US5661134A - Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity - Google Patents

Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity Download PDF


Publication number
US5661134A US08471966 US47196695A US5661134A US 5661134 A US5661134 A US 5661134A US 08471966 US08471966 US 08471966 US 47196695 A US47196695 A US 47196695A US 5661134 A US5661134 A US 5661134A
Grant status
Patent type
Prior art keywords
seq id
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
Phillip Dan Cook
Glenn Hoke
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Grant date




    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06Pyrimidine radicals
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06Pyrimidine radicals
    • C07H19/10Pyrimidine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/16Purine radicals
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/16Purine radicals
    • C07H19/20Purine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H23/00Compounds containing boron, silicon, or a metal, e.g. chelates, vitamin B12
    • C07J43/00Normal steroids having a nitrogen-containing hetero ring spiro-condensed or not condensed with the cyclopenta(a)hydrophenanthrene skeleton
    • C07J43/003Normal steroids having a nitrogen-containing hetero ring spiro-condensed or not condensed with the cyclopenta(a)hydrophenanthrene skeleton not condensed
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1132Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1133Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against herpetoviridae, e.g. HSV
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0069Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Y113/00Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
    • C12Y113/11Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of two atoms of oxygen (1.13.11)
    • C12Y113/11012Linoleate 13S-lipoxygenase (
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/312Phosphonates
    • C12N2310/3125Methylphosphonates
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/333Modified A
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/336Modified G
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521Methyl
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3523Allyl
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3527Other alkyl chain
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/353Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3531Hydrogen
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/353Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3533Halogen


Sequence-specific phosphorothioate oligonucleotides comprising nucleoside units which are joined together by either substantially all Sp or substantially all Rp phosphorothioate intersugar linkages are provided. Such sequence-specific phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages are prepared by enzymatic or chemical synthesis. They are especially well suited as diagnostics, therapeutics, and research reagents in diseases mediated by Ha-ras or Ki-ras.



This application is a continuation-in-part of U.S. patent application Ser. No. 08/297,703, filed Aug. 29, 1994 (now U.S. Pat. No. 5,506,212, issued Apr. 9, 1996), which is a continuation of U.S. patent application Ser. No. 07/777,007, filed Oct. 16, 1991, now abandoned. This application also is a continuation-in-part of U.S. patent application Ser. No. 08/058,023, filed May 5, 1993 (now U.S. Pat. No. 5,521,302, issued May 28, 1996), which is a divisional application of U.S. patent application Ser. No. 07/777,670, filed Oct. 15, 1991 (now U.S. Pat. No. 5,212,295, issued May 18, 1993), which is a continuation-in-part of U.S. patent application Ser. No. 07/777,007, Oct. 16, 1991, now abandoned.


This invention is directed to sequence-specific phosphorothioate oligonucleotides comprising nucleosides joined by intersugar linkages, and to their synthesis and use. More particularly, the intersugar linkages linking the nucleosides of oligonucleotides of the present invention are substantially pure all Sp or all Rp chiral phosphorothioate linkages. Such oligonucleotides are prepared via chemical or enzymatic synthesis. They are especially well suited as diagnostics, therapeutics and research reagents.


Oligonucleotides tides are known to hybridize to single-stranded RNA or single-stranded DNA. Hybridization is the sequence-specific base pair hydrogen bonding of bases of the oligonucleotides to bases of target RNA or DNA. Such base pairs are said to be complementary to one another.

In determining the extent of hybridization of an oligonucleotide to a complementary nucleic acid, the relative ability of an oligonucleotide to bind to the complementary nucleic acid may be compared by determining the melting temperature of a particular hybridization complex. The melting temperature (Tm), a characteristic physical property of double helices, denotes the temperature (°C.) at which 50% helical (hybridized) versus coil (unhybridized) forms are present. Tm is measured by using the UV spectrum to determine the formation and breakdown (melting) of the hybridization complex. Base stacking which occurs during hybridization, is accompanied by a reduction in UV absorption (hypochromicity). Consequently, a reduction in UV absorption indicates a higher Tm. The higher the Tm, the greater the strength of the bonds between the strands.

Oligonucleotides can be used to effect enzymatic cleavage of a target RNA by using the intracellular enzyme RNase H. The mechanism of such RNase H cleavage requires that a 2'-deoxyribofuranosyl oligonucleotide hybridize to a target RNA. The resulting DNA-RNA duplex activates the RNase H enzyme and the activated enzyme cleaves the RNA strand. Cleavage of the RNA strand destroys the normal function of the target RNA. Phosphorothioate oligonucleotides operate via this type of mechanism. However, for a DNA oligonucleotide to be useful for cellular activation of RNase H, the oligonucleotide must be reasonably stable to nucleases in order to survive in a cell for a time period sufficient for RNase H activation. For non-cellular uses, such as use of oligonucleotides as research reagents, such nuclease stability may not be necessary.

Several publications of Walder et al. describe the interaction of RNase H and oligonucleotides. Of particular interest are: (1) Dagle et al., Nucleic Acids Research 1990, 18, 4751; (2) Dagle et al., Antisense Research And Development 1991, 1, 11; (3) Eder et al., J. Biol. Chem. 1991, 266, 6472; and (4) Dagle et al., Nucleic Acids Research 1991, 19, 1805. According to these publications, DNA oligonucleotides having both unmodified phosphodiester internucleoside linkages and modified phosphorothioate internucleoside linkages are substrates for cellular RNase H. Since they are substrates, they activate the cleavage of target RNA by RNase H. However, the authors further note that in Xenopus embryos, both phosphodiester linkages and phosphorothioate linkages are also subject to exonuclease degradation. Such nuclease degradation is detrimental since it rapidly depletes the oligonucleotide available for RNase H activation.

As described in references (1), (2) and (4), to stabilize oligonucleotides against nuclease degradation while still providing for RNase H activation, 2'-deoxy oligonucleotides having a short section of phosphodiester linked nucleotides positioned between sections of phosphoramidate, alkyl phosphonate or phosphotriester linkages were constructed. While the phosphoamidate-containing oligonucleotides were stabilized against exonucleases, in reference (4) the authors noted that each phosphoramidate linkage resulted in a loss of 1.6° C. in the measured Tm value of the phosphoramidate containing oligonucleotides. Such a decrease in the Tm value is indicative of a decrease in hybridization between the oligonucleotide and its target nucleic acid strand.

Applications of oligonucleotides as diagnostics, research reagents, and therapeutic agents require that the oligonucleotides be transported across cell membranes or taken up by cells, appropriately hybridize to target RNA or DNA, and subsequently terminate or disrupt nucleic acid function. These critical functions depend partly on the initial stability of oligonucleotides towards nuclease degradation. Further, these functions depend on specificity of the oligonucleotide for a target DNA or RNA molecule.

A serious deficiency of oligonucleotides for these purposes is their susceptibility to enzymatic degradation by a variety of ubiquitous nucleases which may be intracellularly and extracellularly located. Unmodified, "wild type", oligonucleotides are not useful as therapeutic agents because they are rapidly degraded by nucleases. Therefore, modification of oligonucleotides for conferring nuclease resistance on them has been the primary focus of research directed towards the development of oligonucleotide therapeutics and diagnostics.

Modifications of oligonucleotides to enhance nuclease resistance has generally taken place on the sugar-phosphate backbone, particularly on the phosphorous atom. Phosphorothioates have been reported to exhibit resistance to nucleases. In addition, phosphorothioate oligonucleotides are generally more chemically stable than natural phosphodiester oligonucleotides. Phosphorothioate oligonucleotides also exhibit solubility in aqueous media. Further, phosphorothioate oligonucleotide-RNA heteroduplexes can serve as substrates for endogenous RNase H. Additionally, phosphorothioate oligonucleotides exhibit high thermodynamic stability. However, while the ability of an oligonucleotide to bind to a target DNA or RNA with fidelity is critical for its hybridization to the target DNA or RNA, modifications at the phosphorous atom of the oligonucleotides, while exhibiting various degrees of nuclease resistance, have generally suffered from inferior hybridization properties [Cohen, J. S., Ed., Oligonucleotides:Antisense Inhibitors of Gene Expression (CRC Press, Inc., Boca Raton, Fla., 1989].

One reason for this inferior hybridization may be the prochiral nature of the phosphorous atom. Modifications on the internal phosphorous atom of modified phosphorous oligonucleotides results in Rp and Sp stereoisomers. Modified phosphorus oligonucleotides obtained thus far, wherein the resulting molecule has nonsymmetrical substituents, have been racemic mixtures having 2n isomers, with n equal to the number of phosphorothioate intersugar linkages in the oligonucleotide. Thus, a 15-mer phosphorothioate oligonucleotide, containing 14 asymmetric centers has 214 or 16,384 diastereomers. In view of this, in a racemic mixture, only a small percentage of the oligonucleotides are likely to specifically hybridize to a target mRNA or DNA with sufficient affinity.

Chemically synthesized phosphorothioate oligonucleotides having chirally pure intersugar linkages had thus far been limited to molecules having only one or two diastereomeric intersugar linkages. Until recently, the effects of induced chirality in chemically synthesized racemic mixtures of sequence-specific phosphorothioate oligonucleotides had not been assessed since synthesis of oligonucleotides having chirally pure intersugar linkages had yet to be accomplished by automated synthesis. This was due to the non-stereospecific incorporation of sulfur during automated synthesis. For example, Stec et al., J. Chromatography, 326:263 (1985), synthesized certain oligonucleotide phosphorothioates having racemic intersugar linkages, however, they were able to resolve only the diastereomers of certain small oligomers having one or, at most, two diastereomeric phosphorous intersugar linkages.

However, Stec et al. [Nucleic Acids Res., 19:5883 (1991)] subsequently reported the automated stereocontrolled synthesis of oligonucleotides. The procedure described in the above-mentioned reference utilizes base-catalyzed nucleophilic substitution at a pentavalent phosphorothioyl center.

The synthesis of phosphorothioates having all Rp intersugar linkages using enzymatic methods has been investigated by several authors [Burgers and Eckstein, J. Biological Chemistry, 254:6889 (1979); Gupta et al., J. Biol. Chem., 256:7689 (1982); Brody and Frey, Biochemistry, 20:1245 (1981); and Eckstein and Jovin, Biochemistry, 2:4546 (1983)]. Brody et al. [Biochemistry, 21:2570 (1982)] and Romaniuk and Eckstein, [J. Biol. Chem., 257:7684 (1982)] enzymatically synthesized poly TpA and poly ApT phosphorothioates, while Burgers and Eckstein [Proc. Natl. Acad. Sci. U.S.A., 75:4798 (1978)] enzymatically synthesized poly UpA phosphorothioates. Cruse et al. [J. Mol. Biol., 192:891 (1986)] linked three diastereomeric Rp GpC phosphorothioate dimers via natural phosphodiester bonds into a hexamer.

The relative ability of an oligonucleotide to bind to complementary nucleic acids may be compared by determining the melting temperature of a particular hybridization complex. The melting temperature (Tm), a characteristic physical property of double helixes, denotes the temperature (°C.) at which 50% helical versus coil (unhybridized) forms are present. Tm is measured by using the UV spectrum to determine the formation and breakdown (melting) of hybridization. Base stacking which occurs during hybridization, is accompanied by a reduction in UV absorption (hypochromicity). Consequently a reduction in UV absorption indicates a higher Tm. The higher the Tm, the greater the strength of the binding of the strands. Non-Watson-Crick base pairing has a strong destabilizing effect on the Tm.

In a preliminary report [Stec, J. W., Oligonucleotides as Antisense Inhibitors of Gene Expression: Therapeutic Implications, Meeting abstracts, Jun. 18-21, 1989], thymidine homopolymer octamers having all but one linkage being modified phosphate linkages ("all except one") Rp stereoconfiguration or "all except one" Sp stereoconfiguration in the intersugar linkages were formed from two thymidine methylphosphonate tetrameric diastereomers linked by a natural phosphodiester bond. It was noted that a Rp "all except one" methylphosphonate non-sequence-specific thymidine homooctamer, i.e. (dT)8 having all but one Rp intersugar linkage, formed a thermodynamically more stable hybrid (Tm 38° C.) with a 15-mer deoxyadenosine homopolymer, i.e. (dA)15, than a hybrid formed by a similar thymidine homopolymer having "all except one" Sp configuration methylphosphonate linkages and of d(A)15 (Tm<0° C.), i.e. a d(T)15 having all but one Sp intersugar linkage. A hybrid between (dT)8 having natural phosphodiester linkages, i.e. octathymidylic acid, and d(A)15 was reported to have a Tm of 14° C.

More recently, Ueda et al. [Nucleic Acids Research, 19:547 (1991)] enzymatically synthesized mRNAs intermittently incorporating Rp diastereomeric phosphorothioate linkages for use in translation systems. Ueda et al. employed T7 coliphane DNA having seventeen promoters and one termination site for T7 RNA polymerase. In vitro synthesis by T7 RNA polymerase produced mRNAs having from several hundred to tens of thousands of nucleotides.

Backbone chirality may also affect the susceptibility of a phosphorothioate oligonucleotide-RNA heteroduplex to RNase H activity. The ability to serve as a template for RNAse H has significant therapeutic implications since it has been suggested that RNAse H causes cleavage of the RNA component in an RNA-DNA oligonucleotide heteroduplex. With oligonucleotides containing racemic mixtures of Rp and Sp intersugar linkages, it is not known if all phosphorothioate oligonucleotides can function equally as substrates for RNase H. For a variety of catalytic reactions, hydrolysis of the phosphodiester backbone of nucleic acids proceeds by a stereospecific mechanism (an in-line mechanism) and inversion of configuration. Therefore, there may be only a small percentage of oligonucleotides in a racemic mixture that contain the correct chirality for maximum hybridization efficiency and termination of translation. Thus, increasing the percentage of phosphorothioate oligonucleotides that can serve as substrates for RNAse H in a heteroduplex will likely lead to a more efficacious compound for antisense therapy.

To enhance hybridization fidelity, phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages are greatly desired. Further, such phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages would lead to more efficacious therapeutic compounds. However, until now little success has been achieved in synthesizing such molecules. Therefore, simple methods of synthesizing phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages are greatly desired.

It has been recognized that nuclease resistance of oligonucleotides and fidelity of hybridization are of great importance in the development of oligonucleotide therapeutics. Oligonucleotides possessing nuclease resistance are also desired as research reagents and diagnostic agents.


It is an object of this invention to provide sequence-specific phosphorothioate oligonucleotides having substantially chirally pure, either all Rp or all Sp, intersugar linkages.

It is a further object of this invention to provide phosphorothioate oligonucleotides having all Rp or all Sp intersugar linkages that are specifically hybridizable to target DNA or RNA.

It is another object of this invention to provide methods for synthesis of sequence-specific phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages.

These and other objects of the present invention shall become apparent to persons skilled in the art to which this invention pertains given this specification and the claims appended hereto.


In accordance with this invention, phosphorothioate oligonucleotides having all nucleoside units joined together by either substantially all Sp phosphorothioate intersugar linkages or substantially all Rp phosphorothioate intersugar linkages are provided. Preferably, the phosphorothioate oligonucleotides of the present invention are complementary to at least a portion of the sequence of a target RNA or DNA.

Further, in accordance with the present invention, chemical and enzymatic methods of synthesizing sequence-specific phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages are provided wherein said phosphorothioate oligonucleotides are comprised of at least 10 nucleoside units joined together by either substantially all Rp or substantially all Sp intersugar linkages. Preferably, the phosphorothioate oligonucleotides are comprised of about 10 to about 50 nucleoside units joined by substantially chirally pure intersugar linkages. More preferably, said phosphorothioate oligonucleotides are comprised of about 15 to about 30 nucleoside units joined by substantially chirally pure intersugar linkages. Most preferably, said phosphorothioate oligonucleotides are comprised of about 17 to 21 nucleoside units joined together by substantially chirally pure intersugar linkages. Said methods comprise combining sequence primers, templates, and an excess of all four chirally pure nucleoside 5'-O-(1-thiotriphosphates). Said methods further include synthesizing complementary oligonucleotides by the addition of polymerase followed by cleavage of the primer from the complementary oligonucleotides. In addition, said methods are comprised of disassociating said complementary oligonucleotides from said template.

In alternative embodiments of the present invention methods of synthesizing sequence-specific phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages, sequence primers, templates and racemic mixtures of nucleoside 5'-O-(1-thiotriphosphates) are combined. Phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages and which are complementary to the template are synthesized by the addition of polymerase and a selected metal ion. Oligonucleotides thus synthesized are dissociated from the template and primer.

Phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages are useful for increasing the thermodynamic stability of heteroduplexes formed with target RNA and DNA and to elicit RNase H activity. Further, oligonucleotides of the present invention are useful for modulating the activity of RNA.


The phosphorous atom in a phosphodiester linkage of an oligonucleotide can be described as being "pro-chiral." Once a non-bonding oxygen atom of the phosphodiester linkage is replaced or modified, a chiral sugar-phosphate linkage is generated. The resulting intersugar linkage is either an Sp intersugar linkage or an Rp intersugar linkage. Replacement of a non-bonding oxygen atom of the natural phosphodiester linkage with sulfur to obtain a phosphorothioate linkage results in the generation of a chiral center and affords Sp and Rp diastereomers. Molecules wherein substantially all of the phosphorous atoms in the sugar backbone are either Sp or Rp are referred to herein as chirally pure.

Ribonucleoside- (NTPαS) and 2'-deoxyribonucleoside-5'-O-(1-thiotriphosphates) (dNTPαS) have been synthesized as Sp and Rp racemic mixtures using the methodology of Ludwig and Eckstein [J. Org. Chem., 631 (1989)]. In this exemplary synthetic scheme, unprotected nucleosides can be reacted with 2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one, which phosphitylates the 5'-hydroxyl group. Subsequent reaction with pyrophosphate yields cyclic triphosphate derivatives which are reactive to sulfur, yielding mixtures of Rp and Sp nucleoside 5'-O-(1-thiotriphosphates), i.e. α-thiotriphosphates. The products can be purified by DEAE-Sephadex chromatography and identified by NMR spectroscopy (by characteristic Rp or Sp chemical shifts).

As is shown in the examples below, pure Rp and Sp nucleoside-5'-O-(1-thiotriphosphates) diastereomers can be readily isolated on a preparative scale using, for example, reverse phase HPLC chromatography. Such HPLC-isolated nucleotide diastereomers can be further characterized by analytical HPLC comparisons with commercial samples of such Rp and Sp nucleoside 5'-O-(1-thiotriphosphates) diastereomers.

