WO2010123283A2

WO2010123283A2 - Fluorescently marked cohesin marker, and a cellulosome-forming-enzyme detection method employing the same

Info

Publication number: WO2010123283A2
Application number: PCT/KR2010/002508
Authority: WO
Inventors: 한성옥; 조우재
Original assignee: 고려대학교 산학협력단
Priority date: 2009-04-24
Filing date: 2010-04-21
Publication date: 2010-10-28
Also published as: KR101269596B1; KR20100117526A; WO2010123283A3; WO2010123283A9

Abstract

The present invention relates to a cohesin biomarker and to a cellulosome-forming-enzyme detection method employing the same, and more specifically it relates to a method for selectively detecting only cellulosome-forming enzymes by using a biomarker comprising the cohesin of a scaffold protein in the bond between the cohesin domain of the scaffold protein and the dockerin domain of the cellulosome-forming enzyme which is a cellulosome-forming mechanism.

Description

Fluorescently Labeled Cohysine Markers and Methods for Screening Cellulosomal Enzymes Using the Same

The present invention relates to a cochine biomarker and a method for screening a cellulosome-forming enzyme using the same, and more particularly, a binding between a dockerine domain of a cellulosome-forming enzyme, a cellulosome-forming mechanism, and a cochine domain of a support protein. The present invention relates to a method of selectively searching for cellulosome-forming enzymes by using cohysine of heavy support protein as a biomarker.

Wood fiber is a constituent of the cell walls of plants and consists of a complex of cellulose and hemicellulose. Cellulose is a β-1,4-glucose complex and is the most abundant renewable material in nature (Reiter et al. Curr Opin Plant Biol 5 (2002) 536-42). Although its chemical composition is simple, the action of several different enzymes is required to efficiently degrade cellulose (Ximenes et al. Hemicellulases and biotechnology. Recent Res Develop Microbiol 2 (1998) 165-176). Hemicelluloses include xylan, β-1.4-xylose, and glucomannan, β-1,4-glucose and mannose. Anaerobic microorganisms that can degrade most cellulose form an enzyme complex called cellulose (Roy H. Doi, The Chemical Record 1 (2001) 24-32). Cellulosomes act against various substrates such as crystalline cellulose, xylan, met, pectin and consist of cellulosome-forming enzymes and support proteins. The formation of cellulosomes consists of binding the dockerin domain of one cellulosome forming enzyme and one of several cohisine domains of the support protein. All cellulosome forming enzymes have dockerin domains and those without dockerin domains are non-cellulosome forming enzymes (Bayer et al. Annual Review of Microbiol 58 (2004) 521-554).

The present invention can identify cellulosome forming enzymes simply by one binding step using fluorescently labeled cohissine markers rather than several steps.

On the other hand, proteomics is the study of all proteins expressed in a certain state of life, that is, the proteome. The interaction and function between expression proteomics and proteins that study the expression of protein bodies There are functional proteomics that study interactions, post-translational modifications, etc. (Blackstock, et al. Proteomics: quantitative and physical mapping of cellular proteins. Trends Biotechnol 17 (1999) 121-7). The most used proteomics technology to date is two-dimensional polyacrylamide gel electrophoresis (2-DE). In this method, proteins are first separated according to isoelectric focusing (IEF) and then separated according to molecular weight on sodium dodecylsulfate-polyacrylamide gel electrophoresis (O'Farrell et al. High resolution two-dimensional electrophoresis). of proteins.J Biol Chem 250 (1975) 4007-21). The protein is separated from the 2-DE gel, stained, and the spots of the proteins with different expressions are cut out and subjected to in-gel digestion with trypsin. After the obtained protein is cleaved into peptide units, the mass value is obtained by using a mass spectrometer (LC-MS-MS), and the obtained mass value is investigated in a database to identify the protein. Two-dimensional electrophoresis reveals good resolution, changes in post-translational modifications, and changes due to proteolysis (see Figure 4).

Thus, the present inventors have completed the present invention by confirming that the fluorescently labeled cohisine biomarker can easily and selectively search for cellulosome forming enzymes.

The present invention has been made in view of the above necessity, and an object of the present invention is to provide a biomarker capable of selectively searching for cellulosome forming genes.

Another object of the present invention is to provide a method for selectively searching for cellulosome forming enzymes.

Another object of the present invention is to provide a method for easily separating and purifying a target protein.

Another object of the present invention is to provide a method for detecting a target substance interacting with cohissin.

