WO2010129799A2 - Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene - Google Patents
Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene Download PDFInfo
- Publication number
- WO2010129799A2 WO2010129799A2 PCT/US2010/033908 US2010033908W WO2010129799A2 WO 2010129799 A2 WO2010129799 A2 WO 2010129799A2 US 2010033908 W US2010033908 W US 2010033908W WO 2010129799 A2 WO2010129799 A2 WO 2010129799A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- oligonucleotide
- antisense
- disease
- lipid transport
- metabolism gene
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/10—Drugs for disorders of the urinary system of the bladder
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/30—Drugs for disorders of the nervous system for treating abuse or dependence
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
- A61P27/06—Antiglaucoma agents or miotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01043—Phosphatidylcholine-sterol O-acyltransferase (2.3.1.43), i.e. lecithin-cholesterol acyltransferase or LCAT
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/313—Phosphorodithioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/314—Phosphoramidates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
Definitions
- Embodiments of the invention comprise oligonucleotides modulating expression and/or function of a Lipid transport and metabolism gene and associated molecules.
- DNA-RNA and RNA-RNA hybridization are important to many aspects of nucleic acid function including DNA replication, transcription, and translation. Hybridization is also central to a variety of technologies that either detect a particular nucleic acid or alter its expression. Antisense nucleotides, for example, disrupt gene expression by hybridizing to target RNA, thereby interfering with RNA splicing, transcription, translation, and replication. Antisense DNA has the added feature that DNA-RNA hybrids serve as a substrate for digestion by ribonuclease H, an activity that is present in most cell types.
- Antisense molecules can be delivered into cells, as is the case for oligodeoxynucleotides (ODNs), or they can be expressed from endogenous genes as RNA molecules.
- ODNs oligodeoxynucleotides
- VITRAVENETM for treatment of cytomegalovirus retinitis
- the invention provides methods for inhibiting the action of a natural antisense transcript by using antisense oligonucleotide(s) targeted to any region of the natural antisense transcript resulting in up-regulation of the corresponding sense gene. It is also contemplated herein that inhibition of the natural antisense transcript can be achieved by siRNA, ribozymes and small molecules, which are considered to be within the scope of the present invention.
- One embodiment provides a method of modulating function and/or expression of a Lipid transport and metabolism gene polynucleotide in patient cells or tissues in vivo or in vitro comprising contacting said cells or tissues with an antisense oligonucleotide 5 to 30 nucleotides in length wherein said oligonucleotide has at least 50% sequence identity to a reverse complement of a polynucleotide comprising 5 to 30 consecutive nucleotides within nucleotides 1 to 1299 of SEQ ID NO: 8, l to 918 of SEQ ID NO: 9, 1 to 1550 of SEQ ID NO: 10, 1 to 329 of SEQ ID NO: 11, 1 to 1826 of SEQ ID NO: 12, 1 to 536 of SEQ ID NO: 13, 1 to 551 of SEQ ID NO: 14, 1 to 672 of SEQ ID NO: 15, 1 to 616 of SEQ ID NO: 16, 1 to 471 of SEQ ID NO: 17, 1 to 707 of SEQ ID NO: 18, 1 to 741 of S
- an oligonucleotide targets a natural antisense sequence of a Lipid transport and metabolism gene polynucleotide, for example, nucleotides set forth in SEQ ID NO: 8 to 22, and any variants, alleles, homologs, mutants, derivatives, fragments and complementary sequences thereto.
- antisense oligonucleotides are set forth as SEQ ID NOS: 23 to 263 ( Figure 4 to 9).
- Another embodiment provides a method of modulating function and/or expression of a Lipid transport and metabolism gene polynucleotide in patient cells or tissues in vivo or in vitro comprising contacting said cells or tissues with an antisense oligonucleotide 5 to 30 nucleotides in length wherein said oligonucleotide has at least 50% sequence identity to a reverse complement of the an antisense of the Lipid transport and metabolism gene polynucleotide; thereby modulating function and/or expression of the Lipid transport and metabolism gene polynucleotide in patient cells or tissues in vivo or in vitro.
- Another embodiment provides a method of modulating function and/or expression of a Lipid transport and metabolism gene polynucleotide in patient cells or tissues in vivo or in vitro comprising contacting said cells or tissues with an antisense oligonucleotide 5 to 30 nucleotides in length wherein said oligonucleotide has at least 50% sequence identity to an antisense oligonucleotide to a Lipid transport and metabolism gene antisense polynucleotide; thereby modulating function and/or expression of the Lipid transport and metabolism gene polynucleotide in patient cells or tissues in vivo or in vitro.
- a composition comprises one or more antisense oligonucleotides which bind to sense and/or antisense Lipid transport and metabolism gene polynucleotides.
- the oligonucleotides comprise one or more modified or substituted nucleotides.
- the oligonucleotides comprise one or more modified bonds.
- the modified nucleotides comprise modified bases comprising phosphorothioate, methylphosphonate, peptide nucleic acids, 2'-O-methyl, fluoro- or carbon, methylene or other locked nucleic acid (LNA) molecules.
- the modified nucleotides are locked nucleic acid molecules, including ⁇ -L-LNA.
- the oligonucleotides are administered to a patient subcutaneously, intramuscularly, intravenously or intraperitoneally. [0015] In another preferred embodiment, the oligonucleotides are administered in a pharmaceutical composition. A treatment regimen comprises administering the antisense compounds at least once to patient; however, this treatment can be modified to include multiple doses over a period of time. The treatment can be combined with one or more other types of therapies. [0016] In another preferred embodiment, the oligonucleotides are encapsulated in a liposome or attached to a carrier molecule (e.g. cholesterol, TAT peptide). [0017] Other aspects are described infra.
- Figure 1 is a graph of real time PCR results showing the fold change + standard deviation in ABCAl mRNA after treatment of 518A2 cells with siRNA oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real time PCR results show that the levels of ABCAl mRNA in 518A2 cells are significantly increased 48 h after treatment with one of the siRNAs designed to ABCAl antisense AK311445. Bars denoted as CUR-0521, CUR-0519 and CUR-0523correspond to samples treated with SEQ ID NOS: 23 to 25 respectively.
- Figure IB is a graph of real time PCR results showing the fold change + standard deviation in ABCAl mRNA after treatment of 518A2 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real time PCR results show that the levels of ABCAl mRNA in 518A2 cells are significantly increased 48 h after treatment with six of the oligos designed to ABCAl antisense AK311445. Bars denoted as CUR- 1214 to CUR- 1222 correspond to samples treated with SEQ ID NOS: 26 to 34 respectively.
- Figure 1C is a graph of real time PCR results showing the fold change + standard deviation in ABCAl mRNA after treatment of 3T3 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real time PCR results show that the levels of ABCAl mRNA in 3T3 cells are significantly increased 48 h after treatment with three of the oligos designed to mouse ABCAl antisense BF133827. Bars denoted as CUR-1087 to CUR-1090, CUR-1092 and CUR-1091 correspond to samples treated with SEQ ID NOS: 35 to 38, 40 and 39 respectively.
- Figure ID is a graph of real time PCR results showing the fold change + standard deviation in LCAT mRNA after treatment of Hek293 cells with siRNA and phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real time PCR results show that the levels of the LCAT mRNA in Hek293 cells are significantly increased 48 h after treatment with three of the oligos designed to LCAT antisense Hs.668679. Bars denoted as CUR- 0476, CUR-0478, CUR-0822, CUR-0820 and CUR-0819 correspond to samples treated with SEQ ID NOS: 41, 42, 58, 56 and 55 respectively.
- Figure IE is a graph of real time PCR results showing the fold change + standard deviation in LCAT mRNA after treatment of HepG2 cells with siRNA oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real time PCR results show that the levels of the LCAT mRNA in HepG2 cells are significantly increased 48 h after treatment with two of the oligos designed to LCAT antisense Hs.668679. Bars denoted as CUR-0476, CUR-0478, CUR-0444, CUR-0446, CUR-0448 and CUR-0450 correspond to samples treated with SEQ ID NOS: 41, 42, and 44 to
- Figure IF is a graph of real time PCR results showing the fold change + standard deviation in LCAT mRNA after treatment of HepG2 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control. Real time PCR results show that the levels of the LCAT mRNA in HepG2 cells are significantly increased
- Bars denoted as CUR-0819, CUR- 0818, CUR-0817, CUR-0816, CUR-0815, CUR-0820, CUR-0821 and CUR-0822 correspond to samples treated with SEQ ID NOS: 55, 54, 53, 52, 51 and 56 to 58 respectively.
- Figure IG is a graph of real time PCR results showing the fold change + standard deviation in LCAT mRNA after treatment of Vero cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real time PCR results show that the levels of the LCAT mRNA in Vero cells are significantly increased 48 h after treatment with one of the oligos designed to LCAT antisense Hs.668679.
- Bars denoted as CUR-0819, CUR-0818, CUR-0817, CUR-0816, CUR-0815, CUR-0820, CUR-0821 and CUR-0822 correspond to samples treated with SEQ ID NOS: 55, 54, 53, 52, 51 and 56 to 58 respectively.
- Figure IH is a graph of real time PCR results showing the fold change + standard deviation in LRPl mRNA after treatment of HepG2 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real Time PCR results show that levels of LRPl mRNA in HepG2 cells are significantly increased 48h after treatment with oligos to LRPl antisense DC401271.
- Bars denoted as CUR-0767 to CUR-0769, CUR-0771, CUR- 0770, CUR-0775, CUR-0773, CUR-0772 and CUR-0774 correspond to samples treated with SEQ ID NOS: 59 to 61, 63, 62, 67, 65, 64 and 66 respectively.
- Figure II is a graph of real time PCR results showing the fold change + standard deviation in LRPl mRNA after treatment of Vero cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real Time PCR results show that levels of LRPl mRNA in Vero cells are significantly increased 48h after treatment with oligos to LRPl antisense DC401271 and Hs.711951.
- Bars denoted as CUR-0768, CUR-0767, CUR- 0774 and CUR-0772 correspond to samples treated with SEQ ID NOS: 60, 59, 66 and 64 respectively.
- Figure IJ is a graph of real time PCR results showing the fold change + standard deviation in LRPl mRNA after treatment of 3T3 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real Time PCR results show that levels of LRPl mRNA in 3T3 cells are significantly increased 48h after treatment with oligos to LRPl antisense DC401271 and AW544265. Bars denoted as CUR-1017 to CUR- 1022 correspond to samples treated with SEQ ID NOS: 68 to 73 respectively.
- Figure IK is a graph of real time PCR results showing the fold change + standard deviation in LDLR mRNA after treatment of HepG2 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real Time PCR results show that levels of LDLR mRNA in HepG2 cells are significantly increased 48h after treatment with antisense oligos to LDLR antisense sherflor.aApr07. Bars denoted as CUR-1054 to CUR-1059 correspond to samples treated with SEQ ID NOS: 74 to 79 respectively.
- Figure IL is a graph of real time PCR results showing the fold change + standard deviation in LDLR mRNA after treatment of HepG2 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real Time PCR results show that levels of LDLR mRNA in HepG2 cells after treatment with antisense oligos to LDLR antisense bloflor.aApr07. Bars denoted as CUR-1059 to CUR-1063 correspond to samples treated with SEQ ID NOS: 79 to 83 respectively.
- Figure IM is a graph of real time PCR results showing the fold change + standard deviation in ApoE mRNA after treatment of HepG2 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real time PCR results show that the levels of APOE mRNA in HepG2 cells are significantly increased 48 h after treatment with three of the antisense oligos designed to APOE antisense Hs.626623.
- Bars denoted as CUR-0978, CUR-0980, CUR-0981, CUR-0979, CUR-0973, CUR-0975, CUR-0974, CUR-0977 and CUR-0976 correspond to samples treated with SEQ ID NOS: 89, 91, 92, 90, 84, 86, 85, 88 and 87 respectively.
- Figure IN to Figure IP represent a graphs of real time PCR results showing the fold change + standard deviation in ApoAl mRNA after treatment of HepG2 cells with phosphorothioate oligonucleotides introduced using Lipofectamine 2000, as compared to control.
- Real time PCR results show that the levels of ApoAl mRNA in HepG2 cells are significantly increased 48 h after treatment with some of the antisense oligonucleotides to ApoAl antisense DA327409ext.
- Bars RH3-RH597 correspond to samples treated with SEQ ID NOS 171 to 248 respectively.
- Figure IQ is a graph of real time PCR results showing the fold change in ApoAl mRNA (top panel) and ApoAl natural antisense DA327409ext RNA (bottom panel) after treatment of HepG2 cells with naked LNA or phosphothioate oligonucleotides over 7 days as compared to control. Bars denoted as #6LNA, #11 LNA, #6PS and #11PS represent SEQ ID NOS 249 to 252 respectively.
- Figure IR is a graph of real time PCR results showing the fold change in ApoAl mRNA (orange bars) and ApoAl natural antisense DA327409ext RNA (blue bars) after treatment of HepG2 cells with LNA oligonucleotides. Bars denoted as 6-11 correspond to SEQ ID NOS 249, 257 to 260 and 250.
- Figure IS shows dose dependent increase in ApoAl mRNA (bottom panel) and protein (top panel) after treatment of HepG2 cells with oligonucleotides. Bars denoted CUR-4806 and CUR-4811 correspond to SEQ ID NOS 249 and 250 respectively.
- Figure IT is a graph of the real time PCR results showing upregulation of the ApoAl mRNA in primary African green monkey hepatocytes after treatment with oligonucleotides against natural ApoAl antisense DA327409ext. Bars denoted CUR-4816 and CUR-4811 correspond to SEQ ID NOS: 263 and 250 respectively.
- Figure IU is a graph showing that ApoAl mRNA and protein levels increased in monkey liver biopsies after treatment with CUR-962, an oligonucleotide designed to ApoAl antisense DA327409ext, compared to the baseline levels, as determined by real time PCR and ELISA respectively (right panels). ApoAl mRNA or protein levels did not change after the same period of time in the control group dosed with an oligonucleotide that showed no effect on ApoAl levels in vitro (CUR-963) (left panels). Bars denoted CUR-962 and CUR-963 correspond to SEQ ID NOS 260 and 261 respectively.
- Figure IV shows a side-by-side alignment of the human and rhesus ApoAl natural antisense sequences and the position of some of the oligonucleotides used to target these sequences.
- SEQ ID NO: 1 Homo sapiens ATP-binding cassette, sub-family A (ABCl), member 1(ABCAl), mRNA (NCBI
- SEQ ID NO: 2 Homo sapiens lecithin-cholesterol acyltransferase (LCAT), mRNA (NCBI Accession No.:
- SEQ ID NO: 3 Homo sapiens low density lipoprotein receptor-related protein 1 (LRPl), mRNA (NCBI Accession
- SEQ ID NO: 4 Mus musculus low density lipoprotein receptor-related protein 1 (Lrpl), mRNA (NCBI Accession No.: NM_008512.2).
- SEQ ID NO: 5 Homo sapiens low density lipoprotein receptor (LDLR), mRNA (NCBI Accession No.:
- SEQ ID NO: 6 Homo sapiens apolipoprotein E (APOE), mRNA (NCBI Accession No.: NM 000041.2).
- SEQ ID NO: 7 Homo sapiens apolipoprotein A-I (APOAl), mRNA (NCBI Accession No.: NM 000039).
- Figure 3 shows
- SEQ ID NO: 8 Human Natural ABCAl antisense sequence (AK311445)
- SEQ ID NO: 9 Mouse Natural ABCAl antisense sequence (BF133827)
- SEQ ID NO: 10 Human Natural LCAT antisense sequence (Hs.668679)
- SEQ ID NO: 11 Human Natural LCAT antisense sequence (Hs.593769)
- SEQ ID NO: 12 Human Natural LCAT antisense sequence (Hs.387239)
- SEQ ID NO: 13 Human Natural LRPl antisense sequence (Hs.711951)
- SEQ ID NO: 14 Human Natural LRPl antisense sequence (DC401271)
- SEQ ID NO: 15 Human Natural LRPl antisense sequence (BM933147)
- SEQ ID NO: 16 Mouse Natural LRPl antisense sequence (CK626173)
- SEQ ID NO: 17 Mouse Natural LRPl antisense sequence (AW544265)
- SEQ ID NO: 18 Human Natural ABCAl antisense sequence (bloflor.aApr07)
- SEQ ID NO: 19 Human Natural ABCAl antisense sequence (sherflor.aApr07)
- SEQ ID NO: 20 Natural APOE antisense sequence (Hs.626623)
- SEQ ID NO: 21 Natural APOE antisense sequence (Hs.714236)
- SEQ ID NO: 22 Natural APOAl antisense sequence (DA327409 extended)
- Figure 4 shows the ABCAl antisense oligonucleotides, SEQ ID NOs: 23 to 40. 'r' indicates RNA and * indicates phosphothioate bond.
- Figure 5 shows the LCAT antisense oligonucleotides, SEQ ID NOs: 41 to 58. 'r' indicates RNAand * indicates phosphothioate bond.
- Figure 6 shows the LRPl antisense oligonucleotides, SEQ ID NOs: 59 to 73. * indicates phosphothioate bond.
- Figure 7 shows the LDLR antisense oligonucleotides, SEQ ID NOs: 74 to 83. * indicates phosphothioate bond.
- Figure 8 shows the ApoE antisense oligonucleotides, SEQ ID NOs: 84 to 92. * indicates phosphothioate bond.
- Figure 9 shows the ApoAl antisense oligonucleotides, SEQ ID NOs: 93 to 263. 'r' indicates RNA and * indicates phosphothioate bond.
- Figure 10 shows the ABCAl sense oligonucleotides, SEQ ID NOs: 264 to 266.
- the sense oligonucleotides SEQ ID NOs: 264 to 266.
- SEQ ID NO: 264 to 266 are the reverse complements of the antisense oligonucleotides SEQ ID NO: 23 to 24 respectively, 'r' indicates RNA.
- Figure 11 shows the LCAT sense oligonucleotides, SEQ ID NOs: 275 to 282. The sense oligonucleotides SEQ ID NO: 264 to 266
- ID NO: 267 to 274 are the reverse complements of the antisense oligonucleotides SEQ ID NO: 41 to 48 respectively.
- 'r' indicates RNA.
- Figure 12 shows:
- SEQ ID NOs: 275 to 277 correspond to the probe sequence, forward primer sequence and the reverse primer sequence respectively with respect to the custom designed assay for ApoAl antisense DA327409ext
- SEQ ID NO: 278 corresponds to CUR 962, * indicates phosphothioate bond and + indicates LNA.
- SEQ ID NO: 279 corresponds to CUR 963, * indicates phosphothioate bond and + indicates LNA.
- genes, gene names, and gene products disclosed herein are intended to correspond to homologs from any species for which the compositions and methods disclosed herein are applicable.
- the terms include, but are not limited to genes and gene products from humans and mice. It is understood that when a gene or gene product from a particular species is disclosed, this disclosure is intended to be exemplary only, and is not to be interpreted as a limitation unless the context in which it appears clearly indicates.
- the genes disclosed herein which in some embodiments relate to mammalian nucleic acid and amino acid sequences are intended to encompass homologous and/or orthologous genes and gene products from other animals including, but not limited to other mammals, fish, amphibians, reptiles, and birds. In preferred embodiments, the genes or nucleic acid sequences are human. Definitions
- the term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.
- mRNA means the presently known mRNA transcript(s) of a targeted gene, and any further transcripts which may be elucidated.
- antisense oligonucleotides or “antisense compound” is meant an RNA or DNA molecule that binds to another RNA or DNA (target RNA, DNA). For example, if it is an RNA oligonucleotide it binds to another RNA target by means of RNA-RNA interactions and alters the activity of the target RNA (Eguchi et ah, (1991) Ann. Rev. Biochem. 60, 631-652). An antisense oligonucleotide can upregulate or downregulate expression and/or function of a particular polynucleotide. The definition is meant to include any foreign RNA or DNA molecule which is useful from a therapeutic, diagnostic, or other viewpoint.
- Such molecules include, for example, antisense RNA or DNA molecules, interference RNA (RNAi), micro RNA, decoy RNA molecules, siRNA, enzymatic RNA, therapeutic editing RNA and agonist and antagonist RNA, antisense oligomeric compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid.
- RNAi interference RNA
- micro RNA decoy RNA molecules
- siRNA siRNA
- enzymatic RNA therapeutic editing RNA and agonist and antagonist RNA
- antisense oligomeric compounds antisense oligonucleotides
- EGS external guide sequence oligonucleotides
- alternate splicers primers, probes, and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid.
- these compounds may be introduced in
- oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
- oligonucleotide also includes linear or circular oligomers of natural and/or modified monomers or linkages, including deoxyribonucleosides, ribonucleosides, substituted and alpha-anomeric forms thereof, peptide nucleic acids (PNA), locked nucleic acids (LNA), phosphorothioate, methylphosphonate, and the like.
- Oligonucleotides are capable of specifically binding to a target polynucleotide by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, Hoogsteen or reverse Hoogsteen types of base pairing, or the like.
- the oligonucleotide may be "chimeric", that is, composed of different regions.
- "chimeric" compounds are oligonucleotides, which contain two or more chemical regions, for example, DNA region(s), RNA region(s), PNA region(s) etc. Each chemical region is made up of at least one monomer unit, Le., a nucleotide in the case of an oligonucleotides compound.
- These oligonucleotides typically comprise at least one region wherein the oligonucleotide is modified in order to exhibit one or more desired properties.
- the desired properties of the oligonucleotide include, but are not limited, for example, to increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. Different regions of the oligonucleotide may therefore have different properties.
- the chimeric oligonucleotides of the present invention can be formed as mixed structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide analogs as described above.
- the oligonucleotide can be composed of regions that can be linked in "register” that is, when the monomers are linked consecutively, as in native DNA, or linked via spacers.
- the spacers are intended to constitute a covalent "bridge” between the regions and have in preferred cases a length not exceeding about 100 carbon atoms.
- the spacers may carry different functionalities, for example, having positive or negative charge, carry special nucleic acid binding properties (intercalators, groove binders, toxins, fluorophors etc.), being lipophilic, inducing special secondary structures like, for example, alanine containing peptides that induce alpha-helices.
- "Lipid transport and metabolism genes” are inclusive of all family members, mutants, alleles, fragments, species, coding and noncoding sequences, sense and antisense polynucleotide strands, etc.
- the words ATP-binding cassette 1 Lipid transport and metabolism gene; ABC transporter 1 ; cholesterol efflux regulatory protein (CERP), ABCAl, ABC-I, ABCl, CERP; FLJ14958; HDLDTl; TGD are used interchangeably in the present application.
- the words Lecithin-cholesterol acyltransferase, LCAT, Phosphatidylcholine-sterol acyltransferase, Phospholipid-cholesterol acyltransferase are used interchangeably in the present application.
- A2MR Alpha-2-macroglobulin receptor
- APOER Apolipoprotein E receptor
- APR CD91, FLJ16451, IGFBP3R, LRP, LRP-I, MGC88725, Prolow-density lipoprotein receptor-related protein 1, TGFBR5 are used interchangeably in the present application.
- LDLR Low-density lipoprotein receptor
- AD2 Apo-E, ApoE, Apolipoprotein E, LDLCQ5, LPG, MGC 1571 are used interchangeably in the present application.
- ApoAl, Apo-Al, Apolipoprotein Al, MGCl 17399 are used interchangeably in the present application.
- oligonucleotide specific for or "oligonucleotide which targets” refers to an oligonucleotide having a sequence (i) capable of forming a stable complex with a portion of the targeted gene, or (ii) capable of forming a stable duplex with a portion of a mRNA transcript of the targeted gene. Stability of the complexes and duplexes can be determined by theoretical calculations and/or in vitro assays. Exemplary assays for determining stability of hybridization complexes and duplexes are described in the Examples below.
- target nucleic acid encompasses DNA, RNA (comprising premRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA, coding, noncoding sequences, sense or antisense polynucleotides.
- RNA comprising premRNA and mRNA
- cDNA derived from such RNA, coding, noncoding sequences, sense or antisense polynucleotides.
- antisense The functions of DNA to be interfered include, for example, replication and transcription.
- RNA to be interfered include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
- the overall effect of such interference with target nucleic acid function is modulation of the expression of an encoded product or oligonucleotides.
- RNA interference "RNAi” is mediated by double stranded RNA (dsRNA) molecules that have sequence- specific homology to their "target" nucleic acid sequences (Caplen, N. J., et al. (2001) Proc. Natl. Acad. Sci. USA 98:9742-9747).
- the mediators are 5-25 nucleotide "small interfering" RNA duplexes (siRNAs).
- siRNAs are derived from the processing of dsRNA by an RNase enzyme known as Dicer (Bernstein, E., et al. (2001) Nature 409:363-366).
- siRNA duplex products are recruited into a multi-protein siRNA complex termed RISC (RNA Induced Silencing Complex).
- RISC RNA Induced Silencing Complex
- a RISC is then believed to be guided to a target nucleic acid (suitably mRNA), where the siRNA duplex interacts in a sequence-specific way to mediate cleavage in a catalytic fashion (Bernstein, E., et al. (2001) Nature 409:363-366; Boutla, A., et al. (2001) Curr. Biol. 11:1776-1780).
- Small interfering RNAs that can be used in accordance with the present invention can be synthesized and used according to procedures that are well known in the art and that will be familiar to the ordinarily skilled artisan.
- Small interfering RNAs for use in the methods of the present invention suitably comprise between about 1 to about 50 nucleotides (nt).
- nt nucleotides
- siRNAs can comprise about 5 to about 40 nt, about 5 to about 30 nt, about 10 to about 30 nt, about 15 to about 25 nt, or about 20-25 nucleotides.
- Selection of appropriate oligonucleotides is facilitated by using computer programs that automatically align nucleic acid sequences and indicate regions of identity or homology. Such programs are used to compare nucleic acid sequences obtained, for example, by searching databases such as GenBank or by sequencing PCR products. Comparison of nucleic acid sequences from a range of species allows the selection of nucleic acid sequences that display an appropriate degree of identity between species. In the case of genes that have not been sequenced, Southern blots are performed to allow a determination of the degree of identity between genes in target species and other species. By performing Southern blots at varying degrees of stringency, as is well known in the art, it is possible to obtain an approximate measure of identity.