Enzymatic synthesis of sequence-specific natural oligonucleotides, i.e. natural phosphodiester oligonucleotides, can be effected by the use of an appropriate nuclease in the presence of a template and primer. In a like manner, racemic mixtures of phosphorothioate oligonucleotides having chirally mixed intersugar linkages can be synthesized. According to the present invention, such enzymatic synthesis can also be expanded to include the synthesis of sequence specific phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages by utilizing enantiomerically pure all-Sp or all-Rp nucleoside 5'-O-(1-thiotriphosphates) as substrates for appropriate nucleases in the presence of a sequence-specific template and a primer. For example, commercially available DNA polymerase Sequenase™ (U.S. Biochemical, Inc., Cleveland, Ohio) may be used to synthesize phosphorothioate oligonucleotides using a phosphodiester oligonucleotide template and a racemic phosphorothioate oligonucleotide primer. Using this polymerase both phosphodiester and phosphorothioate primers may be extended.

Yields of enzymatically synthesized phosphorothioate oligonucleotides can be optimized by repetitive additions of template and primer, by repetitive additions of polymerase, by repetitive additions of nucleoside triphosphates or by combinations of some or all of these. For instance, repetitive additions of template and primer results in maximizing yields via an enzymatic cascade. Further optimization can be achieved by pre-hybridization of template and primer together in system buffer, followed by cooling and addition of nucleoside triphosphates and polymerase.

A suitable polymerase may be selected to yield either DNA or RNA phosphorothioate oligonucleotides. Such polymerases include but are not necessarily limited to T7 DNA polymerase, modified T7 DNA polymerases such as the above referenced Sequenase™, E. coli DNA polymerase, DNA poly Klenow fragment polymerase, M. luteus polymerase, T4 bacteriophage polymerase, modified T4 DNA polymerase, T7 RNA polymerase and E. coli RNA polymerase.

The enzymatic synthesis proceeds with inversion of configuration about the chiral center of the phosphorous atom. Thus, use of all Sp α-thiotriphosphates yields substantially all Rp phosphorothioate oligonucleotides while use of all Rp α-thiotriphosphates yields substantially all Sp phosphorothioate oligonucleotides. In an alternate embodiment of the invention, phosphorothioate oligonucleotides may be synthesized from racemic mixtures of nucleoside-5'-O-(1-thiotriphosphates) utilizing metal ions in reaction solutions to promote preferential incorporation of one or the other of the chiral α-thiotriphosphates. As noted above, polymerase synthesis of phosphorothioate oligonucleotides is accomplished with inversion of configuration about the chiral center of the precursor nucleoside-α-thiotriphosphate. While not wishing to be bound by theory, it is believed that optimization of an all Rp configuration may be accomplished by addition of a high concentration of magnesium ion in the reaction buffer utilizing, for instance, an E. coli polymerase. In a like manner, again while not wishing to be bound by theory, an all Sp configuration might be obtained by utilizing a high manganese ion concentration in the reaction buffer.

In accordance with the present invention, "substantially all" is meant to include all oligonucleotides in which at least 75% of the intersugar linkages are chirally pure. More preferably, oligonucleotides having from about 85% to about 100% chirally pure intersugar linkages are substantially chirally pure. Most preferably, oligonucleotides having from about 95% to about 100% chirally pure intersugar linkages are substantially chirally pure.

In the context of this invention, the term "phosphorothioate oligonucleotide" includes phosphorothioate oligonucleotides formed from naturally occurring bases, sugars and phosphorothioate linkages. Naturally occurring bases include adenine, guanine, cytosine, thymine and uracil. Natural sugars include β-D-ribofuranosyl and β-D-2'-deoxy-erythro-pentofuranosyl. To the extent that nucleoside-5'-O-(1-thiotriphosphate) analogs are substrates for suitable polymerases, "phosphorothioate oligonucleotides" also include modified bases or modified sugars incorporated within the phosphorothioate nucleotide units of the oligonucleotides. Modified bases of the oligonucleotides of this invention include adenine, guanine, adenine, cytosine, uracil, thymine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo uracil, 5-halo cytosine, 6-aza uracil, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiouracil, 8-halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8-amino guanine, 8-thiol guanine, 8-thiolalkyl guanines, 8-hydroxyl guanine and other 8-substituted guanines, other aza and deaza uracils, other aza and deaza thymidines, other aza and deaza cytosines, other aza and deaza adenines, other aza and deaza guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine. The sugar moiety may be deoxyribose or ribose. The oligonucleotides of the invention may also comprise modified nucleobases or nucleobases having other modifications consistent with the spirit of this invention, and in particular modifications that increase their nuclease resistance in order to facilitate their use as therapeutic, diagnostic or research reagents.

Oligonucleotides of the invention can be utilized as diagnostics, therapeutics and as research reagents. They can be utilized in pharmaceutical compositions by adding an effective amount of an oligonucleotide of the invention to a suitable pharmaceutically acceptable diluent or carrier. They further can be used for treating organisms having a disease characterized by the undesired production of a protein. The organism can be contacted with an oligonucleotide of the invention having a sequence that is capable of specifically hybridizing with a strand of target nucleic acid that codes for the undesirable protein.

The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. In general, for therapeutics, a patient in need of such therapy is administered an oligonucleotide in accordance with the invention, commonly in a pharmaceutically acceptable carrier, in doses ranging from 0.01 μg to 100 g per kg of body weight depending on the age of the patient and the severity of the disease state being treated. Further, the treatment regimen may last for a period of time which will vary depending upon the nature of the particular disease, its severity and the overall condition of the patient, and may extend from once daily to once every several years. Following treatment, the patient is monitored for changes in his/her condition and for alleviation of the symptoms of the disease state. The dosage of the oligonucleotide may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disease state is observed, or if the disease state has been ablated.

In some cases it may be more effective to treat a patient with an oligonucleotide of the invention in conjunction with other traditional therapeutic modalities.

Dosing is dependent on severity and responsiveness of the disease condition to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50 s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every several years.

Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every several years.

The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration.

Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.

Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.

Compositions for intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives.

Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives.

Phosphorothioate oligonucleotides of the present invention can be contrasted with both natural phosphodiester oligonucleotides and racemic phosphorothioate nucleotides as to their effects on hybridization, nuclease resistance and RNAse H activity. In like manner, pure phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages may also be assessed for their ability to increase effectiveness of therapy in in vivo test systems. Such increase in effectiveness of therapy might include attributes such as pharmacokinetics or metabolism, toxicology, disposition (i.e. absorption and distribution), and species comparisons.

Homopolymers having all Rp or all Sp intersugar linkages have been useful for initial studies of stability and other characteristics. However, these oligonucleotides have little use therapeutically as they are not specific for target molecules. Phosphorothioate oligonucleotides having specific sequences are necessary in order to specifically hybridize to target nucleic acids.

Sequence-specific phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages are useful to increase the thermodynamic stability of heteroduplexes with target RNA and DNA and to elicit RNase H activity.

Radiolabeling can be used to assist in the identification of phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages. For racemic phosphorothioate oligonucleotides synthesized on an automated synthesizer, [35 S](radiolabeled elemental sulfur) can be used for oxidation of the hydrogen-phosphonate oligomers obtained from the synthesizer. Labeling of enzymatically synthesized phosphorothioate oligonucleotides can be accomplished with [α-32 P]ATP and ligase or [α-35 S]ATPs in the polymerase reaction. Also, radiolabeled nucleoside triphosphates can be used in probe and sequencing analysis. Autoradiograms are prepared in standard manners.

Templates of the present invention are most preferably areas of nucleic acid sequence which direct synthesis of disease-potentiating proteins. Short oligonucleotides that base pair to a region of said template oligonucleotide act as primers which form the starting point for oligonucleotide synthesis by polymerases.

Phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages may be synthesized using a primer which may be selected to have a site thereon that is susceptible to nuclease cleavage, for example, restriction endonuclease cleavage. Said cleavage site may be located at the 3' end of said primer. Cleavage at said site by an appropriate restriction endonuclease results in oligonucleotides deriving a first 5' end nucleoside from said primer. Additional nucleosides of said phosphorothioate oligonucleotides of the present invention are those nucleoside chiral thiotriphosphates added via enzymatic means.

By selecting appropriate restriction nucleases in conjunction with selected primers, various 5'-terminal nucleosides of desired phosphorothioate oligonucleotides are appropriately positioned at the 5' end of a phosphorothioate nucleotide. Thus, any endonuclease recognition site can be designed as long as the staggered cut results in one nucleoside from the primer being the first 5' nucleoside of the newly synthesized sequence specific phosphorothioate oligonucleotide of the invention. This results in the generation of different nucleosides on 5' ends of enzymatically synthesized phosphorothioate oligonucleotides of the invention.

Upon completion of enzymatic extension of said primer on an appropriate template of a desired sequence, phosphorothioate oligonucleotides of the invention may be released from said primer by use of appropriate nuclease. For example, for incorporation of a guanosine nucleoside at the 5' end of desired phosphorothioate oligonucleotides, a primer having an CTGCAG sequence at its 3' terminal end may be used. Use of a Pst 1 restriction nuclease then may cleave the A-G linkage. The guanosine nucleoside component of this A-G linkage may thus incorporated as a 5' terminal nucleoside of desired phosphorothioate oligonucleotides. Other restriction endonuclease include but are not limited to BamH1, Smal and Hind III restriction endonucleases.

Oligonucleotides still associated with said template may be dissociated from said template and then purified by gel electrophoresis and/or chromatography. For example, suitable purification can be accomplished utilizing standard polyacrylamide/urea gel electrophoresis coupled with SepPac (Millipore, Miford, Mass.) chromatography. Another useful chromatographic technique that may be employed is HPLC chromatography.

Chiral phosphorothioate oligonucleotides of the present invention may also be chemically synthesized via 1,3,2-oxathiaphospholane intermediates as described by Stec et al. [Nucleic Acids Res., 19:5883 (1991)] and Stec and Lesnikowski [Methods in Molecular Biology, S. Agrawal, Ed., Volume 20, p. 285, 1993].

Phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages which are synthesized according to methods of the present invention may be analyzed by a number of methods. For example, configuration analysis of resulting sequence-specific phosphorothioate oligonucleotides having substantially chirally pure all Sp or all Rp intersugar linkages may be determined by the use of [31 P] NMR chemical shifts. Such chemical shifts have been used to identify the Rp epimer of a phosphorothioate dinucleotide [Ludwig and Eckstein, J. Org. Chem., 631-635 (1989)].

The fidelity of sequences of phosphorothioate oligonucleotides of the invention can be determined using the sensitivities of heteroduplexes to S1 nuclease.

The sequence of the phosphorothioate oligonucleotides can be further substantiated by labeling the 3'hydroxyl groups of phosphorothioate oligonucleotides with [alpha-32 P]cordycepin triphosphate, i.e. 3'-deoxyadenosine-5'-triphosphate. The resultant oligonucleotides may be subjected to enzymatic degradation.

The relative ability of phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages to bind to complementary strands is compared by determining the melting temperature of a hybridization complex of a phosphorothioate oligonucleotide having substantially chirally pure intersugar linkages and its complementary strand. The melting temperature (Tm), a characteristic physical property of double helixes, denotes the temperature in degrees centigrade at which 50% helical versus coiled (unhybridized) forms are present. Tm is measured by using the UV spectrum to determine the formation and breakdown (melting) of hybridization. Base stacking, which occurs during hybridization, is accompanied by a reduction in UV absorption (hypochromicity). Consequently a reduction in UV absorption indicates a higher Tm. The higher the Tm, the greater the strength of the binding of the strands. Non Watson-Crick base pairing has a strong destabilizing effect on the Tm. Consequently, as close to optimal fidelity of base pairing as possible is desired to have optimal binding of an oligonucleotide to its targeted RNA.

Phosphorothioate oligonucleotides of the invention can also be evaluated for their resistance to the degradative ability of a variety of exonucleases and endonucleases. Phosphorothioate oligonucleotides may be treated with nucleases and then analyzed, as for instance, by polyacrylamide gel electrophoresis (PAGE) followed by staining with a suitable stain such as Stains All™ (Sigma Chem. Co., St. Louis, Mo.). Degradation products may be quantitated using laser densitometry.

Fetal calf and human serum may be used to evaluate nucleolytic activity on phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages. For instance, a phosphorothioate oligonucleotide having substantially all Rp intersugar linkages may be evaluated in this manner. Testing on combinations of 3' or 5' end capped (having one or several phosphorothioate linkages per cap) molecules may be used to establish a combination that yields greatest nuclease stability. Capping can be effected by chemically synthesizing the cap portion of a sequence using purified Rp monomers followed by incorporation of said cap into oligonucleotides on the DNA synthesizer. Analysis involving capping can determine the importance of chirality on nucleolytic stability and the number of linkages required to obtain maximum stability.

The sensitivity of phosphorothioate oligonucleotide-RNA heteroduplexes to the catalytic activity of RNase H can also be assessed. A phosphorothioate oligonucleotide can be incubated with a radiolabeled target mRNA (synthesized as for instance via T7 RNA polymerase) at various temperatures for hybridization. Heteroduplexes can then be incubated at 37° C. with RNase H from E. coli according to the procedure of Minshull and Hunt [Nuc. Acid Res., 6433 (1986)]. Products may then be assessed for RNase H activity by Northern Blot analysis wherein products are electrophoresed on a 1.2% agarose/formaldehyde gel and transferred to nitrocellulose. Filters may then be probed using a random primer [32 P]-labeled cDNA complementary to target mRNA and quantitated by autoradiography. Comparisons between different phosphorothioate analogs can be made to determine the impact of chirality on the ability to act as a substrate for RNase H when complexed to RNA.

Comparisons of the susceptibility of heteroduplexes to the catalytic action of E. coli RNase H and mammalian RNAse H can be performed. Heteroduplexes can be incubated in rabbit reticulocyte lysates under conditions of translation and assayed via Northern blot analysis for catalytic cleavage of mRNA by endogenous RNase H. This allows for determination of the effects of chirality on mammalian RNAse H activity.

Phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages can also be evaluated for inhibition of gene expression in cell culture model systems. To determine if a phosphorothioate oligonucleotide having substantially pure chirally pure intersugar linkages is more potent or a more specific inhibitor of gene expression, a phosphorothioate oligonucleotide having substantially chirally pure intersugar linkages designed to target reporter genes may be synthesized and tested in cell culture models of gene expression. The use of the vector pSV2CAT has previously been described to measure antisense effects on gene expression [Henthorn et al., Proc. Natl. Acad. Sci. U.S.A., 85:6342 (1988)]. This vector contains the bacterial chloramphenicol acetyl transferase gene under regulatory controls of the SV40 promoter. Utilizing a 15-mer phosphorothioate oligonucleotide having all Rp intersugar linkages of a sequence complementary to the initiation of translation of the CAT mRNA, pSV2CAT may be transfected into HeLa cells and, following treatment of the cells for 48 hr with a phosphorothioate oligonucleotide having all Rp intersugar linkages, CAT activity may then be assayed in the cells. The activity of a phosphorothioate having substantially chirally pure intersugar linkages in inhibition of gene expression may then be compared directly with a chemically synthesized random phosphorothioate having diastereomeric intersugar linkages and natural phosphodiester oligonucleotides of the same sequence.

The vector pSV2APAP [Marcus-Sekura et al., Nucleic Acids Research, 15:5749 (1987)] contains the mammalian placental alkaline phosphatase gene (PAP). This can also be used as a reporter for measuring antisense effects on gene expression. PAP has advantages over CAT as a reporter gene in that it is a mammalian gene, rather than a bacterial gene that contains introns and other RNA processing signals. It is presently believed that PAP expression mimics more closely the events in natural mammalian gene expression. A 15-mer phosphorothioate oligonucleotide having substantially chirally pure intersugar linkages as described above for the CAT mRNA can be examined in parallel with chemically synthesized racemic phosphorothioate and natural phosphodiester oligonucleotides having similar sequences. The PAP and CAT reporter constructs are used as controls in reciprocal experiments to test for non-specific effects on gene expression.

Additionally, phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages can be evaluated as to their ability to act as inhibitors of RNA translation in vivo. Various therapeutic areas can be targeted for such manipulation by oligonucleotides of the present invention. One therapeutic area is hepatitis caused by Hepatitis C virus (HCV). The following phosphorothioate oligonucleotides have application in the treatment of HCV hepatitis: Oligo #259, CCTTTCGCGACCCAACACTA (SEQ ID NO:1), Oligo #260, GCCTTTCGCGACCCAACACT (SEQ ID NO:2), Oligo #270, GTACCACAAGGCCTTTCGCG (SEQ ID NO:3), Oligo #330, GTGCTCATGGTGCACGGTCT (SEQ ID NO:4) and Oligo #340, TTTAGGATTCGTGCTCATGG (SEQ ID NO:5). Another therapeutic area inflammatory diseases mediated by intercellular cell adhesion molecule (ICAM-1). Oligonucleotides having application in the treatment of inflammatory diseases include: ISIS-2302, GCCCAAGCTGGCATCCGTCA (SEQ ID NO:6). Another therapeutic area includes infections caused by cytomegalovirus (CMV). ISIS-2922 is a phosphorothioate oligonucleotide having application in the treatment of CMV retinitis, and has the sequence GCGTTTGCTCTTCTTCTTGCG (SEQ ID NO:7). Another therapeutic area includes cancers mediated by protein kinase C-α(PKC-α). ISIS-3521 is a phosphorothioate oligonucleotide having application in the treatment of such cancers, and has the sequence GTTCTCGCTGGTGAGTTTCA (SEQ ID NO:8). A further therapeutic area includes C-raf kinase-mediated cancers. ISIS-5132 is a phosphorothioate oligonucleotide having application in the treatment of such cancers, and has the sequence TCCCGCCTGTGACATGCATT (SEQ ID NO:9). A still further therapeutic area includes cancers mediated by Ha-ras or Ki-ras. The following phosphorothioate oligonucleotides have application in the treatment of such cancers: ISIS-2503, TCCGTCATCGCTCCTCAGGG (SEQ ID NO:10), ISIS-2570, CCACACCGACGGCGCCC (SEQ ID NO:11), and ISIS-6957, CAGTGCCTGCGCCGCGCTCG (SEQ ID NO:12). In the above sequences, individual nucleotide units of the oligonucleotides are listed in a 5' to 3' direction from left to right.

In the context of this invention, "hybridization" shall mean hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleotide units. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. "Complementary," as used herein, also refers to sequence complementarity between two nucleotide units. For example, if a nucleotide unit at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide unit at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotide units which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood that an oligonucleotide need not be 100% complementary to its target DNA sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when binding of the oligonucleotide to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide to non-target sequences under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays or therapeutic treatment, or in the case of in vitro assays, under conditions in which the assays are performed.