In order to achieve the above object, the present invention provides a marker composition for searching for cellulose-forming enzyme having a cohesin (cohesin) domain as an active ingredient.

In one embodiment of the present invention, the cohisine domain is preferably labeled with a labeling means selected from the group consisting of fluorescent material and radioisotope, and more preferably labeled with a fluorescent material, but is not limited thereto.

The fluorescent substance for fluorescently labeling the cohisine domain of the present invention is not particularly limited, but Alexa Fluor® 647, TAMRA (carboxytetramethylhodamine), TMR (tetramethylhodamine), and rhodamine green (Rhodamine Green) ), Alexa fluor (registered trademark) 488, YOYO1, EVOblue (registered trademark) 50, phycoerythrin (PE), Texas red (TR), tetramethylrhodamine isothiocyanate , TRITC), fluorescein carboxylic acid (FCA), fluorescein thiourea (FTH), 7-acetoxycoumarin-3-1, fluorescein-5-1, flu Oresin-6-1, 2 ', 7'-dichlorofluorescein-5-1, 2', 7'-dichlorofluorescein-6-1, dehydrotetramethylosamine- 4-1, tetramethylrhodamine-5-1, and tetramethylrhodamine-6-1 Can be .

In a preferred embodiment of the present invention Alexa Fluoro 647 is used. The fluorescent material has a succinimidyl ester structure and effectively binds to primary amines of the cohysine protein to form stable fluorescent dye-protein bonds.

In addition, the protein of the present invention may or may not include a linker connecting the protein and the fluorescent material. The linker serves to facilitate the measurement of fluorescence polarization, and any material having such an effect can be used as the linker, for example, aminocaproic acid or the like can be used as the linker.

Examples of radioactive isotopes labelable in the cohisine domain of the present invention are ² H, ³ H, ¹³ C, ¹⁴ C, ¹⁵ N, ¹⁷ O, ¹⁸ 0, ³⁵ S, ¹⁸ F, ³⁶ Cl, ¹²³ I, ⁷⁶ Isotopes of hydrogen, carbon, nitrogen, oxygen, halogens such as Br, ¹²⁴ I or ⁷⁵ Br. These isotopes can be added during culture or labeled by substituting hydrogen or the like present in the protein.

In addition, the method of separating and purifying the cochsine domain of the present invention is not particularly limited, but methods using charge differences such as dialysis, ultrafiltration, and ion-exchange column chromatography, such as affinity chromatography or reverse phase high performance liquid chromatography, A method using the hydrophilic difference can be used.

In one embodiment of the present invention, the cohysine domain is different for each anaerobic microorganism forming a cellulosome, but cochine domain 1 to domain 9 of support protein CbpA of Clostridium cellulovorans, an anaerobic microorganism used in the present invention (Roy H. Doi , The Clostridium cellulovorans cellulosome: An enzyme complex with plant cell wall degrading activity.The chemical record 1 (2001) 24-32) is preferably at least one domain, more preferably domain 6, but a cellosome-forming enzyme These fragments having a search function or their mutants having one or more deletions, substitutions, inversions, etc. of these domains are also included in the marker composition for searching for cellosome-forming enzymes of the present invention.

In a preferred embodiment of the invention, the domain 6 has a sequence identity of at least 80%, at least 85%, at least 90%, at least 93%, with the amino acid sequence set forth in SEQ ID NO: 1 and the amino acid sequence set forth in SEQ ID NO: 1, At least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99%.

In the present invention, the polypeptide has a certain ratio (eg, 80%, 85%, 90%, 95%, or 99%) of sequence identity to another sequence, when aligning the two sequences, By comparison it is meant that the amino acid residues in this ratio are identical. The alignment and percent homology or identity may be determined by any suitable software program known in the art, such as those described in CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (FM Ausubel et al. (Eds) 1987 Supplement 30 section 7.7.18). Can be determined using Preferred programs include the GCG Pileup program, FASTA (Pearson et al. 1988 Proc. Natl Acad. Sci USA 85: 2444-2448), and BLAST (BLAST Manual, Altschul et al., Natl. Cent. Biotechnol. Inf., Natl Lib. Med. (NCIB NLM NIH), Bethesda, MD, and Altschul et al. 1997 NAR25: 3389-3402. Another preferred alignment program is ALIGN Plus (Scientific and Educational Software, PA), which preferably uses basic parameters. Another sequence software program that can be used is the TFASTA Data Searching Program available from Sequence Software Package Version 6.0 (Genetics Computer Group, University of Wisconsin, Madison, Wis.).

