WO2010079998A2 - 진균 감염의 치료를 위한 hog, ras 및 camp 신호전달경로 유전자의 용도 - Google Patents
진균 감염의 치료를 위한 hog, ras 및 camp 신호전달경로 유전자의 용도 Download PDFInfo
- Publication number
- WO2010079998A2 WO2010079998A2 PCT/KR2010/000137 KR2010000137W WO2010079998A2 WO 2010079998 A2 WO2010079998 A2 WO 2010079998A2 KR 2010000137 W KR2010000137 W KR 2010000137W WO 2010079998 A2 WO2010079998 A2 WO 2010079998A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antifungal
- pharmaceutical composition
- genes
- antifungal agent
- hog1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
- C12Q1/485—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase involving kinase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1072—Differential gene expression library synthesis, e.g. subtracted libraries, differential screening
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/18—Testing for antimicrobial activity of a material
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/37—Assays involving biological materials from specific organisms or of a specific nature from fungi
Definitions
- the present invention relates to the use of HOG, Ras and cAMP signaling pathway genes for the treatment of fungal infections.
- Whether organisms can survive and multiply in a particular environment is largely determined by their ability to respond and adapt to various environmental stresses and maintain cell homeostasis.
- the p38 / Hog1 mitogen-activated protein kinase (MAPK) dependent signaling pathway plays a pivotal role in regulating a wide range of stress-response in eukaryotes from yeast to humans.
- Mammalian stress-activated p38 MAPKs induce a variety of stress association-signals that limit adaptation to the immune response by osmotic pressure change and ultraviolet irradiation, programmed cell death, and regulation of cytokine production and inflammation. Similar stress-sensing signaling systems have been identified in other species. Fungi have p38-like MAPKs that regulate various stress responses. In budding yeast Saccharomyces cerevisiae , Hog1 MAPK modulates the stress response to osmotic shock, oxidative damage and heavy metal damage.
- Fission yeast ski irradiation Schizosaccharomyces pombe also has a Hog1 homologue, Sty1 (also known as Spc1 and Phh1), which includes osmotic shock, heat shock, oxidative damage and heavy metal damage, carbon deficiency and ultraviolet irradiation. It is involved in adapting to so many different stresses. Interestingly, Sty1 is also involved in growth regulation and reproduction and differentiation.
- Hog1 MAPK orthologs are also found in other ascomycete pathogenic fungi, including Candida albicans (Hog1) and Aspergillus fumigatus (SakA), osmotic shock, UV irradiation, oxidation It has been shown to mediate responses to various environmental causes, including damage and high temperatures.
- MAPKK MAPK kinase
- fungi and mammals have developed a unique set of higher regulatory systems.
- fungi utilize a two-component-like phosphorelay system that is absent in mammals and found only in bacteria, fungi and plants.
- the fungal phosphate delivery system consists of three components, including hybrid sensor kinases, histidine-containing phosphotransfer protein (HPt), and response regulators. All of these are not observed in mammals and are considered good antifungal targets.
- Basidiomycetous Cryptococcus neoformus also utilizes a stress-activated Hog1 MAPK system for adaptation to a variety of environmental stresses, including osmotic shock, ultraviolet radiation, heat shock, oxidative damage, toxic metabolites and antifungal agents. .
- Cryptococcus neoformes is a human pathogenic fungus found all over the world that causes skin and lung cryptococcosis and cryptococcus meningitis in immunocompromised patients.
- Cryptococcus neo-performance var. grubii ( antigen A) is the most commonly found (> 90% of environmental and clinical strains), while Cryptococcus neoformus var.
- Cryptococcus gattii also known as antigenic types B and C Cryptococcus neoforms, has been found to be a primary pathogen that attacks normal individuals without abnormalities in the immune system.
- the Cryptococcus neoform Hog1 MAPK pathway not only responds to various environmental stresses, but also supports the production and sexual differentiation of two virulence factors, such as anti-naphtha capsules and antioxidant melanin. Uniquely developed to regulate, suggesting that Hog1 MAPK plays a pivotal role as an important signaling regulator in Cryptococcus neoforms that cross-talks with other signaling pathways.
- Hog1 MAPKs in many Cryptococcus neoformus strains are always phosphorylated under non-stressed conditions and rapidly dephosphorylated for their activation in response to osmotic shock and antifungal fludioxosonyl treatment. This is in stark contrast to other fungal Hog1 MAPK systems. Dual phosphorylation of the TGY motif at Hog1 requires Pbs2 MAPKK. Fungal specific phosphate delivery systems, which are located above the Pbs2-Hog1 pathway, are also found in Cryptococcus neoformes.
- the Cryptococcus neoform phosphate delivery system includes seven different sensor hybrid histidine kinase (Tco1-7), Ypd1 phosphotransfer protein, and two reaction modulators (Ssk1 and Skn7).
- the Pbs2-Hog1 pathway is usually regulated by Ssk1 but not by Skn7.
- Tco1 and Tco2 play a differential and simultaneous overlapping role in activating the Ssk1 and Pbs2-Hog1 MAPK pathways.
- Tco1 and Tco2 regulate some phenotypes associated with Ssk1- and Hog1, other higher receptor or sensor proteins remain to be identified.
- Antifungal agents developed to date can be classified into antifungal agents having chemically azole structures and antifungal agents having no azole structure.
- the azole antifungal agents include ketoconazole, fluconazole, itraconazole and voriconazole, and the non-azole antifungal agents are terbinafine and flucytosine. , Amphotericin B, caspofungin, and the like.
- Ketoconazole, fluconazole, itraconazole, voriconazole, and allylamine-based naphthypine and terbinapine having an azole structure have similar mechanisms of action.
- Both classes of antifungal agents inhibit the enzymes necessary for the conversion of lanosterol to ergosterol, a major component of fungal cell membranes.
- the azole antifungal agent inhibits microsomal enzymes, and the allylamine antifungal agent inhibits squalene epoxidase, thereby exhibiting the above effects.
- Flucytosine is a metabolic antagonist that inhibits nucleic acid synthesis, and has antifungal action by uncompromising antagonism of fungal RNA and DNA synthesis, and shows antifungal action, and has a polyene structure. Binds to ergosterol inside the fungal cell membrane to induce depolarization of the cell membrane, forms pores, and causes loss of intracellular contents, thereby exhibiting antifungal action.
- Caspofungin an antifungal agent of the Echinocandins family, reversibly inhibits the formation of fungal cell walls and differs from the antifungal agents acting on the cell membranes in that they act on the cell walls.
- azole drugs may cause hepatitis death when used in patients with reduced liver function, hepatic function tests must be performed prior to administration. Flucytosine has been reported to be dose-dependently inhibiting myelosuppression, hepatotoxicity, and small intestinal colitis, and these side effects increase when renal function is lowered. Therefore, monitoring renal function of patients is very important. It is also contraindicated in pregnant women. Representative toxicity of amphotericin B is glomerular neotoxicity following renal artery contraction, which is dose dependent, resulting in an increased incidence of permanent renal insufficiency at lifetime cumulative doses of 4-5 g or more.
- nephrotoxicity such as excessive loss of potassium, magnesium, and bicarbonate due to tubular toxicity and a decrease in hematopoietic hormone production may occur.
- acute reactions may cause symptoms such as thrombophlebitis, chills, tremors and hyperventilation.
- the antifungal agents developed in the past have various side effects according to the types of drugs, and thus, there is a demand for the development of new treatments that can reduce the side effects and enhance the antifungal effect.
- cAMP-signaling pathway is important for the production and differentiation of virulence factors (Idnurm). et al. , 2005).
- S. cerevisiae And C. albicans Similarly, two major upstream signaling regulators of adenylyl cyclase (Cac1), Aca1 ( A denylyl c yclase- a ssociated protein 1) and G ⁇ subunit protein (Gpa1) have been shown to modulate the cAMP-signaling pathway of Cryptococcus neoforms (Bru et al. , 2004, Alspaugh et al. , 1997).
- GPA1 Gene disruption results in multiple cell phenotypes, which result in incomplete production of melanin and capsules, a key virulence factor essential for the survival and proliferation of Cryptococcus neoforms in the host, and a reduction in mating important for the dissemination of infectious spores. Contains (Alspaugh et al. , 1997). Aca1 physically interacts with Cac1 adenylyl cyclase and does not regulate the basal level of cAMP but regulates the induction of cAMP to dominate most cAMP-dependent phenotypes (Bru et al. , 2004).
- CAC1 The missing variant of gpa1 ⁇ or aca1 ⁇ Produces a more severe phenotype than the missing variant, gpa1 ⁇ aca1 ⁇ Double deletion variants cac1 ⁇ Phenotype is equivalent to the missing variant (Bru) et al. , 2004). This indicates that Cac1 is activated by both Aca1 and Gpa1.
- the Cac1 subsignal of Cryptococcus neoforms includes two catalytic subunits of PKA (Protein kinase A), Pka1 and Pka2, and the regulatory subunit Pkr1.
- Pka1 is antigenic type A Cryptococcus neo-performance Pka2 plays the predominant role in cAMP signaling in the background of H99 strains, whereas Pka2 is an antigenic type D cryptococcus neoform It does so in the JEC21 strain (Hicks et al. , 2004). Nevertheless, pka1 ⁇ pka2 ⁇ Double deletion variants cac1 ⁇ It shows a phenotype equivalent to the deletion variant, indicating that cAMP signaling from Cac1 splits into two PKA catalytic subunits (Bru et al. , 2004).
- PDE2 is not PDE1
- the fruit of gpa1 ⁇ It repairs some phenotypes, such as melanin deficiency of deletion variants, indicating that different phosphodiesterases work in various fungi (Hicks et al. , 2005).
- Ras1 and Ras2 Two Ras proteins, Ras1 and Ras2, were found in Cryptococcus and they were found to play a shared but distinct role (Alspaugh et al. , 2000, D'Souza et al. , 2001, Waugh et al. , 2002). .
- Ras1 is a major Cryptococcus neoform Ras protein that supports high temperature and invasive growth essential for survival and proliferation in the host and promotes reproductive differentiation (Alspaugh et al. , 2000).
- the ras2 ⁇ deletion variants do not have any discernible phenotype, overexpression of RAS2 somewhat suppresses most ras1 mutant phenotypes (Waugh et al. , 2002). Similar to S.
- Ras proteins are essential for normal cell growth.
- Ras-related phenotypes only invasive growth and crossover are cAMP-dependent while growth at high temperature is a cAMP-independent, Ras1-specific phenotype (Alspaugh et al., 2000, Waugh et al. , 2003) . ).
- Cac1 lacks the Leucine-rich repeat (LRR) domain, which is the binding site for GTP-binding Ras in S. cerevisiae (Shima et al. , 1997).
- adenylyl cyclase / cyclase-related protein complexes can provide a secondary Ras-binding site for their activation as seen in S. cerevisiae (Shima et al., 2000), Ras1 In this Cryptococcus neoformus, it is still possible to interact with the Aca1 / Cac1 complex for its activation.
- Cdc24 a GEF protein
- Cdc24 is a Ras-effector protein and regulates the growth of Cryptococcus neoforms at high temperatures in the superstructure of Ras1 and Rho-like GTPase Cdc42 (Nichols et al. al. , 2007).
- the Cryptococcus neoformus cAMP-signaling pathway is regulated by three different upstream signal regulators Ras1, Gpa1, and Aca1.
- an object of the present invention is to discover new target genes for antifungal agent development.
- the present invention provides an inhibitor for at least one protein selected from the group consisting of Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1, and Nha1 of Cryptococcus neoformans for the production of antifungal agents.
- an antifungal pharmaceutical composition comprising the inhibitor, and a method for treating a fungal infection comprising administering to the subject an effective amount of the inhibitor.
- the present invention is the use of one or more proteins selected from the group consisting of Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 and Nha1 of Cryptococcus neoformans for the screening of antifungal agents or genes encoding the same,
- a composition for screening an antifungal agent comprising the protein or gene, and a method of screening an antifungal agent comprising contacting a candidate with the protein or gene and determining whether the candidate inhibits or promotes the activity of the protein or gene. do.
- the present invention also provides an inhibitor for at least one protein selected from the group consisting of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12, and Hsp122 of Cryptococcus neoformes for the preparation of antifungal agents.
- a method of treating fungal infection comprising administering to a subject, an antifungal pharmaceutical composition comprising said inhibitor, and an effective amount of said inhibitor to a subject.
- the present invention also provides the use of at least one protein selected from the group consisting of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 and Hsp122 of Cryptococcus neoformes for the screening of antifungal agents,
- a composition for screening an antifungal agent comprising the protein or gene, and a method of screening an antifungal agent comprising contacting a candidate with the protein or gene and determining whether the candidate inhibits or promotes the activity of the protein or gene. do.
- the present invention investigates the role of RAS1, RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 and HSP122 genes in the regulation of Ras and cAMP pathways of Cryptococcus neoforms, and these genes are inhibited.
- the researchers discovered a new sensitivity to polyene or azole drugs. Therefore, the antifungal pharmaceutical composition comprising an inhibitor for the gene or the protein encoded by the same can be used as an excellent antimicrobial therapeutic agent that can increase the efficacy while reducing the use dose of the existing antifungal agent.
- Figure 1 shows the results of the identification of the genome level of genes regulated by C. neoformans Hog, Ssk1, Skn7 in normal growth conditions without stress (Fold change is expressed in color).
- Figure 2 shows the results of analysis of the induction of ergosterol biosynthesis genes and cellular ergosterol content by the shaking of the HOG signaling pathway.
- FIG. 3 is an analysis showing that inhibition of the HOG pathway shows an elevated antifungal effect with amphotericin B in C. neoformans .
- ENA1 and NHA1 which are genes encoding efflux pumps of Na + and K + , are subsystem target genes regulated by the HOG pathway, and their inhibition is highly sensitive to polyene drugs and azole drugs. Analytical results showing the results.
- FIG. 6 shows the results of transcript analysis of Cryptococcus neoformas ras1 ⁇ , aca1 ⁇ , gpa1 ⁇ , cac1 ⁇ , and pka1 ⁇ pka2 ⁇ deletion variants (Fold changes are expressed in color).
- FIG. 7 shows functional categories of genes regulated differently by Cryptococcus neoformes ras1 ⁇ , aca1 ⁇ , gpa1 ⁇ , cac1 ⁇ , and pka1 ⁇ pka2 ⁇ deletion variants.
- FIG. 11 is an analysis result showing the expression of HSP12 and HSP122 and controlled positively by the cAMP- and HOG- signaling pathway, hsp12 and hsp122 ⁇ ⁇ increasing sensitivity to polyene antifungal agent by a deficient mutant.
- the present invention provides an inhibitor for at least one protein selected from the group consisting of Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 and Nha1 of Cryptococcus neoformans for the preparation of antifungal agents or genes encoding the same. It provides an antifungal pharmaceutical composition comprising.
- the HOG1 pathway is a cell signaling pathway that regulates responses to various stresses.
- fungi include hybrid sensor kinases, histidine-containing phosphotransfer proteins (HPt), and response regulators, which are not present in mammals in the HOG1 pathway.
- HPt histidine-containing phosphotransfer proteins
- the inventors investigate the role of genes involved in the HOG1 pathway for the development of new antifungal targets. It was. As a result, it was surprisingly found that the inhibition of the SSK1, TCO2, SSK2, PBS2, and HOG1 genes in the regulation of the HOG pathway of Cryptococcus neoformus enhanced the biosynthesis of ergosterol.
- the antifungal pharmaceutical composition comprising an inhibitor against one or more proteins selected from the group consisting of Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 and Nha1 of Cryptococcus neoformes is known as an existing ergosterol-binding antifungal agent or subtype. It can be used as an excellent antimicrobial therapeutic agent that can increase the efficacy while reducing the dosage of the sol-based antifungal agent.
- the present invention provides the use of an inhibitor against at least one protein selected from the group consisting of Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 and Nha1 of Cryptococcus neoformes for the production of an antifungal agent, said inhibitor
- An antifungal pharmaceutical composition comprising an inhibitor, and a method for treating a fungal infection comprising administering an effective amount of the inhibitor to a subject.
- SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 or NHA1 used as a target for blocking HOG1 signaling system means Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 protein or SSK1, TCO2 , SSK2, PBS2, HOG1, ENA1 or NHA1 gene.
- the SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 or NHA1 inhibitors are inhibitors to the Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 proteins or to the SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 or NHA1 genes. It is interpreted to include all inhibitors.
- an inhibitor for one or more proteins selected from the group consisting of Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 of Cryptococcus neoformes binds to the protein to inhibit its signaling Blocking inhibitors.
- an inhibitor for one or more genes selected from the group consisting of SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 or NHA1 of Cryptococcus neoformes inhibits the expression of the gene to block signaling. May be an inhibitor.
- the SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 or NHA1 gene may be DNA encoding them or mRNA transcribed therefrom.
- the inhibitor for the gene may be an inhibitor that binds to the gene itself to interfere with transcription or binds to mRNA transcribed from the gene and interferes with the translation of the mRNA.