In particular, oligonucleotides of the invention may be used in therapeutics, as diagnostics, and for research as is specified in the following United States patent applications assigned to the assignee of this invention. These applications are entitled: Compositions and Methods for Modulating RNA Activity, Ser. No. 463,358, filed Jan. 11, 1990; Antisense Oligonucleotide Inhibitors of Papilloma Virus, Ser. No. 445,196 Filed Dec. 4, 1989; Oligonucleotide Therapies for Modulating the Effects of Herpesvirus, Ser. No. 485,297, Filed Feb. 26, 1990; Reagents and Methods for Modulating Gene Expression Through RNA Mimicry Ser. No. 497,090, Filed Mar. 21, 1990; Oligonucleotide Modulation of Lipid Metabolism, Ser. No. 516,969, Filed Apr. 30, 1990; Oligonucleotides for Modulating the Effects of Cytomegalovirus Infections, Ser. No. 568,366, Filed Aug. 16, 1990; Antisense Inhibitors of the Human Immunodeficiency Virus, Ser. No. 521,907, Filed May 11, 1990; Nuclease Resistant Pyrimidine Modified Oligonucleotides for Modulation of Gene Expression, Ser. No.558,806, Filed Jul. 27, 1990; Novel Polyamine Conjugated Oligonucleotides, Ser. No. 558,663, Filed Jul. 27, 1990; Modulation of Gene Expression Through Interference with RNA Secondary Structure, Ser. No. 518,929, Filed May 4, 1990; Oligonucleotide Modulation of Cell Adhesion, Ser. No. 567,286, Filed Aug. 14, 1990; Inhibition of Influenza Viruses, Ser. No. 567,287, Filed Aug. 14, 1990; Inhibition of Candida, Ser. No. 568,672, Filed Aug. 16, 1990; and Antisense Oligonucleotide Inhibitors of Papillomavirus, Ser. No. PCT/US90/07067, Filed Dec. 3, 1990. These applications disclose a number of means whereby improved modulation of RNA and DNA activity may be accomplished through oligonucleotide interaction. In that the specific sequences disclosed therein may be used in conjunction with the present invention, the disclosures of the foregoing United States patent applications are incorporated herein by reference.

The following examples are illustrative and are not meant to be limiting of the present invention.


5'-O-(1-thiotriphosphate) deoxynucleosides and ribonucleosides are isolated using C-18 reverse phase high performance liquid chromatography (HPLC) using columns packed with ODS Hypersil (Shandon Southern, Runcon, UK) and eluted with an isocratic mixture of solvent A (30 mM potassium phosphate containing 5 mM tetrabutylammonium ion, pH 7.0) and solvent B (5 mM tetrabutylammonium hydroxide in methanol). Alternatively, effective separation is achieved using 100 mM triethylammonium bicarbonate, pH 7.5, containing a linear gradient of acetonitrile from 0% to 15% over 20 minutes.

To establish the purity of such HPLC separated enantiomers the HPLC separated Sp and Rp deoxynucleotide enantiomers are compared to commercially available deoxynucleoside 5'-O-(1-thiotriphosphates) available from E.I. Dupont, Wilmington, Del.


Enzymatic synthesis of an all Rp phosphorothioate extension of a racemic phosphorothioate oligonucleotide primer is effected using the modified T7 DNA polymerase I, Sequenase™ (U.S. Biochemicals Corp, Cleveland, Ohio.). This T7 DNA polymerase is used to extend an 18 mer phosphorothioate oligonucleotide primer hybridized to a 21-mer natural phosphodiester oligonucleotide. 30 picomoles (pmol) of primer and template in a 1× Sequenase™ reaction buffer (U.S. Biochemicals Corp., Cleveland, Ohio.) (final vol 10 μL) are heated for 5 minutes at 95° C. and slowly cooled to room temperature. 180 pmol of deoxy 5'-[α-35 S]cytidine triphosphate and Sequenase™ enzyme (U.S. Biochemicals Corp., Cleveland, Ohio.) are added and incubated at 37° C. for 20 minutes. The product is analyzed via polyacrylamide gel electrophoresis (PAGE) using a 20% polyacrylamide/7M urea denaturing gel. The autoradiograph of the product is compared to a control reaction absent primer/template. The final product is subjected to further characterization by, for example, enzymatic degradation. One such degradation is snake venom phosphatase degradation. A snake venom phosphatase degradation of dinucleoside monophosphorothioate synthesized using E. coli DNA polymerase I shows the dinucleoside to be of the Rp configuration.


A large scale enzymatic synthesis of sequence specific all Rp phosphorothioate oligonucleotide was effected utilizing a 55-mer natural phosphodiester template and a 41-mer natural phosphodiester primer. The template sequence was GTACTTGCATAGTCGATCGGAAAATAGGGTTCTCATCTCCCGGGATTTGGTTGAG (SEQ ID NO:14). The primer sequence was CTCAACCAAATCCCGGGAGATGAGAACCQTATTTTCCGATC (SEQ ID NO:15). The template was selected to have a sequence complementary to a desired specific CGACTATGCAAGTAC (SEQ ID NO:13) sequence. A Sequenase™ buffer (U.S. Biochemicals Corp., Cleveland, Ohio.) diluted from 5× to 1× was used. The template and primer, both at concentrations of 20 nM are added to 40 μL of this buffer. The template and primer were hybridized at 95° C. for 5 minutes and cooled to room temperature. After cooling the buffer was adjusted to 7 mM DTT. 20 μL of 1:8 diluted Sequenase™ enzyme and 320 μM each of Sp GTPαS, CTPαS, ATPαS and TTPαS were then added. The reaction solution was adjusted to 140 μL with H2 O. It was incubated at 37° C. for 18 hours. The reaction solution was extracted 2× with a like volume of phenol in a standard manner and precipitated in a standard manner by treatment with 2.5 volumes of 100% ethanol at -20° C., peltized, washed with 500 μL of 70% ethanol, peltized again and dried. The precipitate was suspended in 20 μL H2 O for 30 minutes then adjusted to 1 mM CaCl2, 25 mM Tris HCl pH 8.0 in 40 μL H2 O. The solution was maintained at 95° C. for 5 minutes and snap cooled, i.e. very quickly cooled with ice. The template and primer were removed from the synthesized oligonucleotide by the addition of 4.6 μM DNase I and incubation at 37° C. for 10 minutes. The reaction mixture was phenol extracted 2× precipitated with ethanol as above. The precipitate was resuspended in H2 O and purified using 20% polyacrylamide/7M urea gel electrophoresis coupled with SepPak™ chromatography (Millipore, Milford, Mass.).

In an alternate synthesis, Pst 1 restriction nuclease (Life Technologies, Inc., Gaithersburg, Md.) was used to cleave the primer-bound phosphorothioate oligonucleotide at the restriction site. The desired CGACTATGCAAGTAC (SEQ ID NO:13) phosphorothioate oligonucleotide was purified using polyacrylamide/7M urea gel electrophoresis coupled with SepPak™ chromatography (Millipore, Milford, Mass.). Yields were optimized using enzymatic cascade effected by repetitive template-primer addition throughout the reaction. The cascade augmented synthesis yielded 75 A260 units of the CGACTATGCAAGTAC (SEQ ID NO:13) all Rp configuration phosphorothioate oligonucleotide from a 20 mL reaction.


Oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using hydrogenphosphonate chemistry in a standard manner [Agrawal et al., Proc. Natl. Acad. Sci. U.S.A., 85:7079 (1988)]. After the final coupling step, the phosphorothioate linkages are generated by oxidizing the bound oligomer with sulfur in carbon disulfide/triethylamine/ pyridine. After sulfur oxidation, standard deblocking procedures with ammonium hydroxide are used to release the oligonucleotides from the support and remove base blocking groups. The phosphorothioate oligonucleotides are purified by oligonucleotide purification column (OPC; ABI, Foster City, Calif.) chromatography and HPLC, using a Beckman System Gold HPLC. The HPLC-purified oligonucleotides are then precipitated with ethanol and assessed for final purity by gel electrophoresis on 20% acrylamide/7M urea or by analytical HPLC. The authenticity of the oligonucleotide sequence was assessed by oxidation with iodine in pyridine/water and standard sequencing methods. These oligonucleotides contain a mixture of all possible combinations of Rp and Sp isomers at each phosphorous linkage.


The synthesis of short complementary DNA oligonucleotides of natural phosphodiester linkages was performed utilizing standard automated synthesis on an ABI model 380B DNA Synthesizer. The oligonucleotides of correct length were purified by HPLC and sequenced by standard techniques.

T7 RNA polymerase was use for the synthesis of short, complementary RNA oligonucleotides for hybridization analysis. A large amount of T7 RNA polymerase at high concentrations was needed for the many cycles of initiation required to synthesize short RNAs. Due to this requirement, the T7 RNA polymerase was derived from a strain of E. coli that contained a T7 RNA polymerase expression vector, BL21/pAR1219, obtained from Brookhaven National Laboratory (Upton, N.Y.). The isolation yielded approximately 300,000 to 500,000 units of T7 RNA polymerase from 2 L of cells, absorbance value=1.2 A600. This was sufficiently concentrated for synthesis of short (10-30 nucleotides) RNA species. For synthesis, a T7 promoter and a template containing the complementary target sequence and T7 promoter hybridization sequence were synthesized using the ABI synthesizer (ABI, Foster City, Calif.). Template and promoter were purified by HPLC to ensure that the correct species was present for enzymatic synthesis. Synthesized products were purified on a 20% polyacrylamide/8M urea gel and sequenced by standard procedures.


Oligonucleotides (either phosphorothioate oligonucleotides of the invention or otherwise) were incubated with either the complementary DNA or RNA oligonucleotides at a standard concentration of 4 μM for each oligonucleotide in 100 mM ionic strength buffer (89.8 mM NaCl, 10 mM Na-phosphate, pH 7.0, 0.2 mM EDTA). Samples were heated to 90° C. and the initial absorbance taken using a Guilford Response II spectrophotometer (Corning). Samples were then slowly cooled to 15° C. and the change in absorbance at 260 nm monitored during the heat denaturation procedure. The temperature was elevated 1 degree/absorbance reading and the denaturation profile analyzed by taking the first derivative of the melting curve. Data was also analyzed using a two-state linear regression analysis to determine the Tm and delta G. The results of these tests are shown in Table 1.

              TABLE 1______________________________________THERMAL DENATURATIONSequence          SEQ ID NO:                       Complement                                 T.sub.m______________________________________Natural phosphodiesterCGA CTA TGC AAG TAC             13        DNA       53.2CGA CTA TGC AAG TAC             13        RNA       46.2Phosphorothioate with racemicintersugar linkagesCGA CTA TGC AAG TAC             13        DNA       46.0CGA CTA TGC AAG TAC             13        RNA       36.5Phosphorothioate with chirally pureintersugar linkagesCGA CTA TGC AAG TAC             13        DNA       45.5CGA CTA TGC AAG TAC             13        RNA       41.5.sup.  GA CTA TGC AAG TAC             16        DNA       44.5.sup.  GA CTA TGC AAG TAC             16        RNA       40.0______________________________________

Filter binding assays are utilized to quantitate the binding stringencies of various phosphorothioate oligonucleotides, i.e. their tendencies to hybridize and form heteroduplexes with DNA or RNA. These assays require radiolabeled oligonucleotides.

Phosphorothioate oligonucleotides having all Rp intersugar linkages are synthesized by enzymatic methods from [35 S]-monomers that have been purified from Sp monomers. For automated synthesis of phosphorothioate oligonucleotides containing mixed chirality intersugar linkages, oligonucleotides are synthesized containing hydrogen phosphonates and then sulfurized in the presence of elemental [35 S]in a pyridine/carbon disulfide mixture. The resulting radiolabeled phosphorothioate oligonucleotide can be purified by OPC chromatography and HPLC. Target mRNA are applied to nitrocellulose filters and baked at 80° C. for 2 hours, blocked and then hybridized with the radiolabeled phosphorothioate oligonucleotide. Binding stringency is assessed by quantitating radiolabeled oligonucleotide eluted from the filters after increases in temperature or increases in the ionic strength of an eluting buffer, as for instance, Tris NaCl buffer. Eluted oligonucleotides are also assessed for their mobility in an anion exchange HPLC protocol isocratically utilizing phosphate buffer. Results are compared to the mobility of standard oligonucleotides prepared having racemic mixtures of intersugar linkages.


Determination of the rate of nuclease degradation of the phosphorothioate oligonucleotides in media containing 10% fetal calf serum (FCS) was carried out in Dulbecco's Modified Essential Medium (DMEM) containing 10% heat inactivated FCS. Heat inactivation of the FCS was carried out at 55° C. for 1 hour prior to addition to media. Oligonucleotides having racemic and chirally pure intersugar linkages were separately tested for resistance to nuclease digestion. 66 μg/mL of each oligonucleotide were separately added to medium and incubated at 37° C., at the time intervals indicated in Table 2. 15 μL Aliquots were removed and added to 15 μL of 9M urea in 0.1 M Tris-HCl (pH 8.3), 0.1 M boric acid and 2 mM EDTA. Aliquots were mixed by vortex and stored at -20° C. Polyacrylamide gel electrophoresis (PAGE) analysis was on 20% polyacrylamide/7M urea slab gels. Following electrophoresis, gels were stained using "Stains All" (Sigma Chem. Co., St. Louis, Mo.). Following de-staining, gels were analyzed via laser densitometry using an UltraScan XL device (Pharmacia LKB Biotechnology, Uppsala, Sweden). Integrations were performed and the data presented as the percentage decrease from full length (n) prior to incubation to n-1. These results are shown in Table 2 for the oligonucleotide sequence CGACTATGCAAGTAC (SEQ ID NO:6) having Rp chirally pure intersugar linkages.

              TABLE 2______________________________________NUCLEASE DIGESTIONIncubation in 10% fetal calf serumDigestion of oligonucleotide of length n to length n - 1     Phosphorothioate with                    Phosphorothioate with     with racemic intersugar                    chirally pureTime (hours)     linkages       intersugar linkages______________________________________0          0              01         44             102         45             104         54             1224        70             4448        70             62______________________________________

As is evident from Table 2, the phosphorothioate oligonucleotide having substantially chirally pure intersugar linkages showed greater resistance to nuclease degradation than did the phosphorothioate oligonucleotide having racemic intersugar linkages.


Phosphorothioate oligonucleotides having racemic and substantially chirally pure intersugar linkages were analyzed for susceptibility to RNase H. Oligonucleotides (2-fold molar excess to RNA) and 5 μg (3.1 kb) in vitro synthesized mRNA (using T7 RNA polymerase promoter) were incubated in 5 μL RNase H hybridization buffer for 30 minutes at 60° C. Samples were slowly cooled to room temperature and then adjusted to 3.7 mg/mL BSA, 20 units E. coli RNase H (Promega), 142 mM DTT, 150 mM KCl, and 3 mM MgCl2. Samples were incubated for 30 minutes at 37° C. Samples were then extracted with phenol, precipitated with ethanol, and analyzed by electrophoresis on 1.2% agarose gels following ethidium bromide staining. Markers were run on gels concurrently with the samples to determine approximate length of RNA samples.


A patient suffering from hepatitis caused by HCV is treated with Oligo #259 (SEQ ID NO:1), Oligo #260 (SEQ ID NO:2), Oligo #270 (SEQ ID NO:3), Oligo #330 (SEQ ID NO:4) or Oligo #340 (SEQ ID NO:5), each of which are synthesized according to the procedure of Example 3 or Example 19. 1-1000 μg/kg body weight of oligonucleotide is incorporated into a pharmaceutically acceptable carrier and administered intravenously or intramuscularly. Treatment may be repeated as necessary until the disease has been ablated.


A patient suffering from an inflammatory disease mediated by ICAM-1 is treated with ISIS-2302, an oligonucleotide synthesized according to Example 3 or Example 19, and having the sequence GCCCAAGCTGGCATCCGTCA (SEQ ID NO:6). 1-1000 μg/kg body weight of oligonucleotide is incorporated into a pharmaceutically acceptable carrier and administered intravenously or intramuscularly. Treatment may be repeated as necessary until the disease has been ablated.


A patient suffering from retinitis caused by cytomegalovirus is treated with ISIS-2922, an oligonucleotide synthesized according to Example 3 or Example 19, and having the sequence GCGTTTGCTCTTCTTCTTGCG (SEQ ID NO:7). 1-1000 μg/kg body weight of oligonucleotide is incorporated into a pharmaceutically acceptable carrier and administered intravitreally. Treatment may be repeated as necessary until the infection is ablated.


A patient suffering from PKC-α-mediated cancer is treated with ISIS-3521, an oligonucleotide synthesized according to Example 3 or Example 19, and having the sequence GTTCTCGCTGGTGAGTTTCA (SEQ ID NO:8). 1-1000 μg/kg body weight of oligonucleotide is incorporated into a pharmaceutically acceptable carrier and administered intravenously or intramuscularly. Treatment may be repeated as necessary until the disease has been ablated.


A patient suffering from C-raf kinase-mediated cancer is treated with ISIS-5132, an oligonucleotide synthesized according to Example 3 or Example 19, and having the sequence TCCCGCCTGTGACATGCATT (SEQ ID NO:9). 1-1000 μg/kg body weight of oligonucleotide is incorporated into a pharmaceutically acceptable carrier and administered intravenously or intramuscularly. Treatment may be repeated as necessary until the disease has been ablated.


A patient suffering from C-raf kinase-mediated cancer is treated with ISIS-2503 (SEQ ID NO:10), ISIS-2570 (SEQ ID NO:11) or ISIS-6957 (SEQ ID NO:12), each of which are synthesized according to the procedure of Example 3 or Example 19. 1-1000 μg/kg body weight of oligonucleotide is incorporated into a pharmaceutically acceptable carrier and administered intravenously or intramuscularly. Treatment may be repeated as necessary until the disease has been ablated. Compounds 1, 2 and 3 of Examples 16, 17 and 18, respectively, are synthesized according to the procedure of Stec et al. [Nucleic Acids Res., 19:5883 (1991)] and Stec and Lesnikowski [Methods in Molecular Biology, S. Agrawal, Ed., Volume 20, p. 285, 1993].


A mixture of pyridine (1 mol), benzene (400 mL), 2-mercaptoethanol (0.5 mol) and phosphorus trichloride (0.5 mol) are stirred at room temperature for 30 minutes. Pyridinium chloride is filtered off, solvent is evaporated under reduced pressure and crude product is purified by distillation under reduced pressure. The fraction boiling at 70°-72° C./20 mm Hg is collected and characterized by 31 P NMR.


Compound 1 (0.2 mol) is dissolved in n-pentane (300 mL) and diisopropylamine (0.4 mol) is added dropwise. The reaction mixture is stirred at room temperature for 30 minutes, after which diisopropylamine hydrochloride is filtered off, solvent is evaporated under reduced pressure and crude product is purified by vacuum distillation. Product 2 is obtained as the fraction boiling at 70° C./0.1 mm Hg and is characterized by 31 P NMR and mass spectroscopy.