In another aspect, the present invention is a) culturing cellulose degradation microorganisms to obtain proteins; b) isolating the proteins; c) the cohesin domain of

claim

1 or 2 effective in the isolated protein Treating the marker composition as a component; And d) identifying a complex of the marker and the protein.

In the search method of the present invention, the cellulose-degrading microorganism is preferably an anaerobic bacterium, and the cellulose-degrading microorganism is Clostridium cellulose, Clostridium thermocell, Clostridium cellulose lightycum, Closs Tridium acetobutylraicum, Clostridium joshua, clostridium papyrosolves, acetiviorio cellulolytics, bacteroids cellulose solbens, luminococos albus, luminococos flab passance, lumi More preferred are, but are not limited to, nococos succinogins, butyliviobrio fibrisolvenes, neocolystic patricial column, offinomyces joyonyl, or offinomiysis PC-2.

In the search method of the present invention, the method of separating the protein is preferably electrophoresis, two-dimensional electrophoresis, but is not limited thereto.

The present invention also provides a recombinant vector pET22b-Coh6 inserted with a cohsin 6 domain gene isolated from Clostridium cellulose boranth.

In another aspect, the present invention provides a method for producing a protein comprising a) adding a dockerine domain to a target protein; And b) treating the cohesin domain of the present invention with the target protein-docerine domain complex.

The present invention artificially aids in lipases, for example, when using the cell-somal formation principle, cohysine-docorin binding, without restricting the cellulose to cellulose according to the principle of cellulose formation. When the curin domain is added, the invention can be used to search the movement path of the lip phase in real time using the cohesine marker, or to search at which site the specific phase is concentrated.

In addition, in a method for separating and purifying a protein of interest using the cohsin domain of the present invention from a fusion protein produced by fusion of a gene encoding a protein of interest with a dockerine sequence of the present invention in vivo, Docker peptide consisting of 15-21 amino acids between the target protein and other peptides or proteins by introducing a DNA sequence encoding 15-21 amino acids at the junction of the coding gene and other peptides or genes encoding the gene. Process using one or more of isoelectric point sedimentation tablets, affinity screening tablets for metal salts, polar tablets, hydrophobic tablets, hydrophilic tablets, antibody affinity tablets, and organic solvent fractionation. It provides a method for separating and purifying the target protein from the fusion protein through.

For example, the DNA sequence encoding 7-15 amino acids behind the gene encoding other peptides or proteins of the present invention is a dockerine gene, which binds the dockerine sequence (SEQ ID NO: 8) to the back of the encoding protein. Thereby purifying through the interaction of docerin and cohysine.

In the separation and purification method, it is preferable to cleave the fusion protein to cleave the other protein fused to the target protein to include an affinity peptide, and then isolate and purify the target protein using an affinity screening method using a metal salt. It is not limited.

In another aspect, the present invention (i) providing at least one cohysine domain and dockerine selected from the nano-complex forming material, cohysine domain 1 to domain 9 in the same field or system; (ii) the cohysine and dockerine Forming nano-high complexes by interaction; And (iii) determining whether the nano-high complex is formed to determine the interaction.

In the present invention, 'nano high unit complex' means a large complex that can be easily observed through the interaction of the affinity peptide sequence cohysine and dockerine,

'Nano high unit complex forming material' refers to any material having the properties and functions capable of forming the nano high unit complex.

In one embodiment of the present invention, an example of the nano-high unit complex forming material is a cellosome-forming enzyme, the nano-high unit complex is preferably a cellosome, but is not limited thereto.

In another aspect, the present invention (i) providing a library of nano-assembly matrix forming material, dockerine and cohysine in the same field or system; (ii) the dockerine and nose Forming a nano-high unit complex by interaction of hisine libraries; (iii) determining whether the nano-high unit complex is formed to determine the interaction between dockerine and cohisine; And (iv) selecting, separating, and identifying dockerine that interacts with the cohysine to form a nano-high complex, as a target material.

Hereinafter, the present invention will be described.