- the Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 protein may each have an amino acid sequence of SEQ ID NO: 1 to 7, wherein the SSK1, TCO2, SSK2, PBS2, HOG1, ENA1
- the NHA1 gene may have a nucleic acid sequence of SEQ ID NOs: 8 to 14 or a cDNA sequence of SEQ ID NOs: 15 to 21, respectively, but it is merely an example of a sequence of Cryptococcus neoformus antigen type A H99 strain, and the present invention.
- the sequence of SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 or NHA1 is not limited thereto.
- the antifungal pharmaceutical composition may include one or more inhibitors against one or more proteins selected from the group consisting of Ssk1, Ena1 and Nha1.
- SSK1 is not only an important upstream response regulator of HOG1 , but also a gene not found in mammals, which makes it an excellent target for the development of antifungal agents. Therefore, the SSK1 inhibitor may improve the efficacy of the ergosterol-binding antifungal agent by increasing the amount of biosynthesis of the ergosterol fungus while lowering the possibility of any side effects caused by the inhibition of SSK1 when administered in vivo.
- ENA1 and NHA1 have been identified as subsystem target genes regulated by the HOG pathway, and inhibition of these genes, along with polyene-based drugs such as amphotericin B, leads to azole drugs such as fluconazole, ketoconazole and itraconazole. Since drug susceptibility is markedly enhanced, inhibitors that simultaneously or individually inhibit these genes may exhibit very high antifungal activity when used in combination with polyene or azole drugs.
- a pharmaceutical composition for the treatment of diseases such as Cryptococcosis and Meningitis including a Hog1, Ena1 or Nha1 inhibitor, and Cryptococoa comprising administering to a subject an effective amount of an Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 inhibitor
- 'inhibitors of Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 protein used to block the HOG1 signaling system' are combined with Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 protein.
- inhibitors may be peptides or compounds that bind to Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 proteins, and the like.
- Such inhibitors may be selected through screening methods exemplified below, such as protein structure analysis, and may be designed using methods known in the art.
- the inhibitor may be a polyclonal antibody or monoclonal antibody against one or more proteins selected from the group consisting of Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 of Cryptococcus neoformus. have.
- polyclonal antibodies or monoclonal antibodies can be prepared using antibody production methods known in the art.
- the "SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 or inhibitors of NHA1 gene” is SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 or expression of NHA1 gene used to block HOG1 signal transmission system
- All inhibitors include inhibitors that block signaling.
- such inhibitor may be a peptide, nucleic acid or compound that binds to the gene.
- Such inhibitors may be selected through screening methods exemplified below, such as cell based screening, and may be designed using methods known in the art.
- the inhibitor is an antisense oligonucleotide, siRNA, shRNA, miRNA or one or more genes for one or more genes selected from the group consisting of SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 and NHA1 of Cryptococcus neoformus . It may be a vector containing.
- antisense oligonucleotides, siRNAs, shRNAs, miRNAs or vectors comprising them can be prepared using methods known in the art.
- the 'vector' refers to a gene construct comprising an external DNA inserted into the genome encoding the polypeptide.
- a vector related to the present invention is a vector in which the nucleic acid sequence that inhibits the gene is inserted into the genome, and examples of the vector include a DNA vector, a plasmid vector, a cosmid vector, a bacteriophage vector, a yeast vector, or a viral vector.
- the antifungal pharmaceutical composition of the present invention comprising an inhibitor against at least one protein or gene selected from the group consisting of SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 and NHA1 of Cryptococcus neoformans alone It does not show antifungal activity, but enhances the fungal killing ability of the antifungal agent through a combination treatment with an ergosterol-binding antifungal agent or an azole antifungal agent. Therefore, the antifungal pharmaceutical composition of the present invention is characterized in that it is administered sequentially or simultaneously with ergosterol-binding antifungal agent or azole antifungal agent.
- Ergosterol-binding antifungal means an antifungal agent that binds to ergosterol on fungal cell membranes to cause depolarization of the cell membranes, form pores, and cause loss of intracellular contents to kill fungi.
- Such ergosterol-binding antifungal agents are known in the art, and any ergosterol-binding antifungal agent will show a marked increase in antifungal effect when used with the antifungal pharmaceutical composition of the present invention.
- the ergosterol-binding antifungal agent may be a polyene-based antifungal agent.
- the polyene-based antifungal agent may be one or more antifungal agents selected from the group consisting of amphotericin B, natamycin, limosidine, philippines, nystatin and candiesine.
- the polyene-based antifungal agent may be amphotericin B.
- the azole antifungal agent may be one or more antifungal agents selected from the group consisting of ketoconazole, fluconazole, itraconazole, and barleyconazole.
- the present invention also provides an antifungal pharmaceutical composition
- an antifungal pharmaceutical composition comprising the inhibitor of the present invention; And a known ergosterol-binding antifungal agent or an azole antifungal agent.
- the present invention also relates to at least one protein selected from the group consisting of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 and Hsp122 of Cryptococcus neoformes for the production of antifungal agents or genes encoding the same.
- An antifungal pharmaceutical composition comprising an inhibitor is provided.
- the antifungal pharmaceutical composition comprising an inhibitor against at least one protein selected from the group consisting of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12, and Hsp122 of Cryptococcus neoformus It can be used as an excellent complex antimicrobial therapeutic agent that can increase the efficacy while reducing the use capacity of the existing polyene-based or itraconazole antifungal agent.
- the present invention provides an inhibitor for at least one protein selected from the group consisting of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 and Hsp122 of Cryptococcus neoformes for the production of antifungal agents.
- a method of treating fungal infection comprising administering to a subject, an antifungal pharmaceutical composition comprising said inhibitor, and an effective amount of said inhibitor to a subject.
- RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1, HSP12 or HSP122 used as targets for the blocking of Ras- and cAMP signaling systems are Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1 , Hsp12 or Hsp122 protein or RAS1, RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 or HSP122 It is interpreted as meaning a gene.
- RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1, HSP12 or HSP122 inhibitors are Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 or Hsp122 Inhibitors to proteins or RAS1, RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 or HSP122 It is interpreted to include all inhibitors to genes.
- the inhibitor for at least one protein selected from the group consisting of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 and Hsp122 of Cryptococcus neoformes binds to and inhibits activity of the protein It may be an inhibitor to block signaling by.
- an inhibitor for one or more genes selected from the group consisting of RAS1, RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 and HSP122 of Cryptococcus neoformes inhibits the expression of the gene to signal It may be an inhibitor that blocks delivery.
- the RAS1, RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 or HSP122 genes may be DNA encoding them or mRNA transcribed therefrom.
- the inhibitor for the gene may be an inhibitor that binds to the gene itself to interfere with transcription or binds to mRNA transcribed from the gene and interferes with the translation of the mRNA.
- the Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 or Hsp122 protein may have an amino acid sequence of SEQ ID NO: 16 to 24, respectively, the RAS1, RAS2, CDC24, GPA1 , CAC1, ACA1 , PKA1, HSP12 and HSP122 genes may have a corresponding nucleic acid sequence or cDNA sequence, which is merely illustrative of the sequence of the Cryptococcus neoformus antigen type A H99 strain, RAS1, The sequence of RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 or HSP122 is not limited thereto.
- the Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 or Hsp122 protein, the RAS1, RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 or HSP122 gene and the like substantially It is understood that variants or fragments thereof having the same activity are included.
- the inhibitor is Cac1 Or an inhibitor against Pka1 protein or gene.
- Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12, or Hsp122 proteins or genes encoding them enhances susceptibility to polyene or azole antifungal agents, thereby reducing the effective amount of polyene or azole antifungal agents.
- the killing efficacy of these antifungal agents can be increased.
- Antifungal activity by inhibition of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 or Hsp122 can treat Cryptococcosis and meningitis caused by infection with Cryptococcus neoforms.
- the use of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 or Hsp122 inhibitors, Ras1, Ras2, for the manufacture of a medicament for the treatment of diseases such as Cryptococcosis and Meningitis Pharmaceutical compositions for the treatment of diseases such as Cryptococcosis and meningitis, including Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 or Hsp122 inhibitors and effective amounts of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 and Provided are methods of treating diseases such as Cryptococcus and Meningitis, comprising administering an Hsp122 inhibitor to a subject.
- Inhibitors of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12, or Hsp122 proteins used to block RAS or cAMP signaling system
- Inhibitors of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12, or Hsp122 proteins used to block RAS or cAMP signaling system
- Inhibitors of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12, or Hsp122 proteins to block signaling It includes everything.
- such inhibitors can be peptides or compounds that bind to Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 or Hsp122 proteins and the like.
- Such inhibitors may be selected through screening methods exemplified below, such as protein structure analysis, and may be designed using methods known in the art.
- the inhibitor is a polyclonal antibody or monoclonal antibody against one or more proteins selected from the group consisting of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 and Hsp122 of Cryptococcus neoformus Raw antibody.
- polyclonal antibodies or monoclonal antibodies can be prepared using antibody production methods known in the art.
- inhibitors of RAS1, RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 or HSP122 genes used to block the RAS or cAMP signaling system' are RAS1, RAS2, CDC24, GPA1, CAC1, ACA1
- inhibitors that block signaling by inhibiting the expression of the PKA1, HSP12 or HSP122 gene may be a peptide, nucleic acid or compound that binds to the gene.
- Such inhibitors may be selected through screening methods exemplified below, such as cell based screening, and may be designed using methods known in the art.
- the inhibitor is an antisense oligonucleotide, siRNA, shRNA against at least one gene selected from the group consisting of RAS1, RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 and HSP122 of Cryptococcus neoformus , miRNA or a vector comprising them.
- antisense oligonucleotides, siRNAs, shRNAs, miRNAs or vectors comprising them can be prepared using methods known in the art.
- the 'vector' refers to a gene construct comprising an external DNA inserted into the genome encoding the polypeptide.
- a vector related to the present invention is a vector in which the nucleic acid sequence that inhibits the gene is inserted into the genome, and examples of the vector include a DNA vector, a plasmid vector, a cosmid vector, a bacteriophage vector, a yeast vector, or a viral vector.
- Antifungal medicament of the present invention comprising an inhibitor of at least one protein selected from the group consisting of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 and Hsp122 of Cryptococcus neoformes or genes encoding the same
- the composition enhances the fungal killing ability of the antifungal agent through complex treatment with a polyene or azole antifungal agent. Therefore, the antifungal pharmaceutical composition of the present invention is characterized in that it is administered sequentially or simultaneously with the polyene or azole antifungal agent.
- polyene or azole antifungal agents are known in the art, and any polyene or azole antifungal agent will show a marked increase in antifungal effect when used with the antifungal pharmaceutical composition of the present invention.
- the polyene-based antifungal agent may be one or more antifungal agents selected from the group consisting of amphotericin B, natamycin, limosidine, philippines, nystatin and candiesine.
- the polyene-based antifungal agent may be amphotericin B.
- the azole antifungal agent may be one or more antifungal agents selected from the group consisting of ketoconazole, fluconazole, itraconazole, and barleyconazole.
- the antifungal pharmaceutical composition is administered sequentially or simultaneously with an inhibitor for one or more proteins selected from the group consisting of SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 and NHA1 of Cryptococcus neoformus. It may be.
- an inhibitor for one or more proteins selected from the group consisting of SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 and NHA1 of Cryptococcus neoformus. It may be.
- SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 and NHA1 of Cryptococcus neoformus may be.
- the inhibition of the expression of CAC1 or PKA1 of Cryptococcus neoformans and simultaneously the expression of HOG1 synergistically enhanced the sensitivity to amphotericin B.
- genes of the cAMP-pathway enhance susceptibility to amphotericin B by a mechanism different from that inhibiting the genes of the HOG pathway identified above enhances the biosynthesis of ergosterol and thus enhances susceptibility to amphotericin B. Appeared.
- the present invention also provides an antifungal pharmaceutical composition
- an antifungal pharmaceutical composition comprising the inhibitor of the present invention; And polyene-based antifungal agents, azole-based antifungal agents and at least one protein selected from the group consisting of Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 of Cryptococcus neoformes or inhibitors for genes encoding the same.
- An antifungal complex formulation comprising one or more antifungal agents selected from is provided.
- the antifungal complex preparation is an antifungal pharmaceutical composition comprising an inhibitor of the present invention, a polyene antifungal agent, and Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 of Cryptococcus neoformans . It may include one or more antifungal agents selected from the group consisting of one or more proteins selected from the group consisting of or inhibitors for genes encoding the same.
- the antifungal pharmaceutical composition or antifungal complex preparation of the present invention may be prepared using a pharmaceutically acceptable and physiologically acceptable adjuvant in addition to the active ingredient, and the adjuvant may include excipients, disintegrants, sweeteners, binders, coatings, Solubilizers such as swelling agents, lubricants, lubricants or flavoring agents can be used.
- the antifungal pharmaceutical composition of the present invention can be preferably formulated into a pharmaceutical composition comprising one or more pharmaceutically acceptable carriers in addition to the active ingredient for administration.
- Acceptable pharmaceutical carriers in compositions formulated in liquid solutions are sterile and physiologically compatible, including saline, sterile water, Ringer's solution, buffered saline, albumin injectable solutions, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers and bacteriostatic agents may be added as necessary. Diluents, dispersants, surfactants, binders and lubricants may also be added in addition to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Furthermore, the method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA can be formulated according to each disease or component according to the appropriate method in the art.
- compositions of the present invention may be granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions and sustained release formulations of the active compounds, and the like. Can be.
- compositions of the present invention may be administered in a conventional manner via intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, sternum, transdermal, nasal, inhalation, topical, rectal, oral, intraocular or intradermal routes. Can be administered.
- An effective amount of the active ingredient of the pharmaceutical composition of the present invention means an amount required to prevent or treat a disease or to achieve a bone growth inducing effect.
- the type of disease, the severity of the disease, the type and amount of the active and other ingredients contained in the composition, the type of formulation and the age, weight, general health, sex and diet, sex and diet, time of administration, route of administration and composition of the patient It can be adjusted according to various factors including the rate of secretion, the duration of treatment, and the drug used concurrently.
- the inhibitor of the present invention when administered once or several times a day, is administered once or several times a day, when the compound is 0.1ng / kg to 10g / kg, a polypeptide, In the case of protein or antibody, 0.1ng / kg ⁇ 10g / kg, antisense oligonucleotide, siRNA, shRNAi, miRNA can be administered at a dose of 0.01ng / kg ⁇ 10g / kg.
- the 'object' includes, but is not limited to, humans, orangutans, chimpanzees, mice, rats, dogs, cattle, chickens, pigs, goats, sheep, and the like.
- the present invention is the use of one or more proteins selected from the group consisting of Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 or Nha1 of Cryptococcus neoformes for the screening of antifungal agents, compositions for screening antifungal agents comprising the protein
- the present invention provides a method for screening an antifungal agent comprising contacting a candidate substance with the protein and determining whether the candidate substance inhibits or promotes the activity of the protein.
- the present invention also provides for the use of one or more genes selected from the group consisting of SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 and NHA1 of Cryptococcus neoformes for screening antifungal agents, screening antifungal agents comprising said genes.
- the present invention provides a method for screening an antifungal agent comprising contacting a composition for a candidate, a candidate with the gene, and determining whether the candidate inhibits or promotes expression of the gene.
- the present invention also provides an antifungal screening method by a yeast two-hybrid system capable of monitoring physical contact between SSK1 and SSK2 of Cryptococcus neoformes, between SSK1 and YPD1, or between YPD1 and TCO2 proteins for the screening of antifungal agents.
- This method has the advantage of screening large amounts of candidates in a short time.
- HOG1 of Cryptococcus neoforms blocks the HOG1 signaling system, thereby enhancing the biosynthesis of ergosterol.
- substances screened to inhibit the protein or gene can be used as an antifungal agent to enhance fungal killing ability in combination with ergosterol-binding antifungal agents.
- substances screened to inhibit ENA1 or NHA1 can be used as antifungal agents to enhance fungal killing ability in combination with ergosterol-binding antifungal agents or azole antifungal agents.
- the present invention also provides the use of at least one protein selected from the group consisting of Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 and Hsp122 of Cryptococcus neoformes for the screening of antifungal agents, comprising the protein An antifungal agent screening composition, and a method for screening an antifungal agent comprising contacting a candidate with the protein and determining whether the candidate inhibits or promotes the activity of the protein.
- the present invention also provides the use of one or more genes selected from the group consisting of RAS1, RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 and HSP122 of Cryptococcus neoforms for the screening of antifungal agents, said genes It provides a composition for screening an antifungal agent, a method of screening an antifungal agent comprising contacting a candidate with the gene, and determining whether the candidate inhibits or promotes expression of the gene.
- the present invention also provides a yeast two-hybrid system capable of monitoring physical contact between Gpa1 and Cac1, Cac1 and Aca1, or Ras1 and Cdc24, Ras2 and Cdc24 proteins of Cryptococcus neoformes for the screening of antifungal agents.
- An antifungal screening method is provided. This method has the advantage of screening large amounts of candidates in a short time.