5'-O-Dimethoxytritylthymidine (10 mmol) and 1H-tetrazole (11 mmol) are vacuum dried and dissolved in dichloromethane (25 mL). Compound 2 (11 mmol) is added to the solution and the reaction mixture is stirred at room temperature for 2 hours. Dried elemental sulfur (15 mmol) is added and the reaction mixture is stirred and left at room temperature for 16 hours. Unreacted sulfur is then filtered off and the filtrate is concentrated under reduced pressure. The residue is dissolved in chloroform (3 mL) and purified by silica gel (230-400 mesh) column chromatography, eluting first with chloroform, and next with chloroform:methanol (97:3). Individual diastereomeric species of compound 3 are obtained by column chromatography on silica gel. Compound 3 is dissolved in ethyl acetate and applied on a silica gel 60H column. Ethyl acetate is used as the eluting solvent, and elution is monitored by HPTLC (silica gel 60, ethyl acetate as the developing solvent). Fractions containing separated diastereomers of compound 3 are concentrated under reduced pressure and the residue is characterized by 31 P NMR and HPLC (Lichrospher Si100, 5 μM, ethyl acetate as eluant, flow rate 3 mL/minute). The fast eluting fraction corresponds to the Sp diastereomer, and the slow eluting fraction is the Rp diastereomer.


The procedure of Stec et al. was followed using an Applied Biosystems (Foster City, Calif.) model 380B automated DNA synthesizer. The reaction between a 5'-OH nucleoside and diastereomerically pure nucleoside oxathiaphospholane, such as 3, requires the use of 1,8-diazabicyclo(5.4.0)undec-7-ene (DBU) as the catalyst. Because the commercially available linker used for the attachment of oligonucleotide to support matrix in automated DNA synthesis is unstable to DBU, a modification is required in the linker. A suitable linker for oligonucleotide synthesis via the oxathiaphospholane method is a "succinic-sarcosinyl" linker that is resistant to DBU, and can be hydrolyzed by concentrated ammonium hydroxide at room temperature in less than 1 hour.

(A) Synthesis of 5'-O-dimethoxytritylnucleosides bound to solid matrix via "succinic-sarcosinyl" linker:

(1) N-Fmoc-sarcosine (Bachem Bioscience, Inc., Philadelphia, Pa.) (1.6 mmol) is added to long chain alkyl amine-CPG (LCA-CPG, Sigma, St. Louis, Mo.) (2 g) and dried under vacuum. Anhydrous DMF (5 mL), pyridine (0.5 mL) and DCC (2.4 mmol) are added and the reaction mixture is shaken at room temperature for 12 hours. The solvent is then filtered off and the support is washed with methanol:acetonitrile:pyridine (1:1:1, 3×20 mL). The N-Fmoc protecting group is removed by treating the support with 10 mL of a 10% solution of piperidine in pyridine. N-sarcosinylated LCA-CPG is washed with methanol:acetonitrile:pyridine (1:1:1, 3×20 mL) and dried under vacuum.

(2) 5'-O-Dimethoxytritylnucleoside is added to the sarcosinylated LCA-CPG obtained as described in (1) in the presence of DMF (2 mL), pyridine (0.2 mL) and DCC (50 mg). The reaction mixture is shaken at room temperature for 12 hours and then washed with methanol:acetonitrile:pyridine (1:1:1, 3×20 mL). After drying, the support is treated with N-methylimidazole:THF (1 mL) and acetic anhydride/lutidine (1 mL) for 15 minutes. The support is then washed with methanol:acetonitrile:pyridine (1:1:1, 3×10 mL), followed by acetonitrile (3×10 mL), and then dried under vacuum.

(B) Diastereomerically pure activated nucleosides are subsequently added onto the oligonucleotide attached to the sarcosinyl LCA-CPG support in the presence of a 300-fold molar excess of DBU. The diastereomers of activated nucleosides are separated by column chromatography [silica gel 60H, ethyl acetate is used as the eluting solvent, elution is monitored by HPTLC (silica gel 60, ethyl acetate as the developing solvent)] prior to use in the coupling reaction. The synthetic protocol is shown in Table 3.

              TABLE 3______________________________________Chemical steps for one synthesis cycle                       TimeReagent or solvent             Purpose   (minutes)______________________________________Trichloroacetic acid in             Detritylation                       1.5dichloromethane (2:98)Acetonitrile      Wash      2Activated nucleoside (with             Coupling  10DBU) in acetonitrileAcetonitrile      Wash      2Acetic anhydride/lutidine             Capping   1in THF (1:1:8) andN-methylimidazole in THF(4:21)Acetonitrile      Wash      1______________________________________

The diastereomeric purity of the phosphorothioate oligonucleotide can be determined by 31 P NMR, by HPLC (Lichrospher Si100, 5 μM, ethyl acetate as eluant, flow rate 3 mL/minute), enzymatically or by electrophoretic methods.


The oligonucleotides of the invention may be used for treatment of various disease states. Treatment of a patient diagnosed with a particular disease state comprises administration of an effective dose of the oligonucleotide, in a pharmaceutically accepted formulation, to the patient via an appropriate route. The effective oligonucleotide dose depends on the disease state being treated, the severity of the disease state and the age of the patient being treated. The effective dose of an oligonucleotide may be determined based on its IC50 and is a routine procedure for one of skill in the art. Alternatively, the effective dose of the oligomer may be determined by using the pharmacokinetics software program TopFit. For example, dosage of oligonucleotides may vary from 0.01 μg (for children) to 100 g (for adults) per kg of body weight depending on progression of the disease state. Similarly, the frequency of dosing depends on the progression of the disease state and may vary from once or more daily to once every 20 years.

The route of oligonucleotide administration depends on the disease state being treated. For example, administration of an oligonucleotide to a patient being treated for an inflammatory disorder may be accomplished either via oral or rectal routes. For treatment of a patient afflicted with AIDS, the most effective method of oligonucleotide administration may be an oral route or by subcutaneous injection. Cancers such as breast cancer may be treated via subcutaneous injection, while colon cancer may be treated via oral or rectal administration of the oligonucleotide. Diseases or disorders of the central nervous system may best be treated by intrathecal or intraventricular administration for delivery of the oligonucleotide to the spinal column or the brain of the patient.

Following oligonucleotide administration, the patient may be monitored for alleviation of symptoms associated with the disease state. Subsequently, the dosage may be adjusted (increased or decreased) depending upon the severity and amenability of the disease state to treatment.

It may be preferable to administer oligonucleotides of the invention in combination with other traditional therapeutics. The oligonucleotides may be administered in combination with drugs including, but not limited to, AZT for the treatment of patients afflicted with AIDS, sulfasalazine for the treatment of an inflammatory disorder such as ulcerative colitis, and 5-fluorouracil for the treatment of colon cancer.

Also, it may be desirable to administer maintenance therapy to a patient who has been successfully treated for a disease state. The dosage and frequency of oligonucleotide administration as part of a maintenance regimen may vary from 0.01 μg to 100 g per kg of body weight, ranging from once or more daily to once every several years.


Intraventricular drug administration, for the direct delivery of drug to the brain of a patient, may be desired for the treatment of patients with diseases afflicting the brain. To effect this mode of oligonucleotide administration, a silicon catheter is surgically introduced into a ventricle of the brain of a human patient, and is connected to a subcutaneous infusion pump (Medtronic Inc., Minneapolis, Minn.) that has been surgically implanted in the abdominal region [Cancer Research, 44:1698 (1984)]. The pump is used to inject the oligonucleotides and allows precise dosage adjustments and variation in dosage schedules with the aid of an external programming device. The reservoir capacity of the pump is 18-20 mL and infusion rates may range from 0.1 mL/h to 1 mL/h. Depending on the frequency of administration, ranging from daily to monthly, and the dose of drug to be administered, ranging from 0.01 μg to 100 g per kg of body weight, the pump reservoir may be refilled at 3-10 week intervals. Refilling of the pump is accomplished by percutaneous puncture of the self-sealing septum of the pump.


Intrathecal drug administration for the introduction of drug into the spinal column of a patient may be desired for the treatment of patients with diseases of the central nervous system. To effect this route of oligonucleotide administration, a silicon catheter is surgically implanted into the L3-4 lumbar spinal interspace of a human patient, and is connected to a subcutaneous infusion pump which has been surgically implanted in the upper abdominal region [The Annals of Pharmacotherapy, 27:912 (1993) and Cancer, 41:1270 (1993]. The pump is used to inject the oligonucleotides and allows precise dosage adjustments and variations in dose schedules with the aid of an external programming device. The reservoir capacity of the pump is 18-20 mL, and infusion rates may vary from 0.1 mL/h to 1 mL/h. Depending on the frequency of drug administration, ranging from daily to monthly, and dosage of drug to be administered, ranging from 0.01 μg to 100 g per kg of body weight, the pump reservoir may be refilled at 3-10 week intervals. Refilling of the pump is accomplished by a single percutaneous puncture to the self-sealing septum of the pump.


Claims (18)

What is claimed is:
1. An oligonucleotide represented by SEQ ID NO:10 wherein at least 75% of the nucleoside units are joined together by Sp phosphorothioate 3' to 5' linkages.
2. An oligonucleotide represented by SEQ ID NO:10 wherein at least 75% of the nucleoside units are joined together by Rp phosphorothioate 3' to 5' linkages.
3. The oligonucleotide of claim 1 wherein all of the nucleoside units are joined together by Sp phosphorothioate 3' to 5' linkages.
4. The oligonucleotide of claim 2 wherein all of the nucleoside units are joined together by Rp phosphorothioate 3' to 5' linkages.
5. An oligonucleotide represented by SEQ ID NO:11 wherein at least 75% of the nucleoside units are joined together by Sp phosphorothioate 3' to 5' linkages.
6. An oligonucleotide represented by SEQ ID NO:11 wherein at least 75% of the nucleoside units are joined together by Rp phosphorothioate 3' to 5' linkages.
7. The oligonucleotide of claim 5 wherein all of the nucleoside units are joined together by Sp phosphorothioate 3' to 5' linkages.
8. The oligonucleotide of claim 6 wherein all of the nucleoside units are joined together by Rp phosphorothioate 3' to 5' linkages.
9. An oligonucleotide represented by SEQ ID NO:12 wherein at least 75% of the nucleoside units are joined together by Sp phosphorothioate 3' to 5' linkages.
10. An oligonucleotide represented by SEQ ID NO:12 wherein at least 75% of the nucleoside units are joined together by Rp phosphorothioate 3' to 5' linkages.
11. The oligonucleotide of claim 9 wherein all of the nucleoside units are joined together by Sp phosphorothioate 3' to 5' linkages.
12. The oligonucleotide of claim 10 wherein all of the nucleoside units are joined together by Rp phosphorothioate 3' to 5' linkages.
13. A composition containing an oligonucleotide of claim 1 and an acceptable carrier.
14. A composition containing an oligonucleotide of claim 2 and an acceptable carrier.
15. A composition containing an oligonucleotide of claim 5 and an acceptable carrier.
16. A composition containing an oligonucleotide of claim 6 and an acceptable carrier.
17. A composition containing an oligonucleotide of claim 9 and an acceptable carrier.
18. A composition containing an oligonucleotide of claim 10 and an acceptable carrier.
US08471966 1990-01-11 1995-06-06 Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity Expired - Fee Related US5661134A (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US07777670 US5212295A (en) 1990-01-11 1991-10-15 Monomers for preparation of oligonucleotides having chiral phosphorus linkages
US77700791 true 1991-10-16 1991-10-16
US08058023 US5521302A (en) 1990-01-11 1993-05-05 Process for preparing oligonucleotides having chiral phosphorus linkages
US08297703 US5506212A (en) 1990-01-11 1994-08-29 Oligonucleotides with substantially chirally pure phosphorothioate linkages
US08471966 US5661134A (en) 1991-10-15 1995-06-06 Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US08471966 US5661134A (en) 1991-10-15 1995-06-06 Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity
JP50125497A JPH10510433A (en) 1995-06-06 1996-06-05 Oligonucleotides having phosphorothioate linkages of high chiral purity
AU6252896A AU698739B2 (en) 1995-06-06 1996-06-05 Oligonucleotides having phosphorothioate linkages of high chiral purity
PCT/US1996/008757 WO1996039154A1 (en) 1995-06-06 1996-06-05 Oligonucleotides having phosphorothioate linkages of high chiral purity
KR19977009017A KR100257972B1 (en) 1995-06-06 1996-06-05 Oligonucleotides having phosphorothioate linkages of high chiral purity
EP19960921270 EP0831854A4 (en) 1995-06-06 1996-06-05 Oligonucleotides having phosphorothioate linkages of high chiral purity
CA 2223103 CA2223103A1 (en) 1995-06-06 1996-06-05 Oligonucleotides having phosphorothioate linkages of high chiral purity
NO975558A NO975558A (en) 1995-06-06 1997-12-02 Oligonucleotides with fosfortioatbindinger high chiral purity
JP2000262865A JP2001114798A (en) 1995-06-06 2000-08-31 Oligonucleotide having phosphorothioate bond having high chiral purity
JP2000262871A JP2001103987A (en) 1995-06-06 2000-08-31 Oligonucleotide of high chiral purity bearing phosphorothioate linkage

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US08058023 Continuation-In-Part US5521302A (en) 1990-01-11 1993-05-05 Process for preparing oligonucleotides having chiral phosphorus linkages
US08297703 Continuation-In-Part US5506212A (en) 1990-01-11 1994-08-29 Oligonucleotides with substantially chirally pure phosphorothioate linkages

Publications (1)

Publication Number Publication Date
US5661134A true US5661134A (en) 1997-08-26



Family Applications (1)

Application Number Title Priority Date Filing Date
US08471966 Expired - Fee Related US5661134A (en) 1990-01-11 1995-06-06 Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity

Country Status (1)

Country Link
US (1) US5661134A (en)

