of muscle diseases, such as muscular dystrophy, muscular dystrophy, muscular loss disease, including a recombinant protein of soluble myostatin prodomain as an active ingredient to inhibit the activity of mamistatin.
본 발명은 상기 가용성 마이오스타틴 프로도메인의 재조합 단백질을 유효성분으로 함유하는 근육성장 개선용 건강식품 조성물을 제공한다.The present invention provides a health food composition for improving muscle growth containing the recombinant protein of the soluble myostatin prodomain as an active ingredient.
본 발명에 있어서, "유효성분"이라 함은 내재된 약리작용에 의해 그 의약품의 효능효과를 직접 또는 간접적으로 발현한다고 기대되는 물질 또는 물질군(약리학적 활성성분등이 밝혀지지 않은 생약 등을 포함한다)으로서 주성분을 포함하는 것을 의미한다.In the present invention, the term "active ingredient" includes a substance or a group of substances (a pharmacologically active ingredient or the like which is expected to express the efficacy effect of the drug directly or indirectly by intrinsic pharmacological action). Means a main component).
본 발명의 약학조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다.The pharmaceutical compositions of the present invention may further comprise suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions.
본 발명의 약학 조성물의 투여 형태는 이들의 약학적 허용 가능한 염의 형태로도 사용될 수 있고, 또한 단독으로 또는 타 약학적 활성 화합물과 결합뿐만 아니라 적당한 집합으로 사용될 수 있다.Dosage forms of the pharmaceutical compositions of the present invention may be used in the form of their pharmaceutically acceptable salts, and may be used alone or in combination with other pharmaceutically active compounds as well as in a suitable collection.
본 발명에서 정의되는 "건강기능식품"은 건강기능식품에 관한 법률 제6727호에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 의미하며, "기능성"이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건 용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다."Health functional food" as defined in the present invention means a food manufactured and processed using raw materials or ingredients having functional properties useful for the human body according to the Health Functional Food Act No. 6767, and "functional" means a human body It means the ingestion for the purpose of obtaining a useful effect in health use such as nutrient control or physiological action on the structure and function of.
본 발명에 따른 재조합 pMALc2x-프로도메인 단백질과 pET32a-프로도메인 단백질은 루시페라아제 분석을 통하여 마이오스타틴 활성에 대한 억제 효과가 나타났으며, 이렇게 발현된 재조합 가용성 마이오스타틴 프로도메인은 고등동물, 고등식물 및 동물성 플랑크톤을 포함하는 해양동물, 식물성 플랑크톤을 포함하는 해양식물 에 적용하여 마이오스타틴의 기능을 억제함으로써 더블-머슬 또는 저지방 고등생물 및 해양생물을 유도 및 근육관련질환의 의약품에도 활용할 수 있을 것으로 사료된다. Recombinant pMALc2x-prodomain protein and pET32a-prodomain protein according to the present invention showed an inhibitory effect on myostatin activity through luciferase analysis, and the recombinant soluble myostatin prodomain thus expressed is higher animals, higher plants. In addition, marine animals, including zooplankton, and marine plants, including phytoplankton, may be used to inhibit myostatin, thereby inducing double-muscle or low-fat higher organisms and marine organisms, and in medicine for muscle-related diseases. It is feed.
또한 가용성 마이오스타틴 프로도메인이 발현된 대장균의 유효성분을 함유하는 동식물의 근육성장 촉진 또는 증체율 향상용 사료첨가제 또한 의약품으로는 근위축증이나 근이영양증 등 근육관련질환 예방 및 치료제에 이용될 수 있을 것이다.In addition, feed additives for promoting muscle growth or improving body weight of plants and animals containing the active ingredient of E. coli expressing soluble myostatin prodomain may also be used for the prevention and treatment of muscle-related diseases such as muscular dystrophy and muscular dystrophy.
본 발명에 따른 마이오스타틴 프로도메인 재조합 단백질인 pMALc2x-프로도메인 단백질과 pET32a-프로도메인 단백질은 마이오스타틴 활성에 대한 억제 효과가 있어, 이를 고등동물, 고등식물 및 동물성 플랑크톤을 포함하는 해양동물, 식물성 플랑크톤을 포함하는 해양식물에 적용하여 마이오스타틴의 기능을 억제함으로써 더블-머슬 또는 저지방 고등생물 및 해양생물을 유도할 수 있고, 가용성 마이오스타틴 프로도메인 재조합 단백질을 이용하여 동식물의 근육성장 촉진 또는 증체율 향상용 사료첨가제 또는 근위축증이나 근이영양증등 근육관련질환 예방 및 치료용 약제의 제조에 이용할 수 있다.Myostatin prodomain recombinant proteins pMALc2x-prodomain protein and pET32a-prodomain protein according to the present invention has an inhibitory effect on myostatin activity, marine animals, including higher animals, higher plants and zooplankton, It can be applied to marine plants containing phytoplankton to inhibit the function of myostatin to induce double-muscle or low fat higher organisms and marine organisms, and to promote muscle growth of plants and animals by using soluble myostatin prodomain recombinant protein. Alternatively, the present invention may be used for the preparation of a feed additive for improving the growth rate, or for the preparation and treatment of muscle-related diseases such as muscular dystrophy or muscular dystrophy.
도 1은 대장균 균주 Rogetta-gami2(DE3)pLyss에 유도된 pET32a poMSTN 프로도메인의 발현 결과를 나타낸 도이다. 1 is a diagram showing the expression results of pET32a poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
도 2는 대장균 균주 Rogetta-gami2(DE3)pLyss에 유도된 pMALc2x poMSTN 프로도메인의 발현 결과를 나타낸 도이다. Figure 2 is a diagram showing the expression results of pMALc2x poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
도 3는 37도에서 대장균 균주 Rogetta-gami2(DE3)pLyss에 유도된 pET32a 프로도메인 (1), pMALc2x프로도메인 (2), pET43.1a 프로도메인(3) 발현결과를 나타낸 도이다.Figure 3 is a diagram showing the expression results of pET32a prodomain (1), pMALc2x prodomain (2), pET43.1a prodomain (3) induced in E. coli strain Rogetta-gami2 (DE3) pLyss at 37 degrees.
도 4는 12.5도에서 대장균 균주 Rogetta-gami2(DE3)pLyss에 유도된 pET32a 프로도메인 (1), pMALc2x프로도메인 (2), pET43.1a 프로도메인(3) 발현결과를 나타낸 도이다.Figure 4 shows the expression results of pET32a prodomain (1), pMALc2x prodomain (2), pET43.1a prodomain (3) induced in E. coli strain Rogetta-gami2 (DE3) pLyss at 12.5 degrees.
도 5은 대장균 균주 Rogetta-gami2(DE3)pLyss에 유도된 pET32a poMSTN 프로도메인의 IPTG첨가 후 시간별 발현 결과를 나타낸 도이다. 5 is a diagram showing the results of expression over time after IPTG addition of pET32a poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
도 6은 대장균 균주 Rogetta-gami2(DE3)pLyss에 유도된 pMALc2x poMSTN 프로도메인의 IPTG첨가 후 시간별 발현 결과를 나타낸 도이다. 6 is a diagram showing the results of expression over time after IPTG addition of pMALc2x poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
도 7은 대장균 균주 Rogetta-gami2(DE3)pLyss에서의 pET32a poMSTN 프로도메인에 대한 친화도 크로마토그래피 결과를 나타낸 도이다. Figure 7 shows the affinity chromatography results for pET32a poMSTN prodomain in E. coli strain Rogetta-gami2 (DE3) pLyss.
