WO2010089541A1

WO2010089541A1 - Assay products, devices and method (klebsiella)

Info

Publication number: WO2010089541A1
Application number: PCT/GB2010/000185
Authority: WO
Inventors: Richard Calder; Paul F. Seaman
Original assignee: Q Chip Limited
Priority date: 2009-02-03
Filing date: 2010-02-03
Publication date: 2010-08-12
Also published as: GB0901708D0

Abstract

Provided are PCR primer sets for the 16S rRNA of Klebsiella organisms and for the fur gene of Klebsiella pneumoniae. Also provided are related probes, probe/primer sets and related reagents, kits and methods and also solid reagents comprising primers and/or probes of the invention.

Description

Assay products , devices and method (Klebsiella)

Field of invention

The present invention relates to assay products, uses and methods, especially those utilising the Polymerase Chain Reaction (PCR) . More specifically it relates to assays for infectious disease organisms (for example those which cause hospital acquired infections) .

Background to invention

Hospital-acquired infections

Hospital-acquired infections (HAIs) are known to not only increase mortality and morbidity among hospitalised patients but also the costs of care. Risk of death and severity of morbidity differs between causative pathogens and is dependent on timely initiation of appropriate treatment of the HAI. Consequently, there is a great requirement for rapid, point-of-care based diagnostic assays that will identify the causative pathogen.

Species of the bacterial genus Klebsiella are found in the environment and also in the human intestinal tract. They are also one of the most important HAI pathogens. Indeed, Klebsiella pneumoniae is the most common species isolated from hospital patients. Most patients are colonised in a variety of sites without serious infection but on occasion Klebsiella pneumoniae can cause severe pneumonia that requires rapid initiation of treatment. A second Current methods for detection of nosocomial Klebsiella infections include various culture-based methods, in-house designed molecular approaches or commercial kits. Whilst culture-based techniques are the traditional approach, they are slow (24-48 h), time consuming to set up and lack the sensitivity and specificity of molecular methods. Consequently, some public health laboratories have developed their own molecular assays; however this can lead to incongruence between laboratories and users. A shift towards molecular-based techniques such as PCR also requires significant training of personnel. In an effort to circumvent these problems some hospitals have taken up the limited number of commercialised clinical diagnostic systems. These platforms often require significant investment in specialised equipment and are expensive to run. They also lack flexibility and leave the users tied to a particular system. Therefore, it is highly desirable for robust and rapid diagnostic assay to be easy to use, stable during storage and compatible with a broad spectrum of PCR formats.

Polymerase chain reaction

Polymerase chain reaction (PCR) is a method of detecting nucleic acids in a highly sensitive sequence-specific manner involving amplification of one or more target sequences by using a thermostable polymerase enzyme and cycling the temperature conditions of the reaction.

In its simplest form, a PCR reaction cycles through three stages, i) a denaturation stage occurring at a temperature of approximately 90 - 100 ⁰C. At this elevated temperature double-stranded DNA denatures or "melts" to form single-stranded DNA, ii) primer annealing at a typical temperature of 50 - 65 ⁰C. In this step the forward and reverse primers hybridize to the complimentary regions of any target present in the solution, and iii) extension typically occurring at 50 - 80 ⁰C during which the polymerase chain reaction utilises deoxynucleotide triphosphates in the solution to extend the 3' end of the primers. Typically, the cycle is carried out 25 - 45 times. According to certain PCR protocols the annealing step and the extension step may be conflated so that the sample cycles through a two-step programme of 90 ⁰C to 100 ⁰C then 50 ⁰C to 80 ⁰C intervals. Theoretical calculations show that a 30 cycle PCR reaction can amplify a single target molecule 268,435,456 times. Because of inefficiencies in the amplification reaction, actual amplification may be less than this, but nevertheless the PCR reaction is typically able to amplify single or very low numbers of target molecules by millions of times to a level at which they can be much more easily detected. PCR reactions rely on a thermostable DNA polymerase, for example, Taq polymerase isolated from the thermophillic bacterium Thermus aquaticus. Other thermostable DNA polymerases can be used in place of Taq, for example, Pfu polymerase isolated from Pyrococcus furiosus which has a proof-reading activity absent from Taq polymerase and is therefore a higher fidelity enzyme.

A review of the polymerase chain reaction is found in most molecular biology textbooks, see, for example, "Principles of Gene Manipulation - An Introduction to Genetic Engineering" by Old and Primrose, Blackwell Science Ltd. There are a number of different "PCR formats". As a basic requirement, a PCR reaction requires a forward primer and a reverse primer designed to hybridize either side of the target sequence. The amplification reaction occurs in respect of the intervening sequence between the two primers. The detection of amplified PCR products may be carried out in a non-specific way which merely detects the presence of double-stranded nucleic acid (for example, by use of a double-stranded-DNA interchelating dye such as ethidium bromide or SYBR- green). Alternatively, a semi-specific detection of product may be carried out by resolving approximate molecular weight of the product, for example, by carrying out an electrophoresis of the reaction products prior to detection. Alternatively, there are a number of sequence-specific detection methods which typically involve the hybridization of a sequence-specific nucleic acid probe to the amplified region or which measure the degradation of the probe concomitant with the amplification of the target sequence and make use of the nucleic acid exonuclease activity of the nucleic acid polymerase. PCR based methods of detection for pathogenic agents typically offer the advantage of faster results than more traditional methods which usually involve culture and incubation over a number of days. A PCR result can be made available in a few hours or less. Two known drawbacks of PCR based assays are firstly that the reagents often lack stability in storage especially at room temperature and may need to be frozen in aliquots which obviously contributes to expense and inconvenience and secondly that the setting up of PCR reactions involves the accurate measuring of small quantities of multiple ingredients. This requires a degree of skill and a risk of error which may be at least partially mitigated by providing to the testing laboratory ready-mixed reagents comprising more than one component of a PCR reaction which have been pre-prepared and optionally aliquoted in the supplier's factory. There is a need for both individual components of PCR reactions and ready-mixed reagents containing mixtures of multiple components to be provided in an easily dispensable and storage-stable condition.