Cited By (100)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6083923A (en) * 1997-10-31 2000-07-04 Isis Pharmaceuticals Inc. Liposomal oligonucleotide compositions for modulating RAS gene expression
US6242589B1 (en) 1998-07-14 2001-06-05 Isis Pharmaceuticals, Inc. Phosphorothioate oligonucleotides having modified internucleoside linkages
US6277967B1 (en) 1998-07-14 2001-08-21 Isis Pharmaceuticals, Inc. Carbohydrate or 2′-modified oligonucleotides having alternating internucleoside linkages
US6369209B1 (en) 1999-05-03 2002-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US6407223B1 (en) * 1997-04-25 2002-06-18 Polska Akademia Nauk Cenirum Badan Molekularnych I Makromlekularnych Process for the synthesis of modified P-chiral nucleotide analogues
US6423493B1 (en) 1998-10-26 2002-07-23 Board Of Regents The University Of Texas System Combinatorial selection of oligonucleotide aptamers
US6492111B1 (en) 1998-11-25 2002-12-10 Isis Pharmaceuticals, Inc. In situ binary synthesis of biologically effective molecules
US20030162190A1 (en) * 2001-11-15 2003-08-28 Gorenstein David G. Phosphoromonothioate and phosphorodithioate oligonucleotide aptamer chip for functional proteomics
US20030207841A1 (en) * 1999-02-12 2003-11-06 Sankyo Company Limited Novel nucleoside and oligonucleotide analogues
US20040143114A1 (en) * 1999-07-22 2004-07-22 Sankyo Company, Limited Novel bicyclonucleoside analogues
US20040171028A1 (en) * 1996-06-06 2004-09-02 Baker Brenda F. Phosphorous-linked oligomeric compounds and their use in gene modulation
US20040242521A1 (en) * 1999-10-25 2004-12-02 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US20040265912A1 (en) * 2003-05-23 2004-12-30 Board Of Regents, The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting AP-1 transcription factors
US20050118611A1 (en) * 2003-07-24 2005-06-02 Board Of Regents, The University Of Texas System Thioaptamers enable discovery of physiological pathways and new therapeutic strategies
US20050123939A1 (en) * 2002-10-16 2005-06-09 Board Of Regents, The University Of Texas System Bead bound combinatorial oligonucleoside phosphorothioate and phosphorodithioate aptamer libraries
US20050239134A1 (en) * 2004-04-21 2005-10-27 Board Of Regents, The University Of Texas System Combinatorial selection of phosphorothioate single-stranded DNA aptamers for TGF-beta-1 protein
US20060121489A1 (en) * 2003-05-23 2006-06-08 Board Of Regents, The University Of Texas System High throughput screening of aptamer libraries for specific binding to proteins on viruses and other pathogens
US20060172925A1 (en) * 1998-10-26 2006-08-03 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US7119184B2 (en) 1991-08-12 2006-10-10 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US20060281702A1 (en) * 2005-05-18 2006-12-14 Board Of Regents, The University Of Texas System Combinatorial selection of phosphorothioate aptamers for RNases
USRE39464E1 (en) * 1998-07-14 2007-01-09 Isis Pharmaceuticals Inc. Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages
US20070172948A1 (en) * 2004-06-03 2007-07-26 Balkrishen Bhat Double strand compositions comprising differentially modified strands for use in gene modulation
US20070220629A1 (en) * 2006-03-15 2007-09-20 Exelixis Plant Sciences, Inc. Resistance to auxinic herbicides
US20080268423A1 (en) * 2002-08-16 2008-10-30 Alan Barrett Compositions and Methods Related to Flavivirus Envelope Protein Domain III Antigens
US7695902B2 (en) 1996-06-06 2010-04-13 Isis Pharmaceuticals, Inc. Oligoribonucleotides and ribonucleases for cleaving RNA
US7812149B2 (en) 1996-06-06 2010-10-12 Isis Pharmaceuticals, Inc. 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations
US7884086B2 (en) 2004-09-08 2011-02-08 Isis Pharmaceuticals, Inc. Conjugates for use in hepatocyte free uptake assays
US7964579B2 (en) 1998-05-21 2011-06-21 Isis Pharmaceuticals, Inc. Compositions and methods for topical delivery of oligonucleotides
US8153602B1 (en) 1991-11-19 2012-04-10 Isis Pharmaceuticals, Inc. Composition and methods for the pulmonary delivery of nucleic acids
US8153606B2 (en) 2008-10-03 2012-04-10 Opko Curna, Llc Treatment of apolipoprotein-A1 related diseases by inhibition of natural antisense transcript to apolipoprotein-A1
US8288354B2 (en) 2005-12-28 2012-10-16 The Scripps Research Institute Natural antisense and non-coding RNA transcripts as drug targets
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
US8569474B2 (en) 2004-03-09 2013-10-29 Isis Pharmaceuticals, Inc. Double stranded constructs comprising one or more short strands hybridized to a longer strand
US8604183B2 (en) 2002-11-05 2013-12-10 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
US8791085B2 (en) 2009-05-28 2014-07-29 Curna, Inc. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US8791087B2 (en) 2009-08-21 2014-07-29 Curna, Inc. Treatment of ‘C terminus of HSP70-interacting protein’ (CHIP)related diseases by inhibition of natural antisense transcript to CHIP
US8796443B2 (en) 2008-09-22 2014-08-05 Rxi Pharmaceuticals Corporation Reduced size self-delivering RNAi compounds
US8815818B2 (en) 2008-07-18 2014-08-26 Rxi Pharmaceuticals Corporation Phagocytic cell delivery of RNAI
US8859515B2 (en) 2009-06-24 2014-10-14 Curna, Inc. Treatment of tumor necrosis factor receptor 2 (TNFR2) related diseases by inhibition of natural antisense transcript to TNFR2
US8895527B2 (en) 2009-05-22 2014-11-25 Curna, Inc. Treatment of transcription factor E3 (TFE3) and insulin receptor substrate 2(IRS2) related diseases by inhibition of natural antisense transcript to TFE3
US8895528B2 (en) 2010-05-26 2014-11-25 Curna, Inc. Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
US8912157B2 (en) 2010-01-06 2014-12-16 Curna, Inc. Treatment of pancreatic developmental gene related diseases by inhibition of natural antisense transcript to a pancreatic developmental gene
US8921329B2 (en) 2008-12-04 2014-12-30 Curna, Inc. Treatment of erythropoietin (EPO) related diseases by inhibition of natural antisense transcript to EPO
US8921330B2 (en) 2009-06-26 2014-12-30 Curna, Inc. Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
US8921334B2 (en) 2009-12-29 2014-12-30 Curna, Inc. Treatment of nuclear respiratory factor 1 (NRF1) related diseases by inhibition of natural antisense transcript to NRF1
US8927511B2 (en) 2008-12-04 2015-01-06 Curna, Inc. Treatment of vascular endothelial growth factor (VEGF) related diseases by inhibition of natural antisense transcript to VEGF
US8940708B2 (en) 2009-12-23 2015-01-27 Curna, Inc. Treatment of hepatocyte growth factor (HGF) related diseases by inhibition of natural antisense transcript to HGF
US8946182B2 (en) 2010-01-25 2015-02-03 Curna, Inc. Treatment of RNASE H1 related diseases by inhibition of natural antisense transcript to RNASE H1
US8946181B2 (en) 2010-01-04 2015-02-03 Curna, Inc. Treatment of interferon regulatory factor 8 (IRF8) related diseases by inhibition of natural antisense transcript to IRF8
US8951981B2 (en) 2009-06-16 2015-02-10 Curna, Inc. Treatment of paraoxonase 1 (PON1) related diseases by inhibition of natural antisense transcript to PON1
US8957037B2 (en) 2009-05-18 2015-02-17 Curna, Inc. Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
US8962586B2 (en) 2010-02-22 2015-02-24 Curna, Inc. Treatment of pyrroline-5-carboxylate reductase 1 (PYCR1) related diseases by inhibition of natural antisense transcript to PYCR1
US8962585B2 (en) 2009-12-29 2015-02-24 Curna, Inc. Treatment of tumor protein 63 (p63) related diseases by inhibition of natural antisense transcript to p63
US8980856B2 (en) 2010-04-02 2015-03-17 Curna, Inc. Treatment of colony-stimulating factor 3 (CSF3) related diseases by inhibition of natural antisense transcript to CSF3
US8980860B2 (en) 2010-07-14 2015-03-17 Curna, Inc. Treatment of discs large homolog (DLG) related diseases by inhibition of natural antisense transcript to DLG
US8980857B2 (en) 2010-05-14 2015-03-17 Curna, Inc. Treatment of PAR4 related diseases by inhibition of natural antisense transcript to PAR4
US8980858B2 (en) 2010-05-26 2015-03-17 Curna, Inc. Treatment of methionine sulfoxide reductase a (MSRA) related diseases by inhibition of natural antisense transcript to MSRA
US8987225B2 (en) 2010-11-23 2015-03-24 Curna, Inc. Treatment of NANOG related diseases by inhibition of natural antisense transcript to NANOG
US8993533B2 (en) 2010-10-06 2015-03-31 Curna, Inc. Treatment of sialidase 4 (NEU4) related diseases by inhibition of natural antisense transcript to NEU4
US9012139B2 (en) 2009-05-08 2015-04-21 Curna, Inc. Treatment of dystrophin family related diseases by inhibition of natural antisense transcript to DMD family
US9023822B2 (en) 2009-08-25 2015-05-05 Curna, Inc. Treatment of 'IQ motif containing GTPase activating protein' (IQGAP) related diseases by inhibition of natural antisense transcript to IQGAP
US9044494B2 (en) 2010-04-09 2015-06-02 Curna, Inc. Treatment of fibroblast growth factor 21 (FGF21) related diseases by inhibition of natural antisense transcript to FGF21
US9044493B2 (en) 2009-08-11 2015-06-02 Curna, Inc. Treatment of Adiponectin related diseases by inhibition of natural antisense transcript to an Adiponectin
US9068183B2 (en) 2009-12-23 2015-06-30 Curna, Inc. Treatment of uncoupling protein 2 (UCP2) related diseases by inhibition of natural antisense transcript to UCP2
US9074210B2 (en) 2009-02-12 2015-07-07 Curna, Inc. Treatment of brain derived neurotrophic factor (BDNF) related diseases by inhibition of natural antisense transcript to BDNF
US9080171B2 (en) 2010-03-24 2015-07-14 RXi Parmaceuticals Corporation Reduced size self-delivering RNAi compounds
US9089588B2 (en) 2010-05-03 2015-07-28 Curna, Inc. Treatment of sirtuin (SIRT) related diseases by inhibition of natural antisense transcript to a sirtuin (SIRT)
US9096636B2 (en) 1996-06-06 2015-08-04 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
US9155754B2 (en) 2009-05-06 2015-10-13 Curna, Inc. Treatment of ABCA1 gene related diseases by inhibition of a natural antisense transcript to ABCA1
US9163285B2 (en) 2009-05-06 2015-10-20 Curna, Inc. Treatment of tristetraproline (TTP) related diseases by inhibition of natural antisense transcript to TTP
US9173895B2 (en) 2009-12-16 2015-11-03 Curna, Inc. Treatment of membrane bound transcription factor peptidase, site 1 (MBTPS1) related diseases by inhibition of natural antisense transcript to MBTPS1
US9200277B2 (en) 2010-01-11 2015-12-01 Curna, Inc. Treatment of sex hormone binding globulin (SHBG) related diseases by inhibition of natural antisense transcript to SHBG
US9222088B2 (en) 2010-10-22 2015-12-29 Curna, Inc. Treatment of alpha-L-iduronidase (IDUA) related diseases by inhibition of natural antisense transcript to IDUA
US9234199B2 (en) 2009-08-05 2016-01-12 Curna, Inc. Treatment of insulin gene (INS) related diseases by inhibition of natural antisense transcript to an insulin gene (INS)
US9328346B2 (en) 2010-11-12 2016-05-03 The General Hospital Corporation Polycomb-associated non-coding RNAs
US9340786B2 (en) 2010-03-24 2016-05-17 Rxi Pharmaceuticals Corporation RNA interference in dermal and fibrotic indications
US9394333B2 (en) 2008-12-02 2016-07-19 Wave Life Sciences Japan Method for the synthesis of phosphorus atom modified nucleic acids
US9464287B2 (en) 2009-03-16 2016-10-11 Curna, Inc. Treatment of nuclear factor (erythroid-derived 2)-like 2 (NRF2) related diseases by inhibition of natural antisense transcript to NRF2
US9580708B2 (en) 2011-09-14 2017-02-28 Rana Therapeutics, Inc. Multimeric oligonucleotides compounds
US9593330B2 (en) 2011-06-09 2017-03-14 Curna, Inc. Treatment of frataxin (FXN) related diseases by inhibition of natural antisense transcript to FXN
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9677074B2 (en) 2009-12-31 2017-06-13 Curna, Inc. Treatment of insulin receptor substrate 2 (IRS2) related diseases by inhibition of natural antisense transcript to IRS2 and transcription factor E3 (TFE3)
US9708604B2 (en) 2009-03-17 2017-07-18 Curna, Inc. Treatment of delta-like 1 homolog (DLK1) related diseases by inhibition of natural antisense transcript to DLK1
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
US9771579B2 (en) 2010-06-23 2017-09-26 Curna, Inc. Treatment of sodium channel, voltage-gated, alpha subunit (SCNA) related diseases by inhibition of natural antisense transcript to SCNA
US9790494B2 (en) 2012-09-14 2017-10-17 Translate Bio Ma, Inc. Multimeric oligonucleotide compounds having non-nucleotide based cleavable linkers
US9920317B2 (en) 2010-11-12 2018-03-20 The General Hospital Corporation Polycomb-associated non-coding RNAs
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US10000752B2 (en) 2010-11-18 2018-06-19 Curna, Inc. Antagonat compositions and methods of use
US10058623B2 (en) 2012-05-16 2018-08-28 Translate Bio Ma, Inc. Compositions and methods for modulating UTRN expression
US10059941B2 (en) 2012-05-16 2018-08-28 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
US10113166B2 (en) 2009-09-25 2018-10-30 Curna, Inc. Treatment of filaggrin (FLG) related diseases by modulation of FLG expression and activity
US10131904B2 (en) 2008-02-11 2018-11-20 Rxi Pharmaceuticals Corporation Modified RNAi polynucleotides and uses thereof
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10174315B2 (en) 2013-05-16 2019-01-08 The General Hospital Corporation Compositions and methods for modulating hemoglobin gene family expression

Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3336289A (en) * 1965-09-20 1967-08-15 Upjohn Co 9-beta-d-ribofuranosyl-7-deazapurine 5'-phosphate esters
US3687808A (en) * 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US3792039A (en) * 1971-12-27 1974-02-12 Miles Lab Poly 2'-fluoro-2'-deoxyuridylic acid
US3846402A (en) * 1971-05-06 1974-11-05 Max Planck Gesellschaft Thiophosphate analogues of the nucleoside diphosphates and triphosphates and a method for the preparation thereof
US4310662A (en) * 1979-12-26 1982-01-12 Genentech, Inc. Nucleosidic phosphorylating agent and methods
US4500707A (en) * 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US4591614A (en) * 1983-10-07 1986-05-27 The Johns Hopkins University Preparation of oligodeoxyribonucleoside alkyl or arylphosphonates
US4663446A (en) * 1983-06-27 1987-05-05 Trustees Of The Univ. Of Massachusetts N2 (phenyl substituted) deoxy guanosine containing compounds
WO1989003683A1 (en) * 1987-10-22 1989-05-05 Temple University Of The Commonwealth System Of Hi 2',5'-phosphorothioate oligoadenylates and antiviral uses thereof
WO1991008313A1 (en) * 1989-12-04 1991-06-13 Isis Pharmaceuticals, Inc. Antisense oligonucleotide inhibition of papillomavirus
US5138045A (en) * 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
EP0506242A1 (en) * 1991-03-06 1992-09-30 POLISH ACADEMY OF SCIENCES, Center of Molecular and Macromolecular Studies Method and compounds for solid phase synthesis of oligonucleotides and oligonucleotide analogs
US5166195A (en) * 1990-05-11 1992-11-24 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus phosphorothioate oligonucleotides
US5212295A (en) * 1990-01-11 1993-05-18 Isis Pharmaceuticals Monomers for preparation of oligonucleotides having chiral phosphorus linkages
US5248670A (en) * 1990-02-26 1993-09-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides for inhibiting herpesviruses

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3336289A (en) * 1965-09-20 1967-08-15 Upjohn Co 9-beta-d-ribofuranosyl-7-deazapurine 5'-phosphate esters
US3687808A (en) * 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US3846402A (en) * 1971-05-06 1974-11-05 Max Planck Gesellschaft Thiophosphate analogues of the nucleoside diphosphates and triphosphates and a method for the preparation thereof
US3792039A (en) * 1971-12-27 1974-02-12 Miles Lab Poly 2'-fluoro-2'-deoxyuridylic acid
US4310662A (en) * 1979-12-26 1982-01-12 Genentech, Inc. Nucleosidic phosphorylating agent and methods
US4500707A (en) * 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US4663446A (en) * 1983-06-27 1987-05-05 Trustees Of The Univ. Of Massachusetts N2 (phenyl substituted) deoxy guanosine containing compounds
US4591614A (en) * 1983-10-07 1986-05-27 The Johns Hopkins University Preparation of oligodeoxyribonucleoside alkyl or arylphosphonates
WO1989003683A1 (en) * 1987-10-22 1989-05-05 Temple University Of The Commonwealth System Of Hi 2',5'-phosphorothioate oligoadenylates and antiviral uses thereof
WO1991008313A1 (en) * 1989-12-04 1991-06-13 Isis Pharmaceuticals, Inc. Antisense oligonucleotide inhibition of papillomavirus
US5212295A (en) * 1990-01-11 1993-05-18 Isis Pharmaceuticals Monomers for preparation of oligonucleotides having chiral phosphorus linkages
US5248670A (en) * 1990-02-26 1993-09-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides for inhibiting herpesviruses
US5166195A (en) * 1990-05-11 1992-11-24 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus phosphorothioate oligonucleotides
US5138045A (en) * 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
EP0506242A1 (en) * 1991-03-06 1992-09-30 POLISH ACADEMY OF SCIENCES, Center of Molecular and Macromolecular Studies Method and compounds for solid phase synthesis of oligonucleotides and oligonucleotide analogs

Non-Patent Citations (152)