- inhibition of RAS1, RAS2, CDC24, GPA1, CAC1, ACA1 , PKA1, HSP12 or HSP122 of Cryptococcus neoformes blocks the RAS or cAMP signaling system and is susceptible to polyene or azole antifungal agents. This increases. Therefore, the material screened as inhibiting the protein or gene can be used as an antifungal agent to enhance fungal killing ability in combination with the polyene or azole antifungal agent.
- Confirmation of the reaction between the protein or the gene and the candidate is used to confirm the reaction between the protein-protein, protein-compound, DNA-DNA, DNA-RNA, DNA-protein, DNA-compound, RNA-protein, RNA-compound.
- Conventional methods can be used. For example, a hybridization test for confirming the binding between the gene and the candidate substance in vitro, reaction of mammalian cells with the test substance, and then Northern analysis, quantitative PCR, quantitative real-time PCR, etc.
- a method of measuring the expression rate of a gene or a method of connecting a reporter gene to the gene and introducing it into a cell, reacting with a test substance and measuring the expression rate of a reporter protein, a method of measuring activity after reacting the protein and a candidate substance, Yeast two-hybrid, search for phage-displayed peptide clones that bind to Idbf protein, high throughput screening (HTS) using drug and natural chemical libraries Screening using a hit hit HTS, cell-based screening, or DNA array The can be used.
- HTS high throughput screening
- the composition for screening may include distilled water or a buffer to stably maintain the structure of the nucleic acid or protein.
- the composition for screening may include a cell expressing the protein or gene, or a cell containing a plasmid expressing the gene under a promoter capable of controlling transcription rate for in vivo experiments. .
- nucleic acids, proteins, peptides, and other extracts that have been suspected of having potential as a medicament to inhibit signal transduction by the HOG1 signaling system or randomly selected according to conventional selection methods. Or natural products, compounds, and the like.
- Cryptococcus neoformance used in this example is shown in Table 1 [Spr YS, Geunes-Boyer S, Heitman J (2007) Eukaryot Cell 6: 2278-2289 .; Bru YS, Kojima K, Cox GM, Heitman J (2005) Mol Biol Cell 16: 2285-2300 .; Bahn YS, Kojima K, Cox GM, Heitman J (2006) Mol Biol Cell 17: 3122-3135 .; Perfect JR, Ketabchi N, Cox GM, Ingram CW, Beiser CL (1993) J Clin Microbiol 31: 3305-3309; Kwon-Chung KJ, Edman JC, Wickes BL (1992) Genetic association of mating types and virulence in Cryptococcus neoformans . Infect Immun 60: 602-605.].
- Cryptococcus neoformes was cultured in yeast extract-peptone-dextrose (YPD) medium unless otherwise indicated.
- Each NAT-STM # indicates the Nat r marker with a unique signature tag.
- RNA used in DNA microarrays For isolation of total RNA used in DNA microarrays, wild type H99 , hog1 ⁇ (YSB64), ssk1 ⁇ (YSB261), skn7 ⁇ (YSB349), ras1 ⁇ (YSB51), aca1 ⁇ (YSB6), gpa1 ⁇ (YSB83 ), cac1 ⁇ (YSB42), and pka1 ⁇ pka2 ⁇ (YSB200) defective variants were incubated for 16 hours at 30 ⁇ in 50 ml YPD medium, respectively.
- RNA For isolation of total RNA, 3 ml of sterile 3 mm glass beads were added to the lyophilized cell particles (SIGMUND LINDER), shaken, and homogenized. 4 ml of TRizol was added thereto and incubated at room temperature for 5 minutes. Then, 800 ⁇ l of chloroform was added and incubated for 3 minutes at room temperature, and transferred to a 15 ml round bottom tube (SPL) and centrifuged at 10,000 rpm for 15 minutes at 4 ° C. (Sorvall SS-34 rotor). 2 ml of supernatant was transferred to a new round bottom tube, inverted several times by adding 2 ml isopropanol and incubated for 10 minutes at room temperature.
- SIGMUND LINDER lyophilized cell particles
- RNA samples were measured by OD 260 nm and gel electrophoresis, respectively.
- control total RNA for Cy3 labeling
- RNA for Cy3 labeling
- RNA concentration was adjusted to 1 ⁇ g / ⁇ l with DEPC treated water, 15 ⁇ l total RNA (15 ⁇ g) and 1 ⁇ l 5 ⁇ g / ⁇ l oligo dT (5'-TTTTTTTTTTTTTTTTTTTTTTTTTTV-3 ') / pdN6 (Amersham) (10 ⁇ g / ⁇ l of 1: 1 mixture, respectively) was added and incubated at 70 ° C. for 10 minutes, and then placed on ice for 10 minutes.
- Cy3 and Cy5 labeling of the prepared cDNA were dissolved in 10 ⁇ l DMSO and 1.25 ⁇ l of each dye and divided into separate tubes.
- CDNA prepared as described above and 9 ⁇ l of 0.05M Na-bicarbonate (pH 8.0) were added and incubated for 15 minutes at room temperature.
- cDNAs prepared from pooled reference RNAs were mixed with Cy3 as a control and cDNAs prepared from each test RNA (each experimental condition) were mixed with Cy5. Each mixture was incubated for one more hour at dark room temperature and purified by QIAquick PCR Purification Kit (QIAGEN).
- Cryptococcus neoformance D 70-mer microarray slide (Duke University) containing 7,936 spots was pre-hydridization buffer [42.4 ml sterile distilled water, 2 ml 30% BSA (Sigma), 600 ⁇ l at 42 ° C. 10% SDS, 15 ml 20x SSC], washed with distilled water and isopropanol and centrifuged briefly (110xg, 2 minutes). Cy3 and Cy5-labeled cDNA samples were combined and concentrated through a Microcon 30 filter. And vacuum dried.
- Dried cDNA samples were retreated with hybridization buffer [250 ⁇ l 50% formamide, 125 ⁇ l 20x SSC, 5 ⁇ l 10% SDS, 120 ⁇ l dH 2 O, 500 ⁇ l total] and 1 ⁇ l poly-A tail DNA (Sigma) After the addition was further incubated for 3 minutes at 100 °C and cooled for 5 minutes at room temperature. Microarray slides were aligned with a hybridization chamber (DieTech), dust was removed and covered with Lifterslips (Erie Scientific). Cy3 / Cy5-labeled cDNA samples were applied between Lifterslips and slides. To prevent the slides from drying, 10 ⁇ l of 3 ⁇ SSC buffer was applied to the slides and the slides were then incubated at 42 ° C.
- washing buffer 1 (10 ml 20x SSC, 600 ⁇ l 10% SDS, 189.4 ml dH 2 O, 42 ° C.
- washing buffer 2 (3.5) in an orbital stirrer.
- washing buffer 3 (0.88 ml 20x SSC, 349.12 ml dH 2 0)]
- the microarray slides were scanned with a GenePix 4000B scanner (Axon Instrument) and the signals were passed to GenePix Pro (version 4.0) and to a gal file ( http://genome.wustl.edu/activity/ma/cneoformans ). Since we used the total RNAs isolated from the antigenic type A Cryptococcus neoformus strain, we used antigenic D cryptocurrency using a blastp irradiation (e value range: e-4) to find the corresponding antigenic type A gene ID. The 70-mer oligonucleotide sequence printed on the Cous neoformus slide was examined against the antigenic A Cryptococcus neoformus genomic database. Each S. cerevisiae was identified by blastp irradiation (e value range: e-4) for each S. cerevisiae using antigenic A gene sequence.
- the ergosterol content is described in "Arthington-Skaggs BA, Jradi H, Desai T, Morrison CJ (1999) Quantitation of ergosterol content: novel method for determination of fluconazole susceptibility of Candida albicans. J Clin Microbiol 37: 3332-3337" was measured with slight deformation. Briefly, each Cryptococcus neoformman strain was incubated for 24 hours at 30 ° C. in 100 ml YPD medium. 100 ml cultures were separated into two 50 ml cultures for duplicate measurements, precipitated in a tabletop centrifuge and washed with distilled water. The cell precipitate was cooled in liquid nitrogen and lyophilized overnight.
- the dried cell precipitate was weighed for standardization of the ergosterol content, 5 ml of 25% alcoholic potassium hydroxide was added and transferred to a sterile rod silicic acid glass screw-cap tube. Cells were then incubated at 80 ° C. for 1 hour and cooled at room temperature. Then 1 ml of distilled water and 3 ml of heptane were added and stirred for 3 minutes. 200 ⁇ l of heptene layer was sampled and mixed with 800 ⁇ l of 100% ethanol, and its optical density (OD) was measured at both 281.5 nm and 230 nm.
- OD optical density
- cells were spotted in solid YPD medium containing amphotericin B (Sigma), fluconazole (Sigma), itraconazole (Simga), ketoconazole (Sigma) and fludioxosonyl. The spotted cells were then incubated at 30 ° C. for 2-4 days and photographed.
- RNA samples were isolated from cells grown at each stress condition after 0 min (stress free), 30 min and 60 min incubation. Three independent RNA samples were obtained under each condition as biological replicates for DNA microarray analysis.
- RNAs pooled from all RNA samples were used as control RNAs for Cy3 labeling.
- HOG1, SSK1, SKN7 genes and, GPP1 (glycerol-3-phosphatase) and GPD1 (glycerol-3-phosphate dehydrogenase through a No.) is known from our array data, such as Hog1- associated genes were investigated for the expression levels of .
- Figure 1 shows the results of the identification of the genome level of genes regulated by C. neoformans Hog, Ssk1, Skn7 in normal growth conditions without stress (Fold change is expressed in color).
- Figure 1A are each hog1 ⁇ (YSB64), ssk1 ⁇ (YSB261), skn7 ⁇ (YSB349) compared to the wild type strain (H99) in the deficient mutant background SKN7, SSK1, represents the relative expression level of HOG1 gene
- Figure 1B WT The results of a conditional tree analysis of a wide range of expression levels in , hog1 ⁇ , ssk1 ⁇ , skn7 ⁇ deletion variants are shown.
- FIG. 1C shows the results of a hierarchical clustering analysis of 950 genes showing significantly different expression patterns (ANOVA test, P ⁇ 0.01) in at least one defective variant strain under normal growth conditions (YDP, 30 ° C.),
- FIG. 1D Shows a Venn diagram showing Hog1, Ssk1, Skn7-dependent genes. Genes that exhibit up to two or more significant upregulations or downregulations in each deletion variant strain.
- the genes regulated by Hog1 and Ssk1 cover a variety of functional categories, including energy production and conversion, amino acid / carbohydrate / fat transport and metabolism, translation and protein biosynthesis, post-translational modifications, signal transduction, and stress-defense mechanisms. It is shown that remodeling in various aspects of function can be simply caused by the fluctuation of the HOG pathway without external stress. In addition, it should be noted that more than one-third of Hog1- and Ssk1-dependent genes do not have any functional orthologs from other organisms, indicating that Cryptococcus neoforms generates Cryptococcus-specific Hog1 / Ssk1-dependent genes. It appears to be.
- the genes include the SIT1 for encoding a fore side (CNAG_00815 and CNAG_07138), peroxidase CFO1 (CNAG_06241) and CFO2 (CNAG_02958), CFT1 (CNAG_06242 ) for encoding a Fe delivery system for encoding a dehydratase.
- Cryptococcus neoformus Sit1 is homologous to S. cerevisiae Arn3 / Sit1, which has a high affinity for hydroxyxamate cederophore perioxamine, and Cryptococcus neoformus Cfo1 / Cfo2 and Cft1 in S. cerevisiae Is homologous to the HIV / multicopper peroxidase complex (Ftr1-Fet3). Because iron transport regulation and melanin synthesis appear to be highly associated with Cryptococcus neoformes, the increased melanin synthesis observed in both hog1 and ssk1 deletion variants may be correlated with increased expression of a group of genes involved in iron transport. have.
- the GPA2 gene (CNAG_00179), which encodes a G-protein subunit in the pheromone-responsive MAPK pathway, is significantly upregulated in ssk1 or hog1 deletion variants (12.1 fold 13.3 fold, respectively).
- HOG1 and SSK1 deletion variants were differentially regulated by HOG1 and SSK1 deletion variants.
- hog1 ⁇ and ssk1 ⁇ the defect variants are CTA1 gene and homogeneous for two genes, as expected from the discovery of the above exhibits a hypersensitivity to hydrogen peroxide, encoding catalase A to decrypt the H 2 O 2 in H 2 O (CNAG_04981 and CNAG_00575) is It was significantly down regulated in both deletion variants.
- basal expression levels of the SOD2 gene mitochondrial superoxide dismutase
- were reduced in both hog1 and ssk1 deficiencies further verifying the role of the HOG pathway in oxidative stress regulation.
- TRR1 oxidative stress response
- TSA1 thioredoxin peroxidase
- GRX5 glutthione-dependent oxidoreductase
- CCP1 mitochondrial cytochrome -c peroxidase
- the SRX1 gene ( sulpyredoxin ), which is also involved in the oxidative stress response, was also more reduced in the ssk1 ⁇ deletion variant (4.2 fold reduction) than the hog1 ⁇ deletion variant (1.3-fold reduction). These results may explain why hog1 ⁇ deletion variants are relatively more resistant to H 2 O 2 than ssk1 ⁇ deletion variants.
- ERG28 is an endoplasmic reticulum (ER) membrane backbone protein and is essential for yeast erosteroster biosynthesis by interacting strongly with Erg27, Erg25, Erg11, Erg6 and weakly with Erg26, Erg1. This discovery led to the identification of expression patterns of other ergosterol biosynthetic genes in the array data.
- ER endoplasmic reticulum
- FIG. 2A shows the relative expression levels of ergosterol biosynthesis in hog1, ssk1, skn7 deletion variants compared to wild type. Fold changes are expressed in color, and the exact number of each gene is shown in a table to the right of the hierarchical clustering diagram.
- Figure 2B cells in WT (H99), skn7 ⁇ ( YSB349), ssk1 ⁇ (YSB261), ssk2 ⁇ (YSB264), hog1 ⁇ (YSB64) deficient mutant shows the ergosterol content.
- the left and right graphs show each strain and the relatively increased percentage of ergosterol in the ergosterol content compared to wild type, respectively.
- ssk2 ⁇ (MAPKKK) and pbs2 ⁇ (MAPKK) deletion variants in the HOG pathway appear to have significantly higher cellular ergosterol levels than wild type and skn7 ⁇ deletion variants (Figure 2B), which further validates our array data.
- 3 is an analysis showing that inhibition of the HOG pathway shows an elevated antifungal effect with amphotericin B in C. neoformans .
- 3A to 3B show photographs obtained by culturing each C. neoformans strain spotted on YPD solid medium containing amphotericin B at the indicated concentration for 72 hours at 30 ⁇ , and
- FIG. 3C shows the cancer cells at the indicated concentration.
- C. neoformans antigen- type A strains and antigen- type D strains spotted on YPD solid medium containing erysin B are photographed by incubation at 30 ⁇ for 72 hours.
- the ssk1, ssk2, pbs2, hog1 deletion variants showed significant hypersensitivity to amphotericin B treatment compared to wild type (FIG. 3A), indicating that the ergosterol content was higher than wild type. Consistent with the finding that it was much higher in the HOG pathway deletion variant (FIG. 2B).
- the skn7 deletion variant showed wild-type levels of resistance to amphotericin B (FIG. 3A), which is also illustrated by previous data that the ergosterol content of cells in the skn7 deletion variant was similar to the wild type (FIG. 2B). .
- Tco1, Tco2, Tco3, Tco4, Tco5, Tco7 a deletion variant hybrid sensor kinase that act on top of the Ssk1 response modulator.
- Tco1 and Tco2 play a role of differentiation and differentiation in regulating some of the Hog1-dependent phenotypes.
- Tco1 and Tco2 each play a role in detecting and responding to amphotericin B.
- Tco2 a double hybrid sensor kinase with two response modulator regions and two histidine kinase regions in one polypeptide, showed hypersensitivity to amphotericin B (FIG. 3B), indicating that Tco2 is responsible for the HOG pathway.
- amphotericin B Through the detection and response of amphotericin B to give drug resistance.
- the degree of hypersensitivity observed in tco2 deletion variants is less than that of the ssk1 deletion variants suggests other possibilities.
- One possibility is that other unknown receptors / sensors may be present to respond to amphotericin B.
- Ssk1, Ssk2, and Pbs2 are all related to the structural phosphorylation level of Hog1, structurally phosphorylated Hog1 inhibits the ergosterol biosynthetic pathway under normal conditions, regardless of the presence of receptors / sensors. You can do it.
- amphotericin B sensitivity of other Cryptococcus neoforms strains such as JEC21, B3501-A was tested and exhibited differential Hog1 phosphorylation levels.
- the JEC21 strain in which Hog1 was not always phosphorylated showed hypersensitivity to amphotericin B, even more than the ssk2 deletion variant in the background of the H99 strain (FIG. 3C).