도 8는 대장균 균주 Rogetta-gami2(DE3)pLyss에서의 pMALc2x poMSTN 프로도메인에 대한 친화도 크로마토그래피 결과를 나타낸 도이다.FIG. 8 shows affinity chromatography results for pMALc2x poMSTN prodomain in E. coli strain Rogetta-gami2 (DE3) pLyss.
도 9는 pET32a poMSTN 프로도메인의 크기 배제 크로마토그래피 결과를 나타낸 도이다.Figure 9 shows the results of size exclusion chromatography of the pET32a poMSTN prodomain.
도 10은 pMALc2x poMSTN 프로도메인의 크기 배제 크로마토그래피 결과를 나타낸 도이다.10 is a diagram showing the size exclusion chromatography results of pMALc2x poMSTN prodomain.
도 11은 대장균 균주 Rogetta-gami2(DE3)pLyss에 유도된 pET32a poMSTN 프로도메인의 발현 및 정제 결과를 나타낸 도이다. 11 is a diagram showing the expression and purification results of pET32a poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
도 12는 대장균 균주 Rogetta-gami2(DE3)pLyss에 유도된 pMALc2x poMSTN 프로도메인의 발현 및 정제 결과를 나타낸 도이다. 12 is a diagram showing the results of expression and purification of pMALc2x poMSTN prodomain induced in E. coli strain Rogetta-gami2 (DE3) pLyss.
도 13은 재조합 프로도메인(pET32a-prodomain 및 pMALc2x-prodomain) (A), (B)에 의한 마이오스타틴 활성 억제를 나타낸 도이다.13 is a diagram showing inhibition of myostatin activity by recombinant prodomains (pET32a-prodomain and pMALc2x-prodomain) (A) and (B).
도 14는 재조합 프로도메인(pET32a-prodomain 및 pMALc2x-prodomain) 를 어류에 한달동안 적용한 후 마이오스타틴 활성억제에 의한 무게변이와 생화학적 분석을 나타낸 도이다.14 is a diagram showing the weight variation and biochemical analysis by myostatin activity inhibition after applying recombinant prodomains (pET32a-prodomain and pMALc2x-prodomain) to fish for one month.
이하에서 본 발명의 바람직한 실시형태를 실시예를 참고로 보다 구체적으로 설명한다. 하지만 본 발명의 범위가 이러한 실시예에 한정되는 것은 아니다.Hereinafter, preferred embodiments of the present invention will be described in more detail with reference to Examples. However, the scope of the present invention is not limited to these examples.
실시예Example
LB 액체배지는 1.2% 트립톤, 0.6% 효모 추출물 및 0.8% NaCl를 pH7.0으로 조제하였고, 균주 선택용 항생제 평판배지는 BL21(DE3) 대장균은 암피실린(ampicillin; Amp, Sigma) 최종농도가 50 ug/mL, 및 오리가미2(Origami2; DE3) 대장균은 암피실린(Amp, Sigma)과 테트라사이클린(tetracycline; Tet, Sigma)이 각각 최종농도가 50 ug/mL, 12.5 ug/mL이 되도록 조제하였으며, BL21(DE3)pLyss과 Origami2(DE3)pLyss 및 Rogetta-gami2(DE3)pLyss 대장균은 암피실린(Amp, Sigma)과 클로로암페니콜(Chloramphenicol; Cam, Sigma)이 각각 최종농도가 50 ug/mL, 34 ug/mL이 되도록 조제하였다. LB liquid medium was prepared with 1.2% tryptone, 0.6% yeast extract, and 0.8% NaCl at pH 7.0. Antibiotic plate medium for selection of strains was BL21 (DE3) Escherichia coli, and the final concentration of ampicillin (Amp, Sigma) was 50. ug / mL and Origami2 (DE3) Escherichia coli were prepared with ampicillin (Amp, Sigma) and tetracycline (tetracycline; Tet, Sigma) at a final concentration of 50 ug / mL and 12.5 ug / mL, respectively. (DE3) pLyss and Origami2 (DE3) pLyss and Rogetta-gami2 (DE3) pLyss Escherichia coli have ampicillin (Amp, Sigma) and chloroamphenicol (Chloramphenicol; Cam, Sigma) concentrations of 50 ug / mL and 34 ug, respectively. It prepared to be / mL.
본 실시예에 사용된 단백질 발현 균주 및 단백질 발현 플라스미드를 하기 표 1에 나타내었다.Protein expression strains and protein expression plasmids used in this Example are shown in Table 1 below.
표 1 본 실시예의 벡터, 발현된 구조, 검출된 MW, 프로모터, 균주 및 구입처
벡터 pET32a pET43.1a pMAL-p2x pMAL c2x
발현 구조 6x his poMSTN 프로도메인 6x his poMSTN 프로도메인 MBP poMSTN 프로도메인 MBP poMSTN 프로도메인
예상 MW 54 kDa 97 kDa 80 kDa 80 kDa
프로모터 T7/lac T7/lac tac tac
입수처 노바젠(Novagen) 노바젠 NEB NEB
균주 유전자형 공급원
BL21(DE3) F-ompThsdSB(rB-mB-)galdcm(DE3) 노바젠
BL21(DE3)pLyss F-ompThsdSB(rB-mB-)galdcm(DE3)pLysS(CamR) 노바젠
Origami2(DE3) (ara-leu)7697 lacX74 phoA Pvull phoR araD139 ahpC galE galK rpsL F'[lac+lacIqpro](DE3)gor522::Tn10trxB(StrR,TetR) 노바젠
Origami2(DE3)pLyss (ara-leu)7697 lacX74 phoA Pvull phoR araD139 ahpC galE galK rpsL F'[lac+lacIqpro](DE3)gor522::Tn10trxBpLysS(CamR,StrR,TetR) 노바젠
Rogetta-gami2(DE3)pLyss (ara-leu)7697 lacX74 phoA Pvull phoR araD139 ahpC galE galK rpsL F'[lac+lacIqpro](DE3)gor522::Tn10trxBpLysSRARE2(CamR,StrR,TetR) 노바젠
Table 1 Vector, expressed structure, detected MW, promoter, strain and place of purchase of this example
vector pET32a pET43.1a pMAL-p2x pMAL c2x
Expression structure 6x his poMSTN prodomain 6x his poMSTN prodomain MBP poMSTN Pro Domain MBP poMSTN Pro Domain
Expected MW 54 kDa 97 kDa 80 kDa 80 kDa
Promoter T7 / lac T7 / lac tac tac
Where to get Novagen Novazen NEB NEB
Strain genotype Source
BL21 (DE3) F - ompThsdSB (rB-mB - ) galdcm (DE3) Novazen
BL21 (DE3) pLyss F - ompThsdSB (rB-mB - ) galdcm (DE3) pLysS (Cam R) Novazen
Origami2 (DE3) (ara-leu) 7697 lacX74 phoA Pvull phoR araD139 ahpC galE galK rpsL F '[lac + lacI q pro] (DE3) gor522 :: Tn10trxB (Str R , Tet R ) Novazen
Origami2 (DE3) pLyss (ara-leu) 7697 lacX74 phoA Pvull phoR araD139 ahpC galE galK rpsL F '[lac + lacI q pro] (DE3) gor522 :: Tn10trxBpLysS (Cam R , StrR, Tet R ) Novazen
Rogetta-gami2 (DE3) pLyss (ara-leu) 7697 lacX74 phoA Pvull phoR araD139 ahpC galE galK rpsL F '[lac + lacI q pro] (DE3) gor522 :: Tn10trxBpLysSRARE2 (Cam R , StrR, Tet R ) Novazen
대장균 BL21(DE3), BL21(DE3)pLyss, origami2(DE3), Origami2(DE3)pLyss 및 Rogetta-gami2(DE3)pLyss는 노바젠사에서 구입하였다. pET32a와 pET43.a는 노바젠사에서 구입 하였으며 pMALp2x와 pMALc2x는 뉴 잉글랜드 바이오랩(New England BioLab)사에서 구입하였다.Escherichia coli BL21 (DE3), BL21 (DE3) pLyss, origami2 (DE3), Origami2 (DE3) pLyss and Rogetta-gami2 (DE3) pLyss were purchased from Novagen. pET32a and pET43.a were purchased from Novagen and pMALp2x and pMALc2x were purchased from New England BioLab.
실시예 1: 넙치의 마이오스타틴 프로도메인 유전자의 클로닝과 대장균 발현벡터의 작성Example 1 Cloning of Myostatin Prodomain Gene of Flounder and Preparation of E. Coli Expression Vector
트라이졸 시약(Trizol reagent) 방법(Invitrogen, USA)을 이용하여 넙치 근육조직에서 총 RNA를 추출하였다. 총 RNA 0.5 ug 을 주형으로 하여 슈퍼스크립트(상표명) II 역전사효소(Superscript™Ⅱ Reverse Transcriptase; Invitrogen)를 이용하여 cDNA를 합성하였다.Total RNA was extracted from halibut muscle tissue using the Trizol reagent method (Invitrogen, USA). CDNA was synthesized using Superscript ™ II Reverse Transcriptase (Invitrogen) with 0.5 ug of total RNA as a template.