* Cited by examiner, † Cited by third party
Agrawal, S., et al., "Oligodeoxynucleoside Phosphoramidates and Phosphorothioates as Inhibitors of Human Immunodeficiency Virus", PNAS USA 1988, 85, 7079-7083.
Agrawal, S., et al., Oligodeoxynucleoside Phosphoramidates and Phosphorothioates as Inhibitors of Human Immunodeficiency Virus , PNAS USA 1988, 85, 7079 7083. *
Brody, R. and Frey, P., "Unambiguous determination of the stereochemistry of nucleotidyl transfer catalyzed by DNA polymerase I from escherichia coli", Biochemistry 1981, 20, 1245-1252.
Brody, R. and Frey, P., Unambiguous determination of the stereochemistry of nucleotidyl transfer catalyzed by DNA polymerase I from escherichia coli , Biochemistry 1981, 20, 1245 1252. *
Brody, R. et al., "Stereochemical course of nucleotidyl catalyzed by bacteriophage T7 induced DNA polymerase", Biochemistry 1982, 21, 2570-2572.
Brody, R. et al., Stereochemical course of nucleotidyl catalyzed by bacteriophage T7 induced DNA polymerase , Biochemistry 1982, 21, 2570 2572. *
Bryant, F. and Benkovic, S., "Stereochemical course of the reaction catalyzed by 5'-nucleotide phosphodiesterase from snake venom", Biochemistry 1979, 2825-2628.
Bryant, F. and Benkovic, S., Stereochemical course of the reaction catalyzed by 5 nucleotide phosphodiesterase from snake venom , Biochemistry 1979, 2825 2628. *
Burgers, P. and Eckstein, F., "A study of the mechanism of DNA polymerase I from escherichia coli with diastereomeric phosphorothioate analogs of deoxyadenosine triphosphate", J. of Biological Chemistry 1979, 254(15), 6889-6893.
Burgers, P. and Eckstein, F., "Absolute configuration of the diastereomers of adenosine 5'-O-(1-thiotriphosphate): Consequences for the stereochemistry of polymerization by DNA-dependent RNA polymerase from Escherichia coli", Proc. Natl. Acad. Sci. USA 1978, 75(10), 4798-4800.
Burgers, P. and Eckstein, F., A study of the mechanism of DNA polymerase I from escherichia coli with diastereomeric phosphorothioate analogs of deoxyadenosine triphosphate , J. of Biological Chemistry 1979, 254(15), 6889 6893. *
Burgers, P. and Eckstein, F., Absolute configuration of the diastereomers of adenosine 5 O (1 thiotriphosphate): Consequences for the stereochemistry of polymerization by DNA dependent RNA polymerase from Escherichia coli , Proc. Natl. Acad. Sci. USA 1978, 75(10), 4798 4800. *
Cohen, J., "Oligonucleotides Inhibitors of Gene Expression", CRC Press, Boca Raton, FL, 1989, pp. 7-116, 137-210.
Cohen, J., Oligonucleotides Inhibitors of Gene Expression , CRC Press, Boca Raton, FL, 1989, pp. 7 116, 137 210. *
Cruse et al., "Chiral Phosphorothioate Analogues of B-DNA", J. Mol. Biol. 1986, 192, 891-905.
Cruse et al., Chiral Phosphorothioate Analogues of B DNA , J. Mol. Biol. 1986, 192, 891 905. *
Dagle et al., "Pathways of Degradation and Mechanism of Action of Antisense Oligonucleotides in Xenopus laevis Embryos", Antisense Res. and Dev. 1991, 1, 11-20.
Dagle et al., "Physical properties of oligonucleotides containing phosphoramidate-modified internucleoside linkages", Nucleic Acids Res. 1991, 19, 1805-1810.
Dagle et al., "Targeted degradation of mRNA in Xenopus oocytes and embryos directed by modified oligonucleotides: studies of An2 and cyclin in embyrogenesis", Nucleic Acids Res. 1990, 18, 4751-4757.
Dagle et al., Pathways of Degradation and Mechanism of Action of Antisense Oligonucleotides in Xenopus laevis Embryos , Antisense Res. and Dev. 1991, 1, 11 20. *
Dagle et al., Physical properties of oligonucleotides containing phosphoramidate modified internucleoside linkages , Nucleic Acids Res. 1991, 19, 1805 1810. *
Dagle et al., Targeted degradation of mRNA in Xenopus oocytes and embryos directed by modified oligonucleotides: studies of An2 and cyclin in embyrogenesis , Nucleic Acids Res. 1990, 18, 4751 4757. *
Daluge et al., "Synthesis and Antimicrobial Activity of a Carbocyclic Puromycin Analog-6-Dimethylamino-9-{R-[2r-hydroxy-3R-(p-methoxyphenyl-L-alanylamino)]-cyclopentyl}purine", J. of Medicinal Chem. 1971, 14, 820-823.
Daluge et al., Synthesis and Antimicrobial Activity of a Carbocyclic Puromycin Analog 6 Dimethylamino 9 R 2r hydroxy 3R (p methoxyphenyl L alanylamino) cyclopentyl purine , J. of Medicinal Chem. 1971, 14, 820 823. *
Doerr and Fox, "Nucleosides. XL. The Introduction of a 2,3'-Imino Bridge into Pyrimidine Nucleosides", J. Am. Chem. 1967, 89, 1760-1761.
Doerr and Fox, Nucleosides. XL. The Introduction of a 2,3 Imino Bridge into Pyrimidine Nucleosides , J. Am. Chem. 1967, 89, 1760 1761. *
Eckstein, F and Jovin, T.M., "Assignment of Resonances in the Phosphorus-31 Nuclear Magnetic Resonance Spectrum of Poly[d(A-T)] from Phosphorothioate Substitution", Biochemistry 1983, 2, 4546-4550.
Eckstein, F and Jovin, T.M., Assignment of Resonances in the Phosphorus 31 Nuclear Magnetic Resonance Spectrum of Poly d(A T) from Phosphorothioate Substitution , Biochemistry 1983, 2, 4546 4550. *
Eckstein, F., "Nucleoside Phosphorothioates", J. Am. Chem. Soc. 1966, 88, 4292.
Eckstein, F., "Nucleoside Phosphorothioates", J. Am. Chem. Soc. 1970, 92, 4718-4723.
Eckstein, F., Nucleoside Phosphorothioates , J. Am. Chem. Soc. 1966, 88, 4292. *
Eckstein, F., Nucleoside Phosphorothioates , J. Am. Chem. Soc. 1970, 92, 4718 4723. *
Eder, P.S. and Walder, J.A., "Ribonuclease H from K562 Human Erythroleukemia Cells", The J. of Biol. Chem. 1991, 266(10), 6472-6479.
Eder, P.S. and Walder, J.A., Ribonuclease H from K562 Human Erythroleukemia Cells , The J. of Biol. Chem. 1991, 266(10), 6472 6479. *
Ettinger, L. et al., "Intrathecal Methotrexate Overdose Without Neurotoxicity", Cancer 1978, 41, 1270-1273.
Ettinger, L. et al., Intrathecal Methotrexate Overdose Without Neurotoxicity , Cancer 1978, 41, 1270 1273. *
Follmann, H. and Hogenkamp, "Interaction of Ribonucleotide Reductase with Ribonucleotide Analogs", Biochemistry 1971, 10, 186-187.
Follmann, H. and Hogenkamp, Interaction of Ribonucleotide Reductase with Ribonucleotide Analogs , Biochemistry 1971, 10, 186 187. *
Fuji, et al., "Acylphosphonates. 7.1 A New Method for Stereospecific and Stereoselective Generation of Dideoxyribonucleoside Phosphorothioates via the Acylphosphonate Intermediates", Tetrahedron 1987, 43, 3395-3407.
Fuji, et al., Acylphosphonates. 7. 1 A New Method for Stereospecific and Stereoselective Generation of Dideoxyribonucleoside Phosphorothioates via the Acylphosphonate Intermediates , Tetrahedron 1987, 43, 3395 3407. *
Goodchild, "Conjugates of Oligonucleotides and Modified Oligonucleotides: A Review of Their Synthesis and Properties", Bioconjugate Chem. 1990, 1, 165-187.
Goodchild, Conjugates of Oligonucleotides and Modified Oligonucleotides: A Review of Their Synthesis and Properties , Bioconjugate Chem. 1990, 1, 165 187. *
Goodman, L. and Hubert Habart, M., The Direct Formation of a 3 , 5 Cyclic Mononucleotide from an Adenine Nucleoside , Chem. Commun. 1969, 740 741. *
Goodman, L. and Hubert-Habart, M., "The Direct Formation of a 3', 5'-Cyclic Mononucleotide from an Adenine Nucleoside", Chem. Commun. 1969, 740-741.
Guga, P. and Okruszek, A., "Stereospecific conversion of p-chiral nucleoside phosphorothioates", Tetrahedron Letters 1984, 25, 2897-2900.
Guga, P. and Okruszek, A., Stereospecific conversion of p chiral nucleoside phosphorothioates , Tetrahedron Letters 1984, 25, 2897 2900. *
Gupta, et al., "Template-Primer-Dependent Turnover of (Sp)-dATP S by T4 DNA Polymerase", J. Bio. Chem. 1982, 247, 7689-7692.
Gupta, et al., Template Primer Dependent Turnover of (Sp) dATP S by T4 DNA Polymerase , J. Bio. Chem. 1982, 247, 7689 7692. *
Haga, K. et al., "The preparation of halo-nucleosides", Bull. of the Chem. Soc. Jpn. 1970, 43, 3922-3924.
Haga, K. et al., The preparation of halo nucleosides , Bull. of the Chem. Soc. Jpn. 1970, 43, 3922 3924. *
Henthorn, P., "Expression of a human placental alkaline phosphatase gene in transfected cells: use as a reporter for studies of gene expression", Proc. Natl. Acad. Sci. USA 1988, 85, 6342-6346.
Henthorn, P., Expression of a human placental alkaline phosphatase gene in transfected cells: use as a reporter for studies of gene expression , Proc. Natl. Acad. Sci. USA 1988, 85, 6342 6346. *
Holy, A. and Sorm, F., "Oligonucleotidic compounds. XXXII. Phosphorylation of 1-xofuranosyl, 1-xylofuranosyl, and 1-arabinofuranosyl derivatives of uracil and thymine with triethyl phosphite and hexachloroacetone", Collection Czechoslov. Chem. Commun. 1969, 34, 1929-1953.
Holy, A. and Sorm, F., Oligonucleotidic compounds. XXXII. Phosphorylation of 1 xofuranosyl, 1 xylofuranosyl, and 1 arabinofuranosyl derivatives of uracil and thymine with triethyl phosphite and hexachloroacetone , Collection Czechoslov. Chem. Commun. 1969, 34, 1929 1953. *
Holy, A., "Nucleic acid components and their analogues. IC. synthesis of 6-azauridine 5'-methanephosphonate and 6-azauridine 2'(3')-methanephosphonate", Collection Czechoslov. Chem. Commun. 1967, 32, 3713-3718.
Holy, A., Nucleic acid components and their analogues. IC. synthesis of 6 azauridine 5 methanephosphonate and 6 azauridine 2 (3 ) methanephosphonate , Collection Czechoslov. Chem. Commun. 1967, 32, 3713 3718. *
Ikehara et al., "Purine Cyclonucleosides-8 Selective Sulfonylation of 8-Bromoadenosine Derivatives and an Alternate Synthesis of 8,2'-and 8,3'-S-Cyclonucleosides", Tetrahedron 1970, 26, 4251-4259.
Ikehara et al., Purine Cyclonucleosides 8 Selective Sulfonylation of 8 Bromoadenosine Derivatives and an Alternate Synthesis of 8,2 and 8,3 S Cyclonucleosides , Tetrahedron 1970, 26, 4251 4259. *
J a ger, A. et al., Oligonucleotide N alkylphosphoramidates: Synthesis and binding to polynucleotides , Biochemistry 1988, 27, 7237 7246. *
Jager, A. et al., "Oligonucleotide N-alkylphosphoramidates: Synthesis and binding to polynucleotides", Biochemistry 1988, 27, 7237-7246.
Jarvest, R.L. and Lowe, G., "Synthesis of methyl (R)-and (S)-[18 O]phosphorothioates and determination of the absolute configuration at phosphorous of the diasteroisomers of adenosine 5'-(1-thiotriphosphate)", J.C.S. Chem. Comm. 1979, 364-366.
Jarvest, R.L. and Lowe, G., Synthesis of methyl (R) and (S) 18 O phosphorothioates and determination of the absolute configuration at phosphorous of the diasteroisomers of adenosine 5 (1 thiotriphosphate) , J.C.S. Chem. Comm. 1979, 364 366. *
Kondo, K. et al., "Studies on biologically active nucleosides and nucleotides.3. synthesis of 9-(3-bromo-3-deoxy-2,5-di-O-acetyl-B-D-xylofuranosyl) adenine", J. Org. Chem. 1977, 42(24), 3957-3958.
Kondo, K. et al., Studies on biologically active nucleosides and nucleotides.3. synthesis of 9 (3 bromo 3 deoxy 2,5 di O acetyl B D xylofuranosyl) adenine , J. Org. Chem. 1977, 42(24), 3957 3958. *
Koole, L.H. et al., "Enhanced stability of a Watson & Crick DNA duplex structure by methylation of the phosphate groups in one strand", Proc. K. Ned. Acad. Wet. 1987, 90(1), 41-46.
Koole, L.H. et al., Enhanced stability of a Watson & Crick DNA duplex structure by methylation of the phosphate groups in one strand , Proc. K. Ned. Acad. Wet. 1987, 90(1), 41 46. *
Lee, Choongeun and Suhadolnik, Robert J., "2', 5'-Oligoadenylates Chiral at Phosphorous: Enzymatic Synthesis, Properties, and Biological Activities of 2', 5'-Phosphorothioate Trimer and Tetramer Analogues Synthesized from (Sp)-ATPαS", Biochemistry 1985, 24(3), 551-555.
Lee, Choongeun and Suhadolnik, Robert J., 2 , 5 Oligoadenylates Chiral at Phosphorous: Enzymatic Synthesis, Properties, and Biological Activities of 2 , 5 Phosphorothioate Trimer and Tetramer Analogues Synthesized from (Sp) ATP S , Biochemistry 1985, 24(3), 551 555. *
Lee, W.W. et al., "Xylo-and Arabinofuranosylthioguanine and Related Nucleosides Derived from 2-Acetamido-6-chloropurine", J. of Medicinal Chem. 1971, 14, 820-823.
Lee, W.W. et al., Xylo and Arabinofuranosylthioguanine and Related Nucleosides Derived from 2 Acetamido 6 chloropurine , J. of Medicinal Chem. 1971, 14, 820 823. *
Lesnikowski, et al., "Octa(thymidine methanephosphonates) of partially defined stereochemistry: synthesis and effect of chirality at phosphorous on binding to pentadecadeoxyriboadenylic acid", Nucleic Acids Res. 1990, 18(8), 2109-2115.
Lesnikowski, et al., Octa(thymidine methanephosphonates) of partially defined stereochemistry: synthesis and effect of chirality at phosphorous on binding to pentadecadeoxyriboadenylic acid , Nucleic Acids Res. 1990, 18(8), 2109 2115. *
Letsinger et al., "Effects of pendant groups at phosphorous on binding properties of d-ApA analogues", Nucleic Acids Res. 1986, 14, 3487-3499.
Letsinger et al., Effects of pendant groups at phosphorous on binding properties of d ApA analogues , Nucleic Acids Res. 1986, 14, 3487 3499. *
Letters, R. et al., "O2, 3'-Cyclouridine", J. Chem. Soc. 1961, 1410-1413.
Letters, R. et al., O 2 , 3 Cyclouridine , J. Chem. Soc. 1961, 1410 1413. *
Lichtenthaler, F.W. et al., Chem. Ber. 1969, 102, 964. *
Ludwig, J. and Eckstein, F., "Rapid and efficient synthesis of nucleoside 5'-O-(1-thiotriphosphates), 5'-triphosphates and 2', 3'-cyclophosphorothioates using 2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one", J. Org. Chem. 1989, 54, 631-635.
Ludwig, J. and Eckstein, F., Rapid and efficient synthesis of nucleoside 5 O (1 thiotriphosphates), 5 triphosphates and 2 , 3 cyclophosphorothioates using 2 chloro 4H 1,3,2 benzodioxaphosphorin 4 one , J. Org. Chem. 1989, 54, 631 635. *
Luer, M. and Hatton, "Vancomycin Administration into the Cerebrospinal Fluid: A Review", The Annals of Pharmacotherapy 1993, 27, 912-921.
Luer, M. and Hatton, Vancomycin Administration into the Cerebrospinal Fluid: A Review , The Annals of Pharmacotherapy 1993, 27, 912 921. *
Marcus Sekura, C.J. et al., Comparative inhibition of chloramphenicol acetyltransferase gene expression by antisense oligonucleotide analogues having alkyl phosphotriester, methylphosphonate and phosphorothioate linkages , Nucleic Acids Research, 1987, 15, 5749 5763. *
Marcus-Sekura, C.J. et al., "Comparative inhibition of chloramphenicol acetyltransferase gene expression by antisense oligonucleotide analogues having alkyl phosphotriester, methylphosphonate and phosphorothioate linkages", Nucleic Acids Research, 1987, 15, 5749-5763.
Marumoto, R. et al., "One-Step Halogenation at the 2'-Position of Uridine, and Related Reactions of Cytidine and N4 -Acetylcytidine", Chem.Pharm.Bull. 1974, 22, 128-134.
Marumoto, R. et al., One Step Halogenation at the 2 Position of Uridine, and Related Reactions of Cytidine and N 4 Acetylcytidine , Chem.Pharm.Bull. 1974, 22, 128 134. *
Miller, N. et al., "Nucleosides. XXI. Synthesis of Some 3'-Substituted 2', 3'-Dideoxyribonucleosides of Thymine and 5-Methylcytosine", J. Org. Chem. 1964, 29, 1772-1776.
Miller, N. et al., Nucleosides. XXI. Synthesis of Some 3 Substituted 2 , 3 Dideoxyribonucleosides of Thymine and 5 Methylcytosine , J. Org. Chem. 1964, 29, 1772 1776. *
Miller, P.S. et al., "Biochemical and Biological Effects of Nonionic Nucleic Acid Methylphosphonates", Biochemistry 1981, 20, 1874-1880.
Miller, P.S. et al., Biochemical and Biological Effects of Nonionic Nucleic Acid Methylphosphonates , Biochemistry 1981, 20, 1874 1880. *
Minshull and Hunt, "The Use of Single-stranded DNA and RNase H to Promote Quantitative Hybrid Arrest of Translation of mRNA/DNA Hybrids in Reticulocyte Lysate Cell-free Translation", Nucleic Acids Res. 1986, 14, 6433-6451.
Minshull and Hunt, The Use of Single stranded DNA and RNase H to Promote Quantitative Hybrid Arrest of Translation of mRNA/DNA Hybrids in Reticulocyte Lysate Cell free Translation , Nucleic Acids Res. 1986, 14, 6433 6451. *
Mizuno, Y. et al., "A Novel Synthesis of Purine β-D-Nucleosides via Purine 8,5'-S-Anhydronucleosides", J.Am.Chem. Soc. 1972, 94, 4737-4739.
Mizuno, Y. et al., "Syntheses of Potential Antimetabolites. XV. Syntheses of a Sulfonate Analog of Adenosine 5'-Phosphate and an Alternative Synthesis of 5', 8-S-Anhydroadenine Nucleosides and 5'-Deoxyspongoadenosine and Its Isomers", J. Org. Chem. 1974, 39, 1440-1444.
Mizuno, Y. et al., A Novel Synthesis of Purine D Nucleosides via Purine 8,5 S Anhydronucleosides , J.Am.Chem. Soc. 1972, 94, 4737 4739. *
Mizuno, Y. et al., Syntheses of Potential Antimetabolites. XV. Syntheses of a Sulfonate Analog of Adenosine 5 Phosphate and an Alternative Synthesis of 5 , 8 S Anhydroadenine Nucleosides and 5 Deoxyspongoadenosine and Its Isomers , J. Org. Chem. 1974, 39, 1440 1444. *
Murray, A.W. et al., "Adenosine 5'-Phosphorothioate. A Nucleotide Analog That Is a Substrate, Competitive Inhibitor, or Regulator of Some Enzymes That Interact with Adenosine 5'-Phosphate", Biochemistry 1968, 4023-4029.
Murray, A.W. et al., Adenosine 5 Phosphorothioate. A Nucleotide Analog That Is a Substrate, Competitive Inhibitor, or Regulator of Some Enzymes That Interact with Adenosine 5 Phosphate , Biochemistry 1968, 4023 4029. *
Niewiarowski, W., et al., "Diastereomers of Thymidine 3'-O-(Methanephosphono-thioate): Synthesis, Absolute Configuration and Reaction with 3'-methoxyacetylthymidine Under Conditions of Triester Approach to Oligonucleotide Synthesis", Acta Biochimica Polonia 1987, 34, 217-231.
Niewiarowski, W., et al., Diastereomers of Thymidine 3 O (Methanephosphono thioate): Synthesis, Absolute Configuration and Reaction with 3 methoxyacetylthymidine Under Conditions of Triester Approach to Oligonucleotide Synthesis , Acta Biochimica Polonia 1987, 34, 217 231. *
Reese, "The Chemical Synthesis of Oligo-and Polynucleotides by the Phosphotriester Approach", Tetrahedron 1978, 34, 3143-3179.
Reese, The Chemical Synthesis of Oligo and Polynucleotides by the Phosphotriester Approach , Tetrahedron 1978, 34, 3143 3179. *
Reist et al., "Synthesis of 9-(5-Deoxy-B-D-arabinofuranosyl) adenine", J. Org. Chem. 1965, 30, 3401-3403.
Reist et al., Synthesis of 9 (5 Deoxy B D arabinofuranosyl) adenine , J. Org. Chem. 1965, 30, 3401 3403. *
Richard, J. P. and Frey, P. A., "Stereochemical course of phosphoanhydride synthesis", Journal of the American Chemical Society 1983, 105, 6605-6609.
Richard, J. P. and Frey, P. A., Stereochemical course of phosphoanhydride synthesis , Journal of the American Chemical Society 1983, 105, 6605 6609. *
Robins et al., "Nucleic acid related compounds. 11. adenosine 2', 3'-ribo-epoxide. synthesis, intramolecular degradation, and transformation into 3'-substituted xylofuranosyl nucleosides and the lyxo-epoxide1.2", J. Org. Chem. 1974, 39(11), 1564-1570.
Robins et al., Nucleic acid related compounds. 11. adenosine 2 , 3 ribo epoxide. synthesis, intramolecular degradation, and transformation into 3 substituted xylofuranosyl nucleosides and the lyxo epoxide 1.2 , J. Org. Chem. 1974, 39(11), 1564 1570. *
Romaniuk, P. J. and Eckstein, F., "A study of the mechanism of t4 DNA polymerase with diasteromeric phosphorothioate analogues of deoxyadenosine triphosphate", Biological Chemistry 1982, 257(13), 7684-7688.
Romaniuk, P. J. and Eckstein, F., A study of the mechanism of t4 DNA polymerase with diasteromeric phosphorothioate analogues of deoxyadenosine triphosphate , Biological Chemistry 1982, 257(13), 7684 7688. *
Rothenberg et al., "Oligodeoxynucleotides as anti-sense inhibitors of gene expression: therapeutic implication", National Cancer Institute 1989, 81(20), 1539-1565.
Rothenberg et al., Oligodeoxynucleotides as anti sense inhibitors of gene expression: therapeutic implication , National Cancer Institute 1989, 81(20), 1539 1565. *
Sammons, R. Douglas and Frey, Perry A., "Synthesis of Rp and Sp [α-18 O]ADP from Sp and Rp β-Cyanoethyl-Adenosine 5'-[1-Thiodiphosphate]", J. Biol. Chem. 1982, 257 (3), 1138-1141.
Sammons, R. Douglas and Frey, Perry A., Synthesis of R p and S p 18 O ADP from S p and R p Cyanoethyl Adenosine 5 1 Thiodiphosphate , J. Biol. Chem. 1982, 257 (3), 1138 1141. *
Scheit, Karl Heinz, "Nucleotides with Modified Phosphate Groups", in Nucleotide Analogs John Wiley & Sons, 1980, Chapter Four and Chapter Six.
Scheit, Karl Heinz, Nucleotides with Modified Phosphate Groups , in Nucleotide Analogs John Wiley & Sons, 1980, Chapter Four and Chapter Six. *
Schuman, D. et al., J. Am. Chem. Soc. 1970, 92, 3434. *
Seela, F. et al., "Phosphoramidites of (oxygen-18) Chiral (Rp)-and (Sp)-configurated Dimer-blocks and their use in Automated Oligonucleotide Synthesis", Nucleosides and Nucleotides 1987, 6(1-2), 451-456.
Seela, F. et al., Phosphoramidites of (oxygen 18) Chiral (Rp) and (Sp) configurated Dimer blocks and their use in Automated Oligonucleotide Synthesis , Nucleosides and Nucleotides 1987, 6(1 2), 451 456. *
Sopchik et al., "17 O NMR of Diastereomeric 3', 5'-Cyclic Thymidine Methyl Phosphates, Methylphosphates, and N,N-Dimethyl Phosphoramidates. Phosphorus Configuration of P-Chiral [17 O, 18 O]-Nucleoside Phosphate Diesters", Tetrahedron Letters 1989, 30(10), 1221-1224.
Sopchik et al., 17 O NMR of Diastereomeric 3 , 5 Cyclic Thymidine Methyl Phosphates, Methylphosphates, and N,N Dimethyl Phosphoramidates. Phosphorus Configuration of P Chiral 17 O, 18 O Nucleoside Phosphate Diesters , Tetrahedron Letters 1989, 30(10), 1221 1224. *
Stec et al., "Reversed-phase High-performance Liquid Chromatographic Separation of Diastereomeric Phosphorothioate Analogues of Oligodeoxyribonucleotides and Other Backbone-Modified Congeners of DNA", J. Chromatography 1985, 326, 263-280.
Stec et al., "Solid-Phase Synthesis, Separation, and Stereochemical Aspects of P-Chiral Methane-and 4,4'-Dimethoxytriphenylmethanephosphonate Analogues of Oligodeoxyribonucleotides", J. Org. Chem. 1985, 50(20), 3908-3913.
Stec et al., "Synthesis and Absolute Configuration of P-Chiral O-Isopropyl Oligonucleotide Triesters", Tetrahedron Letters 1985, 26(18), 2191-2194.
Stec et al., Reversed phase High performance Liquid Chromatographic Separation of Diastereomeric Phosphorothioate Analogues of Oligodeoxyribonucleotides and Other Backbone Modified Congeners of DNA , J. Chromatography 1985, 326, 263 280. *
Stec et al., Solid Phase Synthesis, Separation, and Stereochemical Aspects of P Chiral Methane and 4,4 Dimethoxytriphenylmethanephosphonate Analogues of Oligodeoxyribonucleotides , J. Org. Chem. 1985, 50(20), 3908 3913. *
Stec et al., Synthesis and Absolute Configuration of P Chiral O Isopropyl Oligonucleotide Triesters , Tetrahedron Letters 1985, 26(18), 2191 2194. *
Stec, "Oligonucleotides as Antisense Inhibitors of Gene Expression: Therapeutic Implications", Meeting Abstracts, Abstracts of Papers: Polish Academy of Science, Jun. 18-21, 1989.
Stec, Oligonucleotides as Antisense Inhibitors of Gene Expression: Therapeutic Implications , Meeting Abstracts, Abstracts of Papers: Polish Academy of Science, Jun. 18 21, 1989. *
Stec, W. and Lesnikowski, "Stereospecific Synthesis of P-Chiral Analogs of Oligonucleotides", in Methods in Molecular Biology, Agrawal, S., ed., vol. 20, 1992, pp. 285-313.
Stec, W. and Lesnikowski, Stereospecific Synthesis of P Chiral Analogs of Oligonucleotides , in Methods in Molecular Biology, Agrawal, S., ed., vol. 20, 1992, pp. 285 313. *
Stec, W. et al., "Novel Route to Oligo(Deoxyribonucleoside Phosphorothioates), Stereocontrolled Synthesis of P-chiral Oligo(Deoxyribonucleoside Phosphorothioates)", Nucleic Acids Res. 1991, 19, 5883-5888.
Stec, W. et al., Novel Route to Oligo(Deoxyribonucleoside Phosphorothioates), Stereocontrolled Synthesis of P chiral Oligo(Deoxyribonucleoside Phosphorothioates) , Nucleic Acids Res. 1991, 19, 5883 5888. *
Suzaki et al., "Synthesis of 9-β-D-Xylofuranosyl-6-mercaptopurine and 9-β-D-Xylofuranosylguanine 5'-Phosphate", Chem. Pharm. Bull. 1970, 18, 172-176.
Suzaki et al., Synthesis of 9 D Xylofuranosyl 6 mercaptopurine and 9 D Xylofuranosylguanine 5 Phosphate , Chem. Pharm. Bull. 1970, 18, 172 176. *
Szarek et al., "Synthesis of 5-Deoxy-D-xylo-Hexose and 5-Deoxy-L-arabino-Hexose, and Their Conversion into Adenine Nucleosides", Carbohydrate Res. 1978, 62, 89-103.
Szarek et al., Synthesis of 5 Deoxy D xylo Hexose and 5 Deoxy L arabino Hexose, and Their Conversion into Adenine Nucleosides , Carbohydrate Res. 1978, 62, 89 103. *
Tsai, M. D., "Stereochemistry of the hydrolysis of adenosine 5'-thiophosphate catalyzed by venom 5'-nucleotidase", Biochemistry 1980, 19, 5310-5316.
Tsai, M. D., Stereochemistry of the hydrolysis of adenosine 5 thiophosphate catalyzed by venom 5 nucleotidase , Biochemistry 1980, 19, 5310 5316. *
Ueda, T. et al., "Phosphorothioate-containing RNAs show mRNA activity in the prokaryotic translation systems in vitro", Nucleic Acids Research 1991, 19, 547-552.
Ueda, T. et al., Phosphorothioate containing RNAs show mRNA activity in the prokaryotic translation systems in vitro , Nucleic Acids Research 1991, 19, 547 552. *
Uhlmann, E. and Peyman, A., "Antisense oligonucleotides: A new therapeutic principle", Chemical Reviews 1990, 90(4), 578-584.
Uhlmann, E. and Peyman, A., Antisense oligonucleotides: A new therapeutic principle , Chemical Reviews 1990, 90(4), 578 584. *
Van Pelt, Jean E. et al., "Gentamicin Nucleotidyltransferase: Stereochemical Inversion at Phosphorous in Enzymatic 2'-Deoxyadenyl Transfer to Tobramycin", J. Biol. Chem. 1986, 261(34), 15995-15999.
Van Pelt, Jean E. et al., Gentamicin Nucleotidyltransferase: Stereochemical Inversion at Phosphorous in Enzymatic 2 Deoxyadenyl Transfer to Tobramycin , J. Biol. Chem. 1986, 261(34), 15995 15999. *
Wempen, I. and Fox, "Nucleosides. LV. Synthesis of a sulfur-bridged thymine anhydro nucleoside and derivatives", J. Org. Chem. 1969, 34, 1020-1025.
Wempen, I. and Fox, Nucleosides. LV. Synthesis of a sulfur bridged thymine anhydro nucleoside and derivatives , J. Org. Chem. 1969, 34, 1020 1025. *
Wiberg, "Physical Organic Chemistry", John Wiley & Sons, New York, 1964, p. 424.
Wiberg, Physical Organic Chemistry , John Wiley & Sons, New York, 1964, p. 424. *
Wijnen, M.H., "Disproportionation and Recombination Reactions of Methyl and n-Pentyl Radicals", J. Am. Chem. Soc. 1961, 83, 3752-3754.
Wijnen, M.H., Disproportionation and Recombination Reactions of Methyl and n Pentyl Radicals , J. Am. Chem. Soc. 1961, 83, 3752 3754. *
Zimm, S. et al., "Cerebrosphinal Fluid Pharmacokinetics of Intraventricular and Intravenous Aziridinylbenzoquinone", Cancer Research 1984, 44, 1698-1701.
Zimm, S. et al., Cerebrosphinal Fluid Pharmacokinetics of Intraventricular and Intravenous Aziridinylbenzoquinone , Cancer Research 1984, 44, 1698 1701. *