The present invention provides products and methods for carrying out a polymerase chain reaction assay for the detection of Klebsiella organisms.

Summary of invention

According to a first aspect of the invention there is provided a first PCR forward primer comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO: 1

SEQ ID NO: 1 : CCTYRTCGATTGACGTTACCCGCAGAAGAAG

wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues and wherein X is an integer from 16 to 26 and wherein Y represents C or T and wherein R represents G or A.

According to a second aspect of the invention there is provided a first PCR reverse primer comprising a nucleic acid sequence consisting of X contiguous residues selected

SEQ ID NO:3: ACTCYAGCCTGCCAGTTTCGAATGCAGTTCC

wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues and wherein X is an integer from 16 to 26, and wherein Y represents C or T.

According to a third aspect of the invention there is provided a first nucleic acid probe comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO: 5

SEQ ID NO:5: TAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAA

wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues, and wherein X is an integer from 23 to 33.

According to a fourth aspect of the invention there is provided a PCR reagent comprising a first PCR forward primer according to the invention and a first PCR reverse primer according to the invention.

According to a fifth aspect of the invention there is provided a solid reagent comprising one or more of the following components: a) a first PCR forward primer according to the first aspect of the invention, b) a first PCR reverse primer according to the second aspect of the invention, c) a first nucleic acid probe according to the third aspect of the invention, or d) a PCR reagent according to the fourth aspect of the invention.

According to a sixth aspect of the invention there is provided a kit comprising at least one of the following: a) a first PCR forward primer according to the first aspect of the invention, b) a first PCR reverse primer according to the second aspect of the invention, c) a first nucleic acid probe according to the third aspect of the invention, or d) a PCR reagent according to the fourth aspect of the invention, or e) a solid reagent according to the fifth aspect of the invention.

and one or more further components chosen from:

i) instructions for carrying out a PCR reaction ii) instructions for carrying out a detection of products of a PCR reaction iii) a container, microtitre plate or solid reaction substrate

According to a seventh aspect of the invention there is provided a use of a first PCR forward primer according to the first aspect of the invention, a first PCR reverse primer according to the second aspect of the invention, a first nucleic acid probe according to the third aspect of the invention, a PCR reagent according to the fourth aspect of the invention, a solid reagent according to the fifth aspect of the invention or a kit according to the sixth aspect of the invention in a PCR reaction.

According to an eighth aspect of the invention there is provided a method of providing information relating to the identity of an infectious agent in a clinical sample comprising use of a first PCR forward primer according to a first aspect of the invention, a first PCR reverse primer according to a second aspect of the invention, a first nucleic acid probe according to a third aspect of the invention, a PCR reagent according to a fourth aspect of the invention, a solid reagent according to a fifth aspect of the invention or a kit according to a sixth aspect of the invention to carry out simultaneous multiplexed PCR reactions for detection of the presence of organisms of the Klebsiella genus and Klebsiella pneumoniae in said clinical sample, or a derivative thereof.

According to a ninth aspect of the invention there is provided a method of treating an infection comprising obtaining a clinical sample from a subject suspected to having said infectious disease, carrying out a method according to the eighth aspect of the invention on said clinical sample in order to provide information relating to the identity of the infectious agent, and using this information to select an appropriate antibiotic for treatment of the infection and, administering said selected antibiotic to said subject.

Brief description of the drawings

Figure 1 is a photograph of an example of a reagent-containing microsphere as viewed by light microscopy. The radius is measured as 705.2 μm, the surface area as 1562299.1 μm² and the perimeter as 4430.8 μm.

Figure 2 shows fluorescence plotted against cycle number for the experiment described in Example 1.

Figure 3 shows data demonstrating storage stability of encapsulated reagent.

Definitions

Polymerase Chain Reaction (PCR)

As described in the background section, polymerase chain reaction (PCR) is a technique widely used in molecular biology to amplify a piece of DNA by in vitro enzymatic replication. As the reaction progresses, the DNA generated by earlier replications are used as templates for later replications. This sets in motion a chain reaction in which DNA template is exponentially or approximately exponentially amplified. With PCR it is possible to amplify single or very few copies of nucleic acid across several orders of magnitude generating a million or more copies which may be more easily detected. The basic PCR set-up requires the following components: i) a DNA template or target to be amplified; ii) a pair of primers; the forward primer which is complementary to the DNA region at the 5' prime end of the target region and the reverse primer which is complementary to the DNA region at the 3' prime end of the target region; iii) a thermostable DNA polymerase, for example, Taq polymerase; iv) deoxynucleoside triphosphates (dNTPs). These are used as the building blocks from which the DNA polymerase synthesises the new DNA strand; v) a suitable buffer solution; vi) magnesium ions or other suitable cations; vii) monovalent potassium ions or other suitable cations.