넙치 마이오스타틴 유전자 (GeneBank Accession No. DQ412048)의 염기서열을 기준으로 합성한 올리고뉴클레오타이드 프라이머(oligonucleotide primer)( 프라이머 F: 5'- CCG GAATTCATGCATCTGTCTCACATTGTGCT-3', 프라이머 R: 5'- CCC AAGCTTTCATCTCCTGACTCGCTTTG -3')를 iCycler thermal cycler(Bio-Rad, USA)를 이용하여 마이오스타틴 프로도메인 부위를 증폭하였다. 이 때 단백질 발현벡터 pET32a, pET43.1a, pMALp2x 및 pMAL c2x 벡터를 이용하기 위해 5'쪽의 프라이머에는 EcoR I의 제한효소 자리를, 3'쪽의 프라이머에는 Hind III의 제한효소와 종결코돈 자리를 디자인하였다. PCR(Polymerase chain reaction) 반응 혼합물의 조성은 cDNA 2 ㎕, 10x 완충액 2.5 ㎕, 25 mM MgCl21㎕, 10 mM dNTP 0.5 ㎕, 10 pM 정방향 프라이머 0.5 ㎕, 10 pM 역방향 프라이머 0.5 ㎕, GoTaq (5 U/㎕, promega) 0.1 ㎕, DDW 18.4 ㎕를 넣어 총 부피를 25 ㎕로 하였다. PCR 반응은 94℃ 3분[전-변성(pre-denaturation)], 94℃ 40초, 56℃ 40초, 72℃ 1분간 35 사이클 반응하였으며 최종 신장(final extension)으로 72℃에서 10분간 반응하였다. 반응이 끝난 후 1.0 % 아가로스겔 전기영동에 의해 확인하고 분리하였다. 겔에서 분리한 유전자는 겔 세정 키트(Bioneer)로 정제하였다.Oligonucleotide primers synthesized based on the nucleotide sequence of the olive flounder myostatin gene (GeneBank Accession No. DQ412048) ') Was amplified for the myostatin prodomain using an iCycler thermal cycler (Bio-Rad, USA). At this time the protein, the restriction position of the side of the primer is EcoR I, 3 'expression vector pET32a, pET43.1a, pMALp2x and pMAL to c2x vector using the 5-side of the primer contains a restriction enzyme and the termination codon position of the Hind III Designed. The composition of the polymerase chain reaction (PCR) reaction mixture consisted of 2 μl cDNA, 2.5 μl 10x buffer, 1 μl 25 mM MgCl 2 , 0.5 μl 10 mM dNTP, 0.5 μl 10 pM forward primer, 0.5 μl 10 pM reverse primer, GoTaq (5 U / μl, promega) 0.1 μl and DDW 18.4 μl were added to make the total volume 25 μl. The PCR reaction was carried out for 35 cycles of 94 ° C. 3 minutes [pre-denaturation], 94 ° C. 40 seconds, 56 ° C. 40 seconds, 72 ° C. for 1 minute, and at 10 ° C. for 10 minutes at final extension. . After the reaction was confirmed and separated by 1.0% agarose gel electrophoresis. Genes isolated from the gel were purified by gel cleaning kit (Bioneer).
넙치 근육조직의 cDNA를 주형으로 넙치 마이오스타틴 유전자를 PCR로 증폭했을 때 아가로스 겔 전기영동에서 크기가 약 800 뉴클레오티드 정도의 DNA 밴드를 얻을 수 있었다. 클로닝한 넙치 마이오스타틴 유전자의 대장균 발현계는 다음과 같이 작성하였다. PCR로 증폭한 넙치 마이오스타틴 유전자의 프로도메인 부위와 T7 프로모터를 가진 대장균 발현벡터 pET32a와 pET43.1a 및 tac 프로모터를 가지는 pMALp2x와 pMALc2x를 제한효소 EcoR I과 Hind III로 37도에서 3시간 정도 반응시켜 절단한 다음, 아가로스 겔 전기영동을 통하여 분리하였다. 분리된 벡터와 구조 유전자를 T4 DNA 리가아제를 이용하여 연결시켜 재조합 마이오스타틴의 발현 플라스미드를 작성하였다. 그 결과 생성된 pET32a-프로도메인, pET43-프로도메인, pMALp2x-프로도메인 및 pMALc2x-프로도메인을 대장균 DH5α로 형질전환하였다. 형질전환된 DH5α의 배양된 균체로부터 pET32a-프로도메인, pET43-프로도메인, pMALp2x-프로도메인 및 pMALc2x-프로도메인 플라스미드를 얻을 수 있었다. 이 때 얻어진 발현벡터들은 아가로스 겔 전기영동과 DNA 서열분석하여 마이오스타틴 프로도메인을 확인하였다. When the flounder myostatin gene was amplified by PCR using the flounder muscle cDNA template, agarose gel electrophoresis resulted in DNA bands of about 800 nucleotides in size. The E. coli expression system of the cloned flounder myostatin gene was prepared as follows. My halibut amplified by PCR O statin gene of pro domain site and the E. coli expression vector pET32a with T7 promoter and restrict pMALp2x pMALc2x and having a tac promoter and pET43.1a enzymes EcoR I and Hind III 3 hours of reaction at 37 ° to the After cutting, the mixture was separated by agarose gel electrophoresis. The isolated vector and the structural gene were linked using T4 DNA ligase to prepare an expression plasmid of recombinant myostatin. The resulting pET32a-prodomain, pET43-prodomain, pMALp2x-prodomain and pMALc2x-prodomain were transformed with E. coli DH5α. From the cultured cells of transformed DH5α, pET32a-prodomain, pET43-prodomain, pMALp2x-prodomain and pMALc2x-prodomain plasmid were obtained. Expression vectors obtained at this time were identified by agarose gel electrophoresis and DNA sequencing to identify myostatin prodomains.
실시예 2 : 발현벡터의 작성과 재조합 넙치 마이오스타틴 프로도메인의 발현Example 2 Preparation of Expression Vectors and Expression of Recombinant Flounder Myostatin Prodomains
정제된 넙치 마이오스타틴 프로도메인 부위 유전자와 단백질 발현벡터 pET32a, pET43.1a, pMALp2x 및 pMAL c2x를 제한효소 EcoR I(promega)과 Hind III(promega)로 37℃에서 3시간 동안 절단한 다음, T4 리가아제(solgent)를 이용하여 재조합 마이오스타틴 프로도메인 발현 플라스미드를 제작하였다.The purified halibut myostatin prodomain region gene and protein expression vectors pET32a, pET43.1a, pMALp2x and pMAL c2x were digested with restriction enzymes EcoR I (promega) and Hind III (promega) at 37 ° C for 3 hours, followed by T4. Recombinant myostatin prodomain expression plasmid was prepared using ligase.
pET32a-프로도메인, pET43-프로도메인, pMALp2x-프로도메인 및 pMALc2x-프로도메인으로 형질전환 시킨 대장균 BL21(DE3), BL21(DE3)pLyss, Origami2(DE3), Origami2(DE3)pLyss 및 Rogetta-gami2(DE3)pLyss 각각 (amp 50 ug/mL), (amp 50 ug/mL, cam 34 ug/mL), (amp 50 ug/mL), (amp 50 ug/mL, cam 34 ug/mL), (amp 50 ug/mL, cam 34 ug/mL) 이 포함된 LB 배지에서 37℃ OD600 0.4~0.5가 되었을 때 발현 유도제인 이소프로필-베타-D-티오갈락토피라노사이드(isopropyl-beta-D-thiogalactopyranoside; IPTG, Bioneer)를 최종농도 0.2 mM 되게 하여 37℃, 30℃, 18℃ 및 12.5℃에서 각각 4시간, 10시간, 16시간, 24시간 배양한 후 10,000g 로 20분 동안 원심분리하여 집균하였다.Escherichia coli BL21 (DE3), BL21 (DE3) pLyss, Origami2 (DE3), Origami2 (DE3) pLyss and Rogetta-gami2 transformed with pET32a-prodomain, pET43-prodomain, pMALp2x-prodomain and pMALc2x-prodomain DE3) pLyss (amp 50 ug / mL), (amp 50 ug / mL, cam 34 ug / mL), (amp 50 ug / mL), (amp 50 ug / mL, cam 34 ug / mL), (amp Isopropyl-beta-D-thiogalactopyranoside, an expression inducer, when expressed at 37 ° C OD600 0.4-0.5 in LB medium containing 50 ug / mL, cam 34 ug / mL) IPTG, Bioneer) was incubated at a final concentration of 0.2 mM and incubated at 37 ° C, 30 ° C, 18 ° C and 12.5 ° C for 4 hours, 10 hours, 16 hours and 24 hours, respectively, and centrifuged at 10,000 g for 20 minutes. .
pET32a-프로도메인, pET43-프로도메인, pMALp2x-프로도메인 및 pMALc2x-프로도메인으로 형질전환 시킨 대장균 BL21(DE3), BL21(DE3)pLyss, Origami2(DE3), Origami2(DE3)pLyss 및 Rogetta-gami2(DE3)pLyss들을 소량배양(5mL) 하여 얻은 균체는 10,000 g에서 20 분 동안 원심분리하여 집균하였고, 정제 전까지 -20℃ 에서 보관하였다. Escherichia coli BL21 (DE3), BL21 (DE3) pLyss, Origami2 (DE3), Origami2 (DE3) pLyss and Rogetta-gami2 transformed with pET32a-prodomain, pET43-prodomain, pMALp2x-prodomain and pMALc2x-prodomain Cells obtained by small incubation (5 mL) of DE3) pLyss were collected by centrifugation at 10,000 g for 20 minutes and stored at -20 ° C until purification.