The present invention provides a simple method using cellulosome-forming enzymes, which are cellulosic complexes produced from the anaerobic microorganism Clostridial cellulose boron, which degrades wood-based fibrin, using the relationship between the docurin domain and the cohysine domain. It is a technique to detect only cellulosome forming enzymes. More specifically, anaerobic microorganisms using wood fiber as an energy source form cellulosomes, cellulosome complexes, unlike aerobic microorganisms, in order to decompose fibers more effectively (Bayer et al. The cellulosome: multienzyme machines for degradation of plant cell wall polysaccharides.Annual Review of Microbiol 58 (2004) 521-554). The principle of cellulosome formation is a complex formed by the mutual binding between the dockerine domain of the cellulosome-forming enzyme and the cohisine domain of the support protein. Of course, in addition to cellulosome-forming enzymes, non-cellosome-forming enzymes are also produced, and a combination of the two enzymes has a synergistic effect, which breaks down the fiber more efficiently. The technique can selectively detect only cellulosome-forming enzymes by only one step of binding by fluorescently labeling the cohysine domain of the support protein.

"Cellulosome-forming enzymes" in the present invention has a protein sequence (docranine domain) that is repeated twice differently from non-cellosome-forming enzymes, and the dockerine domain is a protein-protein binding to the co-cycin domain of the support protein. Enzymes forming cellulosomes (Bayer et al. The cellulosome: multienzyme machines for degradation of plant cell wall polysaccharides.Annual Review of Microbiol 58 (2004) 521-554).

The present invention can easily search for cellulosome-forming enzymes of anaerobic microorganisms using wood-based fibrils that have not been genetically analyzed as an energy source, and furthermore, by artificially manipulating the found cellulosome-forming enzymes, they are enriched on the planet. It will be an efficient screening technique to build an efficient fibrinolysis system that converts fiber into a valuable energy source, sugar or ethanol.

Anaerobic microorganisms, which use wood fiber as an energy source, form cellulose complexes, cellulase complexes, in order to break down cellulose more efficiently. Cellulosomes are not found in aerobic microorganisms and are expressed only in anaerobic microorganisms utilizing fiber. The formation of cellulosomes consists of the cross-linking between the dockerin domain of the cellulosome-forming enzyme and the cohisine domain of the support protein.

In the present invention, it was confirmed that only the cellulosome-forming enzyme can be easily and effectively searched by separating and fluorescently labeling the cohine domain from the support protein of Clostridium cellulose boronase, an anaerobic microorganism that has not been ended in gene sequencing.

In one embodiment of the present invention, a cohysine 6 domain gene was obtained through a PCR reaction using Clostridium cellulose boron genomicdiene as a template, and a recombinant vector was produced by subcloning the obtained gene into an E. coli protein expression vector. .

Subsequently, E. coli was transformed using the recombinant vector into which the cohysine 6 domain gene was inserted. Afterwards, the gene was expressed and purified to obtain a pure protein at all times, and the extracellular secreted protein generated from Clostridium cellulose boronase was labeled with fluorescent dyes using an IPG (immobilized pH gradient) strip of pH 4-7. Two-dimensional polyacrylamide gel electrophoresis was performed. Then, the gel was subjected to Coomassie Blue staining to examine the expression of the protein and to bind with fluorescently labeled cohisine markers to selectively identify only cellulosome-forming enzymes with dockerine. As a result, the cellulosome-forming enzyme of 14 ± 3 out of 40 ± 10 spots could be detected. After that, the analyzed spots were identified by cellulose-forming enzymes by LC / MS / MS analysis.

The biomarkers are preferably detected by two-dimensional electrophoresis, but are not limited thereto.

In addition, using the cellulosome enzyme screening method, it was confirmed that it can be very efficiently searched in one binding step, unlike the existing method.

In addition, the fusion protein attached to the back of the coding protein to confirm the use of the cohysine marker developed in the present invention to confirm the purification of the protein and the formation of nano-high complex complex is EgE activity of thermocellum derived from Clostridium In order to clone the chimeric EgE gene linking the region gene and the dockerine module of the Clostridium-derived EngB gene, the 5 'of the forward primer is referred to as the base sequence excluding the signal peptide portion. The primer was synthesized such that the restriction enzyme Spe1 recognition sequence was inserted into 5 'of the primer and the overlapping sequence was inserted into 5' of the overlapping primer. Subsequently, PCR was performed by using a Splice Overlap Extension (SOE) technique using the synthesized primer, and the skeletal protein including the cochine and cellulose binding module is a basic skeleton of cellulose boranth derived from Clostridium. Small cellulose-binding protein-A with a Cellulose binding module (CBM) and two Cohesin modules in Cellulose-binding protein A, a primary scaffolding subunit (Mini-Cellulose-binding protein A) In order to clone the gene, the base sequence was referred to with reference enzyme 5 'of restriction enzyme (Referase) and restriction enzyme Spe1 recognition sequence inserted into reverse primer (Reverse primer) Synthesized with a primer.