A number of PCR variants exist, for example, muliplex PCR involves the simultaneous amplification of more than one target in a single sample container. Multiplex PCR includes duplex and triplex PCR reactions involving up to a dozen sets of primers acting independently.

Nested PCR is a technique which can be used to increase specificity of a PCR amplification reaction. Two sets of primers are used in two successive reactions, hi the first one a pair of primers is used to generate DNA products in a less than completely specific fashion. Nevertheless, the first reaction increases the instance of the target sequence. The second reaction is more specific and amplifies a sequence nested within the first set of primers.

Quantitative PCR (or QPCR) is used to measure or estimate the specific amount of target DNA in a sample. The normal PCR process may, under some circumstances, be approximately quantitative but the aim of true quantitative PCR is to run the amplification reaction or consider the results of the amplification reaction only within the phase of true exponential increase of product amount, thereby avoiding the later plateau phase of amplification. The amount of product in the exponential phase of amplification is much more proportional to the initial amount of target. Thermocycles have been developed which can monitor the amount of product during amplification. One method currently used is quantitative real-time PCR which uses a fluorescent dye such as SYBR- green or fiuorphore containing DNA probes such as the proprietary Taq-Man system to measure the amount of amplified product as the amplification progresses.

Hot-start PCR avoids a possible problem whereby the primers are able to bind at low temperatures to non-specific locations or even to each other. Hot-start PCR is based on the principle of releasing the primers for hybridization only when the reaction temperature is sufficiently high to prevent or reduce non-specific primer binding. The technique can be performed manually by heating the reaction components to the denaturation temperature, for example 94 ⁰C before adding the polymerase or before adding the primers. Alternatively, specialised systems have been developed which inhibit the reaction until the temperature is raised by, for example, binding one or more of the components in an inactive form to be released on the raising of temperature.

Reverse transcriptase PCR (RT-PCR) is a method used to amplify RNA in which a PCR reaction is preceded by a reaction using reverse transcriptase to convert RNA to cDNA. The two reactions are sufficiently compatible that they can be run in the same tube and be carried out in the same thermal cycling instrument.

Methylation-specific PCR or (MSP) involves pre-treating the target DNA with sodium bisulphite which converts unmethylated cytosine units into uracil which is recognised by the DNA primers as thymine. Two amplifications are carried out on the modified DNA using primer sets which distinguish between the modified and unmodified templates. One primer set recognises DNA with cytosines and amplifies the previously unmethylated DNA and the other set recognises DNA with uracil or thymine to amplify methylated targets. The relative proportions of the two amplifications can be used to obtain information about the extent of methylation.

Primers

Primers comprise synthetic oligonucleotides designed to hybridize either side of the target nucleic acid sequence. A set of primers consists of a forward primer and a reverse primer. Both primers are extended by the PCR reaction from the 3' end and the forward primer and reverse primer are designed therefore to anneal to the complementary DNA strands produced by melting of a double-stranded DNA helix.

Probes A nucleic acid probe may be used to detect in a sequence-specific fashion the products of a PCR reaction. Typically, such a probe is designed to anneal to the target sequence at a position intermediate between the positions at which the primers anneal. The probe may be labelled with a label to assist in its detection, for example, a fluorochrome, a radioactive label, an electrochemically active label or an enzymatic label. The label may be linked directly to the nucleic acid or by means of a linker moiety. The probes of the present invention are particularly suitable for the TaqMan PCR format. TaqMan is a method of real time quantative PCR available from Applied BioSystems Limited. In the TaqMan format real time measurements of accumulation of the PCR product during the experimental phase of the amplification is taken. This is carried out in order to determine a threshold cycle, i.e., the number of PCR cycles at which a threshold level of signal is detected. The PCR probes in a TaqMan format are fluorescently labelled and complimentary to a segment of approximately 20 to 60 nucleotides within the DNA template located between the two primers. Suitable fluorescent labels for use in a TaqMan system include 6 carboxy-fluorescein (FAM) or tetrachlorofluorescein (TET). The TaqMan probe is typically labelled with such a fluorochrome and also labelled with a quencher molecule, for example, tetramethylrhodamine (TAMRA). The close proximity between the fluorochrome and the quencher inhibits the fluorescence of the fluorochrome. However during the primer extension phase of the PCR reaction the Taq polymerase also exhibits 5' to 3' exonuclease activity which degrades the portion of the probe that is already annealed to the template. Degradation of the probe releases fluorochrome from it. The fluorochrome is no longer in close proximity to the quencher, thus the quenching effect is diminished and the fluorescent signal given off by the fluorochrome increases and may be detected.