- deletion variants of the SSK2, PBS2, HOG1 genes did not affect the sensitivity to amphotericin B (FIG. 3C).
- FIG. 4 is an analysis showing that inhibition of the HOG pathway in C. neoformans shows antagonistic antifungal effect on some azole drugs, with each C. neoformans strain YPD containing indicated concentrations of fluconazole, ketoconazole, itraconazole Spotted on a solid medium and then incubated for 72 hours at 30 °C shows a photograph taken.
- ssk1 and hog1 variant variants particularly those with increased expression of many ergosterol biosynthetic genes, including ERG11 , would be highly resistant to azole compounds.
- all of the ssk1, ssk2, pbs2, hog1 deficiency variants showed sensitive resistance to fluconazole and ketoconazole, but not itraconazole.
- the skn7 deletion variants also showed higher resistance to fluconazole and ketoconazole than the wild type.
- Tco1 and Tco2 show differential sensitivity to azole compounds.
- the tco2 deletion variant showed higher resistance to fluconazole and ketoconazole than the wild type.
- the tco1 deletion variant is hypersensitive to all azole drugs, indicating that Tco1 may modulate the HOG pathway in contrast to Tco2 in Cryptococcus neoforms.
- inactivation of the HOG pathway increases ergosterol content by induction of ergosterol biosynthesis genes and thus a synergistic effect on amphotericin B treatment, but an antagonistic effect on fluconazole and ketoconazole.
- ENA1 serotype A ID: CNAG_00531.2
- NHA1 serotype A ID: CNAG_01678.2
- K + Toxicity is small but efflux pump must be present to control effectively because it is toxic if present in excessive concentration in cells.
- a deletion mutant of each gene was prepared, and a double deletion mutant ( ena1 ⁇ nha1 ⁇ ) with which the two genes were specifically removed at the same time was prepared, and amphotericin B ( The susceptibility to polyene-based antifungal agents such as AmpB) and azole antifungal agents such as fluconazole, ketoconazole and itraconazole was confirmed.
- the ena1 ⁇ and nha1 ⁇ deletion variants did not show particularly high sensitivity to AmpB.
- ena1 nha1 ⁇ ⁇ double deletion mutant was found to show a significantly increased sensitivity to AmpB (Fig. 5B).
- aca1 ⁇ And gpa1 ⁇ Deletion variants cac1 ⁇ And pka1 ⁇ pka2 ⁇ It showed a transcript pattern similar to that of the missing variant, Aca1 and Gpa1 are two major signaling regulators in the cAMP- signaling pathway (FIG. 6D). aca1 ⁇ And gpa1 ⁇ There were small groups of genes whose expression was controlled differently between the deletion variants. This indicates that Aca1 and Gpa1 may have signaling branches of different non-mainstream (FIG. 6D). As expected, cac1 ⁇ Deletion variants pka1 ⁇ pka2 ⁇ Showed almost the same genome expression pattern as C. neoformans It is shown that it is a necessary and sufficient protein kinase protein subsystem of adenylyl cyclase (FIG. 6D).
- cAMP-signaling dependent genes appear across those involved in signal induction mechanisms (15.2%), carbohydrate transport and metabolism (9.6%), and amino acid transport and metabolism (8.0%).
- the cAMP-path is one of the central signal induction cascades that regulate growth, differentiation, and virulence of C. neoformes, and was known to sense glucose and amino acids (Bru et al., 2004, Xue et al. , 2006) This was a somewhat predicted result.
- genes involved in signal induction mechanisms appeared mostly in ras1 ⁇ defective variants (12.1%) (FIG. 7).
- genes related to cell wall / membrane / shell biosynthesis appeared overall (2.9%), suggesting that Ras1 may be involved in the maintenance of cell wall integrity.
- Ras-dependent genes Of the 161 Ras-dependent genes selected (2-fold cutoff, FIG. 6C), many of them (101 genes, 63%) did not have any orthologs in other fungi, which is a set of Ras unique to Cryptococcus neoforms. It suggests that it includes dependent genes.
- its ortholog S. cerevisiae Three genes known to be involved in the regulation of Rho-GTPase Cdc42 in PXL1 , RDI1 , And BEM3 was notable because the Ras1-Cdc24 signaling pathway was reported to be regulated by one of the Cdc42 homologs in Cryptococcus neoformes (Nichols et al., 2007).
- RDI1 And BEM3 Is each Encodes a Rho-GDP dissociation inhibitor and a Rho-GTPase activating protein (Price et al. , 2008, Zheng et al. , 1994).
- Ras1 in the genotoxic stress response of Cryptococcus neoformes, a number of genes involved in the regulation of DNA damage repair have been identified as Ras-dependent genes.
- RNR2 / RNR3 Rabonucleotide-diphosphate reductase
- RAD3 DNA helicase, a subunit of nucleotide excision repair factor 3
- RAD14 a subunit of nucleotide excision repair factor 1
- MSH6 a protein required for mismatch repair
- MND1 a protein required for recombination and repair of DNA double strand breaks
- DNA2 ATP-dependent nucleases
- CHS1 Chitin synthase 1
- CDA2 Chitin deacetylase
- BGL2 glucan 1,3-b-glucosidase
- GSC2 Glucan synthase
- cAMP deletion variant ( aca1 ⁇ , gpa1 ⁇ , cac1 ⁇ , And pka1 ⁇ pka2 ⁇ Transcript data and wild type strains (ANOVA, P Statistical comparison with ⁇ 0.05) confirmed 163 genes (FIG. 6C). Of these, 38 genes CAC1 , ACA1 , PKA1 , And GPA1 Except for, it showed more than twofold induction or reduction in cAMP deletion variants (FIG. 9). The majority of cAMP-dependent genes (31 genes, 81%) have no known function in Cryptococcus neoforms. S.
- Ena1 Regulates Osmotic Stress in Carbon Deficient Conditions (Ko et al. , 2009), but also required for survival in basic pH and in vivo toxicity (Idnurm et al. , 2009).
- Homolog of Mammalian 3-b-hydroxysteroid dehydrogenase GRE2 genes de r espuesta a e stres, stress-responsive gene, S.
- HOG-dependent Sko1 transcription factors to the CRE (cAMP response element) in the promoter region in the cell is strongly induced in response to various stresses, including osmotic pressure and oxidative stress (Garay-Arroyo & Covarrubias, 1999, Rep). et al. , 2001).
- Heat shock protein HSP12 (03143) is a small hydrophobic protein whose expression is induced by various stresses and regulated by HOG and cAMP signaling pathways (Varela et al. , 1995).
- GRE2 is involved in the regulation of some ergosterol biosynthetic genes, including ERG6 , ERG10 , and ERG19 / MVD1 (Warringer & Blomberg, 2006).
- GRE2 has been reported as one of six genes that increase its expression in response to amphotericin B (AmpB) in S. cerevisiae (Anderson et al. , 2009). Therefore, we examined whether Cryptococcus neoform Ras- and cAMP-deficient variants are more susceptible to AmpB treatment than wild type.
- ras1 ⁇ Deletion variants show higher susceptibility to AmpB compared to wild type, aca1 ⁇ Deletion variants showed slightly higher AmpB sensitivity (FIG. 10A).
- ras1 ⁇ aca1 ⁇ double The deletion variants showed higher AmpB-sensitivity compared to each single deletion variant (FIG. 10B). This indicates that Ras1 and Aca1 regulate AmpB sensitivity either overlapping or independently.
- Cdc24 has been shown to act downstream of Ras1 to modulate polyene drug resistance (FIG. 10C).
- ras2D The deletion variants were also shown to be slightly more susceptible to AmpB compared to the wild type, indicating that the Ras proteins all modulate resistance to polyene drugs in Cryptococcus neoforms.
- the gpa1 ⁇ and cac1 ⁇ deletion variants showed much higher AmpB-sensitivity than the wild type, and even higher AmpB-sensitivity compared to the ras1 ⁇ or aca1 ⁇ deletion variants (FIG. 10A).
- the ras1 ⁇ cac1 ⁇ double deletion variants showed higher AmpB sensitivity compared to the deletion variants of each alone (FIG. 10B), indicating that the Ras- and Gpa1-Cac1-Pka1 pathways are independently associated with AmpB sensitivity.
- the ras1 ⁇ and ras1 ⁇ cac1 ⁇ deletion variants produced in the MAT a background (KN99 strain) showed the same phenotype (data not shown).
- the HOG pathway regulates the ergosterol biosynthesis of Cryptococcus neoformes under nonstress conditions, and the HOG pathway deletion variant is hypersensitive to AmpB due to the increased cellular ergosterol content in the deletion variant. It has been confirmed that the sensitivity and very high resistance to fluconazole. Therefore, it is conceivable that HOG and cAMP pathways affect polyene sensitivity in different ways. That support this, we found that the hog1 ⁇ cac1 ⁇ and hog1 ⁇ pka1 ⁇ double deletion mutant is hog1 ⁇ , cac1 ⁇ , or pka1 ⁇ more sensitive than about AmpB than the defect mutant of the sole (Fig. 10E).
- hog1 ⁇ cac1 ⁇ double deletion variants also showed hypersensitivity to various azole based drugs such as fluconazole, ketoconazole and itraconazole (FIG. 10F).
- ras1 ⁇ , aca1 ⁇ , gpa1 ⁇ , cac1 ⁇ , and pka1 ⁇ deletion variants all showed increased sensitivity to itraconazole (FIG. 10G).
- both Ras1 and Ras2 have been shown to be involved in itraconazole sensitivity in a Cdc24 dependent manner (FIG. 10H).
- Ras- and cAMP signaling pathways modulate susceptibility to polyene or azole antifungal agents in Cryptococcus neoforms.
- Both Ras1 and Ras2 have been shown to be involved in polyene sensitivity using Cdc24 as a subregulator.
- the ras1 ⁇ aca1 ⁇ deletion variant was also shown to be hypersensitive to amphotericin B. This suggests that Ras1 and Aca1 may play a secondary role in sensitivity to polyene based drugs. It is possible that cytoskeletal control and cell wall integrity disturbed by ras1 and aca1 mutations have made the cells more susceptible to polyene-based drugs.
- the cAMP-signaling pathway was also more significantly related in polyene-based sensitivity than the Ras-signaling pathway.
- GPA1 , CAC1 , And PKA1 The variant variant of made Cryptococcus neoformus cells hypersensitive to polyene-based drugs such as amphotericin B (AmpB).
- Amphotericin B Amphotericin B
- the HOG pathway As noted above, fluctuations in the HOG pathway also resulted in Cryptococcus neoforms cells. We have confirmed that it is sensitive to AmpB.
- the cAMP and HOG pathways appear to act differently on the regulation of polyene-based drug sensitivity.
- the HOG pathway increases the biosynthesis of ergosterol, improving the sensitivity of polyene based drugs and the resistance of azole based drugs (Ko et al., 2009). Also, hog1 ⁇ Deletion variants showed higher susceptibility to AmpB compared to cAMP deletion variants.
- the cAMP-signaling pathway was found to be more significantly related to polyene susceptibility than the Ras-signaling pathway.
- the role of the gene was further analyzed.
- HSP12 H99 gene ID: CNAG_03143.2
- HSP122 H99 gene ID: CNAG_01446.2
- two C. neoformans homologs of the two heat shock proteins Hsp12. was shown to contribute some (FIG. 11).
- cac1 ⁇ deficient mutant is hsp12 ⁇ or hsp122 ⁇ , but susceptibility to AmpB more elevated than the defective variant, hsp12 ⁇ or hsp122 ⁇ deficient variants are susceptibility to AmpB appeared to be slightly higher compared to wild type ( Figure 11A ). Therefore, it was conceivable that reduced expression of Hsp12 or HSP122 would contribute to the susceptibility of cAMP deletion variants to AmpB.
- Hsp12 and Hsp122 To clarify the regulatory mechanism of Hsp12 and Hsp122 , we performed Northern blot analysis to confirm that the cAMP-signaling pathway modulates the expression of Hsp12 and Hsp122 genes.
- HSP12 In S. cerevisiae , HSP12 is not expressed under glucose-free conditions of stress, but expression is induced in response to environmental stresses (Praekelt & Meacock, 1990, Siderius et al. , 1997).
- the Hsp12 and Hsp122 genes in Cryptococcus neoformes appeared to be highly expressed genes in wild-type strains under non-stress of glucose rich conditions (FIG. 11A).
- Hsp12 and Hsp122 were significantly down-regulation in cAMP deficient mutants, including gpa1 ⁇ , ⁇ cac1, and pka1 pka2 ⁇ ⁇ deficient mutant (Fig. 11A).
- aca1 ⁇ deletion variants and ras1 ⁇ deletion variants the expression levels of the Hsp12 and Hsp122 genes were only slightly affected (FIG. 11A).
- Hsp12 and Hsp122 may be under the control of the HOG pathway.
- Hsp122 and Hsp12 expression levels hog1 ⁇ ateuna to consider only defects in the variants and mutants deficient ssk1 ⁇ day, but not in the defect ⁇ skn7 mutants ( Figure 11B).
- Figure 11B To verify this, we have found that it can not be detected in were performing Northern blot analysis, expression levels of Hsp12 and Hsp122 in wild-type and skn7 ⁇ deficient mutants is very high, but, hog1 ⁇ and ssk1 ⁇ deficient mutant (Fig. 11B) . All these data show that the Hsp12 and Hsp122 genes are co-regulated by cAMP and HOG signaling pathways.
- Hsp12 the hypersensitivity of the cAMP-deficient variant to the polyene-based drug was partially attributed to the reduced expression of the heat shock proteins Hsp12 and Hsp122.
- S. cerevisiae Hsp12 plays a role in stabilizing cell membranes as cell wall softeners and water substitution molecules (Sales et al., 2000, Shamrock & Lindsey, 2008), S. cerevisiae Is involved in maintaining cell wall integrity under stress conditions (Shamrock et al. , 2009). therefore, hsp12 ⁇ Defect variants cannot grow in the presence of Congo Red, a cell wall destabilizing agent (Motshwene et al. , 2004).
- Hsp12 the level of basal expression of Hsp12, which continues to weaken cell wall integrity and membrane flexibility of Cryptococcus neoformes.
- HOG pathway deletion variants the hypersensitivity of HOG pathway deletion variants to polyene drugs is partially HSP12 It is due to the reduced expression of.
- cac1 ⁇ Deletion variants hsp12 ⁇ As it is much more sensitive to AmpB compared to the deletion variants, other factors except ergosterol biosynthesis may affect the resistance to polyene-based drugs.
- hog1 ⁇ cac1 ⁇ or hog1 ⁇ pka1 ⁇ The dual deletion variants exhibited much higher polyene-based drug sensitivity compared to each alone deletion variant, indicating that the two pathways play independent roles in polyene-based drug sensitivity.
- HOG1 And CAC1 Double deletion variants of the gene caused Cryptococcus neoformus cells to be hypersensitive for most azole drugs, including fluconazole, ketoconazole, and itraconazole, for unknown reasons.
- modification of the Ras-, cAMP / PKA-, and HOG-signaling pathways will provide a new antifungal therapeutic approach in combination with polyene- and azole-based drugs.
- polyene-based drugs such as amphotericin B
- simultaneous inhibition of the cAMP and HOG pathways may be one of the most potent combination therapies for the treatment of Cryptococcus infection.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Abstract
본 발명은 진균 감염의 치료를 위한 HOG, Ras 및 cAMP 신호전달경로 유전자의 용도를 제공한다. 본 발명에서는 크립토코쿠스 네오포만스의 HOG 경로 조절에 있어서 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1 유전자들이 수행하는 역할에 대해 조사하여, 이들 유전자들이 억제되면 에르고스테롤의 생합성량이 증진됨을 새로이 밝혀냈다. 상기 유전자들을 억제하면 진균의 세포막 상에 에르고스테롤이 다량 분포하게 되므로, 에르고스테롤-결합성 항진균제의 작용점이 많아서 에르고스테롤-결합성 항진균제의 효능을 현저히 상승시킬 수 있게 된다. 또한 본 발명에서는 크립토코쿠스 네오포만스의 Ras 및 cAMP 경로의 조절에 있어서 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 및 HSP122 유전자들이 수행하는 역할에 대해 조사하여, 이들 유전자들이 억제되면 폴리엔계 약물이나 아졸계 약물에 대한 감수성이 증진됨을 새로이 밝혀냈다. 따라서 상기 유전자 또는 이들에 의해 코딩되는 단백질에 대한 저해제를 포함하는 항진균용 의약 조성물은 기존 항진균제의 사용 용량을 절감시키면서 효능을 상승시킬 수 있는 우수한 복합 항균치료제로서 사용할 수 있다.
Description
본 발명은 진균 감염의 치료를 위한 HOG, Ras 및 cAMP 신호전달경로 유전자의 용도에 관한 것이다.