As described above, in the present invention, it was confirmed that cellulosome-forming enzymes produced in Clostridium cellulose boranth can be easily and selectively searched by using fluorescently labeled cohissine markers. According to the present invention, it has been confirmed that the present invention can be effectively used to search for cellulosome forming enzymes of microorganisms that produce cellulosomes that have not yet completed gene sequencing. It is expected to be useful for developing artificial enzymatic complex systems that can efficiently decompose the most abundant and renewable wood-based biomass in the natural state into high value products.

1 is a figure confirming the PCR product of the cohisine 6 domain gene of the support protein CbpA of Clostridium cellulose by performing agarose gel electrophoresis in the present invention;

FIG. 2 is a schematic diagram of the recombinant vector pET22b-Coh6 into which the cohsin 6 domain gene of the support protein CbpA of Clostridium cellulose boranth as shown in the present invention is inserted;

FIG. 3 is a diagram illustrating purification of cohysine 6 domain from support protein CbpA of Clostridium cellulose boron in the present invention and separated by 15% SDS-PAGE; FIG.

Figure 4 is an illustration of purified extracellular secretion enzymes of Clostridium cellulose boron in the present invention and separated by 10% Chemical gradient SDS-PAGE;

Figure 5 is an illustration of the two-dimensional electrophoresis of the extracellular secretion protein of anaerobic microorganism Clostridium cellulose boranth in the present invention; And

FIG. 6 is a diagram of selectively detecting extracellular secreted proteins of anaerobic microorganism Clostridial cellulose boron bores by two-dimensional electrophoresis and attaching fluorescently labeled cohiscin markers to selectively detect only cellulose-forming proteins.

Figure 7 (A) is a figure confirming the PCR product of the chimeric endo-beta-1,4-glucanase-gene by performing agarose gel electrophoresis in the present invention, (A) Lane 1, 1kbp DNA marker; Lane 2, chimeric CelE PCR product,

Figure 7 (B) is a figure confirming the PCR product of the small cellulose binding protein A gene by performing agarose gel electrophoresis in the present invention, (B) Lane 1, 1kbp DNA marker; Lane 2, miniCbpA PCR product.

8 is a diagram illustrating a method for purifying affinity proteins using the interaction between cohissin and dockerine in the present invention.

9 is a view showing the formation of enzyme complexes using Native PAGE for use in the formation of polymer nanocomposites using the interaction of cohisine and dockerine in the present invention, Figure 9 Lanes: 1, EngE; 2, EngD, 3, Coh 6; 4, EngE and Coh6 mixtures; 5, represents a mixture of EngD and Coh6,

10 is a view confirming the interaction of cochine and dockerine through the enzyme-linked interaction assay (ELIA) method for use in the formation of polymer nanocomposites using the interaction of cochine and dockerine in the present invention.

The present invention will be described in more detail with reference to the following non-limiting examples. However, the following examples are intended to illustrate the present invention, and the scope of the present invention is not to be construed as being limited by the following examples.

Example 1 Amplification of the Cohysine Domain No. 6 Gene of the Support Protein CbpA of Clostridium cellulose Borland

Forward primer GG GGATCC TGTTAAAACTGTAACAGCTACA (SEQ ID NO: 6) with reference to the base sequence of 6 parts of cohisine domain from the genomic DNA of Clostridium cellulose in order to obtain a large amount of cohysine domains for the production of the cohysine marker. In No. 2) 5, restriction enzyme BamHI and reverse primer CCC CTCGAG TTGACTTGGTTCTATTGTAACGC (SEQ ID NO: 3) were designed to synthesize primers to insert the restriction enzyme XhoI recognition sequence. Then, PCR was performed using the synthesized primers. As a result, the PCR band containing the 436 bp cohysine 6 domain gene was identified and is shown in FIG.