Detailed description of the invention

PCi? Primers The present invention provides PCR primers for the detection of members of the Klebsiella genus. Those primers are designed to target the gene encoding the 16S rRNA of Klebsiella organisms. In alternative embodiments the same sequences could be used to target cDNA corresponding to 16S rDNA in a RT-PCR reaction.

16S rRNA is a 1542 nucleotide long component of the small prokaryotic ribosomal subunit (30S), the gene for which has a number of properties that make it an excellent target for PCR-based pathogen detection. Firstly, 16S rRNA is essential to translation in prokaryotes and hence 16S rRNA genes are present in every prokaryotic genome. Secondly, 16S rRNA gene sequences contain both highly conserved and hypervariable regions. Specific design of PCR primers and probes to these regions has enabled the development of assays of varying phylogenetic resolution.

Through bioinformatic analysis of 16S rRNA gene sequences from members of the target genus and outlier species, the inventors have identified a Klebsiella genus-specific 16S rRNA signature sequence. Subsequently, the inventors designed a first PCR assay that targets this genus-specific sequence and which is compatible with the second PCR assay that is specific to K. pneumoniae and which is described in more detail below.

According to a first embodiment of the invention there is a provided a first PCR forward primer comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO.1

SEQ ID NO: 1 : CCTYRTCGATTGACGTTACCCGCAGAAGAAG

wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues and wherein X is an integer from 16 to 26 and wherein Y represents C or T and wherein R represents A or G.

According to certain embodiments X is from 17 to 25, from 18 to 24, from 19 to 23, from 20 to 22. Most preferably X is 21. There may be 5, 4, 3, 2, 1 or 0 additions of residues, deletions, residues or substitutions of residues.

The primer may optionally include labelling moieties, for example fluorochromes.

According to certain preferred embodiments the first forward PCR primer has a sequence as given in SEQ ID NO:2

SEQ ID NO:2:TCGATTGACGTTACCCGCAGA

wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues. The number of further mutations may according to certain embodiments may be as defined above.

According to a second embodiment of the invention there is provided a first PCR reverse primer comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO:3

SEQ ID NO:3: ACTCYAGCCTGCCAGTTTCGAATGCAGTTCC

Wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues and wherein X is an integer from 16 to 26 and wherein Y represents C or T.

The number of mutations, labelling and the value of X may optionally be as defined above in respect of the first aspect of the invention.

According to certain preferred embodiments the first PCR reverse primer has the nucleic acid sequence given in SEQ ID NO:4 SEQ ID NO:4: AGCCTGCCAGTTTCGAATGCA

wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues.

The number and type of further mutations may optionally be as defined above.

Nucleic acid probe

The inventors have also provided a first nucleic acid probe which is designed to hybridize between the positions at which the first forward primer and the first reverse primer hybridize in order to detect the presence of amplified product, for example, in a real time PCR reaction.

Accordingly, there is provided in accordance with a third aspect of the invention a first nucleic acid probe comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO: 5

SEQ ID NO:5: TAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAA

The number and type of further mutations may be as defined above in respect of the first aspect of the invention. X may be from 24 to 32 from 25 to 31 from 26 to 30 or from 27 to 29. X is most preferably 28.

The first nucleic acid probe may be labelled with a marker moiety to assist in detection of PCR product. Most preferably the first nucleic acid probe has the sequence given in SEQ ID NO:6 SEQ ID NO:6: CGCACGCAGGCGGTCTGTCAAGTCGGAT

The number of further mutations may optionally be as defined in respect of the first aspect of the invention.

Labels

The probe may be labelled using any detectable marker, for example, fluorescent radioactive enzymatic or electro chemical marker, may optionally also comprise a quencher moiety and the label may be fixed to either end or to an intermediate region of the probe optionally by use of a linker molecule.

PCR reagents

The invention also provides a number of what are referred to herein as "PCR reagents" which comprise at least two products necessary for carrying out a PCR reaction.

According to a fourth embodiment there is provided a PCR reagent comprising a first PCR forward primer according to the first aspect of the invention and a first PCR reverse primer according to the second aspect of the invention.

Such a PCR reagent may further comprise a double stranded nucleic acid interchelating dye for example ethidium bromide or SYBR-green.

Multiplex reactions

The applicants also provide a method and reagents for carrying out multiplex reactions. Multiplex reactions include duplex reactions wherein two independent PCR reactions take place. In addition to the Klebsiella genus specific reaction reagents are provided containing components to enable further PCR reactions to take place, for example, further reactions suitable for the detection of infectious agents and/or antibiotic resistance factors. According to certain preferred embodiments reagents are provided containing components to enable a species-specific K.pneumoniae reaction to take place. The target for this second reaction is preferably within the fur gene, which encodes a protein involved in the regulation of ferric ion uptake. This species-specific target was identified similarly to the genus-specific genetic marker, by comparing multiple sequences from K. pneumoniae with other species from the genus. The combination of two levels of resolution (genus and species) provides, in a single duplex assay, the ability to detect all possible HAI-associated Klebsiella species whilst also rapidly detecting the most pathogenic of these species. This allows for the appropriate treatment to be commenced at the earliest possible stage.