형질전환된 pET32a-프로도메인, pET43-프로도메인, pMALp2x-프로도메인 및 pMALc2x-프로도메인 수용성 분획에 포함된 단백질들을 정제하기 위해 20 mM Tris-HCl(pH7.5), 200mM NaCl 완충용액으로 녹인 후, 초음파 파쇄기 (sonicator, misonic INC)를 이용하여 균체를 파쇄하여 10,000g 에서 15분 동안 원심분리를 통하여 수용성 분획을 얻은 후 SDS-PAGE를 이용하여 가용성 마이오스타틴 프로도메인의 유무를 확인하였다(표 2 참조).To purify the proteins contained in the transformed pET32a-prodomain, pET43-prodomain, pMALp2x-prodomain and pMALc2x-prodomain aqueous fractions, they were dissolved in 20 mM Tris-HCl (pH7.5), 200 mM NaCl buffer. After crushing the cells using an ultrasonic crusher (sonicator, misonic INC) to obtain an aqueous fraction by centrifugation at 10,000g for 15 minutes, the presence or absence of soluble myostatin prodomain using SDS-PAGE (Table 1) 2).
표 2 가용성 poMSTN 프로도메인을 얻기 위한 벡터의 조건, 호스트 세포 균주 및 유도 온도
벡터 대장균 균주
BL21(DE3) BL21(DE3)pLyss Origami2(DE3) Origami 2 (DE3)pLyss Rogetta-gami 2 (DE3)pLyss
온도(℃) 37 30 18 12.5 37 30 18 12.5 37 30 18 12.5 37 30 18 12.5 37 30 18 12.5
pET32a - - - - - - - - - - - - - - - - - - - ±
pET43.1a - - - - - - - - - - - - - - - - - - - -
pMAL p2x - - - - - - - - - - - - - - - - - - - -
pMAL c2x - - - - - - - - - - - - - - - - ± ± ± +
TABLE 2 Vectors, Host Cell Strains, and Induction Temperature of Vectors to Obtain Soluble poMSTN Prodomains
vector Escherichia coli strain
BL21 (DE3) BL21 (DE3) pLyss Origami2 (DE3) Origami 2 (DE3) pLyss Rogetta-gami 2 (DE3) pLyss
Temperature (℃) 37 30 18 12.5 37 30 18 12.5 37 30 18 12.5 37 30 18 12.5 37 30 18 12.5
pET32a - - - - - - - - - - - - - - - - - - - ±
pET43.1a - - - - - - - - - - - - - - - - - - - -
pMAL p2x - - - - - - - - - - - - - - - - - - - -
pMAL c2x - - - - - - - - - - - - - - - - ± ± ± +
+ : 재조합 가용성 프로도메인 단백질이 발현됨+: Recombinant soluble prodomain protein is expressed
- : 재조합 가용성 프로도메인 단백질이 발현되지 않음-: Recombinant soluble prodomain protein is not expressed
± : 재조합 가용성 프로도메인 단백질과 봉합체 (비가용성, inclusion body)가 동시 발현됨±: co-expression of recombinant soluble prodomain protein and inclusion body (insoluble, inclusion body)
작성한 발현벡터 pET32a-프로도메인, pET43-프로도메인, pMALp2x-프로도메인 및 pMALc2x-프로도메인의 수용성 단백질발현 조건을 설정하기 위하여 대장균 BL21(DE3), BL21(DE3)pLyss, Origami2(DE3), Origami2(DE3)pLyss 및 Rogetta-gami2(DE3)pLyss에 형질전환 시킨 후, LB배지 5mL 에서 약 3-4시간 정도 37℃에서 배양하였다. 배양액의 OD600 0.4-0.5 되었을 때 단백질 유도제인 IPTG를 최종농도 0.2 mM이 되도록 투여하여 각각 37℃ 4시간, 30℃ 10시간, 18℃ 12시간, 12.5℃ 24시간 동안 단백질발현을 유도되도록 하였다. 그 결과 Rogetta-gami2(DE3)pLyss에 형질전환된 pET32a-프로도메인 및 pMALc2x-프로도메인 에서 수용성 단백질이 발현된 것을 확인 할 수 있었다(표 2 및 도 3 및 도 4 참조).E. coli BL21 (DE3), BL21 (DE3) pLyss, Origami2 (DE3), Origami2 (DE3), Origami2 (DE3) to establish the water-soluble protein expression conditions of the expression vectors pET32a-prodomain, pET43-prodomain, pMALp2x-propdomain DE3) pLyss and Rogetta-gami2 (DE3) pLyss were transformed, and then cultured at 37 ° C. for about 3-4 hours in 5 mL of LB medium. When the OD600 0.4-0.5 of the culture solution, the protein inducer IPTG was administered to a final concentration of 0.2 mM to induce protein expression at 37 ° C. for 4 hours, 30 ° C. for 10 hours, 18 ° C. for 12 hours, and 12.5 ° C. for 24 hours, respectively. As a result, it was confirmed that water-soluble proteins were expressed in pET32a-prodomain and pMALc2x-prodomain transformed in Rogetta-gami2 (DE3) pLyss (see Table 2 and FIGS. 3 and 4).
발현벡터 pET32a-프로도메인 및 pMALc2x-프로도메인에 의해서 발현된 재조합 넙치 마이오스타틴 단백질의 분자량은 SDS-PAGE에서 각각 54 kDa, 80 kDa 위치에서 확인 되었다 (도 1 및 도 2 참조). IPTG 투여후의 배양시간을 설정하기 위하여 12시간, 24시간, 36시간, 48시간 배양한 후 각 시간에 따른 재조합 넙치 마이오스타틴의 발현 양을 조사해 보았다. 그 결과 24시간까지는 발현 양이 증가하였으나 48시간 동안 배양하였을 때에는 발현 양이 서서히 감소하였으며, 24시간과 36시간의 발현양의 차이는 거의 없었다 (도 5 및 도 6 참조). 따라서 재조합 넙치 마이오스타틴의 대장균에서의 최적 발현 조건은 배양액의 OD600이 0.4-0.5 정도 되었을 때 단백질 유도제인 0.2 mM IPTG를 투여후, 12.5도에서 24시간 배양하는 것이 가장 최적이었다.The molecular weights of the recombinant olive flounder myostatin protein expressed by the expression vectors pET32a-prodomain and pMALc2x-prodomain were identified at 54 kDa and 80 kDa positions in SDS-PAGE, respectively (see FIGS. 1 and 2). In order to set the incubation time after IPTG administration, the expression levels of recombinant halibut myostatin according to each time were examined after culturing for 12 hours, 24 hours, 36 hours, and 48 hours. As a result, the expression amount increased up to 24 hours, but when cultured for 48 hours, the expression amount gradually decreased, and there was almost no difference in the expression amount between 24 hours and 36 hours (see FIGS. 5 and 6). Therefore, the optimum expression condition of recombinant halibut myostatin in Escherichia coli was optimally incubated at 12.5 degrees for 24 hours after administration of 0.2 mM IPTG, a protein inducer, when the culture medium had an OD600 of 0.4-0.5.
본 실시예에서 발현유도제로 IPTG를 사용하였으나 0.001-10%의 Lactose를 사용하여도 좋으며, 온도 범위는 본 실시예에서는 12.5℃-37℃까지 기재하였으나, pET32a-프로도메인의 경우는 0℃-15℃, pMALc2x-프로도메인의 경우는 0℃-50℃에서도 각각 수용성 단백질이 발현되었다. 아울러, 본 실시예에서는 발현유도제로 IPTG의 농도를 0.2 mM로 하였으나, 실험방법에 따라서는 0.001-10mM까지 사용하여도 좋다.In this example, IPTG was used as the expression inducing agent, but Lactose of 0.001-10% may be used, and the temperature range is described as 12.5 ° C.-37 ° C. in this example, but 0 ° C.-15 ° for pET32a-prodomain. In the case of ° C and pMALc2x-prodomain, water-soluble proteins were expressed at 0 ° C to 50 ° C, respectively. In addition, in the present embodiment, the concentration of IPTG was 0.2 mM as the expression inducing agent, but depending on the experimental method, it may be used up to 0.001-10 mM.
본 실시예에서는 발현 벡터등을 대장균에서 형질 전환시켰으나, 효모(yeast)등에서 형질 전환하여도 본 발명의 권리범위에 속하는 것은 자명하다.In the present embodiment, expression vectors and the like were transformed in E. coli, but it is obvious that even if transformed in yeast or the like falls within the scope of the present invention.
실시예 3 : 재조합 넙치 마이오스타틴 프로도메인의 정제 Example 3 Purification of Recombinant Flounder Myostatin Prodomains
pET32a-프로도메인, pMALc2x-프로도메인으로 형질전환시킨 대장균 Rogetta-gami2(DE3)pLyss들을 배양(250mL)하여 얻은 균체는 4,000 g에서 30 분동안 원심분리하였고, 정제 전까지 -20℃에서 보관하였다.Cells obtained by culturing (250 mL) E. coli Rogetta-gami2 (DE3) pLyss transformed with pET32a-prodomain and pMALc2x-prodomain were centrifuged at 4,000 g for 30 minutes and stored at -20 ° C until purification.