특정 환경에서 생물이 생존하고 증식할 수 있는지는 주로 다양한 환경적 스트레스에 반응하고 적응하며, 세포 항상성을 유지하는 능력에 의해 결정된다. 세포들은 일련의 복합 신호 네트워크의 수행에 의해 중요 프로세스를 조절한다. 그들 중에서, p38/Hog1 MAPK(mitogen-activated protein kinase) 의존성 신호 경로는 효모로부터 인간에 이르는 진핵 생물에서의 광범위한 스트레스-반응을 조절하는데 중추적인 역할을 수행한다.
포유동물의 스트레스-활성화된 p38 MAPK는 삼투압 변화 및 자외선 조사, 프로그램화된 세포 사멸, 그리고 사이토카인 생성 및 염증의 조절에 의한 면역 반응에 대한 적응을 제한하는 다양한 스트레스 연관-신호를 유도한다. 유사한 스트레스-감지성 신호전달체계는 다른 종들에서 밝혀진 바 있다. 균류는 다양한 스트레스 반응을 조절하는 p38-유사 MAPKs를 갖는다. 출아 효모 사카로마이세스 세르비지에(Saccharomyces cerevisiae)에서, Hog1 MAPK는 삼투압 쇼크, 산화적 손상 및 중금속 손상에 대한 스트레스 반응을 조절한다. 분열 효모 스키조사카로마이세스 폼베(Schizosaccharomyces pombe) 또한 Hog1 동족체인, Sty1 (Spc1 및 Phh1로도 알려짐)을 가지며, 이는 삼투압 쇼크, 열 쇼크, 산화적 손상 및 중금속 손상, 탄소 결핍 및 자외선 조사를 포함한, 굉장히 많은 다양한 스트레스에 대한 적응에 관련되어 있다. 흥미롭게도, Sty1은 또한 성장 조절 및 생식과 분화에도 연관되어 있다. Hog1 MAPK orthologs는 또한 캔디다 알비칸(Candida albicans)(Hog1) 및 아스퍼질러스 푸미가터스(Aspergillus fumigatus)(SakA)를 포함한 다른 자낭균류(ascomycete) 병원성 진균류에서도 발견되며, 삼투압 쇼크, 자외선 조사, 산화적 손상 및 고온을 포함한 다양한 환경적 원인에 대한 반응을 매개하는 것으로 밝혀졌다.
p38/Hog1 MAPK 신호전달 네트워크의 공통적인 분자 메커니즘이 많은 진핵세포에서 폭넓게 보존되어 있다. 정상적인 성장조건 하에서, p38/Hog1 MAPK는 비인산화되어 있지만, 특정한 환경적인 스트레스에 반응하여, 그의 상위신호체계에 있는 MAPKK 카이네이즈(MAPKKK)에 의한 인산화를 통해 활성화되는 MAPK 카이네이즈 (MAPKK)를 통해 TGY 모티프에서 Thr 및 Tyr 잔기의 이중 인산화에 의해 활성화된다. 이어, 인산화된 p38/Hog1 MAPKs는 dimer를 형성한 후 핵 내로 이동하여 전사조절인자의 활성화를 촉발하며 외적 스트레스 조건에 대항하는 스트레스-방어 유전자의 과잉을 유도한다.
p38/Hog1 MAPK의 보존된 조절 메커니즘에도 불구하고, 진균류 및 포유동물은 독특한 세트의 상위 조절 시스템을 발전시켰다. 특히, 진균류는 포유동물에는 존재하지 않고 오직 박테리아, 진균 및 식물에서만 발견되는 이원소-유사 인산전달 시스템(two-component-like phosphorelay system)을 이용한다. 진균의 인산전달 시스템은 하이브리드 센서 카이네이즈(hybrid sensor kinases), 히스티딘-함유 포스포트랜스퍼 단백질(histidine-containing phosphotransfer protein, HPt), 및 반응 조절자(response regulators)를 포함하는 세 가지 요소로 구성되며, 이들 모두는 포유동물에서는 관찰되지 않아, 좋은 항진균제 타깃으로 고려되고 있다.
담자균 효모류(basidiomycetous) 크립토코쿠스 네오포만스는 또한 삼투압 쇼크, 자외선 조사, 열 쇼크, 산화적 손상, 독성 대사체 및 항진균제를 포함한 다양한 환경적 스트레스에 대한 적응을 위해 스트레스 활성화된 Hog1 MAPK 시스템을 또한 이용한다. 크립토코쿠스 네오포만스는 면역 손상 환자에서의 피부 및 폐 크립토코쿠스증 및 크립토코쿠스 뇌수막염을 야기하는, 전 세계에 걸쳐 어디에서나 발견되는 인간 병원성 진균이다. 크립토코쿠스 네오포만스 var. grubii(항원형 A)는 가장 흔히 발견되는 반면(>90% of environmental and clinical strains), 크립토코쿠스 네오포만스 var. neoformans(항원형 D)는 유럽의 특정 지역에서만 보다 흔할 뿐 빈번히 발견되지 않는다 (<10%). 그러나, 항원형 B 및 C 크립토코쿠스 네오포만스로 알려진 Cryptococcus gattii는 면역체계에 이상이 없는 정상인을 공격하는 일차적인 병원체(primary pathogen)로 판명된 바 있다.
그러나, 다른 진균의 Hog1 MAPK 시스템과 비교하여, 크립토코쿠스 네오포만스 Hog1 MAPK 경로는 다양한 환경적 스트레스에 대응하기 위해서 뿐만 아니라, 항포식 캡슐 및 항산화 멜라닌의 두 가지 병독성 인자의 생성 및 성적 분화를 조절하도록 독특하게 발전하여, Hog1 MAPK가 다른 신호전달 경로와 cross-talks하는 크립토코쿠스 네오포만스에서의 중요 신호전달 조절자로서 중추적인 역할을 함을 암시하고 있다. 최근 본 발명자들은 다수의 크립토코쿠스 네오포만스 균주에서의 Hog1 MAPKs가 비스트레스성 조건 하에서 항상 인산화되어 있으며, 삼투압 쇼크 및 항진균제 플루디옥소닐 처리에 대응하여 그의 활성화를 위해 신속히 탈인산화됨을 밝힌 바 있는데, 이는 다른 진균의 Hog1 MAPK 시스템과는 명백히 대조적이다. Hog1에서의 TGY 모티프의 이중적 인산화는 Pbs2 MAPKK를 요구한다. Pbs2-Hog1 경로의 상위에 있는, 진균 특이적 인산전달 시스템 또한 크립토코쿠스 네오포만스에서 발견된다. 크립토코쿠스 네오포만스 인산전달 시스템은 7개의 다른 센서 하이브리드 히스티딘 카이네이즈(Tco1-7), Ypd1 포스포트랜스퍼 단백질, 및 두 개의 반응 조절자(Ssk1 및 Skn7)를 포함한다. Pbs2-Hog1 경로는 대개 Ssk1에 의해 조절되나, Skn7에 의해서는 조절되지 않는다. 7 개의 Tco 단백질 중, Tco1 및 Tco2는 Ssk1 및 Pbs2-Hog1 MAPK 경로를 활성화시키는데 차별적이면서도 동시 중복된 역할을 수행한다. 그러나, Tco1 및 Tco2는 Ssk1- 및 Hog1과 관련된 일부의 표현형을 조절하므로, 다른 상위의 수용체 또는 센서 단백질들은 밝혀져야 할 것으로 남아 있다. 보다 최근에, 우리는 Hog1의 상이한 인산화 패턴을 보여주는 항원형 D f1 형제 균주인 B-3501 및 B-3502 간의 meiotic map의 비교 분석을 통해, 인산전달 시스템과 Pbs2-Hog1 MAPK 경로 간의 연결고리역할을 하는 단백질인 Ssk2 MAPKKK를 동정했다. 가장 주목할만한 것은, 상이한 Hog1 인산화 패턴을 보여주는 두 개의 크립토코쿠스 네오포만스 균주 간의 Ssk2 대립유전자의 상호교환이 상시적인 Hog1 인산화에 의해 제어되는 표현형을 변경시킨다는 것이다. S. 세르비지에 및 S. 폼베와는 달리, 크립토코쿠스 네오포만스는 Hog1 MAPK를 조절하는 단일한 MAPKKK, Ssk2를 갖고 있다. 크립토코쿠스 네오포만스에서의 Hog1 MAPK 경로의 다운스트림 신호전달 네트워크가 아직 밝혀지지 않았으나, 새로운 항진균제의 타겟을 개발하기 위해서는 Hog1 MAPK의 다운스트림 신호전달 네트워크의 동정 및 특성화가 필요하다.
과거에 진균 감염은 건포상백선, 완선, 아구창 같은 국소적 감염이 많이 발생하였고, 전신적 진균 감염은 드물게 발생했지만, 최근 들어 전체 병원 내 감염에서 4번째 빈도를 차지할 정도로 흔하게 발생하고 있다.
현재까지 개발된 항진균제는 크게 화학적으로 아졸(azole) 구조를 갖는 항진균제와 아졸 구조를 갖지 않는 항진균제로 분류할 수 있다. 아졸 계열의 항진균제로 케토코나졸(ketoconazole), 플루코나졸(fluconazole), 이트라코나졸(itraconazole), 보리코나졸(voriconazole) 등이 있고, 비-아졸 계열의 항진균제로 테르비나핀(terbinafine), 플루사이토신(flucytosine), 암포테리신 B(Amphotericin B), 카스포푼긴(caspofungin) 등이 있다.
아졸 구조를 갖는 케토코나졸, 플루코나졸, 이트라코나졸, 보리코나졸과 알릴아민(allylamines) 계열인 나프티핀, 테르비나핀은 유사한 작용기전을 지니고 있다. 두 계열의 항진균제는 라노스테롤이 진균 세포막의 주성분인 에르고스테롤로 전환되는 과정에 필요한 효소를 억제하는 작용을 나타낸다. 아졸 계열 항진균제는 미세소체 효소를 억제하고, 알릴아민 계열의 항진균제는 스쿠알렌 에폭시데이즈(epoxidase)를 억제하여 위와 같은 효과를 나타낸다. 플루사이토신(5-FC)은 핵산합성을 억제하는 대사길항제로서 진균 RNA의 오부호전달 유발 및 DNA 합성을 비경쟁적으로 길항하여 항진균작용을 나타내며, 폴리엔(Polyenes) 구조를 가진 암포테리신 B는 진균 세포막 내부의 에르고스테롤에 결합하여 세포막의 탈분극을 유발하고, 구멍을 형성하여 세포 내 함유물의 손실을 유발하여 항진균작용을 나타낸다. 에키노칸딘(Echinocandins) 계열의 항진균제인 카스포푼긴은 진균 세포벽 형성을 가역적으로 억제하는 작용을 지니고 있으며, 세포벽에 작용한다는 점에서 위에 언급한 세포막에 작용하는 항진균제와 차이가 있다.
아졸 계열의 약물은 간기능 저하 환자에게 사용 시 간염에 의한 사망을 초래할 수도 있으므로 투여 전에 반드시 간기능 검사가 선행되어야 한다. 플루사이토신은 용량의존적으로 골수 억제 작용, 간독성이 나타나고 소장결장염이 발생 가능한 것으로 보고되었고, 이런 부작용은 신기능이 저하된 경우 더 증가하므로 환자의 신기능 모니터링이 매우 중요하다. 또한 임산부에서 금기이다. 암포테리신 B의 대표적 독성은 신동맥 수축에 따른 사구체 신독성으로, 용량 의존적이어서 평생 누적 용량이 4~5g 이상일 경우 영구적인 신기능 손실 발생률이 상승한다. 또한, 세뇨관 독성에 의한 칼륨, 마그네슘, 중탄산염의 과도한 소실 및 조혈호르몬 생산 저하 등의 신독성이 일어날 수 있다. 그 외, 급성 반응으로 혈전정맥염, 오한, 떨림, 과호흡 등의 증상이 나타날 수 있다. 이와 같이, 기존에 개발된 항진균제들은 약물의 종류에 따라 각종 부작용을 나타내고 있어, 이러한 부작용은 낮추면서도 항진균 효과는 증진시킬 수 있는 새로운 치료법의 개발이 요구되고 있다.
한편, Aspergillus fumigatus, Candida albicans, 및 Cryptococcus neoformans를 포함한 전 세계에 분포되어 있는 병원성 균류에서, Ras- 및 cAMP-신호전달 경로는 진화론적으로 보존되어 있으며, 아직까지도 유의한 기능적 및 구조적 차이들이 발견되고 있다 (Pukkila-Worley & Alspaugh, 2004, Rolland et al., 2002, Wang & Heitman, 1999, Thevelein & de Winde, 1999, Alspaugh et al., 1998, Lengeler et al., 2000, Bahn et al., 2007). 생명에 치명적인 진균성 뇌수막염을 일으키는 크립토코쿠스 네오포만스에서 cAMP-신호전달 경로는 병독성 인자의 생산 및 분화에 있어서 중요하다(Idnurm et al., 2005). S. cerevisiae 및 C. albicans 와 유사하게, 아데닐일 사이클라아제(adenylyl cyclase)(Cac1)의 두 개의 주요한 상위 신호전달 조절자인, Aca1 (Adenylyl cyclase-associated protein 1) 및 Gα subunit protein (Gpa1)이 크립토코쿠스 네오포만스의 cAMP-신호전달 경로를 조절함이 확인된 바 있다 (Bahn et al., 2004, Alspaugh et al., 1997). GPA1 유전자의 파괴는 다중적인 세포의 표현형을 야기하는데, 이는 숙주에서 크립토코쿠스 네오포만스의 생존 및 증식에 있어 필수적인 핵심 병독성인자인 멜라닌과 캡슐의 불완전한 생산, 및 감염성 포자의 보급에 중요한 교배의 감소를 포함한다 (Alspaugh et al., 1997). Aca1는 Cac1 아데닐일 사이클라아제와 물리적으로 상호작용하며, cAMP의 기초적인 수준을 조절하지는 않으나 cAMP의 유도를 조절하여 대부분의 cAMP-의존적 표현형을 지배한다 (Bahn et al., 2004). CAC1 의 결손변이체는 gpa1△ 또는 aca1△ 결손변이체에 비해 보다 심한 표현형을 생성하며, gpa1△ aca1△ 이중 결손변이체는 cac1△ 결손변이체와 표현형상 동등하다 (Bahn et al., 2004). 이는 Cac1이 Aca1 및 Gpa1 모두에 의해 활성화됨을 나타낸다. 크립토코쿠스 네오포만스의 Cac1의 하위신호체계에는 PKA(Protein kinase A)의 두 개의 촉매성 subunit인 Pka1 및 Pka2, 및 조절 subunit인 Pkr1을 포함한다. Pka1는 항원형 A 크립토코쿠스 네오포만스 H99 균주 background에서 cAMP 신호전달에 있어 우세한 역할을 하는 반면 Pka2는 항원형 D 크립토코쿠스 네오포만스 JEC21 균주에서 그러한 역할을 한다(Hicks et al., 2004). 그럼에도 불구하고, pka1△ pka2△ 이중 결손변이체는 cac1△ 결손변이체와 동등한 표현형을 나타내는데, 이는 Cac1으로부터의 cAMP 신호전달이 두 개의 PKA 촉매성 subunit로 갈라짐을 나타낸다 (Bahn et al., 2004). 흥미롭게도, PDE2이 아닌 PDE1의 결실은 gpa1△ 결손변이체의 멜라닌 결핍과 같은 일부 표현형을 복구하는데, 이는 상이한 포스포디에스터라아제가 다양한 균류에서 작용하고 있음을 나타낸다(Hicks et al., 2005).
두 개의 Ras 단백질, Ras1 및 Ras2가 크립토코쿠스에서 발견되었으며 그들은 공유하면서도 구별되는 역할을 하는 것으로 밝혀졌다 (Alspaugh et al., 2000, D'Souza et al., 2001, Waugh et al., 2002). 그들 중에서도, Ras1은 숙주에서의 생존 및 증식에 필수적인 고온 성장 및 침범적 성장을 지탱해주고 생식적 분화를 촉진하는 주요한 크립토코쿠스 네오포만스 Ras 단백질이다(Alspaugh et al., 2000). ras2△ 결손변이체가 어떠한 식별가능한 표현형을 갖는 것은 아니지만, RAS2 의 과발현은 대부분의 ras1 돌연변이 표현형을 다소 억제한다 (Waugh et al., 2002). S. cerevisiae와 유사하게, RAS1 및 RAS2 유전자의 파괴는 모든 온도에서 세포의 생존성에 영향을 미치는데, 이는 Ras 단백질이 일반적인 세포의 성장에 필수적임을 나타낸다. 다양한 Ras-관련 표현형 중에서, 오직 침범적 성장 및 교배만이 cAMP-의존적인 반면 고온에서의 성장은 cAMP-비의존적이고, Ras1-특이적인 표현형이다(Alspaugh et al., 2000, Waugh et al., 2003). 흥미롭게도, Cac1은 S. cerevisiae 에서의 GTP-결합 Ras에 대한 결합 부위인 Leucine-rich repeat(LRR) 도메인을 품고 있지 않다(Shima et al., 1997). 아데닐일 사이클라아제/사이클라아제-관련 단백질 복합체는 S. cerevisiae에서 볼 수 있는 바와 같이 그의 활성화를 위한 2차적인 Ras-결합 부위를 제공할 수 있기 때문에 (Shima et al., 2000), Ras1이 크립토코쿠스 네오포만스에서 그의 활성화를 위한 Aca1/Cac1 복합체와 상호반응이 여전히 가능하다. 최근, GEF 단백질인, Cdc24가 Ras-effector 단백질이고, Ras1의 하위체계와 Rho-유사 GTPase Cdc42의 상위체계에서 고온에서의 크립토코쿠스 네오포만스의 성장을 조절한다는 것이 보고된 바 있다 (Nichols et al., 2007). 종합해 보면, 크립토코쿠스 네오포만스 cAMP-신호전달 경로는 세 개의 다른 상위신호조절자인 Ras1, Gpa1, 및 Aca1에 의해 조절된다.