- enzymatic RNA an RNA molecule with enzymatic activity (Cech, (1988) J. American. Med. Assoc. 260, 3030-3035). Enzymatic nucleic acids (ribozymes) act by first binding to a target RNA.
- enzymatic nucleic acid Such binding occurs through the target binding portion of an enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA.
- the enzymatic nucleic acid first recognizes and then binds a target RNA through base pairing, and once bound to the correct site, acts enzymatically to cut the target RNA.
- decoy RNA is meant an RNA molecule that mimics the natural binding domain for a ligand. The decoy RNA therefore competes with natural binding target for the binding of a specific ligand.
- HIV trans-activation response (TAR) RNA can act as a "decoy" and efficiently binds HIV tat protein, thereby preventing it from binding to TAR sequences encoded in the HIV RNA (Sullenger et al. (1990) Cell, 63, 601- 608).
- TAR HIV trans-activation response
- the term "monomers” typically indicates monomers linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a few monomeric units, e.g., from about 3-4, to about several hundreds of monomeric units. Analogs of phosphodiester linkages include: phosphorothioate, phosphorodithioate, methylphosphornates, phosphoroselenoate, phosphoramidate, and the like, as more fully described below. [0053] The term “nucleotide” covers naturally occurring nucleotides as well as nonnaturally occurring nucleotides.
- nucleotides includes not only the known purine and pyrimidine heterocycles-containing molecules, but also heterocyclic analogues and tautomers thereof.
- nucleotides are molecules containing adenine, guanine, thymine, cytosine, uracil, purine, xanthine, diaminopurine, 8-oxo- N6-methyladenine, 7-deazaxanthine, 7-deazaguanine, N4,N4-ethanocytosin, N6,N6- ethano-2,6- diaminopurine, 5-methylcytosine, 5-(C3-C6)-alkynylcytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridin, isocytosine, isoguanin, inosine and the "non-naturally occurring" nucleotides described in Benner et al, U.S.
- nucleotide is intended to cover every and all of these examples as well as analogues and tautomers thereof.
- Especially interesting nucleotides are those containing adenine, guanine, thymine, cytosine, and uracil, which are considered as the naturally occurring nucleotides in relation to therapeutic and diagnostic application in humans.
- Nucleotides include the natural 2'-deoxy and T- hydroxyl sugars, e.g., as described in Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992) as well as their analogs.
- nucleotides in reference to nucleotides includes synthetic nucleotides having modified base moieties and/or modified sugar moieties (see e.g., described generally by Scheit, Nucleotide Analogs, John Wiley, New York, 1980; Freier & Altmann, (1997) Nucl. Acid. Res., 25(22), 4429- 4443, Toulme, JJ., (2001) Nature Biotechnology 19:17-18; Manoharan M., (1999) Biochemica et Biophysica Acta 1489:117-139; Freier S.
- hybridization means the pairing of substantially complementary strands of oligomeric compounds.
- One mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleotides) of the strands of oligomeric compounds.
- adenine and thymine are complementary nucleotides which pair through the formation of hydrogen bonds.
- An antisense compound is "specifically hybridizable" when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a modulation of function and/or activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
- stringent hybridization conditions refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, "stringent conditions" under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated. In general, stringent hybridization conditions comprise low concentrations ( ⁇ 0.15M) of salts with inorganic cations such as Na++ or K++ (i.e., low ionic strength), temperature higher than 20 0 C - 25° C.
- the hybridization rate decreases 1.1% for each 1% formamide.
- An example of a high stringency hybridization condition is 0.1X sodium chloride-sodium citrate buffer (SSC)/0.1% (w/v) SDS at 60° C. for 30 minutes.
- a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule
- the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position.
- the oligomeric compound and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
- oligomeric compound and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleotides such that stable and specific binding occurs between the oligomeric compound and a target nucleic acid.
- sequence of an oligomeric compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
- an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
- the oligomeric compounds of the present invention comprise at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 99% sequence complementarity to a target region within the target nucleic acid sequence to which they are targeted.
- an antisense compound in which 18 of 20 nucleotides of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity.
- the remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides.
- an antisense compound which is 18 nucleotides in length having 4 (four) noncomplementary nucleotides which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
- Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et ah, (1990) J. MoI. Biol, 215, 403-410; Zhang and Madden, (1997) Genome Res., 1, 649-656).
- Percent homology, sequence identity or complementarity can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., (1981) 2, 482-489).
- Thermal Melting Point refers to the temperature, under defined ionic strength, pH, and nucleic acid concentration, at which 50% of the oligonucleotides complementary to the target sequence hybridize to the target sequence at equilibrium.
- stringent conditions will be those in which the salt concentration is at least about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 3O 0 C for short oligonucleotides (e.g., 10 to 50 nucleotide). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene.
- variants when used in the context of a polynucleotide sequence, may encompass a polynucleotide sequence related to a wild type gene. This definition may also include, for example, "allelic,” “splice,” “species,” or “polymorphic” variants.
- a splice variant may have significant identity to a reference molecule, but will generally have a greater or lesser number of polynucleotides due to alternate splicing of exons during mRNA processing.
- the corresponding polypeptide may possess additional functional domains or an absence of domains.
- Species variants are polynucleotide sequences that vary from one species to another. Of particular utility in the invention are variants of wild type gene products.
- Variants may result from at least one mutation in the nucleic acid sequence and may result in altered mRNAs or in polypeptides whose structure or function may or may not be altered. Any given natural or recombinant gene may have none, one, or many allelic forms. Common mutational changes that give rise to variants are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence. [0063] The resulting polypeptides generally will have significant amino acid identity relative to each other.
- a polymorphic variant is a variation in the polynucleotide sequence of a particular gene between individuals of a given species.
- Polymorphic variants also may encompass "single nucleotide polymorphisms" (SNPs,) or single base mutations in which the polynucleotide sequence varies by one base.
- SNPs single nucleotide polymorphisms
- Derivative polynucleotides include nucleic acids subjected to chemical modification, for example, replacement of hydrogen by an alkyl, acyl, or amino group.
- Derivatives, e.g., derivative oligonucleotides may comprise non- naturally-occurring portions, such as altered sugar moieties or inter-sugar linkages.
- Derivative nucleic acids may also contain labels, including radionucleotides, enzymes, fluorescent agents, chemiluminescent agents, chromogenic agents, substrates, cofactors, inhibitors, magnetic particles, and the like.
- a “derivative" polypeptide or peptide is one that is modified, for example, by glycosylation, pegylation, phosphorylation, sulfation, reduction/alkylation, acylation, chemical coupling, or mild formalin treatment.
- a derivative may also be modified to contain a detectable label, either directly or indirectly, including, but not limited to, a radioisotope, fluorescent, and enzyme label.
- animal or "patient” is meant to include, for example, humans, sheep, elks, deer, mule deer, minks, mammals, monkeys, horses, cattle, pigs, goats, dogs, cats, rats, mice, birds, chicken, reptiles, fish, insects and arachnids.
- "Mammal” covers warm blooded mammals that are typically under medical care (e.g., humans and domesticated animals). Examples include feline, canine, equine, bovine, and human, as well as just human.
- Treating covers the treatment of a disease-state in a mammal, and includes: (a) preventing the disease-state from occurring in a mammal, in particular, when such mammal is predisposed to the disease-state but has not yet been diagnosed as having it; (b) inhibiting the disease-state, e.g., arresting it development; and/or (c) relieving the disease-state, e.g., causing regression of the disease state until a desired endpoint is reached. Treating also includes the amelioration of a symptom of a disease (e.g., lessen the pain or discomfort), wherein such amelioration may or may not be directly affecting the disease (e.g., cause, transmission, expression, etc.).
- cancer refers to all types of cancer or neoplasm or malignant tumors found in mammals, including, but not limited to: leukemias, lymphomas, melanomas, carcinomas and sarcomas.
- the cancer manifests itself as a “tumor” or tissue comprising malignant cells of the cancer.
- tumors include sarcomas and carcinomas such as, but not limited to: fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcino
- Additional cancers which can be treated by the disclosed composition according to the invention include but not limited to, for example, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, breast cancer, ovarian cancer, lung cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, small-cell lung tumors, primary brain tumors, stomach cancer, colon cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, cervical cancer, endometrial cancer, adrenal cortical cancer, and prostate cancer.
- Neurological disease or disorder refers to any disease or disorder of the nervous system and/or visual system.
- Neurological disease or disorder include disease or disorders that involve the central nervous system (brain, brainstem and cerebellum), the peripheral nervous system (including cranial nerves), and the autonomic nervous system (parts of which are located in both central and peripheral nervous system).
- Examples of neurological disorders include but are not limited to, headache, stupor and coma, dementia, seizure, sleep disorders, trauma, infections, neoplasms, neuroopthalmology, movement disorders, demyelinating diseases, spinal cord disorders, and disorders of peripheral nerves, muscle and neuromuscular junctions.
- Addiction and mental illness include, but are not limited to, bipolar disorder and schizophrenia, are also included in the definition of neurological disorder.
- An "Inflammation” refers to systemic inflammatory conditions and conditions associated locally with migration and attraction of monocytes, leukocytes and/or neutrophils.
- inflammation include, but are not limited to, Inflammation resulting from infection with pathogenic organisms (including gram-positive bacteria, gram- negative bacteria, viruses, fungi, and parasites such as protozoa and helminths), transplant rejection (including rejection of solid organs such as kidney, liver, heart, lung or cornea, as well as rejection of bone marrow transplants including graft-versus-host disease (GVHD)), or from localized chronic or acute autoimmune or allergic reactions.
- pathogenic organisms including gram-positive bacteria, gram- negative bacteria, viruses, fungi, and parasites such as protozoa and helminths
- transplant rejection including rejection of solid organs such as kidney, liver, heart, lung or cornea, as well as rejection of bone marrow transplants including graft-versus-host disease (GVHD)
- GVHD graft-versus
- Autoimmune diseases include acute glomerulonephritis; rheumatoid or reactive arthritis; chronic glomerulonephritis; inflammatory bowel diseases such as Crohn's disease, ulcerative colitis and necrotizing enterocolitis; granulocyte transfusion associated syndromes; inflammatory dermatoses such as contact dermatitis, atopic dermatitis, psoriasis; systemic lupus erythematosus (SLE), autoimmune thyroiditis, multiple sclerosis, and some forms of diabetes, or any other autoimmune state where attack by the subject's own immune system results in pathologic tissue destruction. Allergic reactions include allergic asthma, chronic bronchitis, acute and delayed hypersensitivity.
- Systemic inflammatory disease states include inflammation associated with trauma, burns, reperfusion following ischemic events (e.g. thrombotic events in heart, brain, intestines or peripheral vasculature, including myocardial infarction and stroke), sepsis, ARDS or multiple organ dysfunction syndrome. Inflammatory cell recruitment also occurs in atherosclerotic plaques.
- ischemic events e.g. thrombotic events in heart, brain, intestines or peripheral vasculature, including myocardial infarction and stroke
- sepsis ARDS or multiple organ dysfunction syndrome.
- ARDS multiple organ dysfunction syndrome.
- Inflammatory cell recruitment also occurs in atherosclerotic plaques.
- Inflammation includes, but is not limited to, Non-Hodgkin's lymphoma, Wegener's granulomatosis, Hashimoto's thyroiditis, hepatocellular carcinoma, thymus atrophy, chronic pancreatitis, rheumatoid arthritis, reactive lymphoid hyperplasia, osteoarthritis, ulcerative colitis, papillary carcinoma, Crohn's disease, ulcerative colitis, acute cholecystitis, chronic cholecystitis, cirrhosis, chronic sialadenitis, peritonitis, acute pancreatitis, chronic pancreatitis, chronic Gastritis, adenomyosis, endometriosis, acute cervicitis, chronic cervicitis, lymphoid hyperplasia, multiple sclerosis, hypertrophy secondary to idiopathic thrombocytopenic purpura, primary IgA nephropathy, systemic lupus erythemato
- a cardiovascular disease or disorder includes those disorders that can either cause ischemia or are caused by reperfusion of the heart. Examples include, but are not limited to, atherosclerosis, coronary artery disease, granulomatous myocarditis, chronic myocarditis (non-granulomatous), primary hypertrophic cardiomyopathy, peripheral artery disease (PAD), stroke, angina pectoris, myocardial infarction, cardiovascular tissue damage caused by cardiac arrest, cardiovascular tissue damage caused by cardiac bypass, cardiogenic shock, and related conditions that would be known by those of ordinary skill in the art or which involve dysfunction of or tissue damage to the heart or vasculature, especially, but not limited to, tissue damage related to a Lipid transport and metabolism gene activation.
- CVS diseases include, but are not limited to, atherosclerosis, granulomatous myocarditis, myocardial infarction, myocardial fibrosis secondary to valvular heart disease, myocardial fibrosis without infarction, primary hypertrophic cardiomyopathy, and chronic myocarditis (non-granulomatous).
- a 'Metabolic disease or disorder refers to a wide range of diseases and disorders of the endocrine system including, for example, insulin resistance, diabetes, obesity, impaired glucose tolerance, high blood cholesterol, hyperglycemia, hyperinsulinemia, dyslipidemia and hyperlipidemia.
- the targets comprise nucleic acid sequences of a Lipid transport and metabolism genes, including without limitation sense and/or antisense noncoding and/or coding sequences associated with a Lipid transport and metabolism gene.
- the targets comprise nucleic acid sequences of ABCAl, including without limitation sense and/or antisense noncoding and/or coding sequences associated with ABCAl gene.
- the targets comprise nucleic acid sequences of LCAT, including without limitation sense and/or antisense noncoding and/or coding sequences associated with LCAT gene.
- the targets comprise nucleic acid sequences of LRPl, including without limitation sense and/or antisense noncoding and/or coding sequences associated with LRPl gene.
- the targets comprise nucleic acid sequences of low density lipoprotein receptor (LDLR), including without limitation sense and/or antisense noncoding and/or coding sequences associated with LDLR.
- the targets comprise nucleic acid sequences of apolipoprotein (ApoAl), including without limitation sense and/or antisense noncoding and/or coding sequences associated with ApoA.
- apolipoprotein A- I Human apolipoprotein A- I (ApoA-I) is the major protein constituent of high-density lipoproteins (HDL and lymph chylomicrons.
- chylomicrons CM
- VLDL very low-density lipoproteins
- LDL low-density lipoproteins
- HDL high-density lipoproteins
- ATP-binding cassette, sub family-A (ABCAI) member I ABCAI functions as a cholesterol efflux pump in the cellular lipid removal pathway.
- ATP-binding cassette transporters are members of a protein superfamily that is one of the largest and most ancient families with representatives in all extant phyla from prokaryotes to humans. ABC transporters are transmembrane proteins that utilize the energy of adenosine triphosphate (ATP) hydrolysis to carry out certain biological processes including translocation of various substrates across membranes and non-transport-related processes such as translation of RNA and DNA repair. They transport a wide variety of substrates across extra- and intracellular membranes, including metabolic products, lipids and sterols, and drugs.
- ATP adenosine triphosphate
- ABC transporters Proteins are classified as ABC transporters based on the sequence and organization of their ATP-binding cassette (ABC) domain(s). ABC transporters are involved in tumor resistance, cystic fibrosis, bacterial multidrug resistance, and a range of other inherited human diseases.
- the membrane-associated protein encoded by ABCl gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABCA, MDRITAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABCA subfamily. Members of the ABCA subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes.
- antisense oligonucleotides are used to prevent or treat diseases or disorders associated with ATP -Binding cassette molecules.
- ATP-binding cassette transporter ABCl member 1 of human transporter sub-family ABCA
- CERP cholesterol efflux regulatory protein
- ABCl is present in high-density lipoproteins (HDL) which permits the removal of excessive cholesterol and phospholipids from human cell membranes.
- Factors that act upon the ABCl transporter's expression or its posttranslational modification are also molecules that are involved in its subsequent function like fatty acids, cholesterol and also cytokines and cyclic adenosine monophosphate.
- LPRl Low-density lipoprotein receptor-related protein 1
- MAFB Low-density lipoprotein receptor-related protein 1
- LPRl is about 4544 amino acids; 504575 Da. It is a heterodimer of an 85-kDa membrane-bound carboxyl subunit and a noncovalently attached 515-kDa amino-terminal subunit.
- Intracellular domain interacts with MAFB. LPRl is found in a complex with PIDIPCLIl, LRPl and CUBNI. Interacts with SNX 17, PIDl IPCLIl, PDGF, LRPAPl and CUBN. The intracellular domain interacts with SHCl, GULPl and DABl.
- LRPl is an endocytic receptor involved in endocytosis and in phagocytosis of apoptotic cells; early embryonic development; cellular lipid homeostasis; plasma clearance of chylomicron remnants and activated LRPAPl (alpha 2- macroglobulin); local metabolism of complexes between plasminogen activators and their endogenous inhibitors. Without wishing to be bound by theory, it may modulate cellular events, such as APP metabolism, kinase-dependent intracellular signaling, neuronal calcium signaling as well as neurotransmission.
- High density lipoprotein (HDL) picks up extra cholesterol in the blood and returns it to the liver
- Low density lipoprotein (or LDL) is the main transporter of cholesterol in the body. But too much LDL over many years can result in atherosclerosis (the narrowing and hardening of arteries) and lead to heart disease or a heart attack.
- the ratio is determined by dividing the LDL cholesterol into the HDL cholesterol. For example, if a person has an HDL cholesterol of 50 mg/dL and an LDL cholesterol of 150 mg/dL, the HDL/LDL ratio would be 0.33. The goal is to keep the HDL/LDL ratio above 0.3, with the ideal HDL/LDL ratio being above 0.4.
- HDL are synthesized de novo in both the liver and small intestine as protein-rich disc-shaped particles.
- the primary apoproteins of HDL are apoA-I, apoA-II, apoC-I, apoC-II, and apoE.
- Newly formed HDL contain very little cholesterol and cholesteryl esters.
- HDL are converted from their initial discoidal shape into spherical lipoprotein particles through the accumulation of cholesteryl esters in the neutral core of the lipoprotein particle. Cholesterol is accumulated by HDL from chylomicron remnants VLDL remnants (also called intermediate density Lipoproteins or IDL) and directly from cell surface membranes.
- VLDL remnants also called intermediate density Lipoproteins or IDL
- LCAT lecithin:cholesterol acyltransferase
- HDL are usually isolated from the plasma by ultracentrifugation.
- the normal HDL density range is from 1.063 g/mL to 1.21 g/mL, which divides roughly into two ranges HDL2 (1.063 g/mL to 1.125 g/mL) and HDL3 (1.125 g/mL to 1.21 g/mL).
- HDL2 1.063 g/mL to 1.125 g/mL
- HDL3 (1.125 g/mL to 1.21 g/mL.
- two major populations of particles in HDL have been identified by two dimensional electrophoresis followed by immunoblotting and enzyme-linked differential antibody immunosorbent assay.
- One of these populations contains particles with apoA-I alone, and the other contains particles with both apoA-I and apoA-II.
- ApoA-I Human apolipoprotein A-I
- ApoA-I is the major protein constituent of HDL and lymph chylomicrons.
- ApoA- I is primarily synthesized in the liver and small intestine as a precursor protein (preproapo A-I).
- Preproapo A-I is cleaved intracellularly to form proapo A-I, the form secreted into the plasma and lymph.
- six amino acids are cleaved from proapo A-I to form mature ApoA-I.
- Mature ApoA-I is a single unglycosylated polypeptide composed of 243 amino acids of known sequence.
- ApoA-I serves as a cofactor of a plasma enzyme (lecithin-cholesterol acyltransferase (LCAT)), responsible for the formation of most cholesterol esters in plasma.
- LCAT lecithin-cholesterol acyltransferase
- Decreased levels of ApoA-I may result in disorders of the plasma lipid transport system and in the development of coronary heart disease.
- Low levels of both ApoA-I and HDL has been shown to be a strong risk factor for heart attacks and other atherosclerotic vascular diseases. See U.S. Pat. Nos. 5,059,528 and 6,258,596.
- Apolipoprotein E is an apoprotein found in the chylomicron and intermediate-density lipoproteins (IDLs) that binds to a specific receptor on liver cells and peripheral cells. Intermediate-density lipoproteins belong to the lipoprotein particle family and are formed from the degradation of very low-density lipoproteins. IDL is one of the five major groups of lipoproteins (chylomicrons, VLDL, IDL, LDL, HDL) that enable fats and cholesterol to move within the water-based solution of the bloodstream. Apolipoprotein E (ApoE) is important for the normal catabolism of triglyceride-rich lipoprotein constituents.
- the APOE gene, ApoE is mapped to chromosome 19 in a cluster with Apolipoprotein Cl and Apolipoprotein C2.
- ApoE consists of four exons and three introns, totaling 3597 base pairs.
- APOE gene expression may be regulated by microphthalmia-associated transcription factor (MITF).
- the gene is polymorphic with three major alleles, ApoE2, ApoE3, ApoE4, which translate into three isoforms of the protein: normal - ApoE-E3; dysfunctional- ApoE-E2 and ApoE-E4. These isoforms differ from each other only by single amino acid substitutions at positions 112 and 158.
- LCAT Lecithin-cholesterol acyltransferase
- HDL high- density lipoprotein
- Apo apolipoprotein B-containing lipoproteins.
- the apolipoprotein E gene is polymorphic with three major alleles, ApoE2, ApoE3, ApoE4.
- E2 is associated with the genetic disorder type III hyperlipoproteinemia and with both increased and decreased risk for atherosclerosis.
- E3 is found in approximately 64 percent of the population. It is considered the "neutral" Apo E genotype.
- E4 may contribute to atherosclerosis and Alzheimer's disease, impaired cognitive function, and reduced neurite outgrowth.
- LCAT promotes the reverse cholesterol transport pathway, the pathway by which excess cellular cholesterol is returned to the liver for excretion.
- mechanisms include, for example: LCAT increases the level of HDL, which in itself may increase the flux of cholesterol from cells by increasing the amount of extracellular acceptors of cholesterol. Also, esterification of cholesterol by LCAT on HDL could limit the spontaneous back exchange of cholesterol from HDL to cells and promotes the net delivery of cholesterol on HDL and on to the liver.
- antisense oligonucleotides are used to prevent or treat diseases or disorders associated with Lipid transport and metabolism gene family members.
- Exemplary Lipid transport and metabolism gene mediated diseases and disorders which can be treated with cell/tissues regenerated from stem cells obtained using the antisense compounds comprise: a cardiovascular disease or disorder, a metabolic disease or disorder (e.g., diabetes, obesity, dyslipidemia, hyperglycemia, hyperinsulinemia, hypercholesterolemia etc.), a disease or disorder associated with impaired lipid metabolism, a coronary artery disease, atherosclerosis, an HDL metabolism disease or disorder (e.g., familial HDL deficiency (FHD), Sea-blue histiocytosis, Tangier's Disease, Fish-eye disease, LCAT deficiency, low-HDL cholesterolemia etc.), a disease or disorder associated with cellular cholesterol and/or phospholipid homeostasis, Familial amyloid nephropathy, a disease or disorder associated with impaired
- the oligonucleotides are specific for polynucleotides of a Lipid transport and metabolism gene, which includes, without limitation noncoding regions.
- the Lipid transport and metabolism gene targets comprise variants of a Lipid transport and metabolism gene; mutants of a Lipid transport and metabolism gene, including SNPs; noncoding sequences of a Lipid transport and metabolism gene; alleles, fragments and the like.
- the oligonucleotide is an antisense RNA molecule.
- the target nucleic acid molecule is not limited to a Lipid transport and metabolism gene polynucleotides alone but extends to any of the isoforms, receptors, homologs, non- coding regions and the like of a Lipid transport and metabolism gene.
- an oligonucleotide targets a natural antisense sequence (natural antisense to the coding and non-coding regions) of a Lipid transport and metabolism gene targets, including, without limitation, variants, alleles, homologs, mutants, derivatives, fragments and complementary sequences thereto.
- the oligonucleotide is an antisense RNA or DNA molecule.
- the oligomeric compounds of the present invention also include variants in which a different base is present at one or more of the nucleotide positions in the compound.
- the first nucleotide is an adenine
- variants may be produced which contain thymidine, guanosine, cytidine or other natural or unnatural nucleotides at this position. This may be done at any of the positions of the antisense compound. These compounds are then tested using the methods described herein to determine their ability to inhibit expression of a target nucleic acid.
- homology, sequence identity or complementarity, between the antisense compound and target is from about 50% to about 60%. In some embodiments, homology, sequence identity or complementarity, is from about 60% to about 70%. In some embodiments, homology, sequence identity or complementarity, is from about 70% to about 80%. In some embodiments, homology, sequence identity or complementarity, is from about 80% Io about 90%. In some embodiments, homology, sequence identity or complementarity, is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100%.
- An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired.
- Such conditions include, i.e., physiological conditions in the case of in vivo assays or therapeutic treatment, and conditions in which assays are performed in the case of in vitro assays.
- An antisense compound whether DNA, RNA, chimeric, substituted etc, is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarily to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.
- targeting of a Lipid transport and metabolism gene including without limitation, antisense sequences which are identified and expanded, using for example, PCR, hybridization etc., one or more of the sequences set forth as SEQ ID NO: 8 to 22, and the like, modulate the expression or function of a Lipid transport and metabolism gene.
- expression or function is up-regulated as compared to a control.
- expression or function is down-regulated as compared to a control.
- oligonucleotides comprise nucleic acid sequences set forth as SEQ ID NOS: 23 to 263 including antisense sequences which are identified and expanded, using for example, PCR, hybridization etc.
- oligonucleotides can comprise one or more modified nucleotides, shorter or longer fragments, modified bonds and the like.
- modified bonds or internucleotide linkages comprise phosphorothioate, phosphorodithioate or the like.
- the nucleotides comprise a phosphorus derivative.