Example 2: Cloning and Purification of Cohysine Domain Genes

The cohysine amplification product obtained in Example 1 was electrophoresed on a 0.8% agarose gel and DNA fragments on the agarose gel were recovered using a gel extraction kit (Elpis, Korea). After digestion with restriction enzymes BamHI, XhoI , ligation was performed on the E. coli protein expression vector pET-22b (Novagen, USA) to transform Escherichia coli (E. coli ) BL21 DE3 and completed. The vector is shown in FIG. Thereafter, the transformed E. coli was inoculated into a Luria-Butani culture solution containing empicillin (50 μg / mL), and then cultured at 37 ° C. until A ₆₀₀ = 0.6, and then isopropyl-β-D-thiogalactopi Lanoside (IPTG) was added to a total concentration of 0.5 mM and incubated at 30 ° C. for 8 hours. Then, E. coli was separated by centrifugation (4,000 X g, 20 minutes), and then dissolved in 10 mL lysis buffer (50 mM NaH ₂ PO ₄ , 300 mM NaCl, 10 mM Imidazole, pH 8.0), and then ground by ultrasound. The insoluble proteins were then removed by centrifugation (10,000 X g, 30 minutes), and the water soluble proteins were separated to purify the cohisine 6 domain using affinity chromatography using histidine labels contained in the recombinant protein and SDS-PAGE. Checking the size of 17kDa was confirmed and shown in FIG.

Example 3: Fluorescent Labeling and Detection of Cohysine Domains

In order to use the cohisine domain obtained in Example 2 as a biomarker for the search for cellulosome-forming enzymes, light labeling was performed using Alexa Fluor 647 protein labeling kit (Molecular Probes, USA). Fluorescently labeled cohysine was explored with a ProXPRESS 2D (Perkin Elmer, USA) imaging device. Fluorescent dyes absorb the 650 nm wavelength as much as possible and emit 668 nm.

Example 4 Acquisition of Extracellular Secretion Enzyme in Clostridium Celluloboranth

Clostridium cellulose boranth (ATCC 35269) was incubated at 37 ° C. for 6 days using a culture solution containing 1% Avicel (crystalline cellulose) in an anaerobic state. Thereafter, the culture was purified by affinity chromatography using Avicel. The culture solution was poured into a column packed with Avicel, washed with 50 mM phosphate buffer (pH 7.0), and then washed with 12.5 mM phosphate buffer (pH 7.0). Thereafter, the enzymes were purified with water. Then, ultrafiltration (Milipore, USA, cut off 10 kDa) was concentrated and confirmed by SDS-PAGE and shown in FIG.

Example 5: two-dimensional polyacrylamide gel electrophoresis

In order to separate the enzymes obtained in Example 4 into each of the enzymes, two-dimensional polyacrylamide gel electrophoresis was performed. IPG (immobilized pH gradient) strips (pH 4-7) (GE Healthcare BioSci, USA) were rehydrated for 16 hours by adding 125 μl of Destreak rehydration solution (GE Healthcare BioSci, USA). Isoelectric focusing (IEF) was performed at 20 ° C. using an Ettan IPGphor II electrophoresis system (GE Healthcare BioSci, USA) as follows. The first step allowed the protein to enter the gel from 100 V to 100 Vhr, 200 V to 200 Vhr, 300 V to 300 Vhr, 500 V to 500 Vhr, and 1000 V to 1000 Vhr and 1000 V to 5000 Vhr. We increased until it was and fully focused from 5000 V to 23000 Vhr. Prior to two-dimensional electrophoresis, the strips were kept for 15 minutes in equilibration buffer (75 mM Tris-HCl, 6 M urea, 2% SDS, 29.3% glycerol, 0.002% Bromophenol blue) containing 1% dithiothreitol (DTT). The reaction was carried out for 15 minutes in an equilibration buffer containing 4% iodoacetamide. The equilibrated strip was placed on top of the SDS-PAGE gel (10 cm, 10%) and subjected to electrophoresis using a Mini protean tetra cell two-dimensional electrophoresis system (Bio-Rad, USA). Two-dimensional electrophoresis gels immobilized the protein with fixative solution (10% acetic acid, 25% isoprophanol). As a result, about 40 ± 10 spots per gel were obtained and shown in FIG.

Example 6: Screening of Cellulosome-forming Enzymes Using Fluorescently Labeled Cohissine Markers

The 2D electrophoresis-treated gel obtained in Example 5 was blotting onto a PVDF membrane, followed by 2% blocking solution (TBS-T (5 mM Tris-Cl pH 8.0, 0.138 mM NaCl, 1% Tween 20) buffer + 2% skim milk powder). ) Was blocked on the shaker for 1 hour and the solution was removed. Then, add 2 μg fluorescent labeled cohissin to the 2% blocking solution, bind on the shaker for 1 hour and remove the solution. Then add TBS-T buffer and replace with fresh TBS-T once every 10 minutes for 30 minutes on the shaker. Cohysine markers remaining without binding were removed. Then, the protein detected and detected using an image device, ProXPRESS 2D (Perkin Elmer, USA), was identified and labeled through sequencing using an LC / MS / MS instrument and shown in FIG. 6. As a result, in addition to the known cellulosome-forming enzymes in a simple manner, it was found that cellulosome-forming enzymes, which are presumed to be new celluloses that have not yet been found, are summarized in Table 1.