According to certain embodiments of the invention the PCR reagent further comprises:-

A) a second PCR forward primer comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO: 7

SEQ ID NO:7: CGCATTAAAGAAGGCTGGCCTGAAAGTCAC

wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues; and

B) a second PCR reverse primer comprising a nucleic acid sequence consisting of Y contiguous residues selected from SEQ ID NO: 8

SEQ ID NO:8: CGGATTTTCCGCCTTCGAAATTATGACGAG

wherein the sequences may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues. X and Y may independently be from 15 to 25 from 16 to 24 from 17 to 23 from 18 to 22 from 19 to 21 most preferably X and Y are 20. The number and type of further mutations may be as described above in reference to the first aspect of the invention.

The nucleic acid sequence of the second PCR forward primer may preferably be as given in SEQ ID NO:9

SEQ ID NO^rTAAAGAAGGCTGGCCTGAAA

The number and type of further mutations may be as defined above.

The nucleic acid sequence of the second PCR reverse primer may preferably be as given in SEQ ID NO: 10:

SEQ ID NO: 10: TTTCCGCCTTCGAAATTATG

A PCR reagent according to the invention may further comprise a second nucleic acid probe comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO. 11

SEQ ID NO: 11 : ATCCTTGAAGTGCTGCAGGAACCGGATAACC

wherein X is an integer from 16 to 26 the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues. The number and type of further mutations may be as defined above. According to certain preferred embodiments X may be from 17 to 25, from 18 to 24, from 19 to 23, or from 20 to 22. Most preferably X is 21.

The second nucleic acid probe may be labelled by any means as defined above in respect of the first nucleic acid probe.

The first PCR forward primer, the first PCR reverse primer and the first nucleic acid probe defined herein are designed to participate in a first PCR reaction. The first PCR reaction is specific for members of the Klebsiella genus. The second forward primer, the second reverse primer and the second nucleic acid probe are designed to participate in a second PCR reaction which is preferably, although not necessarily, carried out simultaneously with the first PCR reaction, ie in a multiplex reaction. The second PCR reaction is designed to detect Klebsiella pneumoniae.

Most preferably the labels are chosen such that the signals from them does not interfere with each other so that they may be separately detected. For example if fluorescent probes are used two different fluorochromes are used for example FAM and JOE which have different emission wavelengths.

The nucleic acid sequence of the second nucleic acid probe is preferably as given in SEQ ID NO: 12

SEQ ID NO: 12: TGAAGTGCTGCAGGAACCGGA

wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues which may be as defined above.

According to certain embodiments the PCR reagent comprises a first and second nucleic acid probe wherein at least a portion of said first nucleic acid probe is conjugated to a first fluorochrome and at least a portion of said second nucleic acid probe is conjugated to a second fluorochrome, said first and second fluorochromes being such that upon excitation their peak fluorescence emission wavelengths are sufficiently different from each other to enable the fluorescence signals from the respective fluorochromes to be distinguished from each other.

A reagent according to the invention may contain products necessary for further PCR reactions for example primers and probes for a third PCR reaction. Preferably those reactions are designed in respect of each other so that they allow triplex or higher multiplex reaction to take place. According to certain preferred embodiments the reagent contains products necessary for a PCR reaction directed to the amplification of positive control target sequences.

Microspheres and solid reagents

A solid reagent of the invention may preferably be composed of ingredients such that at room temperature it is a solid particle but that at elevated temperatures, for example, at more than 30 ⁰C, more than 40 ⁰C, more than 50 ⁰C, or more than 60 ⁰C it melts and becomes a liquid solution. Preferably the solid reagent is a hydrogel. It may, for example, be made of polysaccharide, for example, agarose. Alternative materials include wax, polyethylene glycol or poly vinyl alcohol. According to certain preferred embodiments the solid reagents are made by adding agarose to a warmed solution of PCR ingredients and then lowering the temperature to allow the agarose to gel and the solid reagent to form. The liquid solution returns when the temperature rises, for example, in a PCR reaction. A solid reagent may be provided in the well of a microtitre plate or as a solid particle. Solid particles may be manufactured by cutting or punching into a larger slab or solid reagent. Solid reagent may be cast or printed onto a solid substrate.

Most preferably the solid reagent is a solid microsphere.

Preferably, the microspheres are of consistent shape and size. Because solid microspheres may be made to consistent volumes they typically allow for small volumes to be provided more accurately (as a single or counted small number of microspheres of known volume) than can easily be provided by pipetting. Microsphere variability in one or more of the following parameters:- volume, diameter, radius - is preferably of no more than 10%. According to certain preferred embodiments a population of microspheres have a coefficient of variance in their diameter of no more than 5% or no more than 2% of the mean diameter. Microspheres are preferably from 0.5 to 2.0 mm, 0.8 to 1.5 mm or 1.0 to 1.3 mm in diameter. A single microsphere preferably contains sufficient ingredients for a single PCR reaction vessel. A number of methods exist for manufacturing regular microspheres. For example they may be precipitated from solution or be made in an emulsion. The microspheres as a present invention are particularly suited to being made by the methods detailed in WO2006/082351, EP1358931 and WO2004/043598 (which are incorporated herein by reference). Essentially, those methods involve exploitation of the properties of laminar flow. Typically two immiscible liquids, one containing the PCR ingredients, are injected into a device through two separate inlet passages. Optimally, those inlet passages then merge to form a third passage along which the two fluids flow under parallel laminar conditions. The third passage is then formed with a constriction or other discontinuity which causes the two fluids to flow in a flow of alternate segments or else the merging of the two inlet passages themselves cause flow segmentation. The conditions may then be changed, for example, by changing the temperature and the fluid containing the PCR reagents formed into regular microspheres.