Cac1의 공통적인 상위신호 조절자(Ras1, Aca1, 및 Gpa1)의 존재에도 불구하고, 크립토코쿠스 네오포만스에서 상기 구성인자들과 각각의 조절자에 의해 조절되는 타겟 유전자와의 기능적인 연관성에 대해서는 아직까지 미지로 남아 있다.
본 발명에서는 HOG, Ras 및 cAMP 경로의 신호전달 네트워크를 조사함으로써, 항진균제 개발을 위한 새로운 타깃 유전자를 발굴하고자 하는 것을 목적으로 한다.
본 발명은 항진균제의 제조를 위한 크립토코쿠스 네오포만스(Cryptococcus neoformans)의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 및 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제의 용도, 상기 저해제를 포함하는 항진균용 의약 조성물, 유효량의 상기 저해제를 대상체에 투여하는 것을 포함하는 진균 감염의 치료 방법을 제공한다.
또한 본 발명은 항진균제의 스크리닝을 위한 크립토코쿠스 네오포만스(Cryptococcus neoformans)의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 및 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자의 용도, 상기 단백질 또는 유전자를 포함하는 항진균제 스크리닝용 조성물, 후보물질과 상기 단백질 또는 유전자를 접촉시키고, 상기 후보물질이 상기 단백질 또는 유전자의 활성을 저해하는지 또는 촉진하는지를 판단하는 것을 포함하는 항진균제의 스크리닝 방법을 제공한다.
본 발명은 또한 항진균제의 제조를 위한 크립토코쿠스 네오포만스의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제의 용도, 상기 저해제를 포함하는 항진균용 의약 조성물, 유효량의 상기 저해제를 대상체에 투여하는 것을 포함하는 진균 감염의 치료 방법을 제공한다.
또한 본 발명은 항진균제의 스크리닝을 위한 크립토코쿠스 네오포만스의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자의 용도, 상기 단백질 또는 유전자를 포함하는 항진균제 스크리닝용 조성물, 후보물질과 상기 단백질 또는 유전자를 접촉시키고, 상기 후보물질이 상기 단백질 또는 유전자의 활성을 저해하는지 또는 촉진하는지를 판단하는 것을 포함하는 항진균제의 스크리닝 방법을 제공한다.
본 발명에서는 크립토코쿠스 네오포만스의 HOG 경로 조절에 있어서 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1 유전자들이 수행하는 역할에 대해 조사하여, 이들 유전자들이 억제되면 에르고스테롤의 생합성량이 증진됨을 새로이 밝혀냈다. 상기 유전자들을 억제하면 진균의 세포막 상에 에르고스테롤이 다량 분포하게 되므로, 에르고스테롤-결합성 항진균제의 작용점이 많아서 에르고스테롤-결합성 항진균제의 효능을 현저히 상승시킬 수 있게 된다. 또한 본 발명에서는 크립토코쿠스 네오포만스의 Ras 및 cAMP 경로의 조절에 있어서 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 및 HSP122 유전자들이 수행하는 역할에 대해 조사하여, 이들 유전자들이 억제되면 폴리엔계 약물이나 아졸계 약물에 대한 감수성이 증진됨을 새로이 밝혀냈다. 따라서 상기 유전자 또는 이들에 의해 코딩되는 단백질에 대한 저해제를 포함하는 항진균용 의약 조성물은 기존 항진균제의 사용 용량을 절감시키면서 효능을 상승시킬 수 있는 우수한 복합 항균치료제로서 사용할 수 있다.
도 1은 스트레스 없는 정상 성장 조건에서 C. neoformans Hog, Ssk1, Skn7에 의해 발현이 조절되는 유전자들의 유전체수준의 동정 결과를 보여준다(Fold 변화는 색으로 표현하였다).
도 2는 HOG 신호전달 경로의 동요에 의한 에르고스테롤 생합성 유전자들의 유도 및 세포 에르고스테롤 함량에 대한 분석 결과를 보여준다.
도 3은 HOG 경로의 억제가 C. neoformans에서 암포테리신 B와 함께 상승된 항진균 효과를 나타냄을 보여주는 분석 결과이다.
도 4는
C. neoformans에서의 HOG 경로의 억제가 몇몇 아졸 약물에 대해 길항적인 항진균 효과를 나타냄을 보여주는 분석 결과이다.
도 5는 Na+과 K+의 efflux pump를 코딩하는 유전자인 ENA1과 NHA1이 HOG 경로에 의해 조절을 받는 하위체계 타깃 유전자이며, 이들에 대한 억제가 폴리엔계 약물과 아졸계 약물에 대해 높은 감수성을 나타냄을 보여주는 분석 결과이다.
도 6은 크립토코쿠스 네오포만스 ras1△, aca1△, gpa1△, cac1△, 및 pka1△ pka2△ 결손변이체의 전사체 분석 결과를 보여준다 (Fold 변화는 색으로 표현하였다).
도 7은 크립토코쿠스 네오포만스 ras1△, aca1△, gpa1△, cac1△, 및 pka1△ pka2△ 결손변이체에 의해 상이하게 조절되는 유전자들의 기능적인 카테고리를 보여준다.
도 8은 Ras- 및 cAMP-의존적 유전자 중 유의한 비율이 환경적 스트레스에 조절되는 것을 보여주는 결과이다.
도 9는 크립토코쿠스 네오포만스에서의 cAMP-신호전달 경로 의존적 유전자의 동정 결과를 보여주는 결과이다.
도 10은 Ras- 및 cAMP-신호전달 경로의 저해가 에르고스테롤 생합성과는 독립적으로 폴리엔계 또는 아졸계(이트라코나졸) 항진균제에 대한 민감성을 증가시킴을 보여주는 분석 결과이다.
도 11은 HSP12와 HSP122의 발현이 cAMP-와 HOG-신호전달 경로에 의해 양성적으로 조절되고, hsp12△와 hsp122△ 결손변이체에 의해 폴리엔계 항진균제 대한 민감성을 증가시킴을 보여주는 분석 결과이다.
이하 본 발명을 보다 구체적으로 설명한다.
본 발명은 항진균제의 제조를 위한 크립토코쿠스 네오포만스(Cryptococcus neoformans)의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 및 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제를 포함하는 항진균용 의약 조성물을 제공한다.
HOG1 경로는 다양한 스트레스에 대한 반응을 조절하는 세포신호달전달계이다. 특히, 진균류는 HOG1 경로에서 포유동물에는 존재하지 않는, 하이브리드 센서 카이네이즈(hybrid sensor kinases), 히스티딘-함유 포스포트랜스퍼 단백질(histidine-containing phosphotransfer protein, HPt), 및 반응 조절자(response regulators)를 포함하는 세 가지 요소로 구성된 이원소-유사 인산전달 시스템(two-component-like phosphorelay system)을 이용하기 때문에, 본 발명자들은 새로운 항진균제 타깃의 개발을 위해 HOG1 경로에 관여하는 유전자들의 역할에 대한 조사를 수행하였다. 그 결과, 놀랍게도 크립토코쿠스 네오포만스의 HOG 경로 조절에 있어서 SSK1, TCO2, SSK2, PBS2, 및 HOG1 유전자들이 억제되면 에르고스테롤의 생합성량이 증진됨을 새로이 밝혀냈다. 하기 실시예에서 확인할 수 있는 바와 같이, 상기 유전자들을 억제하면 진균의 세포막 상에 에르고스테롤이 다량 분포하게 되므로, 에르고스테롤-결합성 항진균제의 작용점이 많아서 에르고스테롤-결합성 항진균제의 효능을 현저히 상승시킬 수 있게 된다. 또한 HOG 신호전달체계에 의해 발현이 조절되는 것으로 밝혀진 ENA1과 NHA1유전자들이 억제되면 에르고스테롤 함량의 변화와 상관없이 암포테리신 B와 같은 폴리엔계열의 약과 아졸계열의 약에 대한 감수성이 현저히 올라가는 것을 확인할 수 있었다. 따라서 크립토코쿠스 네오포만스의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 및 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 저해제를 포함하는 항진균용 의약 조성물은 기존 에르고스테롤-결합성 항진균제 또는 아졸계 항진균제의 사용 용량을 절감시키면서 효능을 상승시킬 수 있는 우수한 복합 항균치료제로서 사용될 수 있다.
그러므로 본 발명은 항진균제의 제조를 위한 크립토코쿠스 네오포만스의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 및 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제의 용도, 상기 저해제를 포함하는 항진균용 의약 조성물, 유효량의 상기 저해제를 대상체에 투여하는 것을 포함하는 진균 감염의 치료 방법을 제공한다.
본 발명에 있어서, HOG1 신호전달계의 차단을 위한 타깃으로 이용되는 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1은 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1 단백질을 의미하거나 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1 유전자를 의미하는 것으로 해석된다. 따라서, SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1 저해제는 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1 단백질에 대한 저해제 또는 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1 유전자에 대한 저해제를 모두 포함하는 것으로 해석된다.
한 구체예에서, 크립토코쿠스 네오포만스의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 저해제는 상기 단백질에 결합하여 활성을 저해함으로써 신호전달을 차단하는 저해제일 수 있다. 다른 구체예에서, 크립토코쿠스 네오포만스의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 대한 저해제는 상기 유전자의 발현을 저해하여 신호전달을 차단하는 저해제일 수 있다. 본 발명에서, SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1 유전자는 이들을 코딩하는 DNA 또는 이로부터 전사되는 mRNA일 수 있다. 따라서, 상기 유전자에 대한 저해제는 유전자 자체에 결합하여 전사를 방해하거나 유전자로부터 전사된 mRNA에 결합하여 mRNA의 해독을 방해하는 저해제일 수 있다.
본 발명의 한 구체예에서, 상기 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1 단백질은 각각 서열번호 1 내지 7의 아미노산 서열을 가질 수 있으며, 상기 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1 유전자는 각각 서열번호 8 내지 14의 핵산 서열 또는 각각 서열번호 15 내지 21의 cDNA 서열을 가질 수 있으나, 이는 크립토코쿠스 네오포만스 항원형 A H99 균주의 서열을 예시한 것일 뿐, 본 발명의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1의 서열이 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1 단백질, 상기 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1 유전자 등에는 이들과 실질적으로 동일한 활성을 갖는 이들의 변이체 또는 단편이 포함되는 것으로 해석된다.
한 구체예에서, 상기 항진균용 의약 조성물은 Ssk1, Ena1 및 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 하나 이상의 저해제를 포함하는 것일 수 있다. SSK1은 HOG1의 중요한 업스트림 반응 조절자일 뿐만 아니라 포유동물에서는 발견되지 않는 유전자이므로 항진균제의 개발을 위한 훌륭한 타깃이 될 수 있다. 따라서 SSK1 저해제는 체내 투여시 SSK1의 저해에 따른 임의의 부작용 발생의 가능성을 낮추면서 진균의 에르고스테롤의 생합성량을 증진시켜 에르고스테롤-결합성 항진균제의 효능을 향상시켜 줄 수 있다. 한편, ENA1 및 NHA1은 HOG 경로에 의해 조절을 받는 하위체계 타깃 유전자로 규명되었으며, 이들 유전자들을 저해하면 암포테리신 B와 같은 폴리엔계 계열의 약물과 더불어 플루코나졸, 케토코나졸 및 이트라코나졸과 같은 아졸 계열의 약물에 대해서도 약물에 대한 감수성이 현저히 증진되므로, 이들 유전자들을 동시에 또는 개별적으로 저해하는 저해제들은 폴리엔계 약물 또는 아졸계 약물과 복합 사용할 경우 매우 높은 항진균 활성을 보일 수 있다.
Ssk1, Tco2, Ssk2, Pbs2, Hog1 단백질 또는 유전자의 저해는 에르고스테롤의 생합성을 증진시켜 진균의 세포막 상에 에르고스테롤의 분포를 증가시킨다. 따라서, 에르고스테롤에 결합하여 진균 세포막을 파괴하는 에르고스테롤-결합성 항진균제의 결합 대상이 증가하게 되므로, 에르고스테롤-결합성 항진균제의 유효량을 감소시키면서 에르고스테롤-결합성 항진균제의 살상 효능은 증가시킬 수 있게 된다. 또한, ENA1 및 NHA1에 대한 저해제들은 폴리엔계 항진균제뿐만 아니라 아졸계 항진균제에 대한 약물 감수성을 현저히 증가시키므로 이들 약물의 사용량을 감소시키면서 살상 효능은 증가시켜줄 수 있게 된다. SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1의 저해에 의한 이러한 항진균 활성은 크립토코쿠스 네오포만스의 감염에 의한 크립토코쿠스증 및 뇌수막염 등을 치료할 수 있다.
따라서 본 발명의 한 구체예에서는 크립토코쿠스증 및 뇌수막염 등의 질환의 치료용 의약의 제조를 위한 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1 저해제의 용도, Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1 저해제를 포함하는 크립토코쿠스증 및 뇌수막염 등의 질환의 치료용 의약 조성물 및 유효량의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1 저해제를 대상체에 투여하는 것을 포함하는 크립토코쿠스증 및 뇌수막염 등의 질환의 치료 방법을 제공한다.
본 명세서에서 예시한 크립토코쿠스증 및 뇌수막염 외에도, 진균 감염에 의해 나타나는 질환에 대해서는 당업계에 잘 알려져 있다. 본 발명에서 Ssk1, Tco2, Ssk2, Pbs2, Hog1 단백질 또는 유전자의 저해가 에르고스테롤-결합성 항진균제 또는 아졸계 항진균제의 효능을 증진시킨다는 사실을 밝힌 이상 당업자는 진균 감염과 관련된 질환의 예방 또는 치료를 위해 상기 단백질 또는 유전자들을 저해시킬 수 있을 것이다.
본 발명에 있어서, HOG1 신호전달계를 차단하기 위해 사용되는 'Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1 단백질의 저해제'는 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1 단백질과 결합하여 신호전달을 차단하는 저해제를 모두 포함한다. 예컨대, 이러한 저해제는 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1 단백질과 결합하는 펩타이드 또는 화합물 등일 수 있다. 이러한 저해제는 단백질 구조 분석 등의 하기 예시된 스크리닝 방법을 통해 선정될 수 있으며, 당업계에 공지된 방법을 이용하여 설계될 수 있을 것이다. 한 구체예에서, 상기 저해제는 크립토코쿠스 네오포만스의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 폴리클로날 항체 또는 모노클로날 항체일 수 있다. 이러한 폴리클로날 항체 또는 모노클로날 항체는 당업계에 공지된 항체 제작 방법을 이용하여 제작할 수 있다.
본 발명에 있어서, HOG1 신호전달계를 차단하기 위해 사용되는 'SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1 유전자의 저해제'는 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 또는 NHA1 유전자의 발현을 저해하여 신호전달을 차단하는 저해제를 모두 포함한다. 예컨대, 이러한 저해제는 상기 유전자에 결합하는 펩타이드, 핵산 또는 화합물 등일 수 있다. 이러한 저해제는 세포 기반 스크리닝 등의 하기 예시된 스크리닝 방법을 통해 선정될 수 있으며, 당업계에 공지된 방법을 이용하여 설계될 수 있을 것이다. 한 구체예에서, 상기 저해제는 크립토코쿠스 네오포만스의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 대한 안티센스올리고뉴클레오타이드, siRNA, shRNA, miRNA 또는 이들을 포함하는 벡터일 수 있다. 이러한 안티센스올리고뉴클레오타이드, siRNA, shRNA, miRNA 또는 이들을 포함하는 벡터는 당업계에 공지된 방법을 이용하여 제작할 수 있다. 본 발명에 있어서, 상기 '벡터'는 폴리펩타이드를 암호화하는 게놈 내로 삽입된 외부 DNA를 포함하는 유전자 작제물을 말한다. 본 발명과 관련된 벡터는 상기 유전자를 저해하는 핵산 서열이 게놈 내로 삽입된 벡터로서, 이들 벡터는 DNA 벡터, 플라스미드 벡터, 코즈미드 벡터, 박테리오파아지 벡터, 효모 벡터, 또는 바이러스 벡터를 예로 들 수 있다.