Cited By (187)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7119184B2 (en) 1991-08-12 2006-10-10 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US8153602B1 (en) 1991-11-19 2012-04-10 Isis Pharmaceuticals, Inc. Composition and methods for the pulmonary delivery of nucleic acids
US20070123702A1 (en) * 1992-03-05 2007-05-31 Muthiah Manoharan Oligonucleotdies having A-DNA form and B-DNA form conformational geometry
US9096636B2 (en) 1996-06-06 2015-08-04 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
US7812149B2 (en) 1996-06-06 2010-10-12 Isis Pharmaceuticals, Inc. 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations
US20040171028A1 (en) * 1996-06-06 2004-09-02 Baker Brenda F. Phosphorous-linked oligomeric compounds and their use in gene modulation
US7695902B2 (en) 1996-06-06 2010-04-13 Isis Pharmaceuticals, Inc. Oligoribonucleotides and ribonucleases for cleaving RNA
US6407223B1 (en) * 1997-04-25 2002-06-18 Polska Akademia Nauk Cenirum Badan Molekularnych I Makromlekularnych Process for the synthesis of modified P-chiral nucleotide analogues
US6083923A (en) * 1997-10-31 2000-07-04 Isis Pharmaceuticals Inc. Liposomal oligonucleotide compositions for modulating RAS gene expression
US7964579B2 (en) 1998-05-21 2011-06-21 Isis Pharmaceuticals, Inc. Compositions and methods for topical delivery of oligonucleotides
US6440943B1 (en) 1998-07-14 2002-08-27 Isis Pharmaceuticals, Inc. Oligonucleotides having site specific chiral phosphorothioate internucleoside linkages
US6326358B1 (en) 1998-07-14 2001-12-04 Isis Pharmaceuticals, Inc. Carbohydrate or 2′-modified oligonucleotides having alternating internucleoside linkages
US6277967B1 (en) 1998-07-14 2001-08-21 Isis Pharmaceuticals, Inc. Carbohydrate or 2′-modified oligonucleotides having alternating internucleoside linkages
US7056896B2 (en) 1998-07-14 2006-06-06 Isis Pharmaceuticals, Inc. Carbohydrate or 2′-modified oligonucleotides having alternating internucleoside linkages
US6242589B1 (en) 1998-07-14 2001-06-05 Isis Pharmaceuticals, Inc. Phosphorothioate oligonucleotides having modified internucleoside linkages
US6811975B2 (en) 1998-07-14 2004-11-02 Isis Pharmaceuticals, Inc. Phosphorothioate oligonucleotides having modified internucleoside linkages
USRE39464E1 (en) * 1998-07-14 2007-01-09 Isis Pharmaceuticals Inc. Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages
US20060172925A1 (en) * 1998-10-26 2006-08-03 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US6423493B1 (en) 1998-10-26 2002-07-23 Board Of Regents The University Of Texas System Combinatorial selection of oligonucleotide aptamers
US6867289B1 (en) 1998-10-26 2005-03-15 Board Of Regents, The University Of Texas Systems Thio-modified aptamer synthetic methods and compositions
US20030027184A1 (en) * 1998-10-26 2003-02-06 Gorenstein David G. Combinatorial selection of oligonucleotide aptamers
US20050214772A1 (en) * 1998-10-26 2005-09-29 Board Of Regents, The University Of Texas System Thio modified aptamer synthetic methods and compositions
US7179894B2 (en) 1998-10-26 2007-02-20 Board Of Regents, The University Of Texas System Combinatorial selection of oligonucleotide aptamers
US20020192700A1 (en) * 1998-11-25 2002-12-19 Ecker David J. In situ binary synthesis of biologically effective molecules
US6492111B1 (en) 1998-11-25 2002-12-10 Isis Pharmaceuticals, Inc. In situ binary synthesis of biologically effective molecules
US7314923B2 (en) 1999-02-12 2008-01-01 Daiichi Sankyo Company, Limited Nucleoside and oligonucleotide analogues
US7335765B2 (en) 1999-02-12 2008-02-26 Daiichi Sankyo Company, Limited Nucleoside and oligonucleotide analogues
US20110009471A1 (en) * 1999-02-12 2011-01-13 Daiichi Sankyo Company, Limited Oligonucleotide analogues and methods utilizing the same
US7816333B2 (en) 1999-02-12 2010-10-19 Daiichi Sankyo Company, Limited Oligonucleotide analogues and methods utilizing the same
US8957201B2 (en) 1999-02-12 2015-02-17 Daiichi Sankyo Company, Limited Oligonucleotide analogues and methods utilizing the same
US20030207841A1 (en) * 1999-02-12 2003-11-06 Sankyo Company Limited Novel nucleoside and oligonucleotide analogues
US6369209B1 (en) 1999-05-03 2002-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US6737520B2 (en) 1999-05-03 2004-05-18 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US20040143114A1 (en) * 1999-07-22 2004-07-22 Sankyo Company, Limited Novel bicyclonucleoside analogues
US7994145B2 (en) 1999-07-22 2011-08-09 Takeshi Imanishi Bicyclonucleoside analogues
US20070270370A1 (en) * 1999-07-22 2007-11-22 Sankyo Company, Limited Novel bicyclonucleoside analogues
US7217805B2 (en) 1999-07-22 2007-05-15 Sankyo Company, Limited Bicyclonucleoside analogues
US20040242521A1 (en) * 1999-10-25 2004-12-02 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US20080255005A1 (en) * 2001-11-15 2008-10-16 Board Of Regents, The University Of Texas System Bead Bound Combinatorial Oligonucleoside Phosphorothioate And Phosphorodithioate Aptamer Libraries
US20080200340A1 (en) * 2001-11-15 2008-08-21 Board Of Regents, The University Of Texas System Bead Bound Combinatorial Oligonucleoside Phosphorothioate And Phosphorodithioate Aptamer Libraries
US20030162190A1 (en) * 2001-11-15 2003-08-28 Gorenstein David G. Phosphoromonothioate and phosphorodithioate oligonucleotide aptamer chip for functional proteomics
US20080268423A1 (en) * 2002-08-16 2008-10-30 Alan Barrett Compositions and Methods Related to Flavivirus Envelope Protein Domain III Antigens
US7785799B2 (en) 2002-08-16 2010-08-31 The Board Of Regents Of The University Of Texas System Compositions and methods related to flavivirus envelope protein domain III antigens
US20090123922A1 (en) * 2002-10-16 2009-05-14 Board Of Regents, The University Of Texas System Bead Bound Combinatorial Oligonucleoside Phosphorothioate And Phosphorodithioate Aptamer Libraries
US20050123939A1 (en) * 2002-10-16 2005-06-09 Board Of Regents, The University Of Texas System Bead bound combinatorial oligonucleoside phosphorothioate and phosphorodithioate aptamer libraries
US7338762B2 (en) 2002-10-16 2008-03-04 Board Of Regents, The University Of Texas System Bead bound combinatorial oligonucleoside phosphorothioate and phosphorodithioate aptamer libraries
US8604183B2 (en) 2002-11-05 2013-12-10 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
US9567579B2 (en) 2003-05-23 2017-02-14 Board Of Regents, The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting AP-1 transcription factors
US7910523B2 (en) 2003-05-23 2011-03-22 Board Of Regents, The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting AP-1 transcription factors
US20060121489A1 (en) * 2003-05-23 2006-06-08 Board Of Regents, The University Of Texas System High throughput screening of aptamer libraries for specific binding to proteins on viruses and other pathogens
US20040265912A1 (en) * 2003-05-23 2004-12-30 Board Of Regents, The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting AP-1 transcription factors
US20050118611A1 (en) * 2003-07-24 2005-06-02 Board Of Regents, The University Of Texas System Thioaptamers enable discovery of physiological pathways and new therapeutic strategies
US8569474B2 (en) 2004-03-09 2013-10-29 Isis Pharmaceuticals, Inc. Double stranded constructs comprising one or more short strands hybridized to a longer strand
US20050239134A1 (en) * 2004-04-21 2005-10-27 Board Of Regents, The University Of Texas System Combinatorial selection of phosphorothioate single-stranded DNA aptamers for TGF-beta-1 protein
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
US20070172948A1 (en) * 2004-06-03 2007-07-26 Balkrishen Bhat Double strand compositions comprising differentially modified strands for use in gene modulation
US7884086B2 (en) 2004-09-08 2011-02-08 Isis Pharmaceuticals, Inc. Conjugates for use in hepatocyte free uptake assays
US20060281702A1 (en) * 2005-05-18 2006-12-14 Board Of Regents, The University Of Texas System Combinatorial selection of phosphorothioate aptamers for RNases
US8288354B2 (en) 2005-12-28 2012-10-16 The Scripps Research Institute Natural antisense and non-coding RNA transcripts as drug targets
US20110016590A1 (en) * 2006-03-15 2011-01-20 Agrigenetics, Inc. Resistance to auxinic herbicides
US8088979B2 (en) 2006-03-15 2012-01-03 Agrigenetics, Inc. Resistance to auxinic herbicides
US8535893B2 (en) 2006-03-15 2013-09-17 Agrigenetics, Inc. Resistance to auxinic herbicides
US20070220629A1 (en) * 2006-03-15 2007-09-20 Exelixis Plant Sciences, Inc. Resistance to auxinic herbicides
US7820883B2 (en) 2006-03-15 2010-10-26 Dow Agrosciences Llc Resistance to auxinic herbicides
US8603755B2 (en) 2006-03-15 2013-12-10 Dow Agrosciences, Llc. Resistance to auxinic herbicides
US20110016591A1 (en) * 2006-03-15 2011-01-20 Agrigenetics, Inc. Resistance to auxinic herbicides
US8071847B2 (en) 2006-03-15 2011-12-06 Agrigenetics Inc. Resistance to auxinic herbicides
US10131904B2 (en) 2008-02-11 2018-11-20 Rxi Pharmaceuticals Corporation Modified RNAi polynucleotides and uses thereof
US8815818B2 (en) 2008-07-18 2014-08-26 Rxi Pharmaceuticals Corporation Phagocytic cell delivery of RNAI
US10041073B2 (en) 2008-09-22 2018-08-07 Rxi Pharmaceuticals Corporation Reduced size self-delivering RNAi compounds
US9175289B2 (en) 2008-09-22 2015-11-03 Rxi Pharmaceuticals Corporation Reduced size self-delivering RNAi compounds
US9303259B2 (en) 2008-09-22 2016-04-05 Rxi Pharmaceuticals Corporation RNA interference in skin indications
US9938530B2 (en) 2008-09-22 2018-04-10 Rxi Pharmaceuticals Corporation RNA interference in skin indications
US10138485B2 (en) 2008-09-22 2018-11-27 Rxi Pharmaceuticals Corporation Neutral nanotransporters
US8796443B2 (en) 2008-09-22 2014-08-05 Rxi Pharmaceuticals Corporation Reduced size self-delivering RNAi compounds
US8153606B2 (en) 2008-10-03 2012-04-10 Opko Curna, Llc Treatment of apolipoprotein-A1 related diseases by inhibition of natural antisense transcript to apolipoprotein-A1
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US9394333B2 (en) 2008-12-02 2016-07-19 Wave Life Sciences Japan Method for the synthesis of phosphorus atom modified nucleic acids
US9765336B2 (en) 2008-12-04 2017-09-19 Curna, Inc. Treatment of erythropoietin (EPO) related diseases by inhibition of natural antisense transcript to EPO
US9410155B2 (en) 2008-12-04 2016-08-09 Curna, Inc. Treatment of vascular endothelial growth factor (VEGF) related diseases by inhibition of natural antisense transcript to VEGF
US8927511B2 (en) 2008-12-04 2015-01-06 Curna, Inc. Treatment of vascular endothelial growth factor (VEGF) related diseases by inhibition of natural antisense transcript to VEGF
US8921329B2 (en) 2008-12-04 2014-12-30 Curna, Inc. Treatment of erythropoietin (EPO) related diseases by inhibition of natural antisense transcript to EPO
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
US9074210B2 (en) 2009-02-12 2015-07-07 Curna, Inc. Treatment of brain derived neurotrophic factor (BDNF) related diseases by inhibition of natural antisense transcript to BDNF
US9464287B2 (en) 2009-03-16 2016-10-11 Curna, Inc. Treatment of nuclear factor (erythroid-derived 2)-like 2 (NRF2) related diseases by inhibition of natural antisense transcript to NRF2
US9834769B2 (en) 2009-03-17 2017-12-05 Curna, Inc. Treatment of delta-like 1 homolog (DLK1) related diseases by inhibition of natural antisense transcript to DLK1
US9708604B2 (en) 2009-03-17 2017-07-18 Curna, Inc. Treatment of delta-like 1 homolog (DLK1) related diseases by inhibition of natural antisense transcript to DLK1
US9611477B2 (en) 2009-05-06 2017-04-04 Curna, Inc. Treatment of tristetraproline (TTP) related diseases by inhibition of natural antisense transcript to TTP
US9163285B2 (en) 2009-05-06 2015-10-20 Curna, Inc. Treatment of tristetraproline (TTP) related diseases by inhibition of natural antisense transcript to TTP
US9155754B2 (en) 2009-05-06 2015-10-13 Curna, Inc. Treatment of ABCA1 gene related diseases by inhibition of a natural antisense transcript to ABCA1
US9957503B2 (en) 2009-05-06 2018-05-01 Curna, Inc. Treatment of LCAT gene related diseases by inhibition of a natural antisense transcript to LCAT
US9012139B2 (en) 2009-05-08 2015-04-21 Curna, Inc. Treatment of dystrophin family related diseases by inhibition of natural antisense transcript to DMD family
US9533004B2 (en) 2009-05-08 2017-01-03 Curna, Inc. Treatment of dystrophin family related diseases by inhibition of natural antisense transcript to DMD family
US8957037B2 (en) 2009-05-18 2015-02-17 Curna, Inc. Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
US9914923B2 (en) 2009-05-18 2018-03-13 Curna, Inc. Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
US9725717B2 (en) 2009-05-22 2017-08-08 Curna, Inc. Treatment of transcription factor E3 (TFE3) and insulin receptor substrate 2 (IRS2) related diseases by inhibition of natural antisense transcript to TFE3
US8895527B2 (en) 2009-05-22 2014-11-25 Curna, Inc. Treatment of transcription factor E3 (TFE3) and insulin receptor substrate 2(IRS2) related diseases by inhibition of natural antisense transcript to TFE3
US8791085B2 (en) 2009-05-28 2014-07-29 Curna, Inc. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US9133456B2 (en) 2009-05-28 2015-09-15 Curna, Inc. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US9512427B2 (en) 2009-05-28 2016-12-06 Curna, Inc. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US8951981B2 (en) 2009-06-16 2015-02-10 Curna, Inc. Treatment of paraoxonase 1 (PON1) related diseases by inhibition of natural antisense transcript to PON1
US9714423B2 (en) 2009-06-16 2017-07-25 Curna, Inc. Treatment of Paraoxonase 1 (PON1) related diseases by inhibition of natural antisense transcript to PON1
US8859515B2 (en) 2009-06-24 2014-10-14 Curna, Inc. Treatment of tumor necrosis factor receptor 2 (TNFR2) related diseases by inhibition of natural antisense transcript to TNFR2
US9771593B2 (en) 2009-06-24 2017-09-26 Curna, Inc. Treatment of tumor necrosis factor receptor 2 (TNFR2) related diseases by inhibition of natural antisense transcript to TNFR2
US10036014B2 (en) 2009-06-26 2018-07-31 Curna, Inc. Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
US8921330B2 (en) 2009-06-26 2014-12-30 Curna, Inc. Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US9234199B2 (en) 2009-08-05 2016-01-12 Curna, Inc. Treatment of insulin gene (INS) related diseases by inhibition of natural antisense transcript to an insulin gene (INS)
US9909126B2 (en) 2009-08-11 2018-03-06 Curna, Inc. Treatment of Adiponectin (ADIPOQ) related diseases by inhibition of natural antisense transcript to an Adiponectin (ADIPOQ)
US9290766B2 (en) 2009-08-11 2016-03-22 Curna, Inc. Treatment of adiponectin (ADIPOQ) related diseases by inhibition of natural antisense transcript to an adiponectin (ADIPOQ)
US9044493B2 (en) 2009-08-11 2015-06-02 Curna, Inc. Treatment of Adiponectin related diseases by inhibition of natural antisense transcript to an Adiponectin
US8791087B2 (en) 2009-08-21 2014-07-29 Curna, Inc. Treatment of ‘C terminus of HSP70-interacting protein’ (CHIP)related diseases by inhibition of natural antisense transcript to CHIP
US9725756B2 (en) 2009-08-21 2017-08-08 Curna, Inc. Treatment of ‘C terminus of HSP7O-interacting protein’ (CHIP) related diseases by inhibition of natural antisense transcript to CHIP
US9528110B2 (en) 2009-08-25 2016-12-27 Curna, Inc. Treatment of ‘IQ motif containing gtpase activating protein’ (IQGAP) related diseases by inhibition of natural antisense transcript to IQGAP
US9023822B2 (en) 2009-08-25 2015-05-05 Curna, Inc. Treatment of 'IQ motif containing GTPase activating protein' (IQGAP) related diseases by inhibition of natural antisense transcript to IQGAP
US10113166B2 (en) 2009-09-25 2018-10-30 Curna, Inc. Treatment of filaggrin (FLG) related diseases by modulation of FLG expression and activity
US9879264B2 (en) 2009-12-16 2018-01-30 Curna, Inc. Treatment of membrane bound transcription factor peptidase, site 1 (MBTPS1) related diseases by inhibition of natural antisense transcript to MBTPS1
US9173895B2 (en) 2009-12-16 2015-11-03 Curna, Inc. Treatment of membrane bound transcription factor peptidase, site 1 (MBTPS1) related diseases by inhibition of natural antisense transcript to MBTPS1
US9879256B2 (en) 2009-12-23 2018-01-30 Curna, Inc. Treatment of hepatocyte growth factor (HGF) related diseases by inhibition of natural antisense transcript to HGF
US9068183B2 (en) 2009-12-23 2015-06-30 Curna, Inc. Treatment of uncoupling protein 2 (UCP2) related diseases by inhibition of natural antisense transcript to UCP2
US8940708B2 (en) 2009-12-23 2015-01-27 Curna, Inc. Treatment of hepatocyte growth factor (HGF) related diseases by inhibition of natural antisense transcript to HGF
US9732339B2 (en) 2009-12-29 2017-08-15 Curna, Inc. Treatment of tumor protein 63 (p63) related diseases by inhibition of natural antisense transcript to p63
US8962585B2 (en) 2009-12-29 2015-02-24 Curna, Inc. Treatment of tumor protein 63 (p63) related diseases by inhibition of natural antisense transcript to p63
US8921334B2 (en) 2009-12-29 2014-12-30 Curna, Inc. Treatment of nuclear respiratory factor 1 (NRF1) related diseases by inhibition of natural antisense transcript to NRF1
US9663785B2 (en) 2009-12-29 2017-05-30 Curna, Inc. Treatment of nuclear respiratory factor 1 (NRF1) related diseases by inhibition of natural antisense transcript to NRF1
US9677074B2 (en) 2009-12-31 2017-06-13 Curna, Inc. Treatment of insulin receptor substrate 2 (IRS2) related diseases by inhibition of natural antisense transcript to IRS2 and transcription factor E3 (TFE3)
US9834767B2 (en) 2010-01-04 2017-12-05 Curna, Inc. Treatment of interferon regulatory factor 8 (IRF8) related diseases by inhibition of natural antisense transcript to IRF8
US8946181B2 (en) 2010-01-04 2015-02-03 Curna, Inc. Treatment of interferon regulatory factor 8 (IRF8) related diseases by inhibition of natural antisense transcript to IRF8
US9267136B2 (en) 2010-01-06 2016-02-23 Curna, Inc. Treatment of pancreatic developmental gene related diseases by inhibition of natural antisense transcript to a pancreatic developmental gene
US8912157B2 (en) 2010-01-06 2014-12-16 Curna, Inc. Treatment of pancreatic developmental gene related diseases by inhibition of natural antisense transcript to a pancreatic developmental gene
US9200277B2 (en) 2010-01-11 2015-12-01 Curna, Inc. Treatment of sex hormone binding globulin (SHBG) related diseases by inhibition of natural antisense transcript to SHBG
US8946182B2 (en) 2010-01-25 2015-02-03 Curna, Inc. Treatment of RNASE H1 related diseases by inhibition of natural antisense transcript to RNASE H1
US9745582B2 (en) 2010-01-25 2017-08-29 Curna, Inc. Treatment of RNASE H1 related diseases by inhibition of natural antisense transcript to RNASE H1
US8962586B2 (en) 2010-02-22 2015-02-24 Curna, Inc. Treatment of pyrroline-5-carboxylate reductase 1 (PYCR1) related diseases by inhibition of natural antisense transcript to PYCR1
US9902995B2 (en) 2010-02-22 2018-02-27 Curna, Inc. Treatment of pyrroline-5-carboxylate reductase 1 (PYCR1) related disease by inhibition of natural antisense transcript to PYCR1
US9382543B2 (en) 2010-02-22 2016-07-05 Curna, Inc. Treatment of pyrroline-5-carboxylate reductase 1 (PYCR1) related diseases by inhibition of natural antisense transcript to PYCR1
US9963702B2 (en) 2010-03-24 2018-05-08 Rxi Pharmaceuticals Corporation RNA interference in dermal and fibrotic indications
US9080171B2 (en) 2010-03-24 2015-07-14 RXi Parmaceuticals Corporation Reduced size self-delivering RNAi compounds
US9340786B2 (en) 2010-03-24 2016-05-17 Rxi Pharmaceuticals Corporation RNA interference in dermal and fibrotic indications
US9382538B2 (en) 2010-04-02 2016-07-05 Curna, Inc. Treatment of colony-stimulating factor 3 (CSF3) related diseases by inhibition of natural antisense transcript to CSF3
US8980856B2 (en) 2010-04-02 2015-03-17 Curna, Inc. Treatment of colony-stimulating factor 3 (CSF3) related diseases by inhibition of natural antisense transcript to CSF3
US9920369B2 (en) 2010-04-02 2018-03-20 Curna, Inc. Treatment of colony-stimulating factor 3 (CSF3) related diseases by inhibition of natural antisene transcript to CSF3
US9044494B2 (en) 2010-04-09 2015-06-02 Curna, Inc. Treatment of fibroblast growth factor 21 (FGF21) related diseases by inhibition of natural antisense transcript to FGF21
US9745580B2 (en) 2010-04-09 2017-08-29 Curna, Inc. Treatment of fibroblast growth factor 21 (FGF21) related diseases by inhibition of natural antisense transcript to FGF21
US9089588B2 (en) 2010-05-03 2015-07-28 Curna, Inc. Treatment of sirtuin (SIRT) related diseases by inhibition of natural antisense transcript to a sirtuin (SIRT)
US10100315B2 (en) 2010-05-14 2018-10-16 Curna, Inc. Treatment of PAR4 related diseases by inhibition of natural antisense transcript to PAR4
US9745584B2 (en) 2010-05-14 2017-08-29 Curna, Inc. Treatment of PAR4 related diseases by inhibition of natural antisense transcript to PAR4
US8980857B2 (en) 2010-05-14 2015-03-17 Curna, Inc. Treatment of PAR4 related diseases by inhibition of natural antisense transcript to PAR4
US8895528B2 (en) 2010-05-26 2014-11-25 Curna, Inc. Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
US8980858B2 (en) 2010-05-26 2015-03-17 Curna, Inc. Treatment of methionine sulfoxide reductase a (MSRA) related diseases by inhibition of natural antisense transcript to MSRA
US9624493B2 (en) 2010-05-26 2017-04-18 Curna, Inc. Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
US9970008B2 (en) 2010-05-26 2018-05-15 Curna, Inc. Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
US9771579B2 (en) 2010-06-23 2017-09-26 Curna, Inc. Treatment of sodium channel, voltage-gated, alpha subunit (SCNA) related diseases by inhibition of natural antisense transcript to SCNA
US9902958B2 (en) 2010-07-14 2018-02-27 Curna, Inc. Treatment of discs large homolog (DLG) related diseases by inhibition of natural antisense transcript to DLG
US8980860B2 (en) 2010-07-14 2015-03-17 Curna, Inc. Treatment of discs large homolog (DLG) related diseases by inhibition of natural antisense transcript to DLG
US8993533B2 (en) 2010-10-06 2015-03-31 Curna, Inc. Treatment of sialidase 4 (NEU4) related diseases by inhibition of natural antisense transcript to NEU4
US9873873B2 (en) 2010-10-22 2018-01-23 Curna, Inc. Treatment of alpha-L-iduronidase (IDUA) related diseases by inhibition of natural antisense transcript to IDUA
US9222088B2 (en) 2010-10-22 2015-12-29 Curna, Inc. Treatment of alpha-L-iduronidase (IDUA) related diseases by inhibition of natural antisense transcript to IDUA
US9856479B2 (en) 2010-11-12 2018-01-02 The General Hospital Corporation Polycomb-associated non-coding RNAs
US9328346B2 (en) 2010-11-12 2016-05-03 The General Hospital Corporation Polycomb-associated non-coding RNAs
US9816094B2 (en) 2010-11-12 2017-11-14 The General Hospital Corporation Polycomb-associated non-coding RNAs
US10053694B2 (en) 2010-11-12 2018-08-21 The General Hospital Corporation Polycomb-associated non-coding RNAS
US9920317B2 (en) 2010-11-12 2018-03-20 The General Hospital Corporation Polycomb-associated non-coding RNAs
US10119144B2 (en) 2010-11-12 2018-11-06 The General Hospital Corporation Polycomb-associated non-coding RNAs
US10000752B2 (en) 2010-11-18 2018-06-19 Curna, Inc. Antagonat compositions and methods of use
US9809816B2 (en) 2010-11-23 2017-11-07 Curna, Inc. Treatment of NANOG related diseases by inhibition of natural antisense transcript to NANOG
US8987225B2 (en) 2010-11-23 2015-03-24 Curna, Inc. Treatment of NANOG related diseases by inhibition of natural antisense transcript to NANOG
US9593330B2 (en) 2011-06-09 2017-03-14 Curna, Inc. Treatment of frataxin (FXN) related diseases by inhibition of natural antisense transcript to FXN
US9902959B2 (en) 2011-06-09 2018-02-27 Curna, Inc. Treatment of Frataxin (FXN) related diseases by inhibition of natural antisense transcript to FXN
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9732341B2 (en) 2011-09-14 2017-08-15 Translate Bio Ma, Inc. Methods of delivering multiple targeting oligonucleotides to a cell using cleavable linkers
US9580708B2 (en) 2011-09-14 2017-02-28 Rana Therapeutics, Inc. Multimeric oligonucleotides compounds
US9732340B2 (en) 2011-09-14 2017-08-15 Translate Bio Ma, Inc. Multimeric oligonucleotides compounds having cleavable linkers
US10093924B2 (en) 2011-09-14 2018-10-09 Translate Bio Ma, Inc. Multimetric oligonucleotide compounds
US10059941B2 (en) 2012-05-16 2018-08-28 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
US10058623B2 (en) 2012-05-16 2018-08-28 Translate Bio Ma, Inc. Compositions and methods for modulating UTRN expression
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9790494B2 (en) 2012-09-14 2017-10-17 Translate Bio Ma, Inc. Multimeric oligonucleotide compounds having non-nucleotide based cleavable linkers
US10174315B2 (en) 2013-05-16 2019-01-08 The General Hospital Corporation Compositions and methods for modulating hemoglobin gene family expression
US10174323B2 (en) 2013-05-16 2019-01-08 The General Hospital Corporation Compositions and methods for modulating ATP2A2 expression
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10174324B2 (en) 2015-02-10 2019-01-08 Curna, Inc. Treatment of Methionine sulfoxide reductase a (MSRA) related diseases by inhibition of natural antisense transcript to MSRA