- the phosphorus derivative (or modified phosphate group) which may be attached to the sugar or sugar analog moiety in the modified oligonucleotides of the present invention may be a monophosphate, diphosphate, triphosphate, alkylphosphate, alkanephosphate, phosphorothioate and the like.
- the preparation of the above-noted phosphate analogs, and their incorporation into nucleotides, modified nucleotides and oligonucleotides, per se, is also known and need not be described here.
- oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man. Antisense oligonucleotides have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligonucleotides can be useful therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans.
- oligomeric antisense compounds particularly oligonucleotides, bind to target nucleic acid molecules and modulate the expression and/or function of molecules encoded by a target gene.
- DNA to be interfered comprise, for example, replication and transcription.
- the functions of RNA to be interfered comprise all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
- the functions may be up-regulated or inhibited depending on the functions desired.
- the antisense compounds include, antisense oligomeric compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid. As such, these compounds may be introduced in the form of single-stranded, double-stranded, partially single-stranded, or circular oligomeric compounds.
- Targeting an antisense compound to a particular nucleic acid molecule in the context of this invention, can be a multistep process. The process usually begins with the identification of a target nucleic acid whose function is to be modulated.
- This target nucleic acid may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
- the target nucleic acid encodes a Lipid transport and metabolism gene.
- the targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result.
- the term "region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of target nucleic acids are segments. "Segments” are defined as smaller or sub-portions of regions within a target nucleic acid.
- Sites as used in the present invention, are defined as positions within a target nucleic acid.
- the antisense oligonucleotides bind to the natural antisense sequences of a Lipid transport and metabolism gene and modulate the expression and/or function of a Lipid transport and metabolism gene (SEQ ID NO: 1). Examples of antisense sequences include SEQ ID NOS: 8 to 263. [00115] In another preferred embodiment, the antisense oligonucleotides bind to one or more segments of a Lipid transport and metabolism gene polynucleotide and modulate the expression and/or function of a Lipid transport and metabolism gene. The segments comprise at least five consecutive nucleotides of a Lipid transport and metabolism gene sense or antisense polynucleotides.
- the antisense oligonucleotides are specific for natural antisense sequences of a Lipid transport and metabolism gene wherein binding of the oligonucleotides to the natural antisense sequences of a Lipid transport and metabolism gene modulate expression and/or function of a Lipid transport and metabolism gene.
- oligonucleotide compounds comprise sequences set forth as SEQ ID NOS: 23 to 263, antisense sequences which are identified and expanded, using for example, PCR, hybridization etc. These oligonucleotides can comprise one or more modified nucleotides, shorter or longer fragments, modified bonds and the like.
- modified bonds or internucleotide linkages comprise phosphorothioate, phosphorodithioate or the like.
- the nucleotides comprise a phosphorus derivative.
- the phosphorus derivative (or modified phosphate group) which may be attached to the sugar or sugar analog moiety in the modified oligonucleotides of the present invention may be a monophosphate, diphosphate, triphosphate, alkylphosphate, alkanephosphate, phosphorothioate and the like.
- the preparation of the above-noted phosphate analogs, and their incorporation into nucleotides, modified nucleotides and oligonucleotides, per se, is also known and need not be described here.
- the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon,” the “start codon” or the "AUG start codon”.
- a minority of genes has a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG; and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
- translation initiation codon and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes).
- Eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
- start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding a Lipid transport and metabolism gene, regardless of the sequence(s) of such codons.
- a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'- TAG and 5'-TGA, respectively).
- start codon region and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon.
- stop codon region and “translation termination codon region” referto a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon. Consequently, the "start codon region” (or “translation initiation codon region”) and the “stop codon region” (or “translation termination codon region”) are all regions that may be targeted effectively with the antisense compounds of the present invention.
- a targeted region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
- Another target region includes the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene).
- Still another target region includes the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene).
- the 5' cap site of an mRNA comprises an N7 -methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage.
- the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site.
- Another target region for this invention is the 5' cap region.
- mRNA transcripts Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns," which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as “exons" and are spliced together to form a continuous mRNA sequence.
- targeting splice sites i.e., intron-exon junctions or exon-intron junctions, is particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease.
- An aberrant fusion junction due to rearrangement or deletion is another embodiment of a target site.
- mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". Introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.
- the antisense oligonucleotides bind to coding and/or non-coding regions of a target polynucleotide and modulate the expression and/or function of the target molecule. [00124] In another preferred embodiment, the antisense oligonucleotides bind to natural antisense polynucleotides and modulate the expression and/or function of the target molecule.
- the antisense oligonucleotides bind to sense polynucleotides and modulate the expression and/or function of the target molecule.
- RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence.
- pre-mRNA variants Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller "mRNA variants". Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as "alternative splice variants”. If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
- Variants can be produced through the use of alternative signals to start or stop transcription.
- Pre-mRNAs and mRNAs can possess more than one start codon or stop codon.
- Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as "alternative start variants" of that pre-mRNA or mRNA.
- Those transcripts that use an alternative stop codon are known as "alternative stop variants" of that pre-mRNA or mRNA.
- One specific type of alternative stop variant is the "polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the "polyA stop signals" by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites.
- the types of variants described herein are also embodiments of target nucleic acids.
- target nucleic acid to which the antisense compounds hybridize are defined as at least a 5-nucleotide long portion of a target region to which an active antisense compound is targeted.
- target segments 5-100 nucleotides in length comprising a stretch of at least five (5) consecutive nucleotides selected from within the illustrative preferred target segments are considered to be suitable for targeting as well.
- Target segments can include DNA or RNA sequences that comprise at least the 5 consecutive nucleotides from the 5 '-terminus of one of the illustrative preferred target segments (the remaining nucleotides being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5 '-terminus of the target segment and continuing until the DNA or RNA contains about 5 to about 100 nucleotides).
- preferred target segments are represented by DNA or RNA sequences that comprise at least the 5 consecutive nucleotides from the 3 '-terminus of one of the illustrative preferred target segments (the remaining nucleotides being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3'-terminus of the target segment and continuing until the DNA or RNA contains about 5 to about 100 nucleotides).
- One having skill in the art armed with the target segments illustrated herein will be able, without undue experimentation, to identify further preferred target segments.
- antisense compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
- the oligonucleotides bind to an antisense strand of a particular target.
- the oligonucleotides are at least 5 nucleotides in length and can be synthesized so each oligonucleotide targets overlapping sequences such that oligonucleotides are synthesized to cover the entire length of the target polynucleotide.
- the targets also include coding as well as non coding regions.
- Targeting an antisense compound to a particular nucleic acid is a multistep process.
- the process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a non coding polynucleotide such as for example, non coding RNA (ncRNA).
- ncRNA non coding RNA
- RNAs can be classified into (1) messenger RNAs (mRNAs), which are translated into proteins, and (2) non- protein-coding RNAs (ncRNAs). ncRNAs comprise microRNAs, antisense transcripts and other Transcriptional Units (TU) containing a high density of stop codons and lacking any extensive "Open Reading Frame". Many ncRNAs appear to start from initiation sites in 3' untranslated regions (3'UTRs) of protein-coding loci. ncRNAs are often rare and at least half of the ncRNAs that have been sequenced by the FANTOM consortium seem not to be polyadenylated. Most researchers have for obvious reasons focused on polyadenylated mRNAs that are processed and exported to the cytoplasm.
- mRNAs messenger RNAs
- ncRNAs non- protein-coding RNAs
- TU Transcriptional Units
- Many ncRNAs appear to start from initiation sites in 3' untranslated regions (3'UTRs) of protein-coding loc
- ncRNAs may regulate gene expression by base pairing with target transcripts.
- RNAs that function by base pairing can be grouped into (1) cis encoded RNAs that are encoded at the same genetic location, but on the opposite strand to the RNAs they act upon and therefore display perfect complementarity to their target, and (2) trans-encoded RNAs that are encoded at a chromosomal location distinct from the RNAs they act upon and generally do not exhibit perfect base-pairing potential with their targets.
- perturbation of an antisense polynucleotide by the antisense oligonucleotides described herein can alter the expression of the corresponding sense messenger RNAs.
- this regulation can either be discordant (antisense knockdown results in messenger RNA elevation) or concordant (antisense knockdown results in concomitant messenger RNA reduction).
- antisense oligonucleotides can be targeted to overlapping or non-overlapping parts of the antisense transcript resulting in its knockdown or sequestration.
- Coding as well as non-coding antisense can be targeted in an identical manner and that either category is capable of regulating the corresponding sense transcripts - either in a concordant or disconcordant manner.
- the strategies that are employed in identifying new oligonucleotides for use against a target can be based on the knockdown of antisense RNA transcripts by antisense oligonucleotides or any other means of modulating the desired target.
- Strategy 1 In the case of discordant regulation, knocking down the antisense transcript elevates the expression of the conventional (sense) gene. Should that latter gene encode for a known or putative drug target, then knockdown of its antisense counterpart could conceivably mimic the action of a receptor agonist or an enzyme stimulant.
- Strategy 2 In the case of concordant regulation, one could concomitantly knock down both antisense and sense transcripts and thereby achieve synergistic reduction of the conventional (sense) gene expression. If, for example, an antisense oligonucleotide is used to achieve knockdown, then this strategy can be used to apply one antisense oligonucleotide targeted to the sense transcript and another antisense oligonucleotide to the corresponding antisense transcript, or a single energetically symmetric antisense oligonucleotide that simultaneously targets overlapping sense and antisense transcripts.
- antisense compounds include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid and modulate its function.
- they may be DNA, RNA, DNA-like, RNA-like, or mixtures thereof, or may be mimetics of one or more of these.
- These compounds may be single-stranded, doublestranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges, mismatches or loops.
- Antisense compounds are routinely prepared linearly but can be joined or otherwise prepared to be circular and/or branched.
- Antisense compounds can include constructs such as, for example, two strands hybridized to form a wholly or partially double-stranded compound or a single strand with sufficient self- complementarity to allow for hybridization and formation of a fully or partially double-stranded compound.
- the two strands can be linked internally leaving free 3' or 5' termini or can be linked to form a continuous hairpin structure or loop.
- the hairpin structure may contain an overhang on either the 5' or 3' terminus producing an extension of single stranded character.
- the double stranded compounds optionally can include overhangs on the ends.
- dsRNA can take the form of a self-complementary hairpin-type molecule that doubles back on itself to form a duplex.
- the dsRNAs can be fully or partially double stranded. Specific modulation of gene expression can be achieved by stable expression of dsRNA hairpins in transgenic cell lines, however, in some embodiments, the gene expression or function is up regulated.
- the two strands When formed from two strands, or a single strand that takes the form of a self-complementary hairpin-type molecule doubled back on itself to form a duplex, the two strands (or duplex- forming regions of a single strand) are complementary RNA strands that base pair in Watson-Crick fashion.
- nucleic acids including oligonucleotides
- DNA-like i.e., generally having one or more 2'-deoxy sugars and, generally, T rather than U bases
- RNA-like i.e., generally having one or more 2'- hydroxyl or 2'-modified sugars and, generally U rather than T bases
- Nucleic acid helices can adopt more than one type of structure, most commonly the A- and B-forms.
- an antisense compound may contain both A- and B-form regions.
- the desired oligonucleotides or antisense compounds comprise at least one of: antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interference RNA (RNAi), short interfering RNA (siRNA); a micro, interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNAs (saRNAs), or combinations thereof.
- RNAi interference RNA
- siRNA short interfering RNA
- miRNA micro, interfering RNA
- shRNA small, temporal RNA
- shRNA short, hairpin RNA
- small RNA-induced gene activation RNAa
- small activating RNAs small activating RNAs (saRNAs), or combinations thereof.
- dsRNA can also activate gene expression, a mechanism that has been termed "small RNA-induced gene activation" or RNAa. dsRNAs targeting gene promoters induce potent transcriptional activation of associated genes. RNAa was demonstrated in human cells using synthetic dsRNAs, termed “small activating RNAs" (saRNAs). It is currently not known whether RNAa is conserved in other organisms.
- small double-stranded RNA such as small interfering RNA (siRNA) and microRNA (miRNA) have been found to be the trigger of an evolutionary conserved mechanism known as RNA interference (RNAi).
- RNAi invariably leads to gene silencing via remodeling chromatin to thereby suppress transcription, degrading complementary mRNA, or blocking protein translation.
- oligonucleotides are shown to increase the expression and/or function of the Lipid transport and metabolism gene polynucleotides and encoded products thereof.
- dsRNAs may also act as small activating RNAs (saRNA).
- saRNA small activating RNAs
- the "preferred target segments” identified herein may be employed in a screen for additional compounds that modulate the expression of a Lipid transport and metabolism gene polynucleotide.
- “Modulators” are those compounds that decrease or increase the expression of a nucleic acid molecule encoding a Lipid transport and metabolism gene and which comprise at least a 5 -nucleotide portion that is complementary to a preferred target segment.
- the screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding sense or natural antisense polynucleotides of a Lipid transport and metabolism gene with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding a Lipid transport and metabolism gene polynucleotide, e.g. SEQ ID NOS: 23 to 263.
- the candidate modulator or modulators are capable of modulating (e.g.
- the modulator may then be employed in further investigative studies of the function of a Lipid transport and metabolism gene polynucleotide, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
- Targeting the natural antisense sequence preferably modulates the function of the target gene.
- the Lipid transport and metabolism gene e.g. accession numbers NM 005502, NM 000229, NM 002332, NM_008512, NM_000527.3, NM_000041, NM_000039, Fig. 2.
- the target is an antisense polynucleotide of the Lipid transport and metabolism gene.
- an antisense oligonucleotide targets sense and/or natural antisense sequences of a Lipid transport and metabolism gene polynucleotide (e.g.
- the oligonucleotide is an antisense molecule and the targets include coding and noncoding regions of antisense and/or sense Lipid transport and metabolism gene polynucleotides.
- the preferred target segments of the present invention may be also be combined with their respective complementary antisense compounds of the present invention to form stabilized double-stranded (duplexed) oligonucleotides.
- double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation as well as RNA processing via an antisense mechanism. Moreover, the double-stranded moieties may be subject to chemical modifications (Fire et al, (1998) Nature, 391, 806-811; Timmons and Fire, (1998) Nature, 395, 854; Timmons et al, (2001) Gene, 263, 103-112; Tabara et al, (1998) Science, 282, 430-431; Montgomery et al, (1998) Proc. Natl. Acad.
- an antisense oligonucleotide targets Lipid transport and metabolism gene polynucleotides (e.g.
- oligonucleotide is an antisense molecule.
- the target nucleic acid molecule is not limited to Lipid transport and metabolism gene alone but extends to any of the isoforms, receptors, homologs and the like of a Lipid transport and metabolism gene molecule.
- an oligonucleotide targets a natural antisense sequence of a Lipid transport and metabolism gene polynucleotide, for example, polynucleotides set forth as SEQ ID NO: 8 to 22, and any variants, alleles, homologs, mutants, derivatives, fragments and complementary sequences thereto.
- antisense oligonucleotides are set forth as SEQ ID NOS: 23 to 263.
- the oligonucleotides are complementary to or bind to nucleic acid sequences of a Lipid transport and metabolism gene antisense, including without limitation noncoding sense and/or antisense sequences associated with a Lipid transport and metabolism gene polynucleotide and modulate expression and/or function of a Lipid transport and metabolism gene molecule.
- the oligonucleotides are complementary to or bind to nucleic acid sequences of a Lipid transport and metabolism gene natural antisense, set forth as SEQ ID NO: 8 to 22 and modulate expression and/or function of a Lipid transport and metabolism gene molecule.
- oligonucleotides comprise sequences of at least 5 consecutive nucleotides of SEQ ID NOS: 23 to 263 and modulate expression and/or function of a Lipid transport and metabolism gene molecule.
- the polynucleotide targets comprise Lipid transport and metabolism gene, including family members thereof, variants of a Lipid transport and metabolism gene; mutants of a Lipid transport and metabolism gene, including SNPs; noncoding sequences of a Lipid transport and metabolism gene; alleles of a Lipid transport and metabolism gene; species variants, fragments and the like.
- the oligonucleotide is an antisense molecule.
- the oligonucleotide targeting Lipid transport and metabolism gene polynucleotides comprise: antisense RNA, interference RNA (RNAi), short interfering RNA (siRNA); micro interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); or, small activating RNA (saRNA).
- RNAi interference RNA
- siRNA short interfering RNA
- miRNA micro interfering RNA
- shRNA small, temporal RNA
- shRNA small RNA-induced gene activation
- RNAa small activating RNA
- targeting of a Lipid transport and metabolism gene polynucleotide, e.g. SEQ ID NO: 8 to 22 modulate the expression or function of these targets.
- expression or function is up-regulated as compared to a control.
- expression or function is down-regulated as compared to a control.
- antisense compounds comprise sequences set forth as SEQ ID NOS: 23 to 263.
- These oligonucleotides can comprise one or more modified nucleotides, shorter or longer fragments, modified bonds and the like.
- SEQ ID NOS: 23 to 263 comprise one or more LNA nucleotides.
- the modulation of a desired target nucleic acid can be carried out in several ways known in the art. For example, antisense oligonucleotides, siRNA etc.
- Enzymatic nucleic acid molecules e.g., ribozymes are nucleic acid molecules capable of catalyzing one or more of a variety of reactions, including the ability to repeatedly cleave other separate nucleic acid molecules in a nucleotide base sequence-specific manner.
- Such enzymatic nucleic acid molecules can be used, for example, to target virtually any RNA transcript (Zaug et ah, 324, Nature 429 1986; Cech, 260 JAMA 3030, 1988; and Jefferies et al, 17 ' Nucleic Acids Research 1371, 1989).
- Enzymatic nucleic acid molecules can be designed to cleave specific RNA targets within the background of cellular RNA. Such a cleavage event renders the mRNA nonfunctional and abrogates protein expression from that RNA. In this manner, synthesis of a protein associated with a disease state can be selectively inhibited.
- enzymatic nucleic acids with RNA cleaving activity act by first binding to a target RNA. Such binding occurs through the target binding portion of a enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA.
- the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RNA target, it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.
- RNA-cleaving ribozymes for the purpose of regulating gene expression.
- the hammerhead ribozyme functions with a catalytic rate (kcat) of about 1 min-1 in the presence of saturating (10 mM) concentrations of Mg2+ cofactor.
- An artificial "RNA ligase" ribozyme has been shown to catalyze the corresponding self-modification reaction with a rate of about 100 min-1.
- RNA catalyst Intermolecular cleavage of an RNA substrate by an RNA catalyst that fits the "hammerhead” model was first shown in 1987 (Uhlenbeck, O. C. (1987) Nature, 328: 596-600). The RNA catalyst was recovered and reacted with multiple RNA molecules, demonstrating that it was truly catalytic. [00166] Catalytic RNAs designed based on the "hammerhead” motif have been used to cleave specific target sequences by making appropriate base changes in the catalytic RNA to maintain necessary base pairing with the target sequences (Haseloff and Gerlach, (1988) Nature, 334, 585; Walbot and Bruening, (1988) Nature, 334, 196; Uhlenbeck, O. C.
- RNA interference has become a powerful tool for modulating gene expression in mammals and mammalian cells.
- This approach requires the delivery of small interfering RNA (siRNA) either as RNA itself or as DNA, using an expression plasmid or virus and the coding sequence for small hairpin RNAs that are processed to siRNAs.
- siRNA small interfering RNA
- This system enables efficient transport of the pre-siRNAs to the cytoplasm where they are active and permit the use of regulated and tissue specific promoters for gene expression.
- an oligonucleotide or antisense compound comprises an oligomer or polymer of ribonucleic acid (RNA) and/or deoxyribonucleic acid (DNA), or a mimetic, chimera, analog or homolog thereof.
- RNA ribonucleic acid
- DNA deoxyribonucleic acid
- mimetic, chimera analog or homolog thereof.
- This term includes oligonucleotides composed of naturally occurring nucleotides, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly.
- Such modified or substituted oligonucleotides are often desired over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.
- the oligonucleotides or "antisense compounds” include antisense oligonucleotides (e.g. RNA, DNA, mimetic, chimera, analog or homolog thereof), ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, saRNA, aRNA, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid and modulate its function.
- antisense oligonucleotides e.g. RNA, DNA, mimetic, chimera, analog or homolog thereof
- ribozymes oligonucleotides
- siRNA compounds single- or double-stranded RNA interference (RNAi) compounds
- RNAi RNA interference
- siRNA compounds single- or double-stranded RNA interference
- siRNA compounds single- or double-stranded RNA interference
- Antisense compounds may be single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges, mismatches or loops.
- Antisense compounds are routinely prepared linearly but can be joined or otherwise prepared to be circular and/or branched.
- Antisense compounds can include constructs such as, for example, two strands hybridized to form a wholly or partially double-stranded compound or a single strand with sufficient self-complementarity to allow for hybridization and formation of a fully or partially double-stranded compound.
- the two strands can be linked internally leaving free 3' or 5' termini or can be linked to form a continuous hairpin structure or loop.
- the hairpin structure may contain an overhang on either the 5' or 3' terminus producing an extension of single stranded character.
- the double stranded compounds optionally can include overhangs on the ends. Further modifications can include conjugate groups attached to one of the termini, selected nucleotide positions, sugar positions or to one of the internucleoside linkages. Alternatively, the two strands can be linked via a non-nucleic acid moiety or linker group.
- dsRNA can take the form of a self-complementary hairpin-type molecule that doubles back on itself to form a duplex. Thus, the dsRNAs can be fully or partially double stranded.
- nucleic acids including oligonucleotides
- DNA-like i.e., generally having one or more 2'-deoxy sugars and, generally, T rather than U bases
- RNA-like i.e., generally having one or more 2'- hydroxyl or 2'-modified sugars and, generally U rather than T bases
- Nucleic acid helices can adopt more than one type of structure, most commonly the A- and B-forms.
- an antisense compound may contain both A- and B-form regions.
- the antisense compounds in accordance with this invention can comprise an antisense portion from about 5 to about 80 nucleotides (i.e. from about 5 to about 80 linked nucleosides) in length. This refers to the length of the antisense strand or portion of the antisense compound.
- a single-stranded antisense compound of the invention comprises from 5 to about 80 nucleotides
- a double-stranded antisense compound of the invention (such as a dsRNA, for example) comprises a sense and an antisense strand or portion of 5 to about 80 nucleotides in length.
- the antisense compounds of the invention have antisense portions of 10 to 50 nucleotides in length.
- the oligonucleotides are 15 nucleotides in length.
- the antisense or oligonucleotide compounds of the invention have antisense portions of 12 or 13 to 30 nucleotides in length.
- antisense compounds having antisense portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, or any range therewithin.
- the oligomeric compounds of the present invention also include variants in which a different base is present at one or more of the nucleotide positions in the compound.
- the first nucleotide is an adenosine
- variants may be produced which contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the antisense or dsRNA compounds. These compounds are then tested using the methods described herein to determine their ability to inhibit expression of a target nucleic acid.
- homology, sequence identity or complementarity, between the antisense compound and target is from about 40% to about 60%.
- homology, sequence identity or complementarity is from about 60% to about 70%. In some embodiments, homology, sequence identity or complementarity, is from about 70% to about 80%. In some embodiments, homology, sequence identity or complementarity, is from about 80% to about 90%. In some embodiments, homology, sequence identity or complementarity, is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100%.
- the antisense oligonucleotides such as for example, nucleic acid molecules set forth in SEQ ID NOS: 8 to 263 comprise one or more substitutions or modifications. In one embodiment, the nucleotides are substituted with locked nucleic acids (LNA).
- the oligonucleotides target one or more regions of the nucleic acid molecules sense and/or antisense of coding and/or non-coding sequences associated with Lipid transport and metabolism gene and the sequences set forth as SEQ ID NOS: 1 to 7 and 8 to 22.
- the oligonucleotides are also targeted to overlapping regions of SEQ ID NOS: 1 to 7 and 8 to 22.
- oligonucleotides of this invention are chimeric oligonucleotides.
- "Chimeric oligonucleotides” or “chimeras,” in the context of this invention, are oligonucleotides which contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
- RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of antisense modulation of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
- a chimeric oligonucleotide comprises at least one region modified to increase target binding affinity, and, usually, a region that acts as a substrate for RNAse H.
- Affinity of an oligonucleotide for its target is routinely determined by measuring the Tm of an oligonucleotide/target pair, which is the temperature at which the oligonucleotide and target dissociate; dissociation is detected spectrophotometrically. The higher the Tm, the greater is the affinity of the oligonucleotide for the target.
- Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotides mimetics as described above. Such; compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, US patent nos. 5,013,830; 5,149,797; 5, 220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference.
- the region of the oligonucleotide which is modified comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-Oalkyl, 2'-O-alkyl-O-alkyl or 2'-fluoro-modified nucleotide.
- RNA modifications include 2'-fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3' end of the RNA.
- RNAse H is a cellular endonuclease that cleaves the RNA strand of RNA:DNA duplexes; activation of this enzyme therefore results in cleavage of the RNA target, and thus can greatly enhance the efficiency of RNAi inhibition. Cleavage of the RNA target can be routinely demonstrated by gel electrophoresis.
- the chimeric oligonucleotide is also modified to enhance nuclease resistance.
- Cells contain a variety of exo- and endo-nucleases which can degrade nucleic acids. A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide. Nuclease resistance is routinely measured by incubating oligonucleotides with cellular extracts or isolated nuclease solutions and measuring the extent of intact oligonucleotide remaining over time, usually by gel electrophoresis.
- Oligonucleotides which have been modified to enhance their nuclease resistance survive intact for a longer time than unmodified oligonucleotides.
- a variety of oligonucleotide modifications have been demonstrated to enhance or confer nuclease resistance.
- Oligonucleotides which contain at least one phosphorothioate modification are presently more preferred.
- oligonucleotide modifications which enhance target binding affinity are also, independently, able to enhance nuclease resistance.
- oligonucleotides envisioned for this invention include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages.