크립토코쿠스 네오포만스(Cryptococcus neoformans)의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 유전자에 대한 저해제를 포함하는 본 발명의 항진균용 의약 조성물은 단독으로 항진균 활성을 나타내는 것이 아니라, 에르고스테롤-결합성 항진균제 또는 아졸계 항진균제와의 복합 처리를 통해 항진균제의 진균 살상능을 증진시킨다. 따라서, 본 발명의 항진균용 의약 조성물은 에르고스테롤-결합성 항진균제 또는 아졸계 항진균제와 순차적으로 또는 동시에 투여되는 것을 특징으로 한다.
에르고스테롤-결합성 항진균제는 진균 세포막 상의 에르고스테롤에 결합하여 세포막의 탈분극을 유발하고, 구멍을 형성하여 세포 내 함유물의 손실을 유발하여 진균을 살상하는 항진균제를 의미한다. 이러한 에르고스테롤-결합성 항진균제는 당업계에 공지되어 있으며, 어떠한 에르고스테롤-결합성 항진균제라도 본 발명의 항진균용 의약 조성물과 함께 사용시 현저한 항진균 효과의 상승을 나타내게 된다. 한 구체예에서, 상기 에르고스테롤-결합성 항진균제는 폴리엔계 항진균제일 수 있다. 한 측면에서, 상기 폴리엔계 항진균제는 암포테리신 B, 나타마이신, 리모시딘, 필리핀, 니스타틴 및 캔디신으로 구성되는 군으로부터 선택되는 하나 이상의 항진균제일 수 있다. 바람직한 구체예에서, 상기 폴리엔계 항진균제는 암포테리신 B일 수 있다. 한편, 상기 아졸계 항진균제는 케토코나졸, 플루코나졸, 이트라코나졸, 및 보리코나졸로 구성되는 군으로부터 선택되는 하나 이상의 항진균제일 수 있다.
이러한 측면에서, 본 발명은 또한 상기 본 발명의 저해제를 포함하는 항진균용 의약 조성물; 및 공지의 에르고스테롤-결합성 항진균제 또는 아졸계 항진균제를 포함하는 항진균 복합 제제를 제공한다.
또한, 본 발명은 항진균제의 제조를 위한 크립토코쿠스 네오포만스의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제를 포함하는 항진균용 의약 조성물을 제공한다.
본 발명자들은 Ras 및 cAMP 경로에 관여하는 유전자 외에도, 새로운 항진균제 타깃의 개발을 위해 추가로 Ras 및 cAMP 경로에 관여하는 유전자들의 역할에 대한 조사를 수행하였다. 그 결과, 놀랍게도 크립토코쿠스 네오포만스의 Ras 및 cAMP 경로에 있어서 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 또는 HSP122 유전자가 억제되면 폴리엔계 또는 아졸계 약물의 하나인 이트라코나졸 항진균제에 대한 감수성이 증진되는 것을 증진됨을 새로이 밝혀냈다. 하기 실시예에서 확인할 수 있는 바와 같이, 상기 유전자들을 억제하면 진균의 폴리엔계 또는 이트라코나졸 항진균제에 대한 감수성을 현저히 상승시킬 수 있게 된다. 따라서 크립토코쿠스 네오포만스의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제를 포함하는 항진균용 의약 조성물은 기존 폴리엔계 또는 이트라코나졸 항진균제의 사용 용량을 절감시키면서 효능을 상승시킬 수 있는 우수한 복합 항균치료제로서 사용될 수 있다.
그러므로 본 발명은 항진균제의 제조를 위한 크립토코쿠스 네오포만스의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제의 용도, 상기 저해제를 포함하는 항진균용 의약 조성물, 유효량의 상기 저해제를 대상체에 투여하는 것을 포함하는 진균 감염의 치료 방법을 제공한다.
본 발명에 있어서, Ras- 및 cAMP 신호전달계의 차단을 위한 타깃으로 이용되는 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1, HSP12 또는 HSP122은 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122 단백질을 의미하거나 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 또는 HSP122 유전자를 의미하는 것으로 해석된다. 따라서, RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1, HSP12 또는 HSP122 저해제는 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122 단백질에 대한 저해제 또는 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 또는 HSP122 유전자에 대한 저해제를 모두 포함하는 것으로 해석된다.
한 구체예에서, 크립토코쿠스 네오포만스의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 저해제는 상기 단백질에 결합하여 활성을 저해함으로써 신호전달을 차단하는 저해제일 수 있다. 다른 구체예에서, 크립토코쿠스 네오포만스의 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 및 HSP122로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 대한 저해제는 상기 유전자의 발현을 저해하여 신호전달을 차단하는 저해제일 수 있다. 본 발명에서, RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 또는 HSP122 유전자는 이들을 코딩하는 DNA 또는 이로부터 전사되는 mRNA일 수 있다. 따라서, 상기 유전자에 대한 저해제는 유전자 자체에 결합하여 전사를 방해하거나 유전자로부터 전사된 mRNA에 결합하여 mRNA의 해독을 방해하는 저해제일 수 있다.
본 발명의 한 구체예에서, 상기 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122 단백질은 각각 서열번호 16 내지 24의 아미노산 서열을 가질 수 있으며, 상기 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 및 HSP122 유전자는 이에 상응하는 핵산 서열 또는 cDNA 서열을 가질 수 있으나, 이는 크립토코쿠스 네오포만스 항원형 A H99 균주의 서열을 예시한 것일 뿐, 본 발명의 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 또는 HSP122의 서열이 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122 단백질, 상기 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 또는 HSP122 유전자 등에는 이들과 실질적으로 동일한 활성을 갖는 이들의 변이체 또는 단편이 포함되는 것으로 해석된다.
한 구체예에서, 상기 저해제는 Cac1 또는 Pka1 단백질 또는 유전자에 대한 저해제일 수 있다.
Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122 단백질 또는 이를 코딩하는 유전자의 저해는 폴리엔계 또는 아졸계 항진균제에 대한 감수성을 증진시키므로, 폴리엔계 또는 아졸계 항진균제의 유효량을 감소시키면서 이들 항진균제의 살상 효능은 증가시킬 수 있게 된다. Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122의 저해에 의한 항진균 활성은 크립토코쿠스 네오포만스의 감염에 의한 크립토코쿠스증 및 뇌수막염 등을 치료할 수 있다.
따라서 본 발명의 한 구체예에서는 크립토코쿠스증 및 뇌수막염 등의 질환의 치료용 의약의 제조를 위한 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122 저해제의 용도, Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122 저해제를 포함하는 크립토코쿠스증 및 뇌수막염 등의 질환의 치료용 의약 조성물 및 유효량의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122 저해제를 대상체에 투여하는 것을 포함하는 크립토코쿠스증 및 뇌수막염 등의 질환의 치료 방법을 제공한다.
본 명세서에서 예시한 크립토코쿠스증 및 뇌수막염 외에도, 진균 감염에 의해 나타나는 질환에 대해서는 당업계에 잘 알려져 있다. 본 발명에서 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122 단백질 또는 이를 코딩하는 유전자의 저해가 폴리엔계 또는 아졸계인 이트라코나졸 항진균제에 대한 감수성을 증가시킴으로써 이들 항진균제의 효능을 증진시킨다는 사실을 밝힌 이상 당업자는 진균 감염과 관련된 질환의 예방 또는 치료를 위해 상기 단백질 또는 유전자들을 저해시킬 수 있을 것이다.
본 발명에 있어서, RAS 또는 cAMP 신호전달계를 차단하기 위해 사용되는 ' Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122 단백질의 저해제'는 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122 단백질과 결합하여 신호전달을 차단하는 저해제를 모두 포함한다. 예컨대, 이러한 저해제는 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122 단백질과 결합하는 펩타이드 또는 화합물 등일 수 있다. 이러한 저해제는 단백질 구조 분석 등의 하기 예시된 스크리닝 방법을 통해 선정될 수 있으며, 당업계에 공지된 방법을 이용하여 설계될 수 있을 것이다. 한 구체예에서, 상기 저해제는 크립토코쿠스 네오포만스의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 폴리클로날 항체 또는 모노클로날 항체일 수 있다. 이러한 폴리클로날 항체 또는 모노클로날 항체는 당업계에 공지된 항체 제작 방법을 이용하여 제작할 수 있다.
본 발명에 있어서, RAS 또는 cAMP 신호전달계를 차단하기 위해 사용되는 ' RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 또는 HSP122 유전자의 저해제'는 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 또는 HSP122 유전자의 발현을 저해하여 신호전달을 차단하는 저해제를 모두 포함한다. 예컨대, 이러한 저해제는 상기 유전자에 결합하는 펩타이드, 핵산 또는 화합물 등일 수 있다. 이러한 저해제는 세포 기반 스크리닝 등의 하기 예시된 스크리닝 방법을 통해 선정될 수 있으며, 당업계에 공지된 방법을 이용하여 설계될 수 있을 것이다. 한 구체예에서, 상기 저해제는 크립토코쿠스 네오포만스의 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 및 HSP122로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 대한 안티센스올리고뉴클레오타이드, siRNA, shRNA, miRNA 또는 이들을 포함하는 벡터일 수 있다. 이러한 안티센스올리고뉴클레오타이드, siRNA, shRNA, miRNA 또는 이들을 포함하는 벡터는 당업계에 공지된 방법을 이용하여 제작할 수 있다. 본 발명에 있어서, 상기 '벡터'는 폴리펩타이드를 암호화하는 게놈 내로 삽입된 외부 DNA를 포함하는 유전자 작제물을 말한다. 본 발명과 관련된 벡터는 상기 유전자를 저해하는 핵산 서열이 게놈 내로 삽입된 벡터로서, 이들 벡터는 DNA 벡터, 플라스미드 벡터, 코즈미드 벡터, 박테리오파아지 벡터, 효모 벡터, 또는 바이러스 벡터를 예로 들 수 있다.
크립토코쿠스 네오포만스의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제를 포함하는 본 발명의 항진균용 의약 조성물은 폴리엔계 또는 아졸계 항진균제와의 복합 처리를 통해 상기 항진균제의 진균 살상능을 증진시킨다. 따라서, 본 발명의 항진균용 의약 조성물은 폴리엔계 또는 아졸계 항진균제와 순차적으로 또는 동시에 투여되는 것을 특징으로 한다. 폴리엔계 또는 아졸계 항진균제는 당업계에 공지되어 있으며, 어떠한 폴리엔계 또는 아졸계 항진균제라도 본 발명의 항진균용 의약 조성물과 함께 사용시 현저한 항진균 효과의 상승을 나타내게 된다. 한 측면에서, 상기 폴리엔계 항진균제는 암포테리신 B, 나타마이신, 리모시딘, 필리핀, 니스타틴 및 캔디신으로 구성되는 군으로부터 선택되는 하나 이상의 항진균제일 수 있다. 바람직한 구체예에서, 상기 폴리엔계 항진균제는 암포테리신 B일 수 있다. 한 측면에서, 아졸계 항진균제는 케토코나졸, 플루코나졸, 이트라코나졸, 및 보리코나졸로 구성되는 군으로부터 선택되는 하나 이상의 항진균제일 수 있다.
다른 구체예에서, 상기 항진균용 의약 조성물은 크립토코쿠스 네오포만스의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 저해제와 순차적으로 또는 동시에 투여되는 것일 수 있다. 하기 실시예에서 확인할 수 있는 바와 같이, 크립토코쿠스 네오포만스의 CAC1 또는 PKA1의 발현을 저해함과 동시에 HOG1의 발현을 저해할 경우 암포테리신 B에 대한 감수성이 상승적으로 증진되었다. 이는 위에서 밝힌 HOG 경로의 유전자들을 저해할 경우 에르고스테롤의 생합성이 증진되어 암포테리신 B에 대한 감수성이 증진된다는 것과는 다른 메커니즘에 의해 cAMP-경로의 유전자들이 암포테리신 B에 대한 감수성을 증진시키기 때문인 것으로 나타났다.
이러한 측면에서, 본 발명은 또한 상기 본 발명의 저해제를 포함하는 항진균용 의약 조성물; 및 폴리엔계 항진균제, 아졸계 항진균제 및 크립토코쿠스 네오포만스의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제로 구성되는 군으로부터 선택되는 하나 이상의 항진균제를 포함하는 항진균 복합 제제를 제공한다. 바람직하게는, 상기 항진균 복합 제제는 본 발명의 저해제를 포함하는 항진균용 의약 조성물, 폴리엔계 항진균제, 및 크립토코쿠스 네오포만스(Cryptococcus neoformans)의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제로 구성되는 군으로부터 선택되는 하나 이상의 항진균제를 포함할 수 있다.
본 발명의 항진균용 의약 조성물 또는 항진균 복합 제제는 유효 성분 이외에 약제학적으로 적합하고 생리학적으로 허용되는 보조제를 사용하여 제조될 수 있으며, 상기 보조제로는 부형제, 붕해제, 감미제, 결합제, 피복제, 팽창제, 윤활제, 활택제 또는 향미제 등의 가용화제를 사용할 수 있다.
본 발명의 항진균용 의약 조성물은 투여를 위해서 유효 성분 이외에 추가로 약제학적으로 허용 가능한 담체를 1종 이상 포함하여 의약 조성물로 바람직하게 제제화할 수 있다.
액상 용액으로 제제화되는 조성물에 있어서 허용 가능한 약제학적 담체로는, 멸균 및 생체에 적합한 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다. 더 나아가 해당분야의 적절한 방법으로 Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA에 개시되어 있는 방법을 이용하여 각 질환에 따라 또는 성분에 따라 바람직하게 제제화할 수 있다.
본 발명의 의약 조성물의 약제 제제 형태는 과립제, 산제, 피복정, 정제, 캡슐제, 좌제, 시럽, 즙, 현탁제, 유제, 점적제 또는 주사 가능한 액제 및 활성 화합물의 서방출형 제제 등이 될 수 있다.
본 발명의 의약 조성물은 정맥내, 동맥내, 복강내, 근육내, 동맥내, 복강내, 흉골내, 경피, 비측내, 흡입, 국소, 직장, 경구, 안구내 또는 피내 경로를 통해 통상적인 방식으로 투여할 수 있다.
본 발명의 의약 조성물의 유효성분의 유효량은 질환의 예방 또는 치료, 또는 뼈 성장 유도 효과를 이루는데 요구되는 양을 의미한다. 따라서, 질환의 종류, 질환의 중증도, 조성물에 함유된 유효 성분 및 다른 성분의 종류 및 함량, 제형의 종류 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료 기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 이에 제한되는 것은 아니나, 예컨대, 성인의 경우, 1일 1회 내지 수회 투여시, 본 발명의 저해제는 1일 1회 내지 수회 투여시, 화합물일 경우 0.1ng/kg~10g/kg, 폴리펩타이드, 단백질 또는 항체일 경우 0.1ng/kg~10g/kg, 안티센스올리고뉴클레오타이드, siRNA, shRNAi, miRNA일 경우 0.01ng/kg~10g/kg의 용량으로 투여할 수 있다.
본 발명에 있어서, '대상체'는 인간, 오랑우탄, 침팬지, 마우스, 랫트, 개, 소, 닭, 돼지, 염소, 양 등을 포함하나, 이들 예에 한정되는 것은 아니다.
또한 본 발명은 항진균제의 스크리닝을 위한 크립토코쿠스 네오포만스의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질의 용도, 상기 단백질을 포함하는 항진균제 스크리닝용 조성물, 후보물질과 상기 단백질을 접촉시키고, 상기 후보물질이 상기 단백질의 활성을 저해하는지 또는 촉진하는지를 판단하는 것을 포함하는 항진균제의 스크리닝 방법을 제공한다.
마찬가지로, 본 발명은 또한 항진균제의 스크리닝을 위한 크립토코쿠스 네오포만스의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 유전자의 용도, 상기 유전자를 포함하는 항진균제 스크리닝용 조성물, 후보물질과 상기 유전자를 접촉시키고, 상기 후보물질이 상기 유전자의 발현을 저해하는지 또는 촉진하는지를 판단하는 것을 포함하는 항진균제의 스크리닝 방법을 제공한다.
본 발명은 또한 항진균제의 스크리닝을 위하여 크립토코쿠스 네오포만스의 SSK1과 SSK2 사이, SSK1과 YPD1 사이, 혹은 YPD1과 TCO2 단백질 사이의 물리적 접촉을 모니터링 할 수 있는 yeast two-hybrid system에 의한 항진균제 스크리닝 방법을 제공한다. 이 방법을 이용하면 대용량의 후보물질을 빠른 시간에 스크리닝할 수 있는 장점이 있다.