Similar Documents

Publication Publication Date Title
Vasseur et al. Oligonucleosides: synthesis of a novel methylhydroxylamine-linked nucleoside dimer and its incorporation into antisense sequences
US6127533A (en) 2&#39;-O-aminooxy-modified oligonucleotides
US5684143A (en) Oligo-2&#39;-fluoronucleotide N3&#39;-&gt;P5&#39; phosphoramidates
US5700922A (en) PNA-DNA-PNA chimeric macromolecules
US5968748A (en) Antisense oligonucleotide modulation of human HER-2 expression
Tang et al. Self-stabilized antisense oligodeoxynucleotide phosphorothioates: properties and anti-HIV activity
US5587469A (en) Oligonucleotides containing N-2 substituted purines
US6248878B1 (en) Nucleoside analogs
Shea et al. Synthesis, hybridization properties and antiviral activity of lipid-oligodeoxynucleotide conjugates
Young et al. Tandem promoters direct E. coli ribosomal RNA synthesis
US6867294B1 (en) Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages
US6391636B1 (en) Antisense oligonucleotide modulation of raf gene expression
US6159951A (en) 2&#39;-O-amino-containing nucleoside analogs and polynucleotides
US5693773A (en) Triplex-forming antisense oligonucleotides having abasic linkers targeting nucleic acids comprising mixed sequences of purines and pyrimidines
US6358931B1 (en) Compositions and methods for modulating RNA
US5587470A (en) 3-deazapurines
Kean et al. Photochemical cross-linking of psoralen-derivatized oligonucleoside methylphosphonates to rabbit globin messenger RNA
Giannaris et al. Oligoribonucleotides containing 2′, 5′-phosphodiester linkages exhibit binding selectivity for 3′, 5′-RNA over 3′, 5′-ssDNA
US6608036B1 (en) Oligonucleotide N3′→P5′ thiophosphoramidates: their synthesis and administration to treat neoplasms
US7629321B2 (en) Oligoribonucleotides and ribonucleases for cleaving RNA
US5457191A (en) 3-deazapurines
US5334711A (en) Synthetic catalytic oligonucleotide structures
US5491133A (en) Methods for blocking the expression of specifically targeted genes
US6028188A (en) Synthetic oligomers having chirally pure phosphonate internucleosidyl linkages mixed with non-phosphonate internucleosidyl linkages
US6262241B1 (en) Compound for detecting and modulating RNA activity and gene expression

Legal Events

Date Code Title Description
AS Assignment



CC Certificate of correction
FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
FP Expired due to failure to pay maintenance fee

Effective date: 20090826