- oligonucleotides with phosphorothioate backbones and those with heteroatom backbones particularly CH2 -NH-O- CH2, CH,-N(CH3)-O-CH2 [known as a methylene(methylimino) or MMI backbone], CH2 --O--N (CH3)-CH2, CH2 -N (CH3)-N (CH3)-CH2 and O-N (CH3)-CH2 -CH2 backbones, wherein the native phosphodiester backbone is represented as O--P-- O— CH,).
- the amide backbones disclosed by De Mesmaeker et al. (1995) Ace. Chem. Res. 28:366-374 are also preferred.
- oligonucleotides having morpholino backbone structures are also preferred.
- the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (Nielsen et al. (1991) Science 254, 1497).
- Oligonucleotides may also comprise one or more substituted sugar moieties.
- Preferred oligonucleotides comprise one of the following at the 2' position: OH, SH, SCH3, F, OCN, OCH3 OCH3, OCH3 O(CH2)n CH3, O(CH2)n NH2 or O(CH2)n CH3 where n is from 1 to about 10; Cl to ClO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3 ; 0CF3; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a
- a preferred modification includes 2'-methoxyethoxy [2'-O-CH2 CH2 OCH3, also known as 2'-O-(2-methoxyethyl)] (Martin et al, (1995) HeIv. Chim. Acta, 78, 486).
- Other preferred modifications include 2'-methoxy (2'-O-CH3), T- propoxy (2'-OCH2 CH2CH3) and 2'-fluoro (2'-F).
- Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide.
- Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
- Oligonucleotides may also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
- nucleobase often referred to in the art simply as “base”
- “unmodified” or “natural” nucleotides include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U).
- Modified nucleotides include nucleotides found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5- hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleotides, e.g., 2- aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2- (aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5- bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7- deazaguanine, N6 (6-aminohexyl)adenine and
- oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity or cellular uptake of the oligonucleotide.
- moieties include but are not limited to lipid moieties such as a cholesterol moiety, a cholesteryl moiety (Letsinger et al., (1989) Proc. Natl. Acad. ScL USA 86, 6553), cholic acid (Manoharan et al. (1994) Bioorg. Med. Chem. Let.
- a thioether e.g., hexyl-S-tritylthiol (Manoharan et al. (1992) Ann. N.Y. Acad. ScL 660, 306; Manoharan et al. (1993) Bioorg. Med. Chem. Let. 3, 2765)
- a thiocholesterol Olet al, (1992) Nucl. Acids Res. 20, 533
- an aliphatic chain e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al. EMBO J. 1991, 10, 111; Kabanov et al. (1990) FEBS Lett.
- a phospholipid e.g., di- hexadecyl-rac-glycerol or triethylammonium l ⁇ -di-O-hexadecyl-rac-glycero- 3-H-phosphonate (Manoharan et al. (1995) Tetrahedron Lett. 36, 3651; Shea et al. (1990) Nucl. Acids Res. 18, 3777), a polyamine or a polyethylene glycol chain (Manoharan et al.
- Oligonucleotides comprising lipophilic moieties, and methods for preparing such oligonucleotides are known in the art, for example, U.S. Pat. Nos. 5,138,045, 5,218,105 and 5,459,255.
- the present invention also includes oligonucleotides which are chimeric oligonucleotides as hereinbefore defined.
- the nucleic acid molecule of the present invention is conjugated with another moiety including but not limited to abasic nucleotides, polyether, polyamine, polyamides, peptides, carbohydrates, lipid, or polyhydrocarbon compounds.
- oligonucleotides used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the talents of one of ordinary skill in the art. It is also well known to use similar techniques to prepare other oligonucleotides such as the phosphorothioates and alkylated derivatives.
- CPG controlled-pore glass
- LNA monomers to enhance the potency, specificity and duration of action and broaden the routes of administration of oligonucleotides comprised of current chemistries such as MOE, ANA, FANA, PS etc (Uhlman, et al. (2000) Current Opinions in Drug Discovery & Development Vol. 3 No 2).
- This can be achieved by substituting some of the monomers in the current oligonucleotides by LNA monomers.
- the LNA modified oligonucleotide may have a size similar to the parent compound or may be larger or preferably smaller.
- LNA-modified oligonucleotides contain less than about 70%, more preferably less than about 60%, most preferably less than about 50% LNA monomers and that their sizes are between about 5 and 25 nucleotides, more preferably between about 12 and 20 nucleotides.
- Preferred modified oligonucleotide backbones comprise, but not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 '-5' to 5'- 3' or 2'-5' to 5'-2'.
- Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
- Representative United States patents that teach the preparation of the above oligonucleosides comprise, but are not limited to, US patent nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264, 562; 5, 264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596, 086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623, 070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
- both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
- the base units are maintained for hybridization with an appropriate nucleic acid target compound.
- an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
- PNA peptide nucleic acid
- the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
- nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
- Representative United States patents that teach the preparation of PNA compounds comprise, but are not limited to, US patent nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference . Further teaching of PNA compounds can be found in Nielsen, et al. (1991) Science 254, 1497-1500.
- the oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones and in particular- CH2-NH-O-CH2-,-CH2-N (CH3)-O-CH2-known as a methylene (methylimino) or MMI backbone,- CH2-O-N (CH3)-CH2-,-CH2N(CH3)-N(CH3) CH2-and-O-N(CH3)- CH2-CH2- wherein the native phosphodiester backbone is represented as-O-P-O-CH2- of the above referenced US patent no. 5,489,677, and the amide backbones of the above referenced US patent no. 5,602,240.
- oligonucleotides having morpholino backbone structures of the above-referenced US patent no. 5,034,506.
- Modified oligonucleotides may also contain one or more substituted sugar moieties.
- Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C to CO alkyl or C2 to CO alkenyl and alkynyl.
- oligonucleotides comprise one of the following at the 2' position: C to CO, (lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
- a preferred modification comprises 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2- methoxyethyl) or 2'-MOE) (Martin et al, (1995) HeIv. Chim. Acta, 78, 486-504) i.e., an alkoxyalkoxy group.
- a further preferred modification comprises 2'-dimethylaminooxyethoxy, i.e.
- a O(CH2)2ON(CH3)2 group also known as 2'-DMAOE, as described in examples herein below
- T- dimethylaminoethoxyethoxy also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'- DMAEOE
- 2'-O- CH2-O-CH2-N CH2
- Oligonucleotides may also comprise nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
- nucleobase often referred to in the art simply as “base”
- “unmodified” or “natural” nucleotides comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- Modified nucleotides comprise other synthetic and natural nucleotides such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5- propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5- trifluoromethyl and other 5-substitute
- nucleotides comprise those disclosed in United States Patent No. 3,687,808, those disclosed in 'The Concise Encyclopedia of Polymer Science And Engineering', pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al, 'Angewandle Chemie, International Edition', 1991, 30, page 613, and those disclosed by Sanghvi, Y.S., Chapter 15, 'Antisense Research and Applications', pages 289-302, Crooke, S.T. and Lebleu, B. ea., CRC Press, 1993. Certain of these nucleotides are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
- 5-substituted pyrimidines 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine.
- 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 0 C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-Omethoxyethyl sugar modifications.
- Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates, which enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide.
- Such moieties comprise but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al, (1989) Proc. Natl. Acad. ScL USA, 86, 6553-6556), cholic acid (Manoharan et al, (1994) Bioorg. Med. Chem. Let., 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al, (1992) Ann. N. Y. Acad. ScL, 660, 306-309; Manoharan et al, (1993) Bioorg. Med. Chem.
- lipid moieties such as a cholesterol moiety (Letsinger et al, (1989) Proc. Natl. Acad. ScL USA, 86, 6553-6556), cholic acid (Manoharan et al, (1994) Bioorg. Med. Chem. Let., 4,
- Acids Res., 18, 3777-3783 a polyamine or a polyethylene glycol chain (Mancharan et al, (1995) Nucleosides & Nucleotides, 14, 969-973), or adamantane acetic acid (Manoharan et al, (1995) Tetrahedron Lett., 36, 3651-3654), a palmityl moiety (Mishra et al, (1995) Biochim. Biophys. Acta, 1264, 229- 237), or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety (Crooke et al, (1996) J. Pharmacol Exp. Ther, 277, 923-937).
- Representative United States patents that teach the preparation of such oligonucleotides conjugates comprise, but are not limited to, US patent nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552, 538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486, 603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762, 779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082, 830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5, 245,022; 5,254,
- Drug discovery The compounds of the present invention can also be applied in the areas of drug discovery and target validation.
- the present invention comprehends the use of the compounds and preferred target segments identified herein in drug discovery efforts to elucidate relationships Ihat exist between a Lipid transport and metabolism gene polynucleotide and a disease state, phenotype, or condition.
- These methods include detecting or modulating a Lipid transport and metabolism gene polynucleotide comprising contacting a sample, tissue, cell, or organism with the compounds of the present invention, measuring the nucleic acid or protein level of a Lipid transport and metabolism gene polynucleotide and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further compound of the invention.
- These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the process of target validation or to determine the validity of a particular gene product as a target for treatment or prevention of a particular disease, condition, or phenotype. Assessing Op-regulation or Inhibition of Gene Expression:
- Transfer of an exogenous nucleic acid into a host cell or organism can be assessed by directly detecting the presence of the nucleic acid in the cell or organism. Such detection can be achieved by several methods well known in the art. For example, the presence of the exogenous nucleic acid can be detected by Southern blot or by a polymerase chain reaction (PCR) technique using primers that specifically amplify nucleotide sequences associated with the nucleic acid. Expression of the exogenous nucleic acids can also be measured using conventional methods including gene expression analysis. For instance, mRNA produced from an exogenous nucleic acid can be detected and quantified using a Northern blot and reverse transcription PCR (RT-PCR).
- RT-PCR Northern blot and reverse transcription PCR
- RNA from the exogenous nucleic acid can also be detected by measuring an enzymatic activity or a reporter protein activity.
- antisense modulatory activity can be measured indirectly as a decrease or increase in target nucleic acid expression as an indication that the exogenous nucleic acid is producing the effector RNA.
- primers can be designed and used to amplify coding regions of the target genes. Initially, the most highly expressed coding region from each gene can be used to build a model control gene, although any coding or non coding region can be used. Each control gene is assembled by inserting each coding region between a reporter coding region and its poly(A) signal.
- plasmids would produce an mRNA with a reporter gene in the upstream portion of the gene and a potential RNAi target in the 3' non-coding region.
- the effectiveness of individual antisense oligonucleotides would be assayed by modulation of the reporter gene.
- Reporter genes useful in the methods of the present invention include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof.
- AHAS acetohydroxyacid synthase
- AP alkaline phosphatase
- LacZ beta galactosidase
- GUS beta glucuronidase
- CAT chloramphenicol acetyltransferase
- GFP green fluorescent protein
- RFP red fluorescent protein
- YFP yellow fluorescent protein
- CFP
- Lipid transport and metabolism gene protein and mRNA expression can be assayed using methods known to those of skill in the art and described elsewhere herein.
- immunoassays such as the ELISA can be used to measure protein levels.
- Lipid transport and metabolism gene antibodies for ELISAs are available commercially, e.g., from R&D Systems (Minneapolis, MN), Abeam, Cambridge, MA.
- Lipid transport and metabolism gene expression (e.g., mRNA or protein) in a sample (e.g., cells or tissues in vivo or in vitro) treated using an antisense oligonucleotide of the invention is evaluated by comparison with Lipid transport and metabolism gene expression in a control sample.
- expression of the protein or nucleic acid can be compared using methods known to those of skill in the art with that in a mock-treated or untreated sample.
- comparison with a sample treated with a control antisense oligonucleotide e.g., one having an altered or different sequence
- a difference in the expression of the Lipid transport and metabolism gene protein or nucleic acid in a treated vs. an untreated sample can be compared with the difference in expression of a different nucleic acid (including any standard deemed appropriate by the researcher, e.g., a housekeeping gene) in a treated sample vs. an untreated sample.
- Observed differences can be expressed as desired, e.g., in the form of a ratio or fraction, for use in a comparison with control.
- the level of a Lipid transport and metabolism gene mRNA or protein, in a sample treated with an antisense oligonucleotide of the present invention is increased or decreased by about 1.25- fold to about 10-fold or more relative to an untreated sample or a sample treated with a control nucleic acid.
- the level of a Lipid transport and metabolism gene mRNA or protein is increased or decreased by at least about 1.25-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 4.5-fold, at least about 5-fold, at least about 5.5-fold, at least about 6-fold, at least about 6.5-fold, at least about 7-fold, at least about 7.5-fold, at least about 8-fold, at least about 8.5-fold, at least about 9-fold, at least about 9.5-fold, or at least about 10-fold or more.
- kits, Research Reagents, Diagnostics, and Therapeutics can be utilized for diagnostics, therapeutics, and prophylaxis, and as research reagents and components of kits.
- antisense oligonucleotides which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway.
- the compounds of the present invention are useful as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
- biological system or “system” is defined as any organism, cell, cell culture or tissue that expresses, or is made competent to express products of the Lipid transport and metabolism genes. These include, but are not limited to, humans, transgenic animals, cells, cell cultures, tissues, xenografts, transplants and combinations thereof.
- expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds that affect expression patterns.
- Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and ViIo, (2000) FEBS Lett., 480, 17-24; Celis, et al, (2000) FEBS Lett., 480, 2-16), SAGE (serial analysis of gene expression) (Madden, et al, (2000) Drug Discov. Today, 5, 415- 425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, (1999) Methods Enzymol, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al, (2000) Proc. Natl. Acad. Sci.
- the compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding a Lipid transport and metabolism gene.
- oligonucleotides that hybridize with such efficiency and under such conditions as disclosed herein as to be effective Lipid transport and metabolism gene modulators are effective primers or probes under conditions favoring gene amplification or detection, respectively.
- These primers and probes are useful in methods requiring the specific detection of nucleic acid molecules encoding a Lipid transport and metabolism gene and in the amplification of said nucleic acid molecules for detection or for use in further studies of a Lipid transport and metabolism gene.
- Hybridization of the antisense oligonucleotides, particularly the primers and probes, of the invention with a nucleic acid encoding a Lipid transport and metabolism gene can be detected by means known in the art.
- Such means may include conjugation of an enzyme to the oligonucleotide, radiolabeling of the oligonucleotide, or any other suitable detection means. Kits using such detection means for detecting the level of a Lipid transport and metabolism gene in a sample may also be prepared.
- antisense compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Antisense oligonucleotide drugs have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that antisense compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
- an animal preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of a Lipid transport and metabolism gene polynucleotide is treated by administering antisense compounds in accordance with this invention.
- the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of a Lipid transport and metabolism gene modulator.
- the Lipid transport and metabolism gene modulators of the present invention effectively modulate the activity of a Lipid transport and metabolism gene or modulate the expression of a Lipid transport and metabolism gene protein.
- the activity or expression of a Lipid transport and metabolism gene in an animal is inhibited by about 10% as compared to a control.
- the activity or expression of a Lipid transport and metabolism gene in an animal is inhibited by about 30%. More preferably, the activity or expression of a Lipid transport and metabolism gene in an animal is inhibited by 50% or more.
- the oligomeric compounds modulate expression of a Lipid transport and metabolism gene mRNA by at least 10%, by at least 50%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100% as compared to a control.
- the activity or expression of a Lipid transport and metabolism gene and/or in an animal is increased by about 10% as compared to a control.
- the activity or expression of a Lipid transport and metabolism gene in an animal is increased by about 30%.
- the activity or expression of a Lipid transport and metabolism gene in an animal is increased by 50% or more.
- the oligomeric compounds modulate expression of a Lipid transport and metabolism gene mRNA by at least 10%, by at least 50%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100% as compared to a control.
- the reduction of the expression of a Lipid transport and metabolism gene may be measured in serum, blood, adipose tissue, liver or any other body fluid, tissue or organ of the animal.
- the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding Lipid transport and metabolism gene peptides and/or the Lipid transport and metabolism gene protein itself.
- the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the compounds and methods of the invention may also be useful prophylactically.
- Conjugates [00219] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups.
- Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
- Typicalconjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
- Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence- specific hybridization with the target nucleic acid.
- Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention.
- Representative conjugate groups are disclosed in International Patent Application No. PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, which are incorporated herein by reference.
- Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5- tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-Hphosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl- oxycholesterol moiety.
- lipid moieties such as a cholesterol moiety, cholic acid, a
- Oligonucleotides of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
- active drug substances for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen
- the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as forexample, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
- Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S. Pat. Nos.
- invention practice involves administering at least one of the foregoing antisense oligonucleotides with a suitable nucleic acid delivery system.
- a suitable nucleic acid delivery system in one embodiment, that system includes a non- viral vector operably linked to the polynucleotide.
- nonviral vectors examples include the oligonucleotide alone (e.g. any one or more of SEQ ID NOS: 23 to 263) or in combination with a suitable protein, polysaccharide or lipid formulation.
- suitable nucleic acid delivery systems include viral vector, typically sequence from at least one of an adenovirus, adenovirus-associated virus (AAV), helper-dependent adenovirus, retrovirus, or hemagglutinatin virus of Japan-liposome (HVJ) complex.
- the viral vector comprises a strong eukaryotic promoter operably linked to the polynucleotide e.g., a cytomegalovirus (CMV) promoter.
- CMV cytomegalovirus
- Retroviral vectors include Moloney murine leukemia viruses and HIV-based viruses.
- One preferred HIV-based viral vector comprises at least two vectors wherein the gag and pol genes are from an HIV genome and the env gene is from another virus.
- DNA viral vectors are preferred.
- These vectors include pox vectors such as orthopox or avipox vectors, herpesvirus vectors such as a herpes simplex I virus (HSV) vector [Geller, A.I. et al, (1995) J. Neurochem, 64: 487; Lim, R, et al, in DNA Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ.
- HSV herpes simplex I virus
- the antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
- pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- pharmaceutically acceptable salts for oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein by reference.
- the present invention also includes pharmaceutical compositions and formulations that include the antisense compounds of the invention.
- the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
- administration can be made by, e.g., injection or infusion into the cerebrospinal fluid.
- Administration of antisense RNA into cerebrospinal fluid is described, e.g., in U.S. Pat. App. Pub. No. 2007/0117772, "Methods for slowing familial ALS disease progression," incorporated herein by reference in its entirety.
- administering can be with one or more agents capable of promoting penetration of the subject antisense oligonucleotide across the blood-brain barrier.
- Injection can be made, e.g., in the entorhinal cortex or hippocampus. Delivery of neurotrophic factors by administration of an adenovirus vector to motor neurons in muscle tissue is described in, e.g., U.S. Pat. No. 6,632,427, "Adenoviral-vector-mediated gene transfer into medullary motor neurons,” incorporated herein by reference.
- vectors directly to the brain e.g., the striatum, the thalamus, the hippocampus, or the substantia nigra
- Delivery of vectors directly to the brain is known in the art and described, e.g., in U.S. Pat. No. 6,756,523, "Adenovirus vectors for the transfer of foreign genes into cells of the central nervous system particularly in brain," incorporated herein by reference.
- Administration can be rapid as by injection or made over a period of time as by slow infusion or administration of slow release formulations.
- the subject antisense oligonucleotides can also be linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties.
- the antisense oligonucleotide can be coupled to any substance, known in the art to promote penetration or transport across the blood-brain barrier, such as an antibody to the transferrin receptor, and administered by intravenous injection.
- the antisense compound can be linked with a viral vector, for example, that makes the antisense compound more effective and/or increases the transport of the antisense compound across the blood-brain barrier.
- Osmotic blood brain barrier disruption can also be accomplished by, e.g., infusion of sugars including, but not limited to, meso erythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, dulcitol, myo-inositol, L(-) fructose, D(-) mannitol, D(+) glucose, D(+) arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(-) ribose, adonitol, D(+) arabitol, L(-) arabitol, D(+) fucose, L(-) fucose, D(-) lyxose, L(+) lyxose,
- the subject antisense compounds may be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
- cationic lipids may be included in the formulation to facilitate oligonucleotide uptake.
- One such composition shown to facilitate uptake is LIPOFECTIN (available from GIBCO-BRL, Bethesda, MD).
- Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.
- compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- Coated condoms, gloves and the like may also be useful.
- the pharmaceutical formulations of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas.
- the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
- Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
- the suspension may also contain stabilizers.
- compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations.
- the pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
- Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug that may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment of the present invention.
- Formulations of the present invention include liposomal formulations.
- liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
- Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomeslacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
- PEG polyethylene glycol
- compositions of the present invention may also include surfactants.
- surfactants used in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein by reference.
- the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides.
- penetration enhancers also enhance the permeability of lipophilic drugs.
- Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non- chelating nonsurfactants. Penetration enhancers and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein by reference.
- formulations are routinely designed according to their intended use, i.e. route of administration.
- Preferred formulations for topical administration include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
- Preferred lipids and liposomes include neutral (e.g. dioleoyl-phosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g.
- dimyristoylphosphatidyl glycerol DMPG dimyristoylphosphatidyl glycerol DMPG
- cationic e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoyl-phosphatidyl ethanolamine DOTMA.
- oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes.
- oligonucleotides may be complexed to lipids, in particular to cationic lipids.
- Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860.
- Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets.
- Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators.
- Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
- Preferred bile acids/salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein by reference.
- Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts.
- a particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA.
- Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
- Oligonucleotides of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein by reference.
- compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions that may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- sterile aqueous solutions may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents that function by a non-antisense mechanism.
- chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bischloroethyl- nitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-
- chemotherapeutic agents When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide).
- chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligon
- Antiinflammatory drugs including but not limited to nonsteroidal anti- inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
- compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target.
- the first target may be a particular antisense sequence of a Lipid transport and metabolism gene
- the second target may be a region from another nucleotide sequence.
- compositions of the invention may contain two or more antisense compounds targeted to different regions of the same Lipid transport and metabolism gene nucleic acid target. Numerous examples of antisense compounds are illustrated herein and others may be selected from among suitable compounds known in the art. Two or more combined compounds may be used together or sequentially.
- Dosing [00249] The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art.
- Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved.
- Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models.
- dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every 20 years.
- a patient is treated with a dosage of drug that is at least about 1, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 mg/kg body weight.
- Certain injected dosages of antisense oligonucleotides are described, e.g., in U.S. Pat. No. 7,563,884, "Antisense modulation of PTPlB expression," incorporated herein by reference in its entirety.
- Example 1 Design ofantisense oligonucleotides specific for a nucleic acid molecule antisense to a Lipid transport and metabolism gene and/or a sense strand of a Lipid transport and metabolism gene polynucleotide
- oligonucleotide specific for or oligonucleotide targets refers to an oligonucleotide having a sequence (i) capable of forming a stable complex with a portion of the targeted gene, or (ii) capable of forming a stable duplex with a portion of an mRNA transcript of the targeted gene.
- Selection of appropriate oligonucleotides is facilitated by using computer programs that automatically align nucleic acid sequences and indicate regions of identity or homology. Such programs are used to compare nucleic acid sequences obtained, for example, by searching databases such as GenBank or by sequencing PCR products. Comparison of nucleic acid sequences from a range of species allows the selection of nucleic acid sequences that display an appropriate degree of identity between species. In the case of genes that have not been sequenced, Southern blots are performed to allow a determination of the degree of identity between genes in target species and other species. By performing Southern blots at varying degrees of stringency, as is well known in the art, it is possible to obtain an approximate measure of identity.
- An antisense compound is "specifically hybridizable" when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a modulation of function and/or activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays
- the hybridization properties of the oligonucleotides described herein can be determined by one or more in vitro assays as known in the art.
- the properties of the oligonucleotides described herein can be obtained by determination of binding strength between the target natural antisense and a potential drug molecules using melting curve assay.
- the binding strength between the target natural antisense and a potential drug molecule can be estimated using any of the established methods of measuring the strength of intermolecular interactions, for example, a melting curve assay.
- Melting curve assay determines the temperature at which a rapid transition from double-stranded to single- stranded conformation occurs for the natural antisense/Molecule complex. This temperature is widely accepted as a reliable measure of the interaction strength between the two molecules.
- a melting curve assay can be performed using a cDNA copy of the actual natural antisense RNA molecule or a synthetic DNA or RNA nucleotide corresponding to the binding site of the Molecule.
- kits containing all necessary reagents to perform this assay are available (e.g. Applied Biosystems Inc. MeltDoctor kit). These kits include a suitable buffer solution containing one of the double strand DNA (dsDNA) binding dyes (such as ABI HRM dyes, SYBR Green, SYTO, etc.). The properties of the dsDNA dyes are such that they emit almost no fluorescence in free form, but are highly fluorescent when bound to dsDNA.
- dsDNA binding dyes such as ABI HRM dyes, SYBR Green, SYTO, etc.
- the cDNA or a corresponding oligonucleotide are mixed with Molecule in concentrations defined by the particular manufacturer's protocols.
- the mixture is heated to 95 0 C to dissociate all preformed dsDNA complexes, then slowly cooled to room temperature or other lower temperature defined by the kit manufacturer to allow the DNA molecules to anneal.
- the newly formed complexes are then slowly heated to 95 0 C with simultaneous continuous collection of data on the amount of fluorescence that is produced by the reaction.
- the fluorescence intensity is inversely proportional to the amounts of dsDNA present in the reaction.
- the data can be collected using a real time PCR instrument compatible with the kit (e.g.
- All antisense oligonucleotides were diluted to the concentration of 20 ⁇ M. Two ⁇ l of this solution was incubated with 400 ⁇ l of Opti-MEM media (Gibco cat#31985-070) and 4 ⁇ l of Lipofectamine 2000 (Invitrogen cat# 11668019) at room temperature for 20 min and applied to each well of the 6 well plates with 518A2 cells. A Similar mixture including 2 ⁇ l of water instead of the oligonucleotide solution was used for the mock-transfected controls. After 3-18 h of incubation at 37°C and 5% CO2 the media was changed to fresh growth media.
- the cDNA from this reverse transcription reaction was used to monitor gene expression by real time PCR using ABI Taqman Gene Expression Mix (cat#4369510) and primers/probes designed by ABI (Applied Biosystems Taqman Gene Expression Assay by Applied Biosystems Inc., Foster City CA).