Stability The reagents of the present invention, in particular the solid reagents in accordance with the fifth aspect of the invention have the advantage of being particularly stable during storage especially room temperature storage (thereby removing the need for refrigeration equipment) or 4 ⁰C storage (thereby avoiding freeze-thaw cycles inherent in storage in a freezer). For example, they may retain 80% of their activity for more than 6 months at room temperature (20 ⁰C) or 70% and their activity for more than one year at room temperature or 90% of their activity when stored at -18 ⁰C. Alternatively, 50% or more activity may be retained for 1 year at 4 ⁰C or for 1 year at 20 ⁰C. Retention of activity may be assessed by carrying out a PCR reaction using those reagents and a known quantity of DNA target and then comparing the signal obtained with that obtained from a PCR reaction carried out with corresponding fresh ingredients.

One might assume that the encapsulation of PCR ingredients in solid reagent would be sufficient to provide storage stability of those ingredients. However, this is not the case and the inventors have surprisingly discovered that the degree of storage stability exhibited by primers, probes and PCR reagents according to the invention when encapsulated in agarose microspheres is greatly dependent upon the nucleic acid sequences of the primers and probes in an as yet unpredictable manner. The sequences disclosed herein have been found to be especially stable in storage, especially when encapsulated in the form of a solid reagent and most especially when encapsulated in agarose microspheres.

Kits

According to a sixth aspect of the invention there is provided a kit comprising at least one of the following: a) a first PCR forward primer according to the first aspect of the invention, b) a first PCR reverse primer according to the second aspect of the invention, c) a first nucleic acid probe according to the third aspect of the invention, or d) a PCR reagent according to the fourth aspect of the invention. e) a solid reagent according to the fifth aspect of the invention,

and one or more further components chosen from:

Uses

According to a seventh aspect of the invention there is provided a use of a first PCR forward primer according to the invention, a first PCR reverse primer according to the invention, a first nucleic acid probe according to the invention, a PCR reagent, a solid reagent according to the invention or a kit in a PCR reaction, for example PCR reaction for detecting members of the Klebsiella genus and/or Klebsiella pneumoniae. According to certain preferred embodiments said use includes use in the detection of infectious organisms and use in the detection and control of hospital-acquired infections.

Methods of providing information

According to an eighth aspect of the invention there is provided a method of providing information relating to the identity of an infectious agent in a clinical sample comprising use of a first PCR forward primer according to the invention a first PCR reverse primer, a first nucleic acid probe according to the invention, a PCR reagent according to the invention, a solid reagent according to the invention or a kit according to the invention to carry out simultaneous multiplexed PCR reactions to detect the presence of members of the Klebsiella genus and Klebsiella pneumoniae in said clinical sample, or a derivative thereof. According to certain preferred embodiments the method comprises carrying out further PCR reactions, for example those to detect antibiotic resistance factors or the presence of other non-Klebsiella species.

Methods of treatment

According to a ninth aspect of the invention there is provided a method of treating an infection comprising obtaining a clinical sample from a subject suspected to having said infectious disease, carrying out the method of the eighth aspect of the invention on said clinical sample in order to provide information relating to the identity of the infectious agent, and using this information to select an appropriate antibiotic for treatment of the infection and, administering said selected antibiotic to said subject. According to certain preferred embodiments the method of treatment further comprises the subsequent steps of taking further clinical samples from said subject carrying out the method of the invention on said clinical samples in order to provide new information relating to the identity of any infectious agent present and using this information to assess the success or otherwise of treatment of the patient and to inform decisions regarding further treatment and/or discharge of the patient.

Clinical Samples

Clinical samples may be any sample obtained from a patient, for example, a surface swab, a sputum sample, a sample of stools, a sample of urine, a sample of blood, a sample of mucus, or a biopsy sample of tissue. As used herein "clinical sample" also includes samples obtained from used dressings previously in contact with the patient and the samples obtained from any other piece of medical equipment previously in contact with the patients, for example, a catheter or a cannula. As used herein "derivative of clinical samples" include clinical samples that have been subjected to a further processing step before being used, for example, clarification, filtering, freezing, culturing aliquoting, storing, digesting or disinfecting to remove an infectious disease risk. Sample Preparation

Several methods for sample preparation are suitable for use with encapsulated reagents. The choice of method will be dependent upon the sample collection and desired diagnostic application. If a culture stage is used prior to testing, the sample can be diluted to give an appropriate cell density and used directly in PCRs; the initial denaturation step during the PCR thermal cycle lyses the cells, releasing genomic DNA into the reaction mix. Alternatively, commercial kits such as the DNeasy kit (Qiagen) or a phenol: chloroform nucleic acid extraction technique, such as that described in "Molecular Cloning - A Laboratory Manual" by Sambrook and Russell, Cold Spring Harbour Laboratory Press, can be used. If no culture stage is to be used then a method appropriate to the sample type is required. Swab samples may be placed into an appropriate liquid, such as phosphate buffered saline, and vortex mixed to release the sample into the liquid. Subsequently, a commercial kit such as the QIAamp Media MDx Kit (Qiagen) can be used to isolate the DNA, or the sample can be centrifuged to pellet the cells and a phenol : chloroform technique used. For isolation from tissues, cerebrospinal fluid, blood, urine or other body fluids, commercial kits such as the QIAamp DNA Mini Kit (Qiagen) or Wizard SV Genomic DNA system (Promega) are appropriate.