형질전환된 pET32a-프로도메인 수용성 분획에 포함된 단백질 정제를 위하여 재조합 단백질 용액을 20 mM 인산염 (pH8.0), 300 mM NaCl, 10 mM 이미다졸 완충용액으로 평형시킨 고정된 금속 친화성(immobilized metal affinity) 컬럼(Ni-NTA agarose, Qiagen)에 흡착시켰다. 컬럼 내의 불필요한 단백질을 제거하기 위해 20 mM 인산염(pH8.0), 300 mM NaCl, 10 mM 이미다졸 완충용액으로 충분히 세척한 다음, 30 mM 이미다졸을 포함하고 있는 20 mM 인산염(pH8.0), 300mM NaCl 완충용액으로 용출시켰다(도 7 참조).Immobilized metals in which the recombinant protein solution was equilibrated with 20 mM phosphate (pH8.0), 300 mM NaCl, 10 mM imidazole buffer solution for purification of the protein contained in the transformed pET32a-prodomain aqueous fraction. affinity) column (Ni-NTA agarose, Qiagen). Wash thoroughly with 20 mM phosphate (pH 8.0), 300 mM NaCl, 10 mM imidazole buffer to remove unnecessary protein in the column, then 20 mM phosphate (pH 8.0) containing 30 mM imidazole, Eluted with 300 mM NaCl buffer (see FIG. 7).
형질전환된 pMALc2x-프로도메인 수용성 분획에 포함된 단백질 정제를 위하여 재조합 단백질 용액을 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA 완충용액으로 평형시킨 아밀로오스 수지(New England BioLab)에 흡착시켰다. 컬럼 내의 불필요한 단백질 제거를 위해 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA 완충용액으로 충분히 세척한 다음, 10 mM 말토오스를 포함하고 있는 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA 완충용액으로 용출시켰다(도 8 참조).Recombinant protein solutions were adsorbed onto amylose resin (New England BioLab) equilibrated with 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA buffer for protein purification in the transformed pMALc2x-prodomain water soluble fraction. Wash thoroughly with 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA buffer to remove unnecessary protein in the column, then 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA buffer containing 10 mM maltose. Eluted (see FIG. 8).
SEGC(Size exclusion gel chromatography)는 TSK G3000칼럼 (Tosho)를 이용하였으며, 20mM Phosphate buffer (pH8.0), 300 mM NaCl으로 평형시킨 후 같은 용액으로 용출속도가 0.3mL/min가 되도록 하였고, 280nm에서의 흡광도를 측정하여 0.2mL씩 분획을 모았다(도 9 및 10 참조). Size exclusion gel chromatography (SEGC) was TSK G3000 column (Tosho), equilibrated with 20 mM Phosphate buffer (pH8.0) and 300 mM NaCl, and the elution rate was 0.3mL / min with the same solution. The absorbance was measured to collect fractions by 0.2 mL (see FIGS. 9 and 10).
재조합 pET32a-프로도메인 과 pMALc2x-프로도메인 마이오스타틴 단백질을 니켈 친화도 컬럼을 이용하여 정제 한 결과를 SDS-PAGE를 통하여 확인 하였으며 약 54 kDa과 80 kDa에서 밴드가 확인 되었다. 친화도 크로마토그래피 후 전체 수용성 단백질에 대한 pET32a-프로도메인 과 pMALc2x-프로도메인의 회수율은 각각 약 1.5% 및 1.8% 였으며, 크기 배제 겔 크로마토그래피 후 pET32a-프로도메인과 pMALc2x-프로도메인의 전체 수용성단백질에대한 회수율은 각각 0.6%, 0.8% 였다(표 3, 도 11 내지 12 참조).Purification of recombinant pET32a-prodomain and pMALc2x-prodomain myostatin proteins using a nickel affinity column was confirmed by SDS-PAGE, and the bands were identified at about 54 kDa and 80 kDa. The recovery of pET32a-prodomain and pMALc2x-prodomain against total water soluble protein after affinity chromatography was about 1.5% and 1.8%, respectively, and the total water soluble protein of pET32a-prodomain and pMALc2x-prodomain after size exclusion gel chromatography. The recovery rates were 0.6% and 0.8%, respectively (see Table 3, FIGS. 11-12).
표 3 정제 단계 동안 가용성 pET32a poMSTN 및 pMALc2x poMSTN 프로도메인의 수율 및 회수량
정제 단계(pET32a-프로도메인) 단백질 회수(mg)a 수율 (%) 정제 단계(pMALc2x-프로도메인) 단백질 회수(mg)a 수율 (%)
총 단백질 5.33±0.08 100 총 단백질 3.87 ± 0.17 100
가용성 단백질 3.38±0.10 69 가용성 단백질 3.40 ± 0.23 88
친화도 크로마토그래피 0.08±0.002 1.5 친화도 크로마토그래피 0.07 ± 0.005 1.8
크기배제 크로마토그래피 0.03±0.002 0.6 크기배제 크로마토그래피 0.03 ± 0.002 0.8
TABLE 3 Yield and recovery of soluble pET32a poMSTN and pMALc2x poMSTN prodomains during the purification step
Purification step (pET32a-prodomain) Protein Recovery (mg) a Yield (%) Purification step (pMALc2x-prodomain) Protein Recovery (mg) a Yield (%)
Total protein 5.33 ± 0.08 100 Total protein 3.87 ± 0.17 100
Soluble protein 3.38 ± 0.10 69 Soluble protein 3.40 ± 0.23 88
Affinity Chromatography 0.08 ± 0.002 1.5 Affinity Chromatography 0.07 ± 0.005 1.8
Exclusion Chromatography 0.03 ± 0.002 0.6 Exclusion Chromatography 0.03 ± 0.002 0.8
a 단백질 농도는 표준물질로 BSA를 이용하는 브래드포드 방법으로 측정하였음. a Protein concentration was determined by Bradford method using BSA as a standard.
실시예 4 : 재조합 pET32a-프로도메인과 pMALc2x-프로도메인 단백질의 마이오스타틴 억제 활성도 측정 Example 4 Determination of Myostatin Inhibitory Activity of Recombinant pET32a-Prodomain and pMALc2x-Prodomain Protein
In vitro 분석은 A204 세포들은 96-웰 플레이트에 100 uL 당 30,000 세포들을 접종하였으며, 10 % 우태아혈청이 포함된 DMEM 에서 24시간동안 성장시켰다. 24시간후, 0.15 ug의 pGL3(CAGA)12DNA와 1 uL의 푸겐(Fugene)(상표명)를 트렌스펙션 하였다. 24시간 후 2.5 ng/mL의 마이오스타틴(GDF-8, R&D Systems)과 여러 농도의 pET32a-프로도메인과 pMALc2x-프로도메인 단백질을 첨가하였다. 마이오스타틴 과 재조합 프로도메인 단백질을 첨가한 후 24시간에 루시페라아제 활성도를 측정하였다(Luciferase Assay System, Promega).In vitro analysis showed that A204 cells were seeded with 30,000 cells per 100 uL in 96-well plates and grown for 24 hours in DMEM containing 10% fetal calf serum. After 24 hours, 0.15 ug of pGL3 (CAGA) 12 DNA and 1 uL of Fugene (trade name) were transfected. After 24 hours, 2.5 ng / mL myostatin (GDF-8, R & D Systems) and various concentrations of pET32a-prodomain and pMALc2x-prodomain protein were added. Luciferase activity was measured 24 hours after the addition of myostatin and recombinant prodomain protein (Luciferase Assay System, Promega).
재조합 pMALc2x-프로도메인 단백질은 31 ng/mL 일 때부터 마이오스타틴 활성이 감소하는 것으로 나타났으며, 1 ug/mL일 때 완전하게 마이오스타틴 활성을 억제하였다. 재조합 pET32a-프로도메인 단백질은 1, 2, 및 4 ug/mL 일때 루시페라아제 활성이 감소하였다. 이것은 재조합 pET32a-프로도메인 단백질은 마이오스타틴 활성을 억제하나 100% 마이오스타틴 활성 억제를 하지는 않는다. 이것으로서 pET32a-프로도메인은 pMALc2x-프로도메인에 비하여 낮게 마이오스타틴 억제 활성을 갖는 것으로 나타났다(도 13 참조).Recombinant pMALc2x-prodomain protein was found to decrease myostatin activity from 31 ng / mL, and completely inhibited myostatin activity at 1 ug / mL. Recombinant pET32a-prodomain protein decreased luciferase activity at 1, 2, and 4 ug / mL. This suggests that recombinant pET32a-prodomain protein inhibits myostatin activity but does not inhibit 100% myostatin activity. As a result, pET32a-prodomain was shown to have myostatin inhibitory activity lower than that of pMALc2x-prodomain (see FIG. 13).