- the following PCR cycle was used: 50 0 C for 2 min, 95°C for 10 min, 40 cycles of (95°C for 15 seconds, 60 0 C for 1 min) using StepOne Plus Real Time PCR Machine (Applied Biosystems).
- 3T3 cells from ATCC (cat# CRL-1658) were grown in growth media (MEM/EBSS (Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV) +10% FBS (Mediatech cat# MT35- OH-CV)+ penicillin/streptomycin (Mediatech cat# MT30-002-CI)) at 37°C and 5% CO 2 .
- MEM/EBSS Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV
- FBS Mediatech cat# MT35- OH-CV
- penicillin/streptomycin Mediatech cat# MT30-002-CI
- All antisense oligonucleotides were diluted to the concentration of 20 ⁇ M. Two ⁇ l of this solution was incubated with 400 ⁇ l of Opti-MEM media (Gibco cat#31985-070) and 4 ⁇ l of Lipofectamine 2000 (Invitrogen cat# 11668019) at room temperature for 20 min and applied to each well of the 6 well plates with 3T3 cells. A Similar mixture including 2 ⁇ l of water instead of the oligonucleotide solution was used for the mock-transfected controls. After 3-18 h of incubation at 37°C and 5% CO 2 the media was changed to fresh growth media.
- the cDNA from this reverse transcription reaction was used to monitor gene expression by real time PCR using ABI Taqman Gene Expression Mix (cat#4369510) and primers/probes designed by ABI (Applied Biosystems Taqman Gene Expression Assay by Applied Biosystems Inc., Foster City CA).
- the following PCR cycle was used: 50 0 C for 2 min, 95°C for 10 min, 40 cycles of (95°C for 15 seconds, 60 0 C for 1 min) using StepOne Plus Real Time PCR Machine (Applied Biosystems).
- Fold change in gene expression after treatment with antisense oligonucleotides was calculated based on the difference in 18S-normalized dCt values between treated and mock-transfected samples. Results:
- Method 1 Treatment ofHepG2 cells with naked antisense oligonucleotides: [00270] HepG2 cells from ATCC (cat# HB-8065) were grown in growth media (MEM/EBSS (Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV) +10% FBS (Mediatech cat# MT35-011-CV)+ penicillin/streptomycin (Mediatech cat# MT30-002-CI)) at 37°C and 5% CO 2 . One day before the experiment the cells were replated at the density of 0.5 x 10 4 /ml into 6 well plates and incubated at 37°C and 5% CO 2 .
- MEM/EBSS Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV
- FBS Mediatech cat# MT35-011-CV
- penicillin/streptomycin Mediatech cat# MT30-002-CI
- PCR cycle 50 0 C for 2 min, 95°C for 10 min, 40 cycles of (95°C for 15 seconds, 60 0 C for 1 min) using Mx4000 thermal cycler (Stratagene). Fold change in gene expression after treatment with antisense oligonucleotides was calculated based on the difference in 18S-normalized dCt values between treated and mock-transfected samples.
- HepG2 cells from ATCC (cat# HB-8065) were grown in growth media (MEM/EBSS (Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV) +10% FBS (Mediatech cat# MT35-011-CV)+ penicillin/streptomycin (Mediatech cat# MT30-002-CI)) at 37°C and 5% CO 2 .
- MEM/EBSS Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV
- FBS Mediatech cat# MT35-011-CV
- penicillin/streptomycin Mediatech cat# MT30-002-CI
- PCR cycle 50 0 C for 2 min, 95°C for 10 min, 40 cycles of (95°C for 15 seconds, 6O 0 C for 1 min) using Mx4000 thermal cycler (Stratagene). Fold change in gene expression after treatment with antisense oligonucleotides was calculated based on the difference in 18S-normalized dCt values between treated and mock-transfected samples. Results:
- Real time PCR results show that the levels of APOE mRNA in HepG2 cells are significantly increased 48 h after treatment with three of the antisense oligos designed to APOE antisense Hs.626623. Oligos designed to APOE4 antisense Hs.714236 did not significantly elevate APOE mRNA (Fig M). Real time PCR results show that the levels of ApoAl mRNA in HepG2 cells are significantly increased 48 h after treatment with some of the antisense oligonucleotides to ApoAl antisense DA327409ext (Fig IN to Fig IP).
- Real time PCR results showing the fold change in ApoAl mRNA (top panel) and ApoAl natural antisense DA327409ext RNA (bottom panel) after treatment of HepG2 cells with naked LNA or phosphothioate oligonucleotides over 7 days as compared to control (Fig Q).
- Real time PCR results showing the fold change in ApoAl mRNA (orange bars) and ApoAl natural antisense DA327409ext RNA (blue bars) after treatment of HepG2 cells with LNA oligonucleotides (Fig R).
- Treatment o/Hek293 cells with antisense oligonucleotides Treatment o/Hek293 cells with antisense oligonucleotides
- Hek293 cells from ATCC were grown in growth media (MEM/EBSS (Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV) +10% FBS (Mediatech cat# MT35- OH-CV)+ penicillin/streptomycin (Mediatech cat# MT30-002-CI)) at 37°C and 5% CO 2 .
- MEM/EBSS Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV
- FBS Mediatech cat# MT35- OH-CV
- penicillin/streptomycin Mediatech cat# MT30-002-CI
- All antisense oligonucleotides were diluted to the concentration of 20 ⁇ M. Two ⁇ l of this solution was incubated with 400 ⁇ l of Opti-MEM media (Gibco cat#31985-070) and 4 ⁇ l of Lipofectamine 2000 (Invitrogen cat# 11668019) at room temperature for 20 min and applied to each well of the 6 well plates with Hek293 cells. A Similar mixture including 2 ⁇ l of water instead of the oligonucleotide solution was used for the mock-transfected controls. After 3-18 h of incubation at 37°C and 5% CO 2 the media was changed to fresh growth media.
- the cDNA from this reverse transcription reaction was used to monitor gene expression by real time PCR using ABI Taqman Gene Expression Mix (cat#4369510) and primers/probes designed by ABI (Applied Biosystems Taqman Gene Expression Assay by Applied Biosystems Inc., Foster City CA).
- the following PCR cycle was used: 50 0 C for 2 min, 95°C for 10 min, 40 cycles of (95°C for 15 seconds, 60 0 C for 1 min) using using Mx4000 thermal cycler (Stratagene) or StepOne Plus Real Time PCR Machine (Applied Biosystems).
- Vero 76 cells from ATCC (cat# CRL-1587) were grown in growth media (MEM/EBSS (Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV) +10% FBS (Mediatech cat# MT35- OH-CV)+ penicillin/streptomycin (Mediatech cat# MT30-002-CI)) at 37°C and 5% CO 2 .
- MEM/EBSS Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV
- FBS Mediatech cat# MT35- OH-CV
- penicillin/streptomycin Mediatech cat# MT30-002-CI
- All antisense oligonucleotides were diluted to the concentration of 20 ⁇ M. Two ⁇ l of this solution was incubated with 400 ⁇ l of Opti-MEM media (Gibco cat#31985-070) and 4 ⁇ l of Lipofectamine 2000 (Invitrogen cat# 11668019) at room temperature for 20 min and applied to each well of the 6 well plates with Vero 76 cells. A Similar mixture including 2 ⁇ l of water instead of the oligonucleotide solution was used for the mock-transfected controls. After 3-18 h of incubation at 37°C and 5% CO 2 the media was changed to fresh growth media.
- the cDNA from this reverse transcription reaction was used to monitor gene expression by real time PCR using ABI Taqman Gene Expression Mix (cat#4369510) and primers/probes designed by ABI (Applied Biosystems Taqman Gene Expression Assay by Applied Biosystems Inc., Foster City CA).
- the following PCR cycle was used: 50 0 C for 2 min, 95°C for 10 min, 40 cycles of (95°C for 15 seconds, 6O 0 C for 1 min) using using Mx4000 thermal cycler (Stratagene) or StepOne Plus Real Time PCR Machine (Applied Biosystems).
- Fold change in gene expression after treatment with antisense oligonucleotides was calculated based on the difference in 18S-normalized dCt values between treated and mock-transfected samples. Results:
- Detection probes used in Applied Biosystems Gene Expression Assays ABCAl: Hs00194045_ml (human), Mm01350760_ml (mouse) LCAT: Hs00173415_ml LRPl: Hs00233856_ml (human), Mm00464608_ml (mouse) LDLR: Hs00181192_ml ApoE: Hs00171168_ml ApoAl: Hs00163641_ml, 18S cat# 4319413E Custom designed assay for ApoAl antisense DA327409ext: FAM labeled: TTTGGATCTGGACGACTTC (SEQ ID NO: 275)
- Example 3 Modulation of a Lipid transport and metabolism gene Expression Materials and Methods [00278] Cells were treated with either of the following methods: Method 1: Treatment ofHepG2 cells with naked antisense oligonucleotides:
- HepG2 cell were grown in MEM/EBSS (Hyclone cat #SH30024) +10% FBS+ penicillin+streptomycin at 37°C and 5% CO 2 .
- MEM/EBSS Hyclone cat #SH30024
- penicillin+streptomycin at 37°C and 5% CO 2 .
- the cells were replated at the density of 1.5xlO 4 /ml into 6 well plates and left at 37°C and 5% CO 2 .
- the media in the 6 well plates was changed to fresh MEM/EBSS +10% FBS. All antisense oligonucleotides manufactured by IDT were diluted to the concentration of 20 ⁇ M.
- PCR cycle 50 0 C for 2 min, 95°C for 10 min, 40 cycles of (95°C for 15 seconds, 6O 0 C for 1 min) using Mx4000 thermal cycler (Stratagene). Fold change in gene expression after treatment with antisense oligonucleotides was calculated based on the difference in 18S-normalized dCt values between treated and mock-transfected samples.
- Probe sequence (FAM labeled) TTTGGATCTGGACGACTTC (SEQ ID NO: 275)
- HepG2 cells from ATCC (cat# HB-8065) were grown in growth media (MEM/EBSS (Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV) +10% FBS (Mediatech cat# MT35-011-CV)+ penicillin/streptomycin (Mediatech cat# MT30-002-CI)) at 37°C and 5% CO 2 .
- MEM/EBSS Hyclone cat #SH30024, or Mediatech cat # MT-IO-OlO-CV
- FBS Mediatech cat# MT35-011-CV
- penicillin/streptomycin Mediatech cat# MT30-002-CI
- All antisense oligonucleotides were diluted to the concentration of 20 ⁇ M. 2 ⁇ l of this solution was incubated with 400 ⁇ l of Opti-MEM media (Gibco cat#31985-070) and 4 ⁇ l of Lipofectamine 2000 (Invitrogen cat# 11668019) at room temperature for 20 min and applied to each well of the 6 well plates with HepG2 cells. Similar mixture including 2 ⁇ l of water instead of the oligonucleotide solution was used for the mock-transfected controls. After 3-18 h of incubation at 37°C and 5% CO 2 the media was changed to fresh growth media.
- RNA 600 ng was added to the reverse transcription reaction performed using Verso cDNA kit from Thermo Scientific (cat#AB1453B) as described in the manufacturer's protocol.
- the cDNA from this reverse transcription reaction was used to monitor gene expression by real time PCR using ABI Taqman Gene Expression Mix (cat#4369510) and primers/probes designed by ABI (Applied Biosystems Inc., Foster City CA).
- the following PCR cycle was used: 50 0 C for 2 min, 95°C for 10 min, 40 cycles of (95°C for 15 seconds, 6O 0 C for 1 min) using Mx4000 thermal cycler (Stratagene).
- CTGGTGGATGAAGAAGGTTTGC Treatment of primary monkey hepatocytes
- Primary monkey hepatocytes were introduced into culture by RxGen Inc. and plated in 6 well plates. They were treated with oligonucleotides as follows. The media in the 6 well plates was changed to fresh growth media consisting of William's Medium E (Sigma cat#W4128) supplemented with 5% FBS, 50 U/ml penicillin and 50 ug/ml streptomycin, 4 ug/ml insulin, 1 uM dexamethasone, 10 ug/ml Fungin (InVivogen, San Diego CA). All antisense oligonucleotides were diluted to the concentration of 20 ⁇ M.
- PCR cycle 50 0 C for 2 min, 95°C for 10 min, 40 cycles of (95°C for 15 seconds, 60 0 C for 1 min) using Mx4000 thermal cycler (Stratagene). Fold change in gene expression after treatment with antisense oligonucleotides was calculated based on the difference in 18S-normalized dCt values between treated and mock-transfected samples.
- ELISA was conducted using MabTech Inc. ApoAl ELISA kit cat# 3710-11-6 according to manufacturer's instructions. [00281] The results are shown in Fig. IQ to Fig. IT.
- Figure Q shows that both oligonucleotides with the phosphothioate backbone, i.e.
- Figure T shows upregulation of ApoAl mRNA in primary African green monkey hepatocytes after treatment with oligonucleotides designed against DA327409ext.
- Example 4 Efficacy and Duration of Action Study of CUR-962 in the African Green Monkey [00282] The objective of this study was to assess and compare the effect of antisense knockdown of the discordant noncoding antisense sequences that regulate a Lipid transport and metabolism gene following intravenous administration in a nonhuman primate model.
- the antisense oligonucleotide test articles designed to inhibit the APOAl regulatory sequences were designated as CUR-962.
- CUR-962 +G*+C*T* A*G*T* C*T*G* +T*+T*+G (SEQ ID NO: 278)
- CUR-963 control: +G*+T*C* T*G*A* T*G*G* +A*+G*+A (SEQ ID NO: 279)
- the test article, CUR-962 is a chemically stabilized antisense oligonucleotide.
- the vehicle for intravenous delivery is phosphate-buffered saline (PBS).
- PBS phosphate-buffered saline
- Vehicle characterization [00285] For the PBS vehicle, the composition, batch number, expiry date and storage conditions (temperature and light/dark) was obtained from the supplier.
- Test Article Storage and Handling [00286] The test substance and vehicle were stored according to the received storage conditions supplied by the
- Samples of the test article formulation will be cryopreserved for analysis of the concentration, stability and homogeneity of the test substance formulations.
- the primate is a suitable non rodent species, acceptable to regulatory authorities as an indicator of potential hazards, and for which extensive background data are available.
- the African green monkey specifically is a highly clinically relevant model of multiple human physiologic and disease states.
- the intravenous route of administration corresponds to a possible human therapeutic route. The dose of the test articles was based on the results of the dose finding studies of analogous compounds previously performed in the
- African green monkey were chosen as the primate of choice as the test substances' target sequence are conserved across species with 100 % homology in primates. Additionally, the test substance is a synthetic oligonucleotide. Consequently, dosing in primates allows for a superior assessment of the efficacy of these compounds that would be more reflective of the uptake likely to be seen in humans than in any other species.
- Expected Body Weight The monkeys weigh approximately 3-4 kg. The actual range may vary but will be documented in the data.
- Sex The test animals were adult females.
- Number of Animals Ten animals were screened to ensure identification of 8 animals appropriate for enrollment in the study.
- the Foundation has an approved assurance filed with the Office of Laboratory Animal Welfare, as required by the Guide, #A4384-01 (Axion Research Foundation/St. Kitts Biomedical Foundation). There are no special nonhuman primate veterinary care issues and biohazard issues raised by the research specified in this study. Housing and Environment [00302] To allow detection of any treatment-related clinical signs, the animals were housed individually prior to surgery and postoperatively until sacrifice. The primate building in which the individual cages were situated were illuminated entirely by ambient light, which at 17 degrees north latitude approximates a 12hr:12hr light-dark cycle as recommended in the U.S. D.H.H.S guidelines. The RxGen primate building was completely ventilated to the outside.
- the specific nutritional composition of the diet was recorded.
- the water was periodically analyzed for microbiological purity.
- the criteria for acceptable levels of contaminants in stock diet and water supply were within the analytical specifications established by the diet manufacturer and the periodic facility water evaluations, respectively.
- the water met all criteria necessary for certification as acceptable for human consumption.
- Allocation was done by means of a stratified randomization procedure based on bodyweight and plasma cholesterol profiles. Prior to and after allocation to a group, each animal was identified by a tattoo on the abdomen. Tattoos are placed on all colony animals as a means of identification in the course of routine health inspections. A cage plan was drawn up to identify the individuals housed within, and individual monkeys were further identified by a labeled tag attached to their respective cage.
- the animals were assigned to 2 treatment groups, comprised of 4 monkeys in each group. Specific animal identification numbers were provided to each monkey according to the facility numbering system. This system uniquely identifies each monkey by a letter followed by a three-digit number, e.g. Y032.
- the infusion rate will be 24 mL/kg/h.
- the animals were sedated with ketamine and xylazine prior to and during the dosing procedure.
- a venous catheter (Terumo mini vein infusion set, 20 gauge needle, or similar appropriate infusion set) was inserted into the saphenous vein. Dosing took place in each monkey between 8:00 and 10:00 a.m. shortly after the animals wake and prior to feeding.
- Mortality and morbidity will be recorded. Any decision regarding premature sacrifice will be made after consultation with the Study Director and with the Sponsor's Monitoring Engineer, if possible. Animals that are found dead or killed prematurely will be subjected to necropsy with collection of liver, kidney, heart and spleen lung tissues for histopathology. In the event of premature sacrifice a blood sample will also be taken (if possible) and the parameters determined. Animals that are found dead after regular working hours will be refrigerated overnight and necropsies performed at the start of the next working day. If the condition of an animal requires premature sacrifice, it will be euthanized by intravenous overdose of sodium pentobarbital. All research is governed by the Principles for Use of Animals. RxGen is required by law to comply with the U.S. Department of Health and Human Services standards for primate facility, which dictates the levels of severity that the procedures within this study, specified as mild, must abide.
- Plasma samples were split into three parts on days on which both chemistry and hematology measures will be made.
- One sample was collected into plasma collection tubes containing 25 ⁇ l of heparin and labeled with the study number, dose level, day number, date, unique animal identification number.
- ImI of plasma was removed to a sterile cryotube carrying the above details and stored appropriately until shipment, for blood chemistry analysis.
- One aliquot of the plasma (0.5 ml) was removed to a sterile cryotube labeled with the details described above and stored appropriately until shipment for plasma cholesterol distribution and Lipid profile analysis.
- An additional ImI and 0.5ml aliquot of plasma was flash frozen and stored in liquid nitrogen to serve as back-up samples for potential additional analyses.
- CBC complete blood count
- PTT Prothrombin Time
- Fibrinogen and D-Dimer were measured on all samples collected on days 1, 6 and 11 (and on additional days if perturbations are detected at any of these time points).
- Blood counts were assessed on 1 ml of whole blood collected in vacutainers containing EDTA.
- Coagulation profile determinations were performed on approximately 2.0 mL blood collected in vacutainers containing acid citrate dextrose (ACD) anticoagulant.
- ACD acid citrate dextrose
- Glucose Blood Urea Nitrogen, Creatinine, Total protein, Albumin, Total bilirubin, Alkaline Phosphatase, Alanine aminotransferase (ALT), Aspartate aminotransferase (AST), Cholesterol, Calcium, Phosphorus, Sodium, Potassium, Chloride, A/G ratio, BUN/Creatine (calculated) Globulins (calculated),Lipase, Amylase, Triglycerides, CPK, Lactate dehydrogenase, Gamma glutamyl transferase (GGT), Magnesium ,Total Cholesterol LDL, VLDL, HDL, ApoAl , ApoA2, ApoB, ApoE, ApoLp(a). Superchemistries and LDL and HDL measures were made on every plasma sample. ApoAl measures were made on select samples after assessment of the LDL and HDL data.
- liver Biopsies [00320] A percutaneous liver biopsy was performed on all monkeys at baseline and on days 7 and 17. A 14 gauge biopsy needle (INRAD) will be employed to obtain 2 core biopsies (-1.0 cm in length) from both the right and left lobe of the liver. Successful biopsy was confirmed by visual inspection of the biopsy sample on the biopsy needle prior to subdividing as indicated below. [00321] The samples were pooled and then split in the following manner.
- RNA was isolated employing the Trizol or TriReagent method, with an expected yield of -40 ⁇ g per 1.0 cm 14 g core biopsy (-80-100 ⁇ g total for the pooled RNA derived from all 4 pooled core biopsies from a single monkey, absent the component saved for histopathology and in situ). 5 ⁇ g of the RNA fraction were used for target-specific real-time qPCR (TaqMan miRNA assay, ABI). The remaining RNA fraction was reserved for possible genome wide expression analysis. [00322] The fixed tissue was processed for paraffin embedding. Sections were stained for H&E and histopathological findings reported under Gross Histological findings. All slides generated in this work carried a label with the study number, dose level, day number, date, unique animal identification number.
- Sample size determinations were made on the basis of prior experiments administering modified anti-sense oligonucleotides to African green monkeys and resulting clinical chemistry and lipid profile changes and associated variability.
- the total number of subjects for efficacy evaluation were twenty enrolled animals, with four animals per treatment group, and four additional screened animals.
- FIG. IU ApoAl mRNA (top panels) and protein (bottom panels) levels increased in monkey liver biopsies after treatment with CUR-962, an oligonucleotide designed to ApoAl antisense DA327409ext, compared to the baseline levels, as determined by real time PCR and ELISA respectively (two left panels). ApoAl mRNA and protein levels did not change after the same period of time in the control group dosed with an oligonucleotide that showed no effect on ApoAl levels in vitro (CUR-963, two right panels).