Examples

EXAMPLE 1 - Manufacture and use of encapsulated reagent

Part a) - Manufacturing an encapsulated reagent

A solution containing the PCR reagents for encapsulation was prepared with the following constituents:

Reagent [Stock] Volume / μl

Taq polymerase 5 U/μl 95.18

Forward primer (SEQ ID NO: 2) 200 pmol/μl 23.80

Reverse primer (SEQ ID NO: 4) 200 pmol/μl 23.80

Probe (SEQ ID NO: 6) 200 pmol/μl 5.95 dNTP mix 25 mM of each 95.18

Reaction buffer/molten polymer 30X71.76% 396.60

MgCl₂ I M 59.49

Total 700.00

The probe was labelled at the 5' and 3' ends with FAM and BHQ-I respectively.

This solution was maintained at a temperature equal to or greater than 65 °C prior to being introduced into the microfluidic manufacturing plant. Within the plant the fluid is separated into highly accurate, discreet and monodisperse solid microspheres as described previously in WO2004/043598. The size of the microspheres was precisely controlled by the flow rates of the fluids through the microfluidic circuit. The microsphere size was designed such that a single microsphere would deliver all reagents for a single PCR to proceed once suitable template and sterile deionised water up to a volume of 23.5 μl were added and thermal cycling initiated.

Figure 1 shows an example of a reagent-containing microsphere as viewed by light microscopy.

Part b) - Carrying out a PCR using the reagent

In order to test the performance of the microencapsulated reagent, 20 ng of genomic DNA {Klebsiella oxytoca ATCC700324; purchased from LGC Standards) and 23.5 μl of sterile deionised water were added to individual microspheres placed in suitable 0.2 ml PCR tubes. Control reactions using equivalent liquid reagents were set up alongside. All reactions were replicated 5 times in separate reaction tubes. Reaction tubes were placed in an Eppendorf Mastercycler RealPlex⁴ real time thermal cycler and run through the thermal cycle shown below. Fluorescence at 521 nm was read at the end of every 60°C hold step.

Step Action Duration / s

1 Hold at 95°C 120

2 Hold at 95°C 30

3 Hold at 60°C 60

4 Go to Step 2, 39 times

5 Finish

The fluorescence signal obtained plotted against cycle number is presented in the graph of figure 2. As can be seen from the results the PCR reagent which had been encapsulated performed equally well to these which had not been encapsulated.

C_t values (the number of cycles required for the signal to cross a threshold) and standard deviation values obtained from the data presented in Figure 2 is summarised below:

QT Ct Mean / cTstd

Formulation cycle cycle dev

Encapsulated PCR Reagent

1 18.49 Encapsulated PCR Reagent

2 18.78 Encapsulated PCR Reagent

3 18.87 Encapsulated PCR Reagent

4 18.68 Encapsulated PCR Reagent

5 18.77 18.72 0.14 Liquid control 1 18.90 Liquid control 2 18.95

Liquid control 3 18.64

Liquid control 4 18.50

Liquid control 5 20.06 19.01 0.62

No template control

The results show that good levels of fluorescence and C_t values were achieved with the encapsulated reagent and that the results correlated well with the liquid controls. Moreover, the variability amongst replicates was less in the assays run with encapsulated reagent when compared to liquid reagents. This may be attributed to the more accurate dispensing of reagent volume which is permitted by the use of encapsulated microspheres as opposed to conventional micropipetting of liquid reagents.

There was no amplification detected in the No Template Control reaction, indicating that any amplification detected in other reactions was a result of the primers and probe interacting with the template DNA.

EXAMPLE 2 - Demonstration of storage stability of reagent

Encapsulated PCR reagents were manufactured as described above in part a) of Example 1. Half were stored in the dark at 4°C and the remainder were stored similarly but at ambient temperature. Periodic testing of encapsulated reagents in PCR reactions as described in Example 1 part b) alongside fresh liquid controls was performed. Q and variability data were recorded, allowing for the performance of the encapsulated reagent to be assessed following storage for extended periods. A summary of the results are shown in Figure 3 (values are a mean of 5 replicates and error bars indicate standard deviation).

Claims

1. A first PCR forward primer comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO.l

SEQ ID NO: 1 : CCTYRTCGATTGACGTTACCCGCAGAAGAAG

wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues and wherein X is an integer from 16 to 26 and wherein Y represents C or T, and wherein R represents A or G.