In vivo 분석은 무지개송어의 치어를 이용하여 한달 동안 시행하고 무게, 단백질함량 및 지방함량 등을 측정하였다. pET32a-프로도메인과 pMALc2x-프로도메인 단백질에 대한 성장실험은 무지개 송어 (0.9g, 360개체)를 이용하였고, 각 실험구는 실험시작하기전 일주일전에 50L 수조에 적응하였다. pET32a-프로도메인, pMALc2x-프로도메인으로 형질전환시킨 대장균 Rogetta-gami2(DE3)pLyss들은 단백질 유도제인 0.2M IPTG를 이용하여 12.5도에서 24시간 발현 한 후 4,000 g에서 30 분동안 원심분리하였고, 얻은 대장균은 초음파파쇄기를 이용하여 파쇄한 후, 원심분리기를 이용하여 수용성 재조합단백질이 포함된 상등액을 얻었다. 얻은 상등액을 이용하여 무지개송어 성장실험에 사용하였다. 두 재조합단백질을 처리하기 전, 사이폰(siphon)를 이용하여 청소를 한 후, 1L로 배양수조의 물을 맞추고, 준비된 재조합단백질을 (pET32a-프로도메인과 pMALc2x-프로도메인) 포함한 상등액을 첨가하였다. 처리구의 재조합단백질의 농도는 각각 물 1L에 재조합단백질이 0.05mg, 0.1 mg이 되게 하였다. 대조구는 형질전환하지 않은 대장균 Rogetta-gami2(DE3)pLyss의 상등액을 0.1mg/L가 되게 하였다. 처리시간은 120분동안 하였고 일주일에 2번, 4주동안 시행하였다. 그리고 성장의 효과는 몸무게 변화로 확인하고 실험 종료후, 단백질 및 지방함량 등의 생화학적 분석을 하였다. 침지를 통하여 실험한 결과 처리한 가용성 재조합 마이오스타틴 농도에 따라서 성장의 효과가 나타났다. pET32a-프로도메인 단백질의 경우 0.05mg을 처리한 실험구에서는 4주 후 대조구에 비하여 몸무게가 117% 증가 하였고, 0.1mg처리한 실험구는 128% 증가하였다 (p<0.05). 하지만, 단백질 및 지방의 함량 (mg/g)은 대조구에 비하여 큰 차이가 나타나지 않았다. pMALc2x-프로도메인 단백질의 경우 0.05mg을 처리한 실험구는 4주후에 대조구에 비하여 몸무게가 126% 증가하였고, 0.1mg처리한 실험구는 142% 증가하였다 (p<0.05). 또한 단백질함량 (mg/g)의 경우 0.05mg처리한 실험구는 대조구에 비하여 g당 3mg, 0.1mg처리한 실험구는 g당 6mg이 증가한 것으로 나타났다 (p<0.05). 하지만, 지방의 함량은 유의성이 없는 것으로 나타났지만, 평균값은 다소 감소하는 것으로 보인다 (p>0.05). pET32a-프로도메인보다 pMALc2x-프로도메인이 훨씬 더 높은 성장의 효과와 단백질함량이 높은 것으로 나타났다. 이것은 in vitro에서와 마찬가지로 in vivo 실험에서도 pMALc2x-프로도메인 단백질이 pET32a-프로도메인 단백질보다 마이오스타틴의 활성을 더 억제하는 것으로 나타났다 (도 14 참조). 대장균에서 수용성 재조합 pET32a-프로도메인과 pMALc2x-프로도메인 단백질은 in vivo와 in vitro 분석 결과 마이오스타틴단백질의 활성을 억제하여 성장의 효과 및 단백질 함량이 증가되는것으로 나타났다. 그러므로 발현 벡터 pET32a 및 pMALc2x에 삽입시켜 대장균 Rogetta-gami2(DE3)pLyss에서 가용성 마이오스타틴 프로도메인을 발현 및 재조합단백질 생산의 방법을 통하여 동식물의 근육성장 촉진 또는 증체율 향상용 또는 저지방 사료첨가제 뿐만 아니라 근위축증이나 근이영양증 등 근육관련질환 예방 및 치료용 약학 조성물로 사용할 수 있을 것으로 사료된다.In vivo analysis was performed for one month using rainbow trout and the weight, protein content and fat content were measured. Growth experiments for pET32a-prodomain and pMALc2x-prodomain proteins were performed with rainbow trout (0.9g, 360 individuals), and each experimental group was adapted to a 50L tank one week before the experiment. Escherichia coli Rogetta-gami2 (DE3) pLyss transformed with pET32a-prodomain and pMALc2x-prodomain were expressed 24 hours at 12.5 ° C using 0.2M IPTG, a protein inducer, and then centrifuged at 4,000 g for 30 minutes. E. coli was crushed using an ultrasonic crusher, and then a supernatant containing a water-soluble recombinant protein was obtained using a centrifuge. The obtained supernatant was used for the rainbow trout growth experiment. Before treating the two recombinant proteins, the cells were cleaned using siphon, and then, the water of the culture tank was adjusted to 1 L, and the supernatant containing the prepared recombinant proteins (pET32a-prodomain and pMALc2x-prodomain) was added. . The concentration of recombinant protein in the treatment group was 0.05 mg and 0.1 mg of the recombinant protein in 1 L of water, respectively. The control was allowed to give a supernatant of untransformed E. coli Rogetta-gami2 (DE3) pLyss to 0.1 mg / L. Treatment time was 120 minutes and was performed twice a week for 4 weeks. And the growth effect was confirmed by weight change, and after the experiment, biochemical analysis of protein and fat content. Experimental results showed the effect of growth depending on the concentration of soluble recombinant myostatin treated. In the experimental group treated with 0.05 mg of pET32a-prodomain protein, body weight increased by 117% compared to the control group after 4 weeks, and the experimental group treated with 0.1 mg increased 128% (p <0.05). However, the protein and fat content (mg / g) did not show a significant difference compared to the control. In the pMALc2x-prodomain protein, 0.05 mg treatment group gained 126% weight after 4 weeks, and 0.1 mg treatment group increased 142% (p <0.05). In addition, in the case of protein content (mg / g), the experimental group treated with 0.05 mg was increased by 3 mg per g, and the experimental group treated with 0.1 mg 6 mg per g compared to the control (p <0.05). However, although the fat content appeared to be insignificant, the mean value seems to decrease slightly (p> 0.05). pMALc2x-prodomains showed much higher growth effects and higher protein content than pET32a-prodomains. It was shown that pMALc2x-prodomain protein inhibited myostatin activity more than pET32a-prodomain protein in vitro experiments as well as in vitro (see FIG. 14). In Escherichia coli, the water-soluble recombinant pET32a-prodomain and pMALc2x-prodomain proteins showed in vivo and in vitro assays to inhibit the activity of myostatin protein, increasing the growth effect and protein content. Therefore, expression of soluble myostatin prodomains in Escherichia coli Rogetta-gami2 (DE3) pLyss by inserting them into expression vectors pET32a and pMALc2x to promote muscle growth or increase the weight gain of plants and animals, or to reduce atrophy as well as low fat feed additives. It can be used as a pharmaceutical composition for the prevention and treatment of muscle-related diseases such as muscular dystrophy.
표 4
파라미터 실험군 통계적 분석
대조군 pT 50 pT 100 pM 50 pM 100
체증 (g) e1.45±0.07 bcd1.70±0.05 bcd1.86±0.05 bcd1.84±0.08 a2.06±0.08 p<0.05
HIS 2.22±0.17 1.84±0.14 1.72±0.11 2.04±0.11 2.10±0.12 p>0.05
근육내 수분 (%) bcd77.65±0.36 bcd77.54±0.13 bcd77.43±0.90 a81.45±1.20 e75.93±1.40 p<0.05
근육 단백질 농도 (mg g-1) cde163.1±0.7 cde161.0±0.35 cde162.3±0.83 b166.8±1.2 a169.4±0.5 p<0.05
지방 농도 (mg g-1) 29±1.9 30±1.3 27±1.3 26±4.0 23±0.9 p>0.05
ASH 농도 (mg g-1) bcd37.2±1.70 bcd38.6±0.95 bcd39±0.80 e26.2±0.70 a42.7±2.02 p<0.05
Table 4
parameter Experimental group Statistical analysis
Control pT
50 pT 100 pM 50 pM 100
Jam (g) e 1.45 ± 0.07 bcd 1.70 ± 0.05 bcd 1.86 ± 0.05 bcd 1.84 ± 0.08 a 2.06 ± 0.08 p <0.05
HIS 2.22 ± 0.17 1.84 ± 0.14 1.72 ± 0.11 2.04 ± 0.11 2.10 ± 0.12 p> 0.05
Intramuscular moisture (%) bcd 77.65 ± 0.36 bcd 77.54 ± 0.13 bcd 77.43 ± 0.90 a 81.45 ± 1.20 e 75.93 ± 1.40 p <0.05
Muscle Protein Concentration (mg g-1) cde 163.1 ± 0.7 cde 161.0 ± 0.35 cde 162.3 ± 0.83 b 166.8 ± 1.2 a 169.4 ± 0.5 p <0.05
Fat concentration (mg g-1) 29 ± 1.9 30 ± 1.3 27 ± 1.3 26 ± 4.0 23 ± 0.9 p> 0.05
ASH concentration (mg g-1) bcd 37.2 ± 1.70 bcd 38.6 ± 0.95 bcd 39 ± 0.80 e 26.2 ± 0.70 a 42.7 ± 2.02 p <0.05
별첨enclosure