Abstract
Description
Claims
Priority Applications (9)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2012509979A JP5883782B2 (en) | 2009-05-06 | 2010-05-06 | Treatment of lipid transport metabolism gene-related diseases by suppression of natural antisense transcripts on lipid transport metabolism genes |
CN201080030706.2A CN102459596B (en) | 2009-05-06 | 2010-05-06 | By suppression therapy lipid transfer and the metabolic gene relevant disease of the natural antisense transcript for lipid transfer and metabolic gene |
EP10772845A EP2427553A4 (en) | 2009-05-06 | 2010-05-06 | Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene |
CA 2761152 CA2761152A1 (en) | 2009-05-06 | 2010-05-06 | Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene |
US13/318,713 US9155754B2 (en) | 2009-05-06 | 2010-05-06 | Treatment of ABCA1 gene related diseases by inhibition of a natural antisense transcript to ABCA1 |
KR1020117028622A KR101835889B1 (en) | 2009-05-06 | 2010-05-06 | Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene |
US14/815,007 US9957503B2 (en) | 2009-05-06 | 2015-07-31 | Treatment of LCAT gene related diseases by inhibition of a natural antisense transcript to LCAT |
US14/814,895 US10604755B2 (en) | 2009-05-06 | 2015-07-31 | Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene |
US15/925,266 US20180208930A1 (en) | 2009-05-06 | 2018-03-19 | Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene |
Applications Claiming Priority (10)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US17593009P | 2009-05-06 | 2009-05-06 | |
US61/175,930 | 2009-05-06 | ||
US17626709P | 2009-05-07 | 2009-05-07 | |
US61/176,267 | 2009-05-07 | ||
US18064609P | 2009-05-22 | 2009-05-22 | |
US61/180,646 | 2009-05-22 | ||
US23522709P | 2009-08-19 | 2009-08-19 | |
US61/235,227 | 2009-08-19 | ||
US24821209P | 2009-10-02 | 2009-10-02 | |
US61/248,212 | 2009-10-02 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US13/318,713 A-371-Of-International US9155754B2 (en) | 2009-05-06 | 2010-05-06 | Treatment of ABCA1 gene related diseases by inhibition of a natural antisense transcript to ABCA1 |
US14/814,895 Division US10604755B2 (en) | 2009-05-06 | 2015-07-31 | Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2010129799A2 true WO2010129799A2 (en) | 2010-11-11 |
WO2010129799A3 WO2010129799A3 (en) | 2011-08-04 |
Family
ID=43050878
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2010/033908 WO2010129799A2 (en) | 2009-05-06 | 2010-05-06 | Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene |
Country Status (7)
Country | Link |
---|---|
US (4) | US9155754B2 (en) |
EP (1) | EP2427553A4 (en) |
JP (1) | JP5883782B2 (en) |
KR (1) | KR101835889B1 (en) |
CN (3) | CN106237345A (en) |
CA (1) | CA2761152A1 (en) |
WO (1) | WO2010129799A2 (en) |
Cited By (18)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2014500723A (en) * | 2010-11-12 | 2014-01-16 | ザ ジェネラル ホスピタル コーポレイション | Non-coding RNA related to polycomb |
US20150133528A1 (en) * | 2012-05-16 | 2015-05-14 | Rana Therapeutics, Inc. | Compositions and methods for modulating hemoglobin gene family expression |
WO2015162422A1 (en) * | 2014-04-22 | 2015-10-29 | Mina Therapeutics Limited | Sarna compositions and methods of use |
EP2849801A4 (en) * | 2012-05-16 | 2016-05-25 | Rana Therapeutics Inc | Compositions and methods for modulating apoa1 and abca1 expression |
US20170283496A1 (en) * | 2016-03-14 | 2017-10-05 | Roche Innovation Center Copenhagen A/S | Oligonucleotides for reduction of pd-l1 expression |
US9957503B2 (en) | 2009-05-06 | 2018-05-01 | Curna, Inc. | Treatment of LCAT gene related diseases by inhibition of a natural antisense transcript to LCAT |
CN108103082A (en) * | 2017-05-11 | 2018-06-01 | 北京五加和分子医学研究所有限公司 | A kind of gland relative virus mediated LCAT expression vectors and application thereof |
US10059941B2 (en) | 2012-05-16 | 2018-08-28 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
US10058623B2 (en) | 2012-05-16 | 2018-08-28 | Translate Bio Ma, Inc. | Compositions and methods for modulating UTRN expression |
US10174323B2 (en) | 2012-05-16 | 2019-01-08 | The General Hospital Corporation | Compositions and methods for modulating ATP2A2 expression |
EP3511416A1 (en) | 2012-05-16 | 2019-07-17 | Translate Bio MA, Inc. | Compositions and methods for modulating gene expression |
US10358644B2 (en) | 2010-11-12 | 2019-07-23 | The General Hospital Corporation | Polycomb-associated non-coding RNAs |
US10655128B2 (en) | 2012-05-16 | 2020-05-19 | Translate Bio Ma, Inc. | Compositions and methods for modulating MECP2 expression |
US10837014B2 (en) | 2012-05-16 | 2020-11-17 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
US20200362341A1 (en) * | 2019-03-15 | 2020-11-19 | University Of Massachusetts | Oligonucleotides for tissue specific apoe modulation |
US10858650B2 (en) | 2014-10-30 | 2020-12-08 | The General Hospital Corporation | Methods for modulating ATRX-dependent gene repression |
US10900036B2 (en) | 2015-03-17 | 2021-01-26 | The General Hospital Corporation | RNA interactome of polycomb repressive complex 1 (PRC1) |
US20210340533A1 (en) * | 2019-12-23 | 2021-11-04 | University Of Massachusetts | Oligonucleotides for tissue specific gene expression modulation |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2739464C (en) * | 2008-10-03 | 2020-03-31 | Opko Curna, Llc | Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoprotein-a1 |
WO2017192959A2 (en) * | 2016-05-05 | 2017-11-09 | The Research Foundation For The State University Of New York | Therapeutically modulating apob and apoai |
US11104700B2 (en) | 2017-07-17 | 2021-08-31 | Oxford University Innovation Limited | Oligonucleotides |
US11110114B2 (en) | 2017-07-17 | 2021-09-07 | Oxford University Innovation Limited | Dinucleotides |
CN112384237A (en) * | 2018-05-11 | 2021-02-19 | Hdl治疗公司 | Methods for prophylactic prevention, slowing of progression or treatment of cerebral amyloid angiopathy, alzheimer's disease and/or acute stroke |
Citations (175)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US538A (en) | 1837-12-26 | Self-separating link for connecting railroad-cars and locomotives | ||
US5552A (en) | 1848-05-09 | Paul stillman | ||
US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
US4426330A (en) | 1981-07-20 | 1984-01-17 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
US4534899A (en) | 1981-07-20 | 1985-08-13 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
US4667025A (en) | 1982-08-09 | 1987-05-19 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
US4835263A (en) | 1983-01-27 | 1989-05-30 | Centre National De La Recherche Scientifique | Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use |
US4845205A (en) | 1985-01-08 | 1989-07-04 | Institut Pasteur | 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites |
US4866042A (en) | 1987-11-18 | 1989-09-12 | Neuwelt Edward A | Method for the delivery of genetic material across the blood brain barrier |
US4876335A (en) | 1986-06-30 | 1989-10-24 | Wakunaga Seiyaku Kabushiki Kaisha | Poly-labelled oligonucleotide derivative |
US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
US4981957A (en) | 1984-07-19 | 1991-01-01 | Centre National De La Recherche Scientifique | Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini |
US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
US5013830A (en) | 1986-09-08 | 1991-05-07 | Ajinomoto Co., Inc. | Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers |
US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
US5059528A (en) | 1987-05-28 | 1991-10-22 | Ucb, S.A. | Expression of human proapolipoprotein a-i |
US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
US5108921A (en) | 1989-04-03 | 1992-04-28 | Purdue Research Foundation | Method for enhanced transmembrane transport of exogenous molecules |
US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
US5112963A (en) | 1987-11-12 | 1992-05-12 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Modified oligonucleotides |
US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
US5177196A (en) | 1990-08-16 | 1993-01-05 | Microprobe Corporation | Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof |
US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
US5227170A (en) | 1989-06-22 | 1993-07-13 | Vestar, Inc. | Encapsulation process |
US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
US5264221A (en) | 1991-05-23 | 1993-11-23 | Mitsubishi Kasei Corporation | Drug-containing protein-bonded liposome |
US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
US5319080A (en) | 1991-10-17 | 1994-06-07 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
US5354844A (en) | 1989-03-16 | 1994-10-11 | Boehringer Ingelheim International Gmbh | Protein-polycation conjugates |
US5356633A (en) | 1989-10-20 | 1994-10-18 | Liposome Technology, Inc. | Method of treatment of inflamed tissues |
US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
US5395619A (en) | 1993-03-03 | 1995-03-07 | Liposome Technology, Inc. | Lipid-polymer conjugates and liposomes |
US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
US5405939A (en) | 1987-10-22 | 1995-04-11 | Temple University Of The Commonwealth System Of Higher Education | 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine |
US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5414077A (en) | 1990-02-20 | 1995-05-09 | Gilead Sciences | Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods |
US5417978A (en) | 1993-07-29 | 1995-05-23 | Board Of Regents, The University Of Texas System | Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use |
US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
US5446137A (en) | 1993-12-09 | 1995-08-29 | Syntex (U.S.A.) Inc. | Oligonucleotides containing 4'-substituted nucleotides |
US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
US5455233A (en) | 1989-11-30 | 1995-10-03 | University Of North Carolina | Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
US5459127A (en) | 1990-04-19 | 1995-10-17 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
US5462854A (en) | 1993-04-19 | 1995-10-31 | Beckman Instruments, Inc. | Inverse linkage oligonucleotides for chemical and enzymatic processes |
US5466786A (en) | 1989-10-24 | 1995-11-14 | Gilead Sciences | 2'modified nucleoside and nucleotide compounds |
US5466677A (en) | 1993-03-06 | 1995-11-14 | Ciba-Geigy Corporation | Dinucleoside phosphinates and their pharmaceutical compositions |
US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
US5469854A (en) | 1989-12-22 | 1995-11-28 | Imarx Pharmaceutical Corp. | Methods of preparing gas-filled liposomes |
US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
US5491133A (en) | 1987-11-30 | 1996-02-13 | University Of Iowa Research Foundation | Methods for blocking the expression of specifically targeted genes |
US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
US5510475A (en) | 1990-11-08 | 1996-04-23 | Hybridon, Inc. | Oligonucleotide multiple reporter precursors |
US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
US5512295A (en) | 1994-11-10 | 1996-04-30 | The Board Of Trustees Of The Leland Stanford Junior University | Synthetic liposomes for enhanced uptake and delivery |
US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
US5514785A (en) | 1990-05-11 | 1996-05-07 | Becton Dickinson And Company | Solid supports for nucleic acid hybridization assays |
US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
US5519126A (en) | 1988-03-25 | 1996-05-21 | University Of Virginia Alumni Patents Foundation | Oligonucleotide N-alkylphosphoramidates |
US5521291A (en) | 1991-09-30 | 1996-05-28 | Boehringer Ingelheim International, Gmbh | Conjugates for introducing nucleic acid into higher eucaryotic cells |
US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
US5527528A (en) | 1989-10-20 | 1996-06-18 | Sequus Pharmaceuticals, Inc. | Solid-tumor treatment method |
US5534259A (en) | 1993-07-08 | 1996-07-09 | Liposome Technology, Inc. | Polymer compound and coated particle composition |
US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
US5543165A (en) | 1995-06-06 | 1996-08-06 | Hill; Julie B. | Process of making a soluble tea product with champagne-like properties |
US5543152A (en) | 1994-06-20 | 1996-08-06 | Inex Pharmaceuticals Corporation | Sphingosomes for enhanced drug delivery |
US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
US5547932A (en) | 1991-09-30 | 1996-08-20 | Boehringer Ingelheim International Gmbh | Composition for introducing nucleic acid complexes into higher eucaryotic cells |
US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
US5552540A (en) | 1987-06-24 | 1996-09-03 | Howard Florey Institute Of Experimental Physiology And Medicine | Nucleoside derivatives |
US5556948A (en) | 1993-01-22 | 1996-09-17 | Mitsubishi Chemical Corporation | Phospholipid derivatized with PEG bifunctional linker and liposome containing it |
US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
US5565350A (en) | 1993-12-09 | 1996-10-15 | Thomas Jefferson University | Compounds and methods for site directed mutations in eukaryotic cells |
US5567811A (en) | 1990-05-03 | 1996-10-22 | Amersham International Plc | Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
US5576427A (en) | 1993-03-30 | 1996-11-19 | Sterling Winthrop, Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
US5580575A (en) | 1989-12-22 | 1996-12-03 | Imarx Pharmaceutical Corp. | Therapeutic drug delivery systems |
US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
US5583020A (en) | 1992-11-24 | 1996-12-10 | Ribozyme Pharmaceuticals, Inc. | Permeability enhancers for negatively charged polynucleotides |
US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
US5587371A (en) | 1992-01-21 | 1996-12-24 | Pharmacyclics, Inc. | Texaphyrin-oligonucleotide conjugates |
US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
US5591721A (en) | 1994-10-25 | 1997-01-07 | Hybridon, Inc. | Method of down-regulating gene expression |
US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
US5595756A (en) | 1993-12-22 | 1997-01-21 | Inex Pharmaceuticals Corporation | Liposomal compositions for enhanced retention of bioactive agents |
US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
US5596086A (en) | 1990-09-20 | 1997-01-21 | Gilead Sciences, Inc. | Modified internucleoside linkages having one nitrogen and two carbon atoms |
US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
US5599928A (en) | 1994-02-15 | 1997-02-04 | Pharmacyclics, Inc. | Texaphyrin compounds having improved functionalization |
US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
US5610300A (en) | 1992-07-01 | 1997-03-11 | Ciba-Geigy Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
US5614617A (en) | 1990-07-27 | 1997-03-25 | Isis Pharmaceuticals, Inc. | Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression |
US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
US5639873A (en) | 1992-02-05 | 1997-06-17 | Centre National De La Recherche Scientifique (Cnrs) | Oligothionucleotides |
US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
US5658873A (en) | 1993-04-10 | 1997-08-19 | Degussa Aktiengesellschaft | Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them |
US5663312A (en) | 1993-03-31 | 1997-09-02 | Sanofi | Oligonucleotide dimers with amide linkages replacing phosphodiester linkages |
US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
US5677439A (en) | 1990-08-03 | 1997-10-14 | Sanofi | Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues |
US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
US5750692A (en) | 1990-01-11 | 1998-05-12 | Isis Pharmaceuticals, Inc. | Synthesis of 3-deazapurines |
US6258596B1 (en) | 1995-05-22 | 2001-07-10 | Aventis Pharmaceuticals Products Inc. | Variants of apolipoprotein A-I |
US6287860B1 (en) | 2000-01-20 | 2001-09-11 | Isis Pharmaceuticals, Inc. | Antisense inhibition of MEKK2 expression |
US6294520B1 (en) | 1989-03-27 | 2001-09-25 | Albert T. Naito | Material for passage through the blood-brain barrier |
US6632427B1 (en) | 1994-12-13 | 2003-10-14 | Aventis Pharma S.A. | Adenoviral-vector-mediated gene transfer into medullary motor neurons |
US6756523B1 (en) | 1992-09-25 | 2004-06-29 | Aventis Pharma S.A. | Adenovirus vectors for the transfer of foreign genes into cells of the central nervous system particularly in brain |
US6936589B2 (en) | 2001-09-28 | 2005-08-30 | Albert T. Naito | Parenteral delivery systems |
US20070117772A1 (en) | 2001-06-21 | 2007-05-24 | Bennett C F | Methods for slowing familial ALS disease progression |
US7563884B2 (en) | 2000-01-18 | 2009-07-21 | Isis Pharmaceuticals, Inc. | Antisense modulation of PTP1B expression |
US9209196B2 (en) | 2011-11-30 | 2015-12-08 | Sharp Kabushiki Kaisha | Memory circuit, method of driving the same, nonvolatile storage device using the same, and liquid crystal display device |
Family Cites Families (233)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US577347A (en) * | 1897-02-16 | Cigarette-tube machine | ||
NZ207394A (en) | 1983-03-08 | 1987-03-06 | Commw Serum Lab Commission | Detecting or determining sequence of amino acids |
US4754065A (en) | 1984-12-18 | 1988-06-28 | Cetus Corporation | Precursor to nucleic acid probe |
US5506337A (en) | 1985-03-15 | 1996-04-09 | Antivirals Inc. | Morpholino-subunit combinatorial library and method |
US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US4800159A (en) | 1986-02-07 | 1989-01-24 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences |
US5288512A (en) | 1987-12-15 | 1994-02-22 | The Procter & Gamble Company | Reduced calorie fats made from triglycerides containing medium and long chain fatty acids |
NL8800756A (en) | 1988-03-25 | 1989-10-16 | Vereniging Voor Christelijk Wetenschappelijk Onderwijs | GENETICALLY MANUFACTURED PLANT CELLS AND PLANTS AND USEABLE RECOMBINANT DNA. |
US6203976B1 (en) | 1989-07-18 | 2001-03-20 | Osi Pharmaceuticals, Inc. | Methods of preparing compositions comprising chemicals capable of transcriptional modulation |
US5457189A (en) | 1989-12-04 | 1995-10-10 | Isis Pharmaceuticals | Antisense oligonucleotide inhibition of papillomavirus |
US5852188A (en) | 1990-01-11 | 1998-12-22 | Isis Pharmaceuticals, Inc. | Oligonucleotides having chiral phosphorus linkages |
US6034233A (en) | 1990-05-04 | 2000-03-07 | Isis Pharmaceuticals Inc. | 2'-O-alkylated oligoribonucleotides and phosphorothioate analogs complementary to portions of the HIV genome |
IE66205B1 (en) | 1990-06-14 | 1995-12-13 | Paul A Bartlett | Polypeptide analogs |
US5650489A (en) | 1990-07-02 | 1997-07-22 | The Arizona Board Of Regents | Random bio-oligomer library, a method of synthesis thereof, and a method of use thereof |
ATE159548T1 (en) | 1990-11-13 | 1997-11-15 | Immunex Corp | BIFUNCTIONAL SELECTABLE FUSION GENES |
US6307040B1 (en) | 1992-03-05 | 2001-10-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
US5474796A (en) | 1991-09-04 | 1995-12-12 | Protogene Laboratories, Inc. | Method and apparatus for conducting an array of chemical reactions on a support surface |
US5661134A (en) | 1991-10-15 | 1997-08-26 | Isis Pharmaceuticals, Inc. | Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity |
US5576302A (en) | 1991-10-15 | 1996-11-19 | Isis Pharmaceuticals, Inc. | Oligonucleotides for modulating hepatitis C virus having phosphorothioate linkages of high chiral purity |
US6335434B1 (en) | 1998-06-16 | 2002-01-01 | Isis Pharmaceuticals, Inc., | Nucleosidic and non-nucleosidic folate conjugates |
US5605662A (en) | 1993-11-01 | 1997-02-25 | Nanogen, Inc. | Active programmable electronic devices for molecular biological analysis and diagnostics |
US5573905A (en) | 1992-03-30 | 1996-11-12 | The Scripps Research Institute | Encoded combinatorial chemical libraries |
IL101600A (en) | 1992-04-15 | 2000-02-29 | Yissum Res Dev Co | Synthetic partially phosphorothioated antisense oligodeoxynucleotides and pharmaceutical compositions containing them |
US5288514A (en) | 1992-09-14 | 1994-02-22 | The Regents Of The University Of California | Solid phase and combinatorial synthesis of benzodiazepine compounds on a solid support |
US6710174B2 (en) | 2001-09-13 | 2004-03-23 | Isis Pharmaceuticals, Inc. | Antisense inhibition of vascular endothelial growth factor receptor-1 expression |
US6784290B1 (en) * | 1992-10-05 | 2004-08-31 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide inhibition of ras |
AU674891B2 (en) | 1992-10-15 | 1997-01-16 | Toray Industries, Inc. | Process for producing major histocompatibility antigen class II protein and material having the same immobilized thereon |
EP1897942A1 (en) | 1993-05-11 | 2008-03-12 | The University Of North Carolina At Chapel Hill | Antisense oligonucleotides which combat aberrant splicing and methods of using the same |
WO1994028143A1 (en) | 1993-05-21 | 1994-12-08 | Targeted Genetics Corporation | Bifunctional selectable fusion genes based on the cytosine deaminase (cd) gene |
US6410322B1 (en) * | 1993-07-27 | 2002-06-25 | Hybridon Inc | Antisense oligonucleotide inhibition of vascular endothelial growth factor expression |
ATE247128T1 (en) | 1993-09-03 | 2003-08-15 | Isis Pharmaceuticals Inc | AMINODERIVATIZED NUCLEOSIDES AND OLIGONUCLEOSIDES |
US5491084A (en) | 1993-09-10 | 1996-02-13 | The Trustees Of Columbia University In The City Of New York | Uses of green-fluorescent protein |
JPH09506253A (en) | 1993-11-30 | 1997-06-24 | マクギル・ユニヴァーシティ | Inhibition of DNA methyltransferase |
US5908779A (en) | 1993-12-01 | 1999-06-01 | University Of Connecticut | Targeted RNA degradation using nuclear antisense RNA |
US5593853A (en) | 1994-02-09 | 1997-01-14 | Martek Corporation | Generation and screening of synthetic drug libraries |
EP0745134A1 (en) | 1994-02-22 | 1996-12-04 | Danafarber Cancer Institute | Nucleic acid delivery system, method of synthesis and uses thereof |
US5539083A (en) | 1994-02-23 | 1996-07-23 | Isis Pharmaceuticals, Inc. | Peptide nucleic acid combinatorial libraries and improved methods of synthesis |
US5902880A (en) | 1994-08-19 | 1999-05-11 | Ribozyme Pharmaceuticals, Inc. | RNA polymerase III-based expression of therapeutic RNAs |
US6551618B2 (en) | 1994-03-15 | 2003-04-22 | University Of Birmingham | Compositions and methods for delivery of agents for neuronal regeneration and survival |
US6015880A (en) | 1994-03-16 | 2000-01-18 | California Institute Of Technology | Method and substrate for performing multiple sequential reactions on a matrix |
US5807522A (en) | 1994-06-17 | 1998-09-15 | The Board Of Trustees Of The Leland Stanford Junior University | Methods for fabricating microarrays of biological samples |
US5525735A (en) | 1994-06-22 | 1996-06-11 | Affymax Technologies Nv | Methods for synthesizing diverse collections of pyrrolidine compounds |
US5549974A (en) | 1994-06-23 | 1996-08-27 | Affymax Technologies Nv | Methods for the solid phase synthesis of thiazolidinones, metathiazanones, and derivatives thereof |
US6645943B1 (en) | 1994-10-25 | 2003-11-11 | Hybridon, Inc. | Method of down-regulating gene expression |
GB9501465D0 (en) | 1995-01-25 | 1995-03-15 | King S College London | Nucleoside phosphorothioate derivatives,synthesis and use thereof |
DE19502912A1 (en) | 1995-01-31 | 1996-08-01 | Hoechst Ag | G-Cap Stabilized Oligonucleotides |
IT1276642B1 (en) | 1995-03-03 | 1997-11-03 | Consiglio Nazionale Ricerche | ANTI-SENSE TRANSCRIPT PRESENT IN B LYMPHOCYTES AND SYNTHETIC OLIGODEOXYNUCLEOTIDES USEFUL FOR INHIBIRING THEIR ACTION |
IT1275862B1 (en) | 1995-03-03 | 1997-10-24 | Consiglio Nazionale Ricerche | ANTI-SENSE TRANSCRIPT ASSOCIATED WITH SOME TYPES OF TUMOR CELLS AND SYNTHETIC OLIGODEOXYNUCLEOTIDES USEFUL IN DIAGNOSIS AND TREATMENT |
US5739311A (en) | 1995-06-07 | 1998-04-14 | Gen-Probe Incorporated | Enzymatic synthesis of phosphorothioate oligonucleotides using restriction endonucleases |
US5569588A (en) | 1995-08-09 | 1996-10-29 | The Regents Of The University Of California | Methods for drug screening |
SK109198A3 (en) | 1996-02-14 | 1999-06-11 | Isis Pharmaceuticals Inc | Sugar-modified gapped oligonucleotides |
WO1997033912A2 (en) | 1996-03-14 | 1997-09-18 | Genentech, Inc. | Uses of gdnf and gdnf receptor |
EP0910634A2 (en) | 1996-04-17 | 1999-04-28 | Hoechst Marion Roussel Deutschland GmbH | ANTISENSE INHIBITORS OF VASCULAR ENDOTHELIAL GROWTH FACTOR (VEgF/VPF) EXPRESSION |
US5786213A (en) | 1996-04-18 | 1998-07-28 | Board Of Regents, The University Of Texas System | Inhibition of endogenous gastrin expression for treatment of colorectal cancer |
US5756710A (en) | 1996-06-05 | 1998-05-26 | The Trustees Of Columbia University In City Of New York | Phosphorothioate oligonucleotides that bind to the V3-loop and uses thereof |
US5898031A (en) | 1996-06-06 | 1999-04-27 | Isis Pharmaceuticals, Inc. | Oligoribonucleotides for cleaving RNA |
US5849902A (en) | 1996-09-26 | 1998-12-15 | Oligos Etc. Inc. | Three component chimeric antisense oligonucleotides |
US5739119A (en) | 1996-11-15 | 1998-04-14 | Galli; Rachel L. | Antisense oligonucleotides specific for the muscarinic type 2 acetylcholine receptor MRNA |
US7008776B1 (en) | 1996-12-06 | 2006-03-07 | Aventis Pharmaceuticals Inc. | Compositions and methods for effecting the levels of high density lipoprotein (HDL) cholesterol and apolipoprotein AI very low density lipoprotein (VLDL) cholesterol and low density lipoprotein (LDL) cholesterol |