2. A first PCR forward primer as claimed in claim 1, wherein the sequence of said nucleic acid is as given in SEQ ID NO. 2

SEQ ID NO:2: TCGATTGACGTTACCCGCAGA

3. A first PCR reverse primer comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO:3

SEQ ID NO:3 : ACTCYAGCCTGCCAGTTTCGAATGCAGTTCC

4. A first PCR reverse primer as claimed in claim 3, wherein the sequence of said nucleic acid sequence given in SEQ ID NO:4 SEQ ID NO:4: AGCCTGCCAGTTTCGAATGCA

5. A first nucleic acid probe comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO: 5

SEQ ID NO:5: TAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAA

6. A first nucleic acid probe as claimed in claim 5, wherein the nucleic acid sequence of the first nucleic acid probe is as given in SEQ ID NO: 6

SEQ ID NO:6: CGCACGCAGGCGGTCTGTCAAGTCGGAT

7. A PCR reagent comprising a first PCR forward primer as claimed in claim 1 or claim 2 and a first PCR reverse primer as claimed in claim 3 or claim 4.

8. A PCR reagent as claimed in claim 7 further comprising a first nucleic acid probe as claimed in claim 5 or claim 6.

9. A PCR reagent as claimed in claim 7 or claim 8 further comprising:

A) A second PCR forward primer comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO:7 SEQ ID NO:7: CGCATTAAAGAAGGCTGGCCTGAAAGTCAC

wherein X is an integer from 25 to 35 and wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues; and

SEQ ID NO:8: CGGATTTTCCGCCTTCGAAATTATGACGAG

Wherein Y is an integer from 15 to 25 and wherein the sequences may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues.

10. A PCR reagent as claimed in claim 9, wherein

A) the nucleic acid sequence of the second PCR forward primer is given in SEQ ID NO:9

SEQ ID NO:9: TAAAGAAGGCTGGCCTGAAA

B) the nucleic acid sequence of the second PCR reverse primer is given in SEQ ID NO: 10

SEQ ID NO: 10: TTTCCGCCTTCGAAATTATG

11. A PCR reagent as claimed in claim 9 or claim 10 further comprising, a second nucleic acid probe comprising a nucleic acid sequence consisting of X contiguous residues selected from SEQ ID NO:11

SEQ ID NO: 11 : ATCCTTGAAGTGCTGCAGGAACCGGATAACC

wherein X is an integer from 16 to 26 and wherein the sequence may be further mutated by up to 5 additions of residues, deletions of residues or substitutions of residues.

12. A PCR reagent as claimed in claim 11, wherein the nucleic acid sequence of the second nucleic acid probe is as given in SEQ ID NO: 12

SEQ ID NO: 12: TGAAGTGCTGCAGGAACCGGA

13. A PCR reagent as claimed in claim 12 when dependent on claim 8, wherein at least a portion of said first nucleic acid probe is conjugated to a first fluorochrome and at least a portion of said second nucleic acid probe is conjugated to a second fluorochrome, said first and second fluorochromes being such^that upon excitation their peak fluorescence emission wavelengths are sufficiently different from each other to enable the fluorescence signals from the respective fluorochromes to be distinguished from each other.

14. A solid reagent comprising one or more of the folio wing components: ^y a) a first PCR forward primer as claimed in claim 1 or claim 2, b) a first PCR reverse primer as claimed in claim 3 or claim 4, c) a first nucleic acid probe as claimed in claim 5 or claim 6, or d) a PCR reagent as claimed in one of claims 7 to 13.

15. A kit comprising at least one of the following: a) a first PCR forward primer as claimed in claim 1 or claim 2, b) a first PCR reverse primer as claimed in claim 3 or claim 4, c) a first nucleic acid probe as claimed in claim 5 or claim 6, or d) a PCR reagent as claimed in claim 7 or claim 8. e) a solid reagent as claimed in claim 14

and one or more further components chosen from:

i) instructions for carrying out a PCR reaction ii) instructions for carrying out a detection of products of a PCR reaction iii) a container, micro titre plate or solid reaction substrate

16. Use of a first PCR forward primer as claimed in claim 1 or claim 2, a first PCR reverse primer as claimed in claim 3 or claim 4, a first nucleic acid probe as claimed in claim 5 or claim 6, a PCR reagent as claimed in any of claims 7 to 13, a solid reagent as claimed in claim 14 or a kit as claimed in claim 15 in a PCR reaction.

17. A method of providing information relating to the identity of an infectious agent in a clinical sample comprising use of a first PCR forward primer comprising as claimed in claim 1 or claim 2, first PCR reverse primer as claimed in claim 3 or claim 4, a first nucleic acid probe as claimed in claim 5 or claim 6, a PCR reagent as claimed in any of claims 7 to 13, a solid reagent as claimed in claim 14 or a kit as claimed in claim 15 to carry out simultaneous multiplexed PCR reactions to detect the presence of members of the Klebsiella genus and Klebsiella pneumoniae in said clinical sample, or a derivative thereof

18. A method of treating an infection comprising obtaining a clinical sample from a subject suspected to having said infectious disease, carrying out the method of claim 17 on said clinical sample in order to provide information relating to the identity of the infectious agent and using this information to select an appropriate antibiotic for treatment of the infection and, administering said selected antibiotic to said subject.