Claims (14)

  1. 생물 조직의 마이오스타틴을 이용하여 마이오스타틴 프로도메인 유전자를 클로닝하는 단계; Cloning the myostatin prodomain gene using myostatin of a biological tissue;
    상기 생물 마이오스타틴 프로도메인을 발현 벡터에 삽입시키는 단계; Inserting the biological myostatin prodomain into an expression vector;
    상기 발현 벡터 결합 마이오스타틴 프로도메인을 대장균에서 형질전환시켜 발현유도제를 첨가하여 가용성 마이오스타틴 프로도메인의 재조합 단백질을 발현시키는 단계; 및 Transforming the expression vector-binding myostatin prodomain into E. coli to express an recombinant protein of soluble myostatin prodomain by adding an expression inducing agent; And
    상기 형질전환된 가용성 마이오스타틴 프로도메인의 재조합 단백질을 정제하는 단계Purifying the recombinant protein of the transformed soluble myostatin prodomain
    로 이루어진 마이오스타틴의 기능을 억제하는 가용성 마이오스타틴 프로도메인의 재조합 단백질 생산방법.Method for producing a recombinant protein of soluble myostatin prodomain that inhibits the function of myostatin consisting of.
  2. 제1항에 있어서, 상기 마이오스타틴 프로도메인은 육상생물, 해양생물 중에서 선택되는 어느 하나인 것이 특징인 재조합 단백질의 생산방법.The method of claim 1, wherein the myostatin prodomain is any one selected from terrestrial and marine organisms.
  3. 제1항에 있어서, 상기 마이오스타틴 프로도메인은, 소, 래트, 마우스, 돼지, 닭, 칠면조, 양, 인간, 개, 청둥오리, 메추라기, 필리핀원숭이, 로랜드고릴라, 전복, 돌가자미, 가자미, 조피볼락, 틸라피아, 참돔, 감성돔, 자주복, 송어, 연어, 메기, 로티퍼 또는 넙치의 마이오스타틴 프로도메인 것을 특징으로 하는 가용성 마이오스타틴 프로도메인의 재조합 단백질 생산방법.The method according to claim 1, wherein the myostatin prodomain is cow, rat, mouse, pig, chicken, turkey, sheep, human, dog, mallard, quail, Philippine monkey, roland gorilla, abalone, stone flounder, flounder, A method for producing a recombinant protein of soluble myostatin prodomain, characterized in that it is myostatin prodomain of zodiac rock, tilapia, red sea bream, black sea bream, volcano, trout, salmon, catfish, rotifer or flounder.
  4. 제1항에 있어서, 상기 발현 벡터가 pET32a, pET43.a, pMALp2x 및 pMALc2x로 구성된 군으로부터 선택된 것임을 것을 특징으로 하는 가용성 마이오스타틴 프로도메인의 재조합 단백질 생산방법.The method of claim 1, wherein the expression vector is selected from the group consisting of pET32a, pET43.a, pMALp2x and pMALc2x.
  5. 제1항에 있어서, 상기 대장균은 BL21(DE3), BL21(DE3)pLyss, origami2(DE3), Origami2(DE3)pLyss 및 Rogetta-gami2(DE3)pLyss로 구성된 군으로부터 선택된 것을 특징으로 하는 가용성 마이오스타틴 프로도메인의 재조합 단백질 생산방법.According to claim 1, wherein the E. coli is soluble myo, characterized in that selected from the group consisting of BL21 (DE3), BL21 (DE3) pLyss, origami2 (DE3), Origami2 (DE3) pLyss and Rogetta-gami2 (DE3) pLyss. Method for producing recombinant protein of statin prodomains.
  6. 제1항에 있어서, 상기 단백질 발현 유도제는 0.001-10 mM IPTG The method of claim 1, wherein the protein expression inducing agent is 0.001-10 mM IPTG
    또는 0.001-10%의 Lactose 임을 특징으로 하는 가용성 마이오스타틴 프로도메인의 재조합 단백질 생산방법.Or 0.001-10% Lactose, characterized in that the recombinant protein production method of soluble myostatin prodomain.
  7. 제1항의 방법으로 생산된 생물의 마이오스타틴의 기능을 억제하는 가용성 마이오스타틴 프로도메인의 재조합 단백질을 첨가하여 0℃-50℃에서 발현시킴을 특징으로 하는 가용성 마이오스타틴 프로도메인의 재조합 단백질 생산방법.Recombinant protein of soluble myostatin prodomain, characterized in that the recombinant protein of soluble myostatin prodomain that inhibits the function of myostatin of the organism produced by the method of claim 1 is added and expressed at 0 ℃ -50 ℃ Production method.
  8. 제7항에 있어서, 상기 가용성 마이오스타틴 프로도메인의 재조합 단백질이 pMALc2x-프로도메인 단백질 또는 pET32a-프로도메인 단백질인 것을 특징으로 하는 가용성 마이오스타틴 프로도메인의 재조합 단백질. 8. The recombinant protein of claim 7 wherein the recombinant protein of soluble myostatin prodomain is a pMALc2x-prodomain protein or a pET32a-prodomain protein.
  9. 제8항에 있어서, 상기 pMALc2x-프로도메인 단백질 또는 pET32a-프로도메인 단백질의 프로도메인이 서열번호 1 내지 26의 소(서열번호 1), 래트(서열번호 2), 마우스(서열번호 3), 돼지(서열번호 4), 닭(서열번호 5), 칠면조(서열번호 6), 양(서열번호 7), 인간(서열번호 8), 개(서열번호 9), 청둥오리(서열번호 10), 메추라기(서열번호 11), 필리핀원숭이(서열번호 12), 로랜드고릴라(서열번호 13), 전복(서열번호 14), 돌가자미(서열번호 15), 가자미(서열번호 16), 조피볼락(서열번호 17), 틸라피아(서열번호 18), 참돔(서열번호 19), 감성돔(서열번호 20), 자주복(서열번호 21), 무지개송어(서열번호 22), 연어(서열번호 23), 메기(서열번호 24), 로티퍼(서열번호 25) 또는 넙치(서열번호 26)의 마이오스타틴 프로도메인 것을 특징으로 하는 가용성 마이오스타틴 프로도메인의 재조합 단백질.The method of claim 8, wherein the pMALc2x-prodomain protein or pET32a-prodomain protein of the prodomain of the cow of SEQ ID NO: 1 to 26 (SEQ ID NO: 1), rat (SEQ ID NO: 2), mouse (SEQ ID NO: 3), pig (SEQ ID NO: 4), chicken (SEQ ID NO: 5), turkey (SEQ ID NO: 6), sheep (SEQ ID NO: 7), human (SEQ ID NO: 8), dog (SEQ ID NO: 9), mallard (SEQ ID NO: 10), quail (SEQ ID NO: 11), Philippine Monkey (SEQ ID NO: 12), Lowland Gorilla (SEQ ID NO: 13), Abalone (SEQ ID NO: 14), Stone Fluke (SEQ ID NO: 15), Fluke (SEQ ID NO: 16), Zoffevolak (SEQ ID NO: 17) , Tilapia (SEQ ID NO: 18), red sea bream (SEQ ID NO: 19), black sea bream (SEQ ID NO: 20), self-defense (SEQ ID NO: 21), rainbow trout (SEQ ID NO: 22), salmon (SEQ ID NO: 23), catfish (SEQ ID NO: 24) ), Recombinant protein of soluble myostatin prodomain, characterized in that iostatin prodomain of rotifer (SEQ ID NO: 25) or halibut (SEQ ID NO: 26) .
  10. 제8항에 있어서, 상기 pMALc2x-프로도메인 단백질이 서열번호 27 내지 52로 구성된 군으로부터 선택된 pMALc2x-프로도메인 단백질인 것을 특징으로 하는 가용성 마이오스타틴 프로도메인의 재조합 단백질.The recombinant protein of soluble myostatin prodomain according to claim 8, wherein the pMALc2x-prodomain protein is a pMALc2x-prodomain protein selected from the group consisting of SEQ ID NOs: 27-52.
  11. 제7항에 있어서, 상기 pET32a-프로도메인 단백질이 서열번호 53 내지 78로 구성된 군으로부터 선택된 pET32a-프로도메인 단백질인 것을 특징으로 하는 가용성 마이오스타틴 프로도메인의 재조합 단백질.The recombinant protein of soluble myostatin prodomain according to claim 7, wherein the pET32a-prodomain protein is a pET32a-prodomain protein selected from the group consisting of SEQ ID NOs: 53-78.
  12. 제7항에 따른 가용성 마이오스타틴 프로도메인의 재조합 단백질을 유효성분으로 함유하는 동식물의 근육성장 촉진 또는 증체율 향상용 사료첨가제 조성물.A feed additive composition for promoting muscle growth or improving the growth rate of animals and plants containing a recombinant protein of soluble myostatin prodomain according to claim 7.
  13. 제7항에 따른 가용성 마이오스타틴 프로도메인의 재조합 단백질을 유효성분으로 함유하여 마이오스타틴의 활성을 저해하는 근위축증, 근이영양증, 근육소실성 질환을 포함하는 근육질환관련 예방 및 치료용 약제학적 조성물.A pharmaceutical composition for preventing and treating muscle diseases, including muscular dystrophy, muscular dystrophy, and muscular loss, which comprises the recombinant protein of soluble myostatin prodomain according to claim 7 to inhibit the activity of myostatin.
  14. 제7항에 따른 가용성 마이오스타틴 프로도메인의 재조합 단백질을 유효성분으로 함유하는 근육성장 개선용 건강식품 조성물.A health food composition for improving muscle growth, comprising the recombinant protein of soluble myostatin prodomain according to claim 7 as an active ingredient.
PCT/KR2010/001385 2009-05-20 2010-03-05 Soluble myostatin pro-domain recombinant protein having myostatin inhibitory activity and use thereof WO2010134686A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2009-0044054 2009-05-20
KR20090044054 2009-05-20
KR1020100017002A KR20100125171A (en) 2009-05-20 2010-02-25 Soluble myostatin prodomain recombination protein having myostatin inhibitory activity and its use
KR10-2010-0017002 2010-02-25