US7235653B2 (en) | 1996-12-31 | 2007-06-26 | Isis Pharmaceuticals, Inc. | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
JP3756313B2 (en) | 1997-03-07 | 2006-03-15 | 武 今西 | Novel bicyclonucleosides and oligonucleotide analogues |
GB9711040D0 (en) * | 1997-05-29 | 1997-07-23 | Duff Gordon W | Prediction of inflammatory disease |
US6013786A (en) | 1997-08-22 | 2000-01-11 | Hybridon, Inc. | MDM2-specific antisense oligonucleotides |
US6794499B2 (en) | 1997-09-12 | 2004-09-21 | Exiqon A/S | Oligonucleotide analogues |
US7572582B2 (en) | 1997-09-12 | 2009-08-11 | Exiqon A/S | Oligonucleotide analogues |
CN1273476C (en) | 1997-09-12 | 2006-09-06 | 埃克西康有限公司 | Bi-and tri-cyclic nucleoside, nucleotide and oligonucleotide analoguse |
US7285288B1 (en) | 1997-10-03 | 2007-10-23 | Board Of Regents, The University Of Texas System | Inhibition of Bcl-2 protein expression by liposomal antisense oligodeoxynucleotides |
US6034883A (en) | 1998-01-29 | 2000-03-07 | Tinney; Charles E. | Solid state director for beams |
US6175409B1 (en) | 1999-04-02 | 2001-01-16 | Symyx Technologies, Inc. | Flow-injection analysis and variable-flow light-scattering methods and apparatus for characterizing polymers |
US7321828B2 (en) | 1998-04-13 | 2008-01-22 | Isis Pharmaceuticals, Inc. | System of components for preparing oligonucleotides |
US20040186071A1 (en) | 1998-04-13 | 2004-09-23 | Bennett C. Frank | Antisense modulation of CD40 expression |
US6525185B1 (en) * | 1998-05-07 | 2003-02-25 | Affymetrix, Inc. | Polymorphisms associated with hypertension |
US6221587B1 (en) | 1998-05-12 | 2001-04-24 | Isis Pharmceuticals, Inc. | Identification of molecular interaction sites in RNA for novel drug discovery |
US6833361B2 (en) | 1998-05-26 | 2004-12-21 | Ribapharm, Inc. | Nucleosides having bicyclic sugar moiety |
HUP0102152A3 (en) | 1998-05-26 | 2002-04-29 | Icn Pharmaceuticals Inc Costa | Nucleosid and oligo nucleotid analogues having bicyclic sugar derivative |
US6100090A (en) | 1999-06-25 | 2000-08-08 | Isis Pharmaceuticals Inc. | Antisense inhibition of PI3K p85 expression |
US20030139359A1 (en) | 2001-12-04 | 2003-07-24 | Isis Pharmaceuticals Inc. | Antisense modulation of phospholipid scramblase 3 expression |
US6867294B1 (en) | 1998-07-14 | 2005-03-15 | Isis Pharmaceuticals, Inc. | Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages |
US6242589B1 (en) | 1998-07-14 | 2001-06-05 | Isis Pharmaceuticals, Inc. | Phosphorothioate oligonucleotides having modified internucleoside linkages |
US6821724B1 (en) * | 1998-09-17 | 2004-11-23 | Affymetrix, Inc. | Methods of genetic analysis using nucleic acid arrays |
US6214986B1 (en) | 1998-10-07 | 2001-04-10 | Isis Pharmaceuticals, Inc. | Antisense modulation of bcl-x expression |
US6376541B1 (en) | 1998-11-06 | 2002-04-23 | Alcon Manufacturing, Ltd. | Upregulation of endogenous prostaglandins to lower intraocular pressure |
US5985663A (en) | 1998-11-25 | 1999-11-16 | Isis Pharmaceuticals Inc. | Antisense inhibition of interleukin-15 expression |
WO2000044409A1 (en) | 1999-01-27 | 2000-08-03 | University College London | Formulations comprising antisense nucleotides to connexins |
ES2234563T5 (en) | 1999-02-12 | 2018-01-17 | Daiichi Sankyo Company, Limited | New nucleoside and oligonucleotide analogs |
IL144975A0 (en) | 1999-02-26 | 2002-06-30 | Univ British Columbia | A composition containing an antisense oligonucleotide |
WO2000055318A2 (en) | 1999-03-15 | 2000-09-21 | University Of British Columbia | Abc1 polypeptide and methods and reagents for modulating cholesterol levels |
US20040137423A1 (en) | 1999-03-15 | 2004-07-15 | Hayden Michael R. | Compositions and methods for modulating HDL cholesterol and triglyceride levels |
CN1361829A (en) | 1999-03-18 | 2002-07-31 | 埃克西库恩公司 | Detection of mutations in genes by specific LNA primers |
US7084125B2 (en) | 1999-03-18 | 2006-08-01 | Exiqon A/S | Xylo-LNA analogues |
DE60029314T2 (en) | 1999-03-24 | 2007-07-12 | Exiqon A/S | Improved synthesis for -2.2.1. I bicyclo nucleosides |
US6734291B2 (en) | 1999-03-24 | 2004-05-11 | Exiqon A/S | Synthesis of [2.2.1]bicyclo nucleosides |
MXPA01009727A (en) | 1999-03-26 | 2002-07-22 | Aventis Pharma Inc | Compositions and methods for effecting the levels of high density lipoprotein (hdl) cholesterol and apolipoprotein ai, very low density lipoprotein (vldl) cholesterol and low density lipoprotein (ldl) cholesterol. |
EP1171617B1 (en) | 1999-04-08 | 2008-02-13 | Novartis Vaccines and Diagnostics, Inc. | Enhancement of the immune response for vaccine and gene therapy applications |
WO2000063365A1 (en) | 1999-04-21 | 2000-10-26 | Pangene Corporation | Locked nucleic acid hybrids and methods of use |
NZ514348A (en) | 1999-05-04 | 2004-05-28 | Exiqon As | L-ribo-LNA analogues |
US6525191B1 (en) | 1999-05-11 | 2003-02-25 | Kanda S. Ramasamy | Conformationally constrained L-nucleosides |
DE19925073C2 (en) | 1999-06-01 | 2001-07-19 | Stefan Weiss | Nucleic acid molecules with specific recognition of native PrP · S ·· c ·, production and use |
US6656730B1 (en) | 1999-06-15 | 2003-12-02 | Isis Pharmaceuticals, Inc. | Oligonucleotides conjugated to protein-binding drugs |
EP1189940A2 (en) | 1999-06-25 | 2002-03-27 | Genset | A bap28 gene and protein |
US20040006031A1 (en) | 2002-07-02 | 2004-01-08 | Isis Pharmaceuticals Inc. | Antisense modulation of HMG-CoA reductase expression |
US6147200A (en) | 1999-08-19 | 2000-11-14 | Isis Pharmaceuticals, Inc. | 2'-O-acetamido modified monomers and oligomers |
WO2001021631A2 (en) | 1999-09-20 | 2001-03-29 | Millennium Pharmaceuticals, Inc. | Secreted proteins and uses thereof |
US6617442B1 (en) | 1999-09-30 | 2003-09-09 | Isis Pharmaceuticals, Inc. | Human Rnase H1 and oligonucleotide compositions thereof |
US6528262B1 (en) | 1999-10-06 | 2003-03-04 | Quark Biotech, Inc. | Method for enrichment of natural antisense messenger RNA |
US6986988B2 (en) | 1999-10-06 | 2006-01-17 | Quark Biotech, Inc. | Method for enrichment of natural antisense messenger RNA |
AU2778801A (en) | 2000-01-07 | 2001-07-24 | Baylor University | Antisense compositions and methods |
AU2001230913B2 (en) | 2000-01-14 | 2005-06-30 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Methanocarba cycloalkyl nucleoside analogues |
US6303374B1 (en) | 2000-01-18 | 2001-10-16 | Isis Pharmaceuticals Inc. | Antisense modulation of caspase 3 expression |
JP2001247459A (en) | 2000-03-03 | 2001-09-11 | Oakland Uniservices Ltd | Combination therapy for cancer |
EP1268768A2 (en) | 2000-03-27 | 2003-01-02 | University Of Delaware | Targeted chromosomal genomic alterations with modified single stranded oligonucleotides |
US6936467B2 (en) | 2000-03-27 | 2005-08-30 | University Of Delaware | Targeted chromosomal genomic alterations with modified single stranded oligonucleotides |
US7402434B2 (en) | 2000-05-08 | 2008-07-22 | Newman Stuart A | Splice choice antagonists as therapeutic agents |
EP1294754A1 (en) | 2000-06-29 | 2003-03-26 | Pharma Pacific Pty. Ltd. | Interferon-alpha induced gene |
AU2001282717A1 (en) | 2000-07-28 | 2002-02-13 | Cancer Research Technology Limited | Cancer treatment by combination therapy |
WO2002018388A1 (en) | 2000-08-29 | 2002-03-07 | Takeshi Imanishi | Novel nucleoside analogs and oligonucleotide derivatives containing these analogs |
DE50113568D1 (en) | 2000-09-02 | 2008-03-20 | Gruenenthal Gmbh | ANTISENSE OLIGONUCLEOTIDES AGAINST VR 1 |
US6444464B1 (en) | 2000-09-08 | 2002-09-03 | Isis Pharmaceuticals, Inc. | Antisense modulation of E2F transcription factor 2 expression |
JP2004509619A (en) | 2000-09-20 | 2004-04-02 | アイシス・ファーマシューティカルス・インコーポレーテッド | Antisense modulation of FLIP-C expression |
AU2002210295A1 (en) | 2000-10-13 | 2002-04-22 | Institut De Cardiologie De Montreal | Antisense oligonucleotide directed toward mammalian vegf receptor genes and uses thereof |
US20030228618A1 (en) | 2000-11-24 | 2003-12-11 | Erez Levanon | Methods and systems for identifying naturally occurring antisense transcripts and methods, kits and arrays utilizing same |
WO2002053575A1 (en) * | 2001-01-03 | 2002-07-11 | Genaissance Pharmaceutuicals, Inc. | Drug target isogenes: polymorphisms in the lecithin-cholesterol acyltransferase gene |
US20050222029A1 (en) | 2001-01-04 | 2005-10-06 | Myriad Genetics, Incorporated | Compositions and methods for treating diseases |
US7423142B2 (en) | 2001-01-09 | 2008-09-09 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of anti-apoptotic genes |
US20020147165A1 (en) | 2001-02-22 | 2002-10-10 | Isis Pharmaceuticals, Inc. | Antisense modulation of calreticulin expression |
AU2002234755A1 (en) | 2001-02-26 | 2002-09-12 | Pharma Pacific Pty Ltd | Interferon-alpha induced gene |
AUPR497101A0 (en) | 2001-05-14 | 2001-06-07 | Queensland University Of Technology | Polynucleotides and polypeptides linked to cancer and/or tumorigenesi |
IL143379A (en) | 2001-05-24 | 2013-11-28 | Yissum Res Dev Co | Antisense oligonucleotide against the r isophorm of human ache and uses thereof |
US7053195B1 (en) | 2001-06-12 | 2006-05-30 | Syngenta Participatious Ag | Locked nucleic acid containing heteropolymers and related methods |
US7153954B2 (en) | 2001-07-12 | 2006-12-26 | Santaris Pharma A/S | Method for preparation of LNA phosphoramidites |
BR0211111A (en) | 2001-07-12 | 2004-06-22 | Univ Massachusetts | Isolated nucleic acid molecule, vector, host cell, transgene, engineered rna precursor, non-human transgenic animal, and method of inducing ribonucleic acid interference from a target gene in a cell |
US7425545B2 (en) | 2001-07-25 | 2008-09-16 | Isis Pharmaceuticals, Inc. | Modulation of C-reactive protein expression |
US20030096772A1 (en) | 2001-07-30 | 2003-05-22 | Crooke Rosanne M. | Antisense modulation of acyl CoA cholesterol acyltransferase-2 expression |
US7259150B2 (en) | 2001-08-07 | 2007-08-21 | Isis Pharmaceuticals, Inc. | Modulation of apolipoprotein (a) expression |
WO2003020739A2 (en) | 2001-09-04 | 2003-03-13 | Exiqon A/S | Novel lna compositions and uses thereof |
US20040214766A1 (en) | 2001-10-01 | 2004-10-28 | Kari Alitalo | VEGF-C or VEGF-D materials and methods for treatment of neuropathologies |
WO2003032713A2 (en) | 2001-10-10 | 2003-04-24 | Societe Des Produits Nestle S.A. | COFFEE PLANT WITH REDUCED α-D-GALACTOSIDASE ACTIVITY |
US20030219770A1 (en) * | 2001-11-08 | 2003-11-27 | Eshleman James R. | Methods and systems of nucleic acid sequencing |
AR037699A1 (en) | 2001-12-04 | 2004-12-01 | Monsanto Technology Llc | TRANSGENIC CORN WITH IMPROVED PHENOTYPE |
US7125982B1 (en) | 2001-12-05 | 2006-10-24 | Frayne Consultants | Microbial production of nuclease resistant DNA, RNA, and oligo mixtures |
US6965025B2 (en) | 2001-12-10 | 2005-11-15 | Isis Pharmaceuticals, Inc. | Antisense modulation of connective tissue growth factor expression |
CA2365811A1 (en) | 2001-12-21 | 2003-06-21 | Institut De Cardiologie | A new gene therapy using antisense strategy to estrogen receptors (er .alpha. and/or er .beta.) to optimize vascular healing and cardioprotection after vascular injury |
KR20030056538A (en) | 2001-12-28 | 2003-07-04 | 주식회사 웰진 | EFFECTIVE INHIBITION OF TRANSFORMING GROWTH FACTOR-β1 BY A RIBBON-TYPE ANTISENSE OLIGONUCLEOTIDE |
US20030191075A1 (en) | 2002-02-22 | 2003-10-09 | Cook Phillip Dan | Method of using modified oligonucleotides for hepatic delivery |
AU2003212729A1 (en) | 2002-02-25 | 2003-09-09 | Gunnar Norstedt | Vitamin d upregulated protein 1 (vdup-1) methods and uses thereof |
AU2003230566A1 (en) | 2002-02-26 | 2003-09-09 | Southern Illinois University | Therapeutic regulation of deoxyribonuclease-1-like-3 activity |
WO2003077215A2 (en) | 2002-03-08 | 2003-09-18 | Glen Research Corporation | Fluorescent nitrogenous base and nucleosides incorporating same |
GB2386836B (en) | 2002-03-22 | 2006-07-26 | Cancer Res Ventures Ltd | Anti-cancer combinations |
US7169916B2 (en) | 2002-04-01 | 2007-01-30 | Isis Pharmaceuticals, Inc. | Chloral-free DCA in oligonucleotide synthesis |
US20050215504A1 (en) | 2002-04-02 | 2005-09-29 | Bennett C F | Antisense modulation of sterol regulatory element-binding protein-1 expression |
WO2003085110A2 (en) | 2002-04-05 | 2003-10-16 | Santaris Pharma A/S | Oligomeric compounds for the modulation hif-1alpha expression |
US6808906B2 (en) | 2002-05-08 | 2004-10-26 | Rigel Pharmaceuticals, Inc. | Directionally cloned random cDNA expression vector libraries, compositions and methods of use |
US7569575B2 (en) | 2002-05-08 | 2009-08-04 | Santaris Pharma A/S | Synthesis of locked nucleic acid derivatives |
US7199107B2 (en) | 2002-05-23 | 2007-04-03 | Isis Pharmaceuticals, Inc. | Antisense modulation of kinesin-like 1 expression |
US7148342B2 (en) | 2002-07-24 | 2006-12-12 | The Trustees Of The University Of Pennyslvania | Compositions and methods for sirna inhibition of angiogenesis |
US20040033480A1 (en) | 2002-08-15 | 2004-02-19 | Wong Norman C.W. | Use of resveratrol to regulate expression of apolipoprotein A1 |
EP1555870A4 (en) | 2002-09-10 | 2006-11-02 | Samuel Roberts Noble Found Inc | Methods and compositions for production of flavonoid and isoflavonoid nutraceuticals |
US20060211640A1 (en) | 2002-09-25 | 2006-09-21 | Kane Christopher D | Antisense modulation of farnesoid X receptor expression |
US7229976B2 (en) | 2002-09-26 | 2007-06-12 | Isis Pharmaceuticals, Inc. | Modulation of forkhead box O1A expression |
KR20050083855A (en) | 2002-11-01 | 2005-08-26 | 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 | Compositions and methods for sirna inhibition of hif-1 alpha |
US20040152651A1 (en) | 2002-11-01 | 2004-08-05 | Rana Tariq M. | Regulation of transcription elongation factors |
GB2394658A (en) | 2002-11-01 | 2004-05-05 | Cancer Rec Tech Ltd | Oral anti-cancer composition |
AU2003290598A1 (en) | 2002-11-05 | 2004-06-03 | Isis Pharmaceuticals, Inc. | Modified oligonucleotides for use in rna interference |
EP1562971B1 (en) | 2002-11-05 | 2014-02-12 | Isis Pharmaceuticals, Inc. | Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
US20060009410A1 (en) | 2002-11-13 | 2006-01-12 | Crooke Rosanne M | Effects of apolipoprotein B inhibition on gene expression profiles in animals |
EP2314691A3 (en) * | 2002-11-14 | 2012-01-18 | Dharmacon, Inc. | Fuctional and hyperfunctional siRNA |
EP1569661B1 (en) | 2002-11-18 | 2009-09-09 | Santaris Pharma A/S | Antisense design |
US7144999B2 (en) | 2002-11-23 | 2006-12-05 | Isis Pharmaceuticals, Inc. | Modulation of hypoxia-inducible factor 1 alpha expression |
US7713738B2 (en) | 2003-02-10 | 2010-05-11 | Enzon Pharmaceuticals, Inc. | Oligomeric compounds for the modulation of survivin expression |
ATE555201T1 (en) * | 2003-03-05 | 2012-05-15 | Senesco Technologies Inc | USE OF SIRNA TO ABOLITATE EXPRESSION OF EIF-5A1 IN THE TREATMENT OF GLAUCOMA |
US20060234242A1 (en) * | 2003-04-07 | 2006-10-19 | Ribonomics, Inc. | Methods for identifying therapeutic targets involved in glucose and lipid metabolism |
US7598227B2 (en) | 2003-04-16 | 2009-10-06 | Isis Pharmaceuticals Inc. | Modulation of apolipoprotein C-III expression |
US7339051B2 (en) | 2003-04-28 | 2008-03-04 | Isis Pharmaceuticals, Inc. | Compositions and methods for the treatment of severe acute respiratory syndrome (SARS) |
US7276599B2 (en) | 2003-06-02 | 2007-10-02 | Isis Pharmaceuticals, Inc. | Oligonucleotide synthesis with alternative solvents |
CN1984921B (en) | 2003-06-03 | 2010-06-16 | Isis药物公司 | Modulation of survivin expression |
US7825235B2 (en) | 2003-08-18 | 2010-11-02 | Isis Pharmaceuticals, Inc. | Modulation of diacylglycerol acyltransferase 2 expression |
US7425544B2 (en) | 2003-09-18 | 2008-09-16 | Eli Lilly And Company | Modulation of eIF4E expression |
WO2005030928A2 (en) * | 2003-09-23 | 2005-04-07 | Chihiro Koike | PORCINE INVARIANT CHAIN PROTEIN, FULL LENGTH cDNA, GENOMIC ORGANIZATION, AND REGULATORY REGION |
US8258105B2 (en) | 2003-10-07 | 2012-09-04 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotides optimized for kidney targeting |
EP1675948A2 (en) | 2003-10-23 | 2006-07-05 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED TREATMENT OF PARKINSON DISEASE USING SHORT INTERERING NUCLEIC ACID (siNA) |
CA2550258A1 (en) | 2003-12-23 | 2005-07-07 | Santaris Pharma A/S | Oligomeric compounds for the modulation of bcl-2 |
EP1716228A4 (en) | 2004-01-12 | 2009-06-17 | Univ Pennsylvania | System and method of up-regulating bone morphogenetic protein (bmp) gene expression in bone cells via the appplication of fields generated by specific and selective electric and electromagnetic signals |
US7341835B2 (en) * | 2004-01-13 | 2008-03-11 | Affymetrix, Inc. | Methods of analysis of alternative splicing in mouse |
US7468431B2 (en) | 2004-01-22 | 2008-12-23 | Isis Pharmaceuticals, Inc. | Modulation of eIF4E-BP2 expression |
GB0403041D0 (en) | 2004-02-11 | 2004-03-17 | Milner Anne J | Induction of apoptosis |
EP1566202A1 (en) | 2004-02-23 | 2005-08-24 | Sahltech I Göteborg AB | Use of resistin antagonists in the treatment of rheumatoid arthritis |
US7402574B2 (en) | 2004-03-12 | 2008-07-22 | Avi Biopharma, Inc. | Antisense composition and method for treating cancer |
US7374927B2 (en) * | 2004-05-03 | 2008-05-20 | Affymetrix, Inc. | Methods of analysis of degraded nucleic acid samples |
WO2005109001A2 (en) * | 2004-05-12 | 2005-11-17 | Galapagos N.V. | Methods, compositions and compound assays for inhibiting amyloid-beta protein production |
US8394947B2 (en) | 2004-06-03 | 2013-03-12 | Isis Pharmaceuticals, Inc. | Positionally modified siRNA constructs |
US7297786B2 (en) | 2004-07-09 | 2007-11-20 | University Of Iowa Research Foundation | RNA interference in respiratory epitheial cells |
WO2006023880A2 (en) | 2004-08-23 | 2006-03-02 | Isis Pharmaceuticals, Inc. | Compounds and methods for the characterization of oligonucleotides |
JP2008517931A (en) * | 2004-10-22 | 2008-05-29 | ダナ−ファーバー キャンサー インスティチュート,インコーポレイテッド | Methods and compositions for modulating PGC-1β for treating lipid-related diseases and disorders |
EA014097B1 (en) | 2004-11-09 | 2010-08-30 | Сантарис Фарма А/С | Potent lna oligonucleotides for modulating of hif-1a expression and use thereof |
US7220549B2 (en) | 2004-12-30 | 2007-05-22 | Helicos Biosciences Corporation | Stabilizing a nucleic acid for nucleic acid sequencing |
US7737265B2 (en) | 2005-06-27 | 2010-06-15 | Alnylam Pharmaceuticals, Inc. | RNAi modulation of HIF-1 and therapeutic uses thereof |
CN1904900A (en) * | 2005-07-28 | 2007-01-31 | 中国科学院生物物理研究所 | Human autogenous siRNA sequence, its application and screening method |
US20070213292A1 (en) | 2005-08-10 | 2007-09-13 | The Rockefeller University | Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof |
WO2007028065A2 (en) | 2005-08-30 | 2007-03-08 | Isis Pharmaceuticals, Inc. | Chimeric oligomeric compounds for modulation of splicing |
CA2627025A1 (en) | 2005-10-28 | 2007-05-03 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of huntingtin gene |
CA2626584A1 (en) | 2005-11-04 | 2007-05-18 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of nav1.8 gene |
EP2431467A3 (en) | 2005-11-17 | 2012-05-02 | Board Of Regents, The University Of Texas | Modulation of gene expression by oligomers targeted to chromosomal DNA |
JP2009521408A (en) | 2005-12-02 | 2009-06-04 | サートリス ファーマシューティカルズ, インコーポレイテッド | Modulator of Cdc2-like kinase (CLK) and method of use thereof |
CN101378764A (en) | 2005-12-09 | 2009-03-04 | 贝勒研究院 | Diagnosis, prognosis and monitoring of disease progression of systemic lupus erythematosus through blood leukocyte microarray analysis |
CN100356377C (en) | 2005-12-20 | 2007-12-19 | 无锡永中科技有限公司 | Document display method |
WO2007071824A1 (en) | 2005-12-20 | 2007-06-28 | Oy Jurilab Ltd | Novel genes and markers associated with high-density lipoprotein -cholesterol (hdl-c) |
CN103301475B (en) | 2005-12-28 | 2016-08-03 | 斯克里普斯研究所 | Method that pharmaceutical composition and expression vector and regulator gene are expressed and the application of nucleic acid molecules |
US7569686B1 (en) | 2006-01-27 | 2009-08-04 | Isis Pharmaceuticals, Inc. | Compounds and methods for synthesis of bicyclic nucleic acid analogs |
PL2314594T3 (en) | 2006-01-27 | 2014-12-31 | Isis Pharmaceuticals Inc | 6-modified bicyclic nucleic acid analogs |
SG170780A1 (en) | 2006-03-31 | 2011-05-30 | Alnylam Pharmaceuticals Inc | Compositions and methods for inhibiting expression of eg5 gene |
WO2007134014A2 (en) | 2006-05-05 | 2007-11-22 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression of gcgr |
US7666854B2 (en) | 2006-05-11 | 2010-02-23 | Isis Pharmaceuticals, Inc. | Bis-modified bicyclic nucleic acid analogs |
ES2874149T3 (en) | 2006-05-11 | 2021-11-04 | Alnylam Pharmaceuticals Inc | Compositions and methods to inhibit the expression of the PCSK9 gene |
DK2066684T3 (en) | 2006-05-11 | 2012-10-22 | Isis Pharmaceuticals Inc | 5'-Modified Bicyclic Nucleic Acid Analogs |
US8598333B2 (en) * | 2006-05-26 | 2013-12-03 | Alnylam Pharmaceuticals, Inc. | SiRNA silencing of genes expressed in cancer |
EP1867338A1 (en) | 2006-05-30 | 2007-12-19 | Université Libre De Bruxelles | Pharmaceutical composition comprising apolipoproteins for the treatment of human diseases |
WO2008057556A2 (en) | 2006-11-06 | 2008-05-15 | Beth Israel Deaconess Medical Center | Identification and use of small molecules to modulate ese-1 transcription factor function and to treat ese-1 transcription factor associated diseases |
WO2008066672A2 (en) | 2006-11-06 | 2008-06-05 | Beth Israel Deaconess Medical Center | Identification and use of small molecules to modulate transcription factor function and to treat transcription factor associated diseases |
US8093222B2 (en) | 2006-11-27 | 2012-01-10 | Isis Pharmaceuticals, Inc. | Methods for treating hypercholesterolemia |
US20100169996A1 (en) | 2007-01-19 | 2010-07-01 | Lionel Navarro | Methods and compositions for modulating the sirna and rna-directed-dna methylation pathways |
US20080293136A1 (en) * | 2007-03-02 | 2008-11-27 | Nastech Pharmaceutical Company Inc. | Nucleic acid compounds for inhibiting akt gene expression and uses thereof |
US20100255117A1 (en) | 2007-04-06 | 2010-10-07 | The Johns Hopkins University | Methods and compositions for the treatment of cancer |
US20080293142A1 (en) | 2007-04-19 | 2008-11-27 | The Board Of Regents For Oklahoma State University | Multiple shRNA Expression Vectors and Methods of Construction |
US20110263687A1 (en) * | 2008-04-07 | 2011-10-27 | Riken | Rna molecules and uses thereof |
CN106995819B (en) | 2008-07-01 | 2020-10-20 | 孟山都技术公司 | Recombinant DNA constructs and methods for regulating expression of target genes |
CA2739464C (en) | 2008-10-03 | 2020-03-31 | Opko Curna, Llc | Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoprotein-a1 |
EP2177615A1 (en) | 2008-10-10 | 2010-04-21 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Method for a genome wide identification of expression regulatory sequences and use of genes and molecules derived thereof for the diagnosis and therapy of metabolic and/or tumorous diseases |
US8606289B2 (en) | 2008-11-10 | 2013-12-10 | Qualcomm Incorporated | Power headroom-sensitive scheduling |
WO2010058227A2 (en) | 2008-11-22 | 2010-05-27 | The University Of Bristol | NOVEL USES OF VEGFxxxB |
WO2010088668A2 (en) * | 2009-02-02 | 2010-08-05 | Cepheid | Methods of detecting sepsis |
EP2414521B1 (en) * | 2009-03-31 | 2016-10-26 | The General Hospital Corporation | Regulation of mir-33 micrornas in the treatment of cholesterol-related disorders |
KR101835889B1 (en) | 2009-05-06 | 2018-03-08 | 큐알엔에이, 인크. | Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene |
-
2010
- 2010-05-06 KR KR1020117028622A patent/KR101835889B1/en active IP Right Grant
- 2010-05-06 CN CN201610643773.0A patent/CN106237345A/en active Pending
- 2010-05-06 CN CN201080030706.2A patent/CN102459596B/en not_active Expired - Fee Related
- 2010-05-06 US US13/318,713 patent/US9155754B2/en active Active
- 2010-05-06 CA CA 2761152 patent/CA2761152A1/en not_active Abandoned
- 2010-05-06 WO PCT/US2010/033908 patent/WO2010129799A2/en active Application Filing
- 2010-05-06 EP EP10772845A patent/EP2427553A4/en not_active Withdrawn
- 2010-05-06 CN CN201310156266.0A patent/CN103223177B/en not_active Expired - Fee Related
- 2010-05-06 JP JP2012509979A patent/JP5883782B2/en not_active Expired - Fee Related
-
2015
- 2015-07-31 US US14/814,895 patent/US10604755B2/en active Active
- 2015-07-31 US US14/815,007 patent/US9957503B2/en active Active
-
2018
- 2018-03-19 US US15/925,266 patent/US20180208930A1/en not_active Abandoned
Patent Citations (196)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5552A (en) | 1848-05-09 | Paul stillman | ||
US538A (en) | 1837-12-26 | Self-separating link for connecting railroad-cars and locomotives | ||
US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
US4426330A (en) | 1981-07-20 | 1984-01-17 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US4534899A (en) | 1981-07-20 | 1985-08-13 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
US4789737A (en) | 1982-08-09 | 1988-12-06 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives and production thereof |
US4667025A (en) | 1982-08-09 | 1987-05-19 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