Table 1

Protein ^a	Molecular weight (kDa)	pI	Partial sequence	Homology ^b
NC1	75	4.9	SQIDYALGSTGR	Clostridium cellulolyticum Endoglucanase G
NC2
	70	4.7	TTYNSPYVVTLDELFLGSFVDCPGSDSFTVVYPSNYTDVALFLVA	Clostridium cellulolyticum H10Glycoside hydrolase family 26 (Precursor)
NU1	70	4.7	DESLTSLGL DTVWSASNVC	NS
NU2	48	5.8	MFKTLEPVQSTSNDLSCLQTW	NS
NU2	48	6	MKTSNDLLY	NS
NU3	45	4.8	SSGLFDYNMTTTLVELLFGSETLVT	NS
NU4	65	4.5	WQEVGELEVELDVGELMVLGSSLVGGWADLGLN	NS

Table 1 above lists the newly discovered cellulosome forming enzymes in Clostridium cellulose boranth by the method of the present invention. In the table, ^a NC is a protein suspected of a new cellulosome forming enzyme, NU represents a new cellulosome forming protein of unknown function, and ^b NS means no matching information.

Example 7: Confirmation of protein purification and nano-high complex formation through interaction of peptides

In order to confirm the use of the cohysine marker developed in the present invention, the purification of the protein and the formation of the nano-high complex were confirmed. The fusion protein that gave the dockerine tail to the back of the coding protein was prepared as follows.

Of the endo-beta-1,4-glucanase-E (CelE) gene of Clostridium-derived thermocell and the endo-beta-1,4-glucanase-ratio (EngB) of cellulose boron derived from Clostridium In order to clone a chimeric endo-beta-1,4-glucanase-di gene with a dokerin site, the 5 'of the forward primer is limited by reference to the nucleotide sequence of the chimeric CelE. "a restriction enzyme NotI recognition sequence is inserted into each of primers (Forward primer - 5'AAA GGATCC GTCGGGAACAAAGCTTTTG3 ' 5 of the enzyme BamHI, a reverse primer (reverse primer) (SEQ ID NO: 4); reverse primer - 5'CCC GCGGCCGC TCATAAAAGCATTTTTTTAAGAACA3' ( SEQ ID NO: Number 5), underscores indicate restriction enzyme sites). Thereafter, PCR was performed using the synthesized primers. As a result, a PCR band containing the chimeric CelE gene derived from Clostridium of 1.3 kbp was identified, which is shown in FIG. 7 (A).

In order to clone the small cellulose binding protein A (miniCbpA) gene, which is a cellulosome basic skeletal subunit of cellulose boron derived from Clostridium, the restriction enzyme BamHI was identified at 5 'of the forward primer with reference to the base sequence of miniCbpA. , and the reverse primer of (reverse primer) 5 ', the restriction enzyme NotI recognition sequence, each insert primer (Forward primer - 5'CCC GGATCC AGCAGCGACATCATCAATGTC3' ( SEQ ID NO: 6); reverse primer - 5'CCC GCGGCCGC TCATATAGGATCTCCAATATTTA3 '( SEQ ID NO: 7 ), Underscores indicate restriction sites). As a result, a PCR band containing a 1.6 kbp clostridium-derived cellulose boranth miniCbpA gene was identified, which is shown in FIG. 7 (B).

Using this fusion protein, protein purification was performed using the interaction between the cellulose-binding module (CBM) and cellulose of the small cellulose-binding protein.

Cellulose (Sigmacell Type 50, SIGMA) was added and reacted at room temperature for 1 hour for protein purification using the interaction between cellulose-binding module (CBM) and cellulose. After the reaction, the mixture was rinsed three times with 1 mol sodium chloride 0.02 mol Tris buffer (pH 8.0) and eluted with 0.05 mol Tris buffer (pH 12.5). SDS-PAGE electrophoresed the enzyme protein using 10% poly-acrylamide gel.

As a result, the miniCbpA protein band purified at the 58 kDa position was confirmed. This result is shown in FIG. For the purification of the protein, a fusion protein was prepared by attaching a dockerine tail that interacts with cohysine at the back of the coding protein.