Publications (2)

Publication Number Publication Date
WO2010134686A2 true WO2010134686A2 (en) 2010-11-25
WO2010134686A3 WO2010134686A3 (en) 2011-01-13

Family

ID=43126612

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/001385 WO2010134686A2 (en) 2009-05-20 2010-03-05 Soluble myostatin pro-domain recombinant protein having myostatin inhibitory activity and use thereof

Country Status (1)

Country Link
WO (1) WO2010134686A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20220135637A1 (en) * 2019-03-01 2022-05-05 Knc Laboratories Co., Ltd. Inhibition of myostatin signal by myostatin splice variant-derived protein and utilization thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040002927A (en) * 2001-04-24 2004-01-07 더 존스 홉킨스 유니버시티 Use of follistatin to increase muscle mass

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040002927A (en) * 2001-04-24 2004-01-07 더 존스 홉킨스 유니버시티 Use of follistatin to increase muscle mass

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FUNKENSTEIN, B. ET AL.: 'Expression, purification, renaturation and activation of fish myostatin expressed in Escherichia coli: Facilitation of refolding and activity inhibition by myostatin prodomain' PROTEIN EXPRESSION AND PURIFICATION. vol. 54, 12 February 2007, pages 54 - 65, XP022056635 *
XU, C. ET AL.: 'Analysis of myostatin gene structure, expression and function in zebrafish' J. EXPERIMENTAL BIOLOGY. vol. 206, 2003, pages 4067 - 4079 *
YANG, J. ET AL.: 'Expression of myostatin pro domain results in muscular transgenic mice' MOLECULAR REPRODUCTION AND DEVELOPMENT. vol. 60, 2001, pages 351 - 361, XP002444986 *
ZHONG, Q. ET AL.: 'The isolation and characterization of myostatin gene in Japanese flounder (Paralichthys olivaceus): Ubiquitous tissue expression and developmental specific regulation' AQUACULTURE. vol. 280, 01 August 2008, pages 247 - 255, XP022939456 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20220135637A1 (en) * 2019-03-01 2022-05-05 Knc Laboratories Co., Ltd. Inhibition of myostatin signal by myostatin splice variant-derived protein and utilization thereof

Also Published As

Publication number Publication date
WO2010134686A3 (en) 2011-01-13

Similar Documents

Publication Publication Date Title
Hobart et al. Cloning and sequence analysis of cDNAs encoding two distinct somatostatin precursors found in the endocrine pancreas of anglerfish
Chen et al. Molecular characterization and expression analysis of the IFN-gamma related gene (IFN-γrel) in grass carp Ctenopharyngodon idella
Garikipati et al. Characterization of rainbow trout myostatin-2 genes (rtMSTN-2a and-2b): genomic organization, differential expression, and pseudogenization
Huang et al. Characterization of Toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea
Bo et al. Characterization of interleukin-1β as a proinflammatory cytokine in grass carp (Ctenopharyngodon idella)
JP2019172693A (en) Peptide compositions
NZ511683A (en) Nucleotide and protein sequences of nogo genes and methods based thereon for treatment of diseases that result in damage to the central system
Jiang et al. Molecular characterization, recombinant expression and bioactivity analysis of the interleukin-1β from the yellowfin sea bream, Acanthopagrus latus (Houttuyn)
De et al. Identification of four CCCH zinc finger proteins in Xenopus, including a novel vertebrate protein with four zinc fingers and severely restricted expression
Du et al. A new antimicrobial peptide isoform, Pc-crustin 4 involved in antibacterial innate immune response in fresh water crayfish, Procambarus clarkii
US20150322460A1 (en) Compositions and methods for regulating thermogenesis and muscle inflammation using metrnl and metrn
Wang et al. Molecular characterization and expression analysis of large yellow croaker (Larimichthys crocea) interleukin-12A, 16 and 34 after poly I: C and Vibrio anguillarum challenge
Nam et al. Molecular and functional analyses of growth hormone-releasing hormone (GHRH) from olive flounder (Paralichthys olivaceus)
Lin et al. Molecular cloning and expression studies of the adapter molecule myeloid differentiation factor 88 (MyD88) in turbot (Scophthalmus maximus)
Huang et al. Molecular cloning and expression analysis of a fish specific interferon regulatory factor, IRF11, in orange spotted grouper, Epinephelus coioides
Pozzolini et al. Molecular characterization and expression analysis of the first Porifera tumor necrosis factor superfamily member and of its putative receptor in the marine sponge Chondrosia reniformis
US20050180949A1 (en) hC1Q/TNF7 and uses thereof
Mai et al. cDNA cloning, expression and antibacterial activity of lysozyme C in the blue shrimp (Litopenaeus stylirostris)
Lee et al. Myostatin inhibitory region of fish (Paralichthys olivaceus) myostatin-1 propeptide
AU2006244080C1 (en) Use of peptides derived from the growth factor AMP-18 for the treatment of mucositis
Han et al. Molecular characterization, expression and functional analysis of IRAK1 and IRAK4 in Nile tilapia (Oreochromis niloticus)
Wu et al. The roles of two myostatins and immune effects after inhibition in Qi river crucian carp (Carassius auratus)
CN102341407A (en) Modified omci as complement inhibitor
WO2010134686A2 (en) Soluble myostatin pro-domain recombinant protein having myostatin inhibitory activity and use thereof
WO2013129852A1 (en) Repebody for novel interleukin-6 and use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10777873

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10777873

Country of ref document: EP

Kind code of ref document: A2