US4835263A (en) | 1983-01-27 | 1989-05-30 | Centre National De La Recherche Scientifique | Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use |
US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
US5541313A (en) | 1983-02-22 | 1996-07-30 | Molecular Biosystems, Inc. | Single-stranded labelled oligonucleotides of preselected sequence |
US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
US4981957A (en) | 1984-07-19 | 1991-01-01 | Centre National De La Recherche Scientifique | Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini |
US5578717A (en) | 1984-10-16 | 1996-11-26 | Chiron Corporation | Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides |
US5552538A (en) | 1984-10-16 | 1996-09-03 | Chiron Corporation | Oligonucleotides with cleavable sites |
US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
US4845205A (en) | 1985-01-08 | 1989-07-04 | Institut Pasteur | 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites |
US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
US4876335A (en) | 1986-06-30 | 1989-10-24 | Wakunaga Seiyaku Kabushiki Kaisha | Poly-labelled oligonucleotide derivative |
US5013830A (en) | 1986-09-08 | 1991-05-07 | Ajinomoto Co., Inc. | Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers |
US5286717A (en) | 1987-03-25 | 1994-02-15 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
US5059528A (en) | 1987-05-28 | 1991-10-22 | Ucb, S.A. | Expression of human proapolipoprotein a-i |
US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
US5552540A (en) | 1987-06-24 | 1996-09-03 | Howard Florey Institute Of Experimental Physiology And Medicine | Nucleoside derivatives |
US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
US5405939A (en) | 1987-10-22 | 1995-04-11 | Temple University Of The Commonwealth System Of Higher Education | 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine |
US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
US5112963A (en) | 1987-11-12 | 1992-05-12 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Modified oligonucleotides |
US4866042A (en) | 1987-11-18 | 1989-09-12 | Neuwelt Edward A | Method for the delivery of genetic material across the blood brain barrier |
US5491133A (en) | 1987-11-30 | 1996-02-13 | University Of Iowa Research Foundation | Methods for blocking the expression of specifically targeted genes |
US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
US5519126A (en) | 1988-03-25 | 1996-05-21 | University Of Virginia Alumni Patents Foundation | Oligonucleotide N-alkylphosphoramidates |
US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
US5453496A (en) | 1988-05-26 | 1995-09-26 | University Patents, Inc. | Polynucleotide phosphorodithioate |
US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
US5599923A (en) | 1989-03-06 | 1997-02-04 | Board Of Regents, University Of Tx | Texaphyrin metal complexes having improved functionalization |
US5354844A (en) | 1989-03-16 | 1994-10-11 | Boehringer Ingelheim International Gmbh | Protein-polycation conjugates |
US6294520B1 (en) | 1989-03-27 | 2001-09-25 | Albert T. Naito | Material for passage through the blood-brain barrier |
US5108921A (en) | 1989-04-03 | 1992-04-28 | Purdue Research Foundation | Method for enhanced transmembrane transport of exogenous molecules |
US5416016A (en) | 1989-04-03 | 1995-05-16 | Purdue Research Foundation | Method for enhancing transmembrane transport of exogenous molecules |
US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
US5416203A (en) | 1989-06-06 | 1995-05-16 | Northwestern University | Steroid modified oligonucleotides |
US5227170A (en) | 1989-06-22 | 1993-07-13 | Vestar, Inc. | Encapsulation process |
US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
US5356633A (en) | 1989-10-20 | 1994-10-18 | Liposome Technology, Inc. | Method of treatment of inflamed tissues |
US5213804A (en) | 1989-10-20 | 1993-05-25 | Liposome Technology, Inc. | Solid tumor treatment method and composition |
US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
US5527528A (en) | 1989-10-20 | 1996-06-18 | Sequus Pharmaceuticals, Inc. | Solid-tumor treatment method |
US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
US5466786B1 (en) | 1989-10-24 | 1998-04-07 | Gilead Sciences | 2' Modified nucleoside and nucleotide compounds |
US5466786A (en) | 1989-10-24 | 1995-11-14 | Gilead Sciences | 2'modified nucleoside and nucleotide compounds |
US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
US5455233A (en) | 1989-11-30 | 1995-10-03 | University Of North Carolina | Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
US5580575A (en) | 1989-12-22 | 1996-12-03 | Imarx Pharmaceutical Corp. | Therapeutic drug delivery systems |
US5469854A (en) | 1989-12-22 | 1995-11-28 | Imarx Pharmaceutical Corp. | Methods of preparing gas-filled liposomes |
US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
US5750692A (en) | 1990-01-11 | 1998-05-12 | Isis Pharmaceuticals, Inc. | Synthesis of 3-deazapurines |
US5587469A (en) | 1990-01-11 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides containing N-2 substituted purines |
US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
US5366878A (en) | 1990-02-15 | 1994-11-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
US5414077A (en) | 1990-02-20 | 1995-05-09 | Gilead Sciences | Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods |
US5563253A (en) | 1990-03-08 | 1996-10-08 | Worcester Foundation For Biomedical Research | Linear aminoalkylphosphoramidate oligonucleotide derivatives |
US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
US5541306A (en) | 1990-03-08 | 1996-07-30 | Worcester Foundation For Biomedical Research | Aminoalkylphosphotriester oligonucleotide derivatives |
US5536821A (en) | 1990-03-08 | 1996-07-16 | Worcester Foundation For Biomedical Research | Aminoalkylphosphorothioamidate oligonucleotide deratives |
US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
US5459127A (en) | 1990-04-19 | 1995-10-17 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
US5567811A (en) | 1990-05-03 | 1996-10-22 | Amersham International Plc | Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
US5514785A (en) | 1990-05-11 | 1996-05-07 | Becton Dickinson And Company | Solid supports for nucleic acid hybridization assays |
US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
US5614617A (en) | 1990-07-27 | 1997-03-25 | Isis Pharmaceuticals, Inc. | Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression |
US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
US5567810A (en) | 1990-08-03 | 1996-10-22 | Sterling Drug, Inc. | Nuclease resistant compounds |
US5677439A (en) | 1990-08-03 | 1997-10-14 | Sanofi | Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues |
US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
US5177196A (en) | 1990-08-16 | 1993-01-05 | Microprobe Corporation | Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof |
US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
US5596086A (en) | 1990-09-20 | 1997-01-21 | Gilead Sciences, Inc. | Modified internucleoside linkages having one nitrogen and two carbon atoms |
US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
US5510475A (en) | 1990-11-08 | 1996-04-23 | Hybridon, Inc. | Oligonucleotide multiple reporter precursors |
US5264221A (en) | 1991-05-23 | 1993-11-23 | Mitsubishi Kasei Corporation | Drug-containing protein-bonded liposome |
US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
US5521291A (en) | 1991-09-30 | 1996-05-28 | Boehringer Ingelheim International, Gmbh | Conjugates for introducing nucleic acid into higher eucaryotic cells |
US5547932A (en) | 1991-09-30 | 1996-08-20 | Boehringer Ingelheim International Gmbh | Composition for introducing nucleic acid complexes into higher eucaryotic cells |
US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
US5393878A (en) | 1991-10-17 | 1995-02-28 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
US5319080A (en) | 1991-10-17 | 1994-06-07 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
US5587371A (en) | 1992-01-21 | 1996-12-24 | Pharmacyclics, Inc. | Texaphyrin-oligonucleotide conjugates |
US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
US5639873A (en) | 1992-02-05 | 1997-06-17 | Centre National De La Recherche Scientifique (Cnrs) | Oligothionucleotides |
US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
US5610300A (en) | 1992-07-01 | 1997-03-11 | Ciba-Geigy Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
US5700920A (en) | 1992-07-01 | 1997-12-23 | Novartis Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
US6756523B1 (en) | 1992-09-25 | 2004-06-29 | Aventis Pharma S.A. | Adenovirus vectors for the transfer of foreign genes into cells of the central nervous system particularly in brain |
US5583020A (en) | 1992-11-24 | 1996-12-10 | Ribozyme Pharmaceuticals, Inc. | Permeability enhancers for negatively charged polynucleotides |
US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
US5556948A (en) | 1993-01-22 | 1996-09-17 | Mitsubishi Chemical Corporation | Phospholipid derivatized with PEG bifunctional linker and liposome containing it |
US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
US5395619A (en) | 1993-03-03 | 1995-03-07 | Liposome Technology, Inc. | Lipid-polymer conjugates and liposomes |
US5466677A (en) | 1993-03-06 | 1995-11-14 | Ciba-Geigy Corporation | Dinucleoside phosphinates and their pharmaceutical compositions |
US5576427A (en) | 1993-03-30 | 1996-11-19 | Sterling Winthrop, Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
US5663312A (en) | 1993-03-31 | 1997-09-02 | Sanofi | Oligonucleotide dimers with amide linkages replacing phosphodiester linkages |
US5658873A (en) | 1993-04-10 | 1997-08-19 | Degussa Aktiengesellschaft | Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them |
US5462854A (en) | 1993-04-19 | 1995-10-31 | Beckman Instruments, Inc. | Inverse linkage oligonucleotides for chemical and enzymatic processes |
US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
US5534259A (en) | 1993-07-08 | 1996-07-09 | Liposome Technology, Inc. | Polymer compound and coated particle composition |
US5417978A (en) | 1993-07-29 | 1995-05-23 | Board Of Regents, The University Of Texas System | Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use |
US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
US5446137A (en) | 1993-12-09 | 1995-08-29 | Syntex (U.S.A.) Inc. | Oligonucleotides containing 4'-substituted nucleotides |
US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
US5565350A (en) | 1993-12-09 | 1996-10-15 | Thomas Jefferson University | Compounds and methods for site directed mutations in eukaryotic cells |
US5595756A (en) | 1993-12-22 | 1997-01-21 | Inex Pharmaceuticals Corporation | Liposomal compositions for enhanced retention of bioactive agents |
US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
US5599928A (en) | 1994-02-15 | 1997-02-04 | Pharmacyclics, Inc. | Texaphyrin compounds having improved functionalization |
US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
US5543152A (en) | 1994-06-20 | 1996-08-06 | Inex Pharmaceuticals Corporation | Sphingosomes for enhanced drug delivery |
US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
US5591584A (en) | 1994-08-25 | 1997-01-07 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
US5591721A (en) | 1994-10-25 | 1997-01-07 | Hybridon, Inc. | Method of down-regulating gene expression |
US5512295A (en) | 1994-11-10 | 1996-04-30 | The Board Of Trustees Of The Leland Stanford Junior University | Synthetic liposomes for enhanced uptake and delivery |
US6632427B1 (en) | 1994-12-13 | 2003-10-14 | Aventis Pharma S.A. | Adenoviral-vector-mediated gene transfer into medullary motor neurons |
US6258596B1 (en) | 1995-05-22 | 2001-07-10 | Aventis Pharmaceuticals Products Inc. | Variants of apolipoprotein A-I |
US5543165A (en) | 1995-06-06 | 1996-08-06 | Hill; Julie B. | Process of making a soluble tea product with champagne-like properties |
US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
US7563884B2 (en) | 2000-01-18 | 2009-07-21 | Isis Pharmaceuticals, Inc. | Antisense modulation of PTP1B expression |
US6287860B1 (en) | 2000-01-20 | 2001-09-11 | Isis Pharmaceuticals, Inc. | Antisense inhibition of MEKK2 expression |
US20070117772A1 (en) | 2001-06-21 | 2007-05-24 | Bennett C F | Methods for slowing familial ALS disease progression |
US6936589B2 (en) | 2001-09-28 | 2005-08-30 | Albert T. Naito | Parenteral delivery systems |
US9209196B2 (en) | 2011-11-30 | 2015-12-08 | Sharp Kabushiki Kaisha | Memory circuit, method of driving the same, nonvolatile storage device using the same, and liquid crystal display device |
Non-Patent Citations (91)
Title |
---|
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
B. F. ASZTALOS ET AL.: "Normolipidemic subjects with low HDL cholesterol levels have altered HDL subpopulations", ARTERIOSCLER. THROMB. VASE. BIOL., vol. 17, 1997, pages 1885 - 1893 |
BEAUDRY ET AL., SCIENCE, vol. 257, 1992, pages 635 - 641 |
BERNSTEIN, E. ET AL., NATURE, vol. 411, 2001, pages 494 - 498 |
BOUTLA, A. ET AL., CURR. BIOL., vol. 11, 2001, pages 1776 - 1780 |
BREAKER ET AL., TIBTECH, vol. 12, 1994, pages 268 |
BREAKER, CURR. OP. BIOTECH., vol. 7, 1996, pages 442 |
CAPLEN, N. J. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 98, 2001, pages 9742 - 9747 |
CARULLI ET AL., J. CELL BIOCHEM. SUPPL., vol. 31, 1998, pages 286 - 96 |
CECH, J. AMERICAN. MED. ASSOC., vol. 260, 1988, pages 3030 - 3035 |
CECH, JAMA, vol. 260, 1988, pages 3030 |
CELIS ET AL., FEBS LETT., vol. 480, 2000, pages 17 - 16 |
CHENG, J. ET AL., SCIENCE, vol. 308, no. 5725, 2005, pages 1149 - 1154 |
CHO EJ ET AL., ANNUAL REVIEW OF ANALYTICAL CHEMISTRY, vol. 2, 2009, pages 241 - 264 |
CHRISTOFFERSENMARR, J. MED. CHEM., vol. 38, 1995, pages 2023 - 2037 |
CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 937 |
D. I. SILVERMAN ET AL.: "High-density lipoprotein subtractions", AM. J. MED., vol. 94, 1993, pages 636 - 45, XP026381353, DOI: doi:10.1016/0002-9343(93)90217-D |
DAVIDSON ET AL., NAT. GENET., vol. 3, 1993, pages 219 |
DE MESMAEKER ET AL., ACC. CHEM. RES., vol. 28, 1995, pages 366 - 374 |
EGUCHI ET AL., ANN. REV. BIOCHEM., vol. 60, 1991, pages 631 - 652 |
ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 485 - 490 |
ENGLISCH ET AL., ANGEWANDLE CHEMIE, INTERNATIONAL EDITION, vol. 30, 1991, pages 613 |
FREIER S. M., NUCLEIC ACID RESEARCH, vol. 25, 1997, pages 4429 - 4443 |
FREIERALTMANN, NUCL. ACID. RES., vol. 25, no. 22, 1997, pages 4429 - 4443 |
FUCHS ET AL., ANAL. BIOCHEM., vol. 286, 2000, pages 91 - 98 |
GEBEYEHU, G. ET AL., NUCL. ACIDS RES., vol. 15, 1987, pages 4513 |
GELLER, A.I. ET AL., J. NEUROCHEM, vol. 64, 1995, pages 487 |
GELLER, A.I. ET AL., PROC NATL. ACAD. SCI USA, vol. 87, 1990, pages 1149 |
GELLER, A.I. ET AL., PROC NATL. ACAD. SCI., vol. 90, 1993, pages 7603 - 302 |
GOINGGUSTERSON, EUR. J. CANCER, vol. 35, 1999, pages 1895 - 904 |
HAMMOND ET AL., NAT. REV. GENET., vol. 2, 1991, pages 110 - 119 |
HASELOFFGERLACH, NATURE, vol. 334, 1988, pages 196 |
HERDEWIN P., ANTISENSE & NUCLEIC ACID DRUG DEV., vol. 10, 2000, pages 297 - 310 |
J. C. FRUCHART ET AL.: "Apolipoprotein A-containing lipoprotein particles: physiological role, quantification, and clinical significance", CLIN. CHEM., vol. 38, 1992, pages 793 - 7 |
JEFFERIES ET AL., NUCLEIC ACIDS RESEARCH, vol. 17, 1989, pages 1371 |
JOYCE, GENE, vol. 82, 1989, pages 83 - 87 |
JOYCE, SCIENTIFIC AMERICAN, vol. 267, 1992, pages 90 - 97 |
JUNGBLUT ET AL., ELECTROPHORESIS, vol. 20, 1999, pages 2100 - 10 |
JURECICBELMONT, CURR. OPIN. MICROBIOL., vol. 3, 2000, pages 316 - 21 |
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327 |
KABANOV ET AL., FEBSLETT., vol. 259, 1990, pages 327 - 330 |
KAPLITT, M.G. ET AL., NAT. GENET., vol. 8, 1994, pages 148 |
KAPRANOV, P. ET AL., GENOME RES, vol. 15, no. 7, 2005, pages 987 - 997 |
KOIZUMI, M. ET AL., FEBS LETT., vol. 228, 1988, pages 228 - 230 |
KORNBERG, A.: "DNA Replication", 1980, W. H. FREEMAN & CO., pages: 75 - 77 |
KUMAR ET AL., FASEB J., vol. 9, 1995, pages 1183 |
LARSON ET AL., CYTOMETRY, vol. 41, 2000, pages 203 - 208 |
LARSSON ET AL., J. BIOTECHNOL., vol. 80, 2000, pages 143 - 57 |
LEGAL LASALLE ET AL., SCIENCE, vol. 259, 1993, pages 1411 - 1418 |
LETSINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6553 - 6556 |
MADDEN ET AL., DRUG DISCOV. TODAY, vol. 5, 2000, pages 415 - 425 |
MANCHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 973 |
MANOHARAN ET AL., ANN. N. Y. ACAD. SCI., vol. 660, 1992, pages 306 - 309 |
MANOHARAN ET AL., ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 306 |
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 3, 1993, pages 2765 - 2770 |
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 4, 1994, pages 1053 - 1060 |
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651 - 3654 |
MANOHARAN M., BIOCHEMICA ET BIOPHYSICA ACTA, vol. 1489, 1999, pages 117 - 139 |
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504 |
MATZKE ET AL., CURR. OPIN. GENET. DEV., vol. 11, 2001, pages 221 - 227 |
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 237 |
MONTGOMERY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, 1998, pages 15502 - 15507 |
N.K CHRISTIENSEN. ET AL., J. AM. CHEM. SOC., vol. 120, 1998, pages 5458 - 5463 |
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500 |
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 538 |
ORGEL, PROC. R. SOC. LONDON, vol. B 205, 1979, pages 435 |
PRAKASH TPBHAT B., CURR TOP MED CHEM., vol. 7, no. 7, 2007, pages 641 - 9 |
PRASHARWEISSMAN, METHODS ENZYMOL., vol. 303, 1999, pages 258 - 72 |
R. I. LEVY ET AL.: "The structure, function and metabolism of high-density lipoproteins: A status report", CIRCULATION, vol. 62, 1980, pages IV4 - 8 |
SAISON-BEHMOARAS ET AL., EMBO J., vol. 10, 1991, pages 111 |
See also references of EP2427553A4 |
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 3783 |
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 - 489 |
SULLENGER ET AL., CELL, vol. 63, 1990, pages 601 - 608 |
SUTCLIFFE ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 97, 2000, pages 1976 - 81 |
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54 |
SZOSTAK, TIBS, vol. 17, 1993, pages 89 - 93 |
TABARA ET AL., SCIENCE, vol. 282, 1998, pages 430 - 431 |
TIJSTERMAN ET AL., SCIENCE, vol. 295, 2002, pages 694 - 697 |
TIMMONS ET AL., GENE, vol. 263, 2001, pages 103 - 112 |
TIMMONSFIRE, NATURE, vol. 395, 1998, pages 854 - 811 |
TO, COMB., CHEM. HIGH THROUGHPUT SCREEN, vol. 3, 2000, pages 235 - 41 |
TOULME, J.J., NATURE BIOTECHNOLOGY, vol. 19, 2001, pages 17 - 18 |
TUSCHL ET AL., GENES DEV.,, vol. 13, 1999, pages 3191 - 3197 |
UHLENBECK, O. C., NATURE, vol. 328, 1987, pages 596 - 600 |
UHLMAN ET AL., CURRENT OPINIONS IN DRUG DISCOVERY & DEVELOPMENT, vol. 3, no. 2, 2000 |
UHLMAN, E., DRUG DISCOVERY & DEVELOPMENT, vol. 3, 2000, pages 203 - 213 |
USMANMCSWIGGEN, ANN. REP. MED. CHEM., vol. 30, 1995, pages 285 - 294 |
YANG ET AL., J. VIROL., vol. 69, 1995 |
ZAUG ET AL., NATURE, vol. 324, 1986, pages 429 |
ZHANGMADDEN, GENOME RES., vol. 7, 1997, pages 649 - 656 |
Cited By (28)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9957503B2 (en) | 2009-05-06 | 2018-05-01 | Curna, Inc. | Treatment of LCAT gene related diseases by inhibition of a natural antisense transcript to LCAT |
US11066673B2 (en) | 2010-11-12 | 2021-07-20 | The General Hospital Corporation | Polycomb-associated non-coding RNAs |
JP2014500723A (en) * | 2010-11-12 | 2014-01-16 | ザ ジェネラル ホスピタル コーポレイション | Non-coding RNA related to polycomb |
US10358644B2 (en) | 2010-11-12 | 2019-07-23 | The General Hospital Corporation | Polycomb-associated non-coding RNAs |
US10119144B2 (en) | 2010-11-12 | 2018-11-06 | The General Hospital Corporation | Polycomb-associated non-coding RNAs |
US10053694B2 (en) | 2010-11-12 | 2018-08-21 | The General Hospital Corporation | Polycomb-associated non-coding RNAS |
EP3260540A1 (en) | 2010-11-12 | 2017-12-27 | The General Hospital Corporation | Polycomb-associated non-coding rnas |
US11788089B2 (en) | 2012-05-16 | 2023-10-17 | The General Hospital Corporation | Compositions and methods for modulating MECP2 expression |
US10837014B2 (en) | 2012-05-16 | 2020-11-17 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
US10059941B2 (en) | 2012-05-16 | 2018-08-28 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
US10058623B2 (en) | 2012-05-16 | 2018-08-28 | Translate Bio Ma, Inc. | Compositions and methods for modulating UTRN expression |
EP2849801A4 (en) * | 2012-05-16 | 2016-05-25 | Rana Therapeutics Inc | Compositions and methods for modulating apoa1 and abca1 expression |
US10174323B2 (en) | 2012-05-16 | 2019-01-08 | The General Hospital Corporation | Compositions and methods for modulating ATP2A2 expression |
US10174315B2 (en) * | 2012-05-16 | 2019-01-08 | The General Hospital Corporation | Compositions and methods for modulating hemoglobin gene family expression |
EP3511416A1 (en) | 2012-05-16 | 2019-07-17 | Translate Bio MA, Inc. | Compositions and methods for modulating gene expression |
US10655128B2 (en) | 2012-05-16 | 2020-05-19 | Translate Bio Ma, Inc. | Compositions and methods for modulating MECP2 expression |
US20150133528A1 (en) * | 2012-05-16 | 2015-05-14 | Rana Therapeutics, Inc. | Compositions and methods for modulating hemoglobin gene family expression |
WO2015162422A1 (en) * | 2014-04-22 | 2015-10-29 | Mina Therapeutics Limited | Sarna compositions and methods of use |
US10858650B2 (en) | 2014-10-30 | 2020-12-08 | The General Hospital Corporation | Methods for modulating ATRX-dependent gene repression |
US10900036B2 (en) | 2015-03-17 | 2021-01-26 | The General Hospital Corporation | RNA interactome of polycomb repressive complex 1 (PRC1) |
US10829555B2 (en) | 2016-03-14 | 2020-11-10 | Hoffman-La Roche Inc. | Oligonucleotides for reduction of PD-L1 expression |
US10745480B2 (en) | 2016-03-14 | 2020-08-18 | Hoffmann-La Roche, Inc. | Oligonucleotides for reduction of PD-L1 expression |
US11466081B2 (en) | 2016-03-14 | 2022-10-11 | Hoffmann-La Roche Inc. | Oligonucleotides for reduction of PD-L1 expression |
US20170283496A1 (en) * | 2016-03-14 | 2017-10-05 | Roche Innovation Center Copenhagen A/S | Oligonucleotides for reduction of pd-l1 expression |
CN108103082B (en) * | 2017-05-11 | 2021-07-13 | 北京锦篮基因科技有限公司 | Adeno-associated virus mediated LCAT gene expression vector and application thereof |
CN108103082A (en) * | 2017-05-11 | 2018-06-01 | 北京五加和分子医学研究所有限公司 | A kind of gland relative virus mediated LCAT expression vectors and application thereof |
US20200362341A1 (en) * | 2019-03-15 | 2020-11-19 | University Of Massachusetts | Oligonucleotides for tissue specific apoe modulation |
US20210340533A1 (en) * | 2019-12-23 | 2021-11-04 | University Of Massachusetts | Oligonucleotides for tissue specific gene expression modulation |
Also Published As
Publication number | Publication date |
---|---|
US9957503B2 (en) | 2018-05-01 |
CN103223177A (en) | 2013-07-31 |
CN102459596B (en) | 2016-09-07 |
KR101835889B1 (en) | 2018-03-08 |
CA2761152A1 (en) | 2010-11-11 |
US20160024506A1 (en) | 2016-01-28 |
KR20120061068A (en) | 2012-06-12 |
WO2010129799A3 (en) | 2011-08-04 |
EP2427553A2 (en) | 2012-03-14 |
US10604755B2 (en) | 2020-03-31 |
JP2012525851A (en) | 2012-10-25 |
CN103223177B (en) | 2016-08-10 |
US20180208930A1 (en) | 2018-07-26 |
JP5883782B2 (en) | 2016-03-15 |
US20160024505A1 (en) | 2016-01-28 |
EP2427553A4 (en) | 2012-11-07 |
CN106237345A (en) | 2016-12-21 |
US20120046344A1 (en) | 2012-02-23 |
CN102459596A (en) | 2012-05-16 |
US9155754B2 (en) | 2015-10-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9957503B2 (en) | Treatment of LCAT gene related diseases by inhibition of a natural antisense transcript to LCAT | |
US10876117B2 (en) | Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene | |
US10465192B2 (en) | Treatment of delta-like 1 homolog (DLK1) related diseases by inhibition of natural antisense transcript to DLK1 | |
US10995334B2 (en) | Treatment of nuclear factor (erythroid-derived 2)-like 2 (NRF2) related diseases by inhibition of natural antisense transcript to NRF2 | |
US10316317B2 (en) | Treatment of adiponectin (ADIPOQ) related diseases by inhibition of natural antisense transcript to an adiponectin (ADIPOQ) | |
US9725717B2 (en) | Treatment of transcription factor E3 (TFE3) and insulin receptor substrate 2 (IRS2) related diseases by inhibition of natural antisense transcript to TFE3 | |
EP2352830A2 (en) | Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoprotein-a1 | |
US20160168574A1 (en) | Treatment of insulin gene (ins) related diseases by inhibition of natural antisense transcript to an insulin gene (ins) |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 201080030706.2 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10772845 Country of ref document: EP Kind code of ref document: A2 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 13318713 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2761152 Country of ref document: CA Ref document number: 2012509979 Country of ref document: JP |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 20117028622 Country of ref document: KR Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2010772845 Country of ref document: EP |