Cellulose, a primary scaffolding subunit of cellulose boranth-derived cellulose boranth, a skeletal protein prepared for complexation between cohisine and the present protein for protein purification and confirmation of formation of nanopolymer complexes in the present invention. Mini-Cellulose-binding protein A with Cellulose binding module (CBM) and two Cohesin modules in Cellulose-binding protein A By using the binding of cellulose to CBD contained in the gene, the same method as described above in the method of protein expression and purification was also used, and Ca ²⁺ ions were used to elute the fusion protein.

In addition, as an experiment for confirming the binding of cohysine and dockerine for the use of cohysine markers in the formation of nano-higher complexes in the present invention, nano-higher complexes by confirming the binding of cohysine and dockerine through native PAGE It was found to be a peptide module suitable for formation. This result is shown in FIG. In addition, Elia (enzyme-linked interaction assay) confirmed the interaction of the peptides. Cohesine coated on microplate at 25 ° C. for 2 hours to bind with other substances in TrisNC buffer (50 mM Tris, 100 mM NaCl, 2 mM CaCl ₂ , and 0.02% sodium azide, pH 7.5) containing 3% BSA protein Inhibited. After washing three times with TrisNC buffer, a cellulase including dockerine was added to react with cohicin and dockerine for 2 hours. After washing three times after the reaction by specifying the cellulase activity was confirmed the activity of cohysine and tokerin. This result is shown in FIG.

Claims

Marker composition for searching for cellosome-forming enzyme having a cohesin (cohesin) domain as an active ingredient.
[Claim 2] The marker composition of claim 1, wherein the cohisine domain is labeled with a labeling means selected from the group consisting of a fluorescent substance and a radioisotope.
[Claim 3] The marker composition of claim 1 or 2, wherein the cohisine domain is one or more domains selected from cohisine domain 1 to domain 9.
4. The marker composition of claim 3, wherein the cohysine domain is domain 6.
[Claim 5] The marker composition of claim 4, wherein the domain 6 has the amino acid sequence of SEQ ID NO.
a) culturing the cellulose degrading microorganism to obtain proteins;

b) separating the proteins;

c) treating the isolated protein with a marker composition comprising the cohesin domain of claim 1 or 2 as an active ingredient; And

d) A method for searching for cellosome-forming enzyme comprising identifying the complex of the marker and the protein.
The method of claim 6, wherein the cohisine domain is labeled with a fluorescent material.
The method of claim 6, wherein the cellulose-degrading microorganism is an anaerobic bacterium.
The method according to claim 6 or 8, wherein the cellulose degrading microorganisms are Clostridium cellulose borrose, Clostridium thermocelum, Clostridium cellulose lyumcum, Clostridium acetobutyl lycum, Clostridium joshua , Clostridium papyrosolves, acetibrio cellulolytics, bacteroids cellulose solvates, luminococos albus, luminococos flavfacience, luminococos succinogins, butylivibrio fibris And at least one strain selected from the group consisting of Solvents, Neocolimatic Partial Column, Opinomyces Zoionyl, and Opinomyces C-2.
7. The method of claim 6, wherein the cohisine domain is at least one domain selected from cohisine domain 1 to domain 9.
11. The method of claim 10, wherein said cohisine domain is domain 6.
a) adding a dockerine domain to the target protein; And

b) treating the target protein-docory domain complex with a cohesin domain marker of claim 1 or 2;
In the method for separating and purifying the protein of interest by processing the cohysine domain from the fusion protein generated by fusion of the gene encoding the protein of interest with the dockerine sequence in vivo,

A gene sequence encoding 15-21 amino acids is introduced at the junction of a gene encoding a protein of interest and a gene encoding a peptide or protein different from the protein of interest, thereby providing 15-21 amino acids between the target protein and another peptide or protein. A method for producing a dockerine peptide consisting of amino acids and separating and purifying the protein of interest from the fusion protein by using the protein properties thereof.
a) providing at least one cohisine domain and dockerine selected from the nano-complex forming material, cohisine domain 1 to domain 9, in the same field or system;

b) forming a nano-high complex by the interaction of the cohysine and dockerine; And

c) A method of searching for an interaction of a substance using an affinity peptide, comprising determining the interaction by measuring whether the nano-high complex is formed.
a) providing a library of nano-assembly matrix forming materials, dockerine and cohisine in the same field or system;

b) forming a nano-high complex by the interaction of the dockerine and cohisine library;

c) determining whether the nano-high complex is formed to determine the interaction between dockerine and cohysine; And

d) a method of detecting a target substance interacting with cohissin comprising the step of selecting, separating and identifying a docurin that interacts with the cohysine to form a nano-high complex as a target substance.