앞서 언급한 바와 같이, 크립토코쿠스 네오포만스의 SSK1, TCO2, SSK2, PBS2또는 HOG1을 저해하면 HOG1 신호전달계가 차단되어 에르고스테롤의 생합성이 증진된다. 따라서 상기 단백질 또는 유전자를 저해하는 것으로 스크리닝된 물질은 에르고스테롤-결합성 항진균제와 함께 사용하여 진균 살상능을 증진시켜주는 항진균제로서 사용될 수 있다. 또한 ENA1 또는 NHA1를 저해하는 것으로 스크리닝된 물질은 에르고스테롤-결합성 항진균제 또는 아졸계 항진균제와 함께 사용하여 진균 살상능을 증진시켜주는 항진균제로서 사용될 수 있다.
또한 본 발명은 항진균제의 스크리닝을 위한 크립토코쿠스 네오포만스의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 및 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질의 용도, 상기 단백질을 포함하는 항진균제 스크리닝용 조성물, 후보물질과 상기 단백질을 접촉시키고, 상기 후보물질이 상기 단백질의 활성을 저해하는지 또는 촉진하는지를 판단하는 것을 포함하는 항진균제의 스크리닝 방법을 제공한다.
마찬가지로, 본 발명은 또한 항진균제의 스크리닝을 위한 크립토코쿠스 네오포만스의 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 및 HSP122로 이루어진 군으로부터 선택되는 하나 이상의 유전자의 용도, 상기 유전자를 포함하는 항진균제 스크리닝용 조성물, 후보물질과 상기 유전자를 접촉시키고, 상기 후보물질이 상기 유전자의 발현을 저해하는지 또는 촉진하는지를 판단하는 것을 포함하는 항진균제의 스크리닝 방법을 제공한다.
본 발명은 또한 항진균제의 스크리닝을 위하여 크립토코쿠스 네오포만스의 Gpa1과 Cac1 사이, Cac1과 Aca1 사이, 혹은 Ras1과 Cdc24 사이, Ras2와 Cdc24 단백질 사이의 물리적 접촉을 모니터링 할 수 있는 yeast two-hybrid system에 의한 항진균제 스크리닝 방법을 제공한다. 이 방법을 이용하면 대용량의 후보물질을 빠른 시간에 스크리닝할 수 있는 장점이 있다.
앞서 언급한 바와 같이, 크립토코쿠스 네오포만스의 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1,
HSP12 또는 HSP122를 저해하면 RAS 또는 cAMP 신호전달계가 차단되어 폴리엔계 또는 아졸계 항진균제에 대한 감수성이 증가한다. 따라서 상기 단백질 또는 유전자를 저해하는 것으로 스크리닝된 물질은 상기 폴리엔계 또는 아졸계 항진균제와 함께 사용하여 진균 살상능을 증진시켜주는 항진균제로서 사용될 수 있다.
상기 단백질 또는 유전자와 후보물질 간의 반응 확인은 단백질-단백질, 단백질-화합물, DNA-DNA, DNA-RNA, DNA-단백질, DNA-화합물, RNA-단백질, RNA-화합물 간의 반응 여부를 확인하는데 사용되는 통상적인 방법들을 사용할 수 있다. 예를 들면, 생체 외부에서(in vitro) 상기 유전자와 후보 물질 사이의 결합 여부를 확인하기 위한 혼성화 시험, 포유류세포와 시험대상물질을 반응시킨 후 노던 분석, 정량적 PCR, 정량적 실시간 PCR 등을 통한 상기 유전자의 발현율 측정 방법, 또는 상기 유전자에 리포터 유전자를 연결시켜 세포 내로 도입한 후 시험대상물질과 반응시키고 리포터 단백질의 발현율을 측정하는 방법, 상기 단백질과 후보 물질을 반응시킨 후 활성을 측정하는 방법, 효모 이중 혼성법(yeast two-hybrid), Idbf 단백질에 결합하는 파지 디스플레이 펩티드 클론(phage-displayed peptide clone)의 검색, 천연물 및 화학물질 라이브러리(chemical library) 등을 이용한 HTS(high throughput screening), 드럭 히트 HTS(drug hit HTS), 세포 기반 스크리닝(cell-based screening), 또는 DNA 어레이(DNA array)를 이용하는 스크리닝법 등을 사용할 수 있다.
상기 스크리닝용 조성물은 상기 단백질 또는 유전자 외에도, 핵산 또는 단백질의 구조를 안정하게 유지시키는 증류수 또는 완충액을 포함할 수 있다. 또한 상기 스크리닝용 조성물은 생체 내(in vivo) 실험을 위해, 상기 단백질 또는 유전자를 발현하는 세포, 또는 전사율을 조절할 수 있는 프로모터 하에 상기 유전자를 발현하는 플라스미드를 함유하는 세포 등을 포함할 수 있다.
본 발명의 스크리닝 방법에서, 시험대상물질은 통상적인 선정방식에 따라 HOG1 신호전달계에 의한 신호 전달을 저해하는 의약으로서의 가능성을 지닌 것으로 추정되거나 또는 무작위적으로 선정된 개별적인 핵산, 단백질, 펩타이드, 기타 추출물 또는 천연물, 화합물 등이 될 수 있다.
본 발명에서 유전공학적 기술과 관련된 사항은 샘브룩 등의 문헌(Sambrook, et al. Molecular Cloning, A Laboratory Manual, Cold Spring Harbor laboratory Press, Cold Spring Harbor, N. Y. (2001)) 및 프레드릭 등의 문헌(Frederick M. Ausubel et al., Current protocols in molecular biology volume 1, 2, 3, John Wiley & Sons, Inc. (1994))에 개시되어 있는 내용에 의해 보다 명확하게 된다.
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 상세하게 후술되어 있는 실시예들을 참조하면 명확해질 것이다. 그러나 본 발명은 이하에서 개시되는 실시예들에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 것이며, 단지 본 실시예들은 본 발명의 개시가 완전하도록 하고, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.
[실시예]
<실험 방법>
균주 및 배양 조건
본 실시예에 사용된 크립토코쿠스 네오포만스는 표 1에 나타나 있다[Bahn YS, Geunes-Boyer S, Heitman J (2007) Eukaryot Cell 6: 2278-2289.; Bahn YS, Kojima K, Cox GM, Heitman J (2005) Mol Biol Cell 16: 2285-2300.; Bahn YS, Kojima K, Cox GM, Heitman J (2006) Mol Biol Cell 17: 3122-3135.; Perfect JR, Ketabchi N, Cox GM, Ingram CW, Beiser CL (1993) J Clin Microbiol 31: 3305-3309; Kwon-Chung KJ, Edman JC, Wickes BL (1992) Genetic association of mating types and virulence in Cryptococcus neoformans. Infect Immun 60: 602-605.].
크립토코쿠스 네오포만스는 별도의 표시가 없으면 이스트 추출물-펩톤-덱스트로스(YPD) 배지에서 배양되었다.
Each NAT-STM# indicates the Natr marker with a unique signature tag.
DNA 마이크로어레이에 의한 전사체 분석
DNA 마이크로어레이에 사용된 전체 RNA의 분리를 위해, 야생형 H99, hog1△(YSB64), ssk1△(YSB261), skn7△(YSB349), ras1△(YSB51), aca1△(YSB6), gpa1△ (YSB83), cac1△(YSB42), 및 pka1△ pka2△(YSB200) 결손변이체주들을 각각 50 ml YPD 배지에서 30△로 16시간 배양했다. 그 후 5 ml의 overnight 배양액을 100 ml의 신선한 YPD 배지로 접종하고, 600 nm에서 흡광도(OD)가 대략 1.0에 이를 때까지(OD600nm = 1.0) 30℃에서 4-5시간 더 배양하였다. 제로-타임 샘플을 위해, 100 ml 중 50 ml의 배양액을 표본으로 추출하여 액체 질소에서 급속히 냉각하였다. 남은 50 ml 배양액에는, 50 ml의 YDP 함유 2 M NaCl, 40 ㎍/ml 플루디옥소닐 (PESTANAL, Sigma, 100 mg/ml 원액 in 디메틸설폭사이드), 또는 5 mM 과산화수소(H2O2)를 첨가했다 (최종 농도 각각 1 M NaCl, 20 ㎍/ml 플루디옥소닐, 2.5 mM H2O2). 각각의 스트레스-유도 배지에서 배양하는 동안에, 50 ml의 배양액을 30분과 60분에 표본 추출하여 테이블탑 원심분리기에서 침전하였고 액체질소로 냉각하여 밤새 동결 건조(lyophilze)하였다. 그 후 동결 건조된 세포들은 전체 RNA 분리를 위해 사용하였다. DNA 마이크로어레이를 위한 생물학적 복제물로서, 각각의 균주와 배양 조건에 대한 3개의 독립적인 컬쳐들을 전체 RNA 분리를 위해 제조하였다.
Total RNA 제조
Total RNA의 분리를 위하여, 동결 건조된 세포입자들에 3 ml 부피의 무균 3mm 유리구슬을 넣고(SIGMUND LINDER) 흔들어서 균질화하였으며, 4 ml의 TRizol 시약을 넣고 실온에서 5분간 배양하였다. 그리고 나서 800 ㎕ 의 클로로포름을 넣고 실온에서 3분간 배양하였으며, 15 ml의 둥근바닥 튜브(SPL)에 옮겨 4℃에서 15분간 10,000 rpm으로 원심분리하였다(Sorvall SS-34 rotor). 2 ml의 상등액을 새로운 둥근바닥 튜브로 옮기고 2ml 이소프로파놀을 더하여 몇 번 거꾸로 뒤집은 후 실온에서 10분간 배양하였다. 그 후 혼합물을 4℃에서 10분간 10,000 rpm으로 재원심분리하였고, 그것의 침전물을 디에틸피로카보네이트(DEPC) 처리된 물로 희석한 75% 에탄올 4 ml로 씻었다. 침전물은 실온에서 건조하였고 500 ㎕ DEPC 처리된 물로 다시 씻었다. 전체 RNA 샘플의 농도와 순도는 각각 OD260nm 와 겔 전기영동에 의해 측정하였다. 컨트롤 전체 RNA(Cy3 표지 위함)를 위해, 상기 기술한 조건에서 배양된 야생형, hog1△, ssk1△, skn7△, ras1△, gpa1△, aca1△, cac1△ 및 skn7△ 결손변이체주들로부터 제조된 모든 전체 RNAs가 pooled 되었다(pooled reference RNAs).
cDNA 합성과 Cy3/Cy5 표지
cDNA 합성을 위해 전체 RNA 농도를 DEPC 처리된 물로 1 ㎍/㎕로 조절하고, 15㎕의 전체 RNA(15㎍)과 1㎕의 5 ㎍/㎕ 올리고 dT (5’-TTTTTTTTTTTTTTTTTTTTV-3’)/pdN6 (Amersham)(1:1 혼합물 10 ㎍/㎕, 각각)를 첨가하여 70℃에서 10분간 배양한 후, 얼음에 10분 두었다. 그리고 나서 15 ㎕의 cDNA 합성 혼합물 {3㎕ 0.1 M DTT, 0.5 RNasin [Promega], 0.6 ㎕ aa-dUTP (5-(3-아미노알릴)-2’-데옥시우리딘 5’-트리포스페이트)/dNTPs [ 6 ㎕ dTTP (100 mM), 4 ㎕ aa-dUTP (100 mM), 10 ㎕dATP (100 mM), 10 ㎕ dCTP (100 mM), 10 ㎕ dGTP (100 mM) 혼합물], 1.5 ㎕ AffinityScript 역전사효소 (Stratagene), 3 ㎕ AffinityScript 버퍼, 7 ㎕ 물]을 첨가하였고 42℃에서 2시간 동안 배양하였다. 그리고 나서 10 ㎕의 1N NaOG와 10 ㎕의 0.5M EDTA(pH 8.0)을 첨가하여 65℃에서 15분 배양하였다. 배양 후에 25 ㎕의 1M HEPES 버퍼(pH 8.0)와 450 ㎕의 DEPE-처리된 물을 첨가하였고, 전체 혼합물은 미크로콘30 필터(밀리포어)를 통해 농축되어 1시간 진공건조 되었다.
준비된 cDNA의 Cy3과 Cy5 표지를 위해, Cy3과 Cy5가 10 ㎕ DMSO와 1.25 ㎕의 각 염료로 용해되어 분리된 튜브로 나누어졌다. 상기 기술된 대로 제조된 cDNA와 9 ㎕의 0.05M Na-비카보네이트(pH 8.0)를 첨가하여 실온에서 15분간 배양하였다. pooled 참조 RNAs로부터 제조된 cDNAs는 대조군으로서 Cy3과 혼합되었고 각각의 테스트 RNA(각 실험 조건)으로부터 제조된 cDNAs는 Cy5와 혼합되었다. 각 혼합물은 어두운 실온에서 1시간 더 배양되었고 QIAquick PCR 정제 키트(QIAGEN)에 의해 정제되었다.
마이크로어레이 혼성화와 세척
7,936개의 스팟을 포함하는 크립토코쿠스 네오포만스 항원형 D 70-mer 마이크로어레이 슬라이드(Duke 대학교)를 42℃에서 pre-hydridization 버퍼[42.4 ml 무균 증류수, 2 ml 30% BSA (Sigma), 600㎕ 10% SDS, 15 ml 20x SSC]에서 반응시키고, 증류수와 이소프로파놀로 세척하고 잠시 원심분리 하였다.(110xg, 2분) Cy3와 Cy5-표지된 cDNA 샘플들이 결합되었고 마이크로콘 30 필터를 통해 농축되고 진공건조 되었다. 건조된 cDNA 샘플들은 hybridization 버퍼[250 ㎕ 50% 포름아미드, 125 ㎕ 20x SSC, 5 ㎕ 10% SDS, 120 ㎕ dH2O, 전체 500 ㎕]로 다시 처리하고 1 ㎕ poly-A tail DNA (Sigma)를 더한 뒤 100℃에서 3분간 더 배양하고 실온에서 5분간 식혔다. 마이크로어레이 슬라이드들은 hybridization chamber(DieTech)로 정렬되었고 먼지는 제거되었으며 Lifterslips(Erie Scientific)으로 덮혔다. Cy3/Cy5-표지된 cDNA 샘플들은 Lifterslips과 슬라이드 사이에 도포되었다. 슬라이드가 건조되는 것을 막기 위해, 10 ㎕의 3x SSC 버퍼가 슬라이드에 도포되었고, 슬라이드는 이후 42℃에서 16시간 배양되었다. 배양 후, 마이크로어레이 슬라이드들은 오비탈 교반기에서 세 가지 다른 washing 버퍼 [washing 버퍼 1 (10 ml 20x SSC, 600 ㎕ 10% SDS, 189.4 ml dH2O, 42ㅀC에서 예열됨), washing 버퍼 2 (3.5 ml 20x SSC, 346.5 ml dH2O), washing 버퍼 3 (0.88 ml 20x SSC, 349.12 ml dH2O)]로 각각 2, 5, 5분 세척하였다.
각각의 전체 RNA 샘플에 대하여, 1-염료 교환(dye-swap) 실험을 포함하여, 3개의 독립적인 DNA 마이크로어레이가 3개의 독립적인 생물학적 복제물을 가지고 수행되었다.
마이크로어레이 슬라이드 스캐닝과 데이터 분석
혼성화와 세척 후에, 마이크로어레이 슬라이드들을 GenePix 4000B 스캐너 (Axon Instrument)로 스캔하였고 신호들은 GenePix Pro (버전 4.0)와 갈 파일(gal file)(http://genome.wustl.edu/activity/ma/cneoformans)로 분석하였다. 우리는 항원형 A 크립토코쿠스 네오포만스 균주로부터 단리된 전체 RNAs를 이용하였으므로, 상응하는 항원형 A 유전자 ID를 찾기 위해 blastp 조사(e값 범위: e-4)를 이용하여 항원형 D 크립토코쿠스 네오포만스 슬라이드에 프린트된 70-mer 올리고뉴클레오티드 서열을 항원형 A 크립토코쿠스 네오포만스 게놈 데이터베이스에 대해 조사하였다. 항원형 A 유전자 서열을 사용하여 각 S. cerevisiae에 유전자 이름 또는 표에 나열된 ID가 blastp 조사(e값 범위: e-4)에 의해 밝혀졌다.
계층과 통계학적인 분석을 위하여, GenePix 소프트웨어로부터 이송된 데이터는 LOWESS 표준화를 이용한 GeneSpring (Agilent), 신뢰성 높은 유전자 필터링, 클러스터링(표준 상관과 평균 연결), 제로-트랜스포메이션, ANOVA 분석으로 분석하였다 (P값<0.01).
에르고스테롤 분석
에르고스테롤 함량은 "Arthington-Skaggs BA, Jradi H, Desai T, Morrison CJ (1999) Quantitation of ergosterol content: novel method for determination of fluconazole susceptibility of Candida albicans. J Clin Microbiol 37: 3332-3337"에서 설명된 방법을 약간 변형하여 측정하였다. 간략히 설명하면, 각 크립토코쿠스 네오포르만 균주를 100 ml YPD 배지에서 30℃에서 24시간 동안 배양했다. 100 ml 배양액은 중복 측정을 위하여 두 개의 50 ml 배양액으로 분리하여 테이블탑 원심분리기에서 침전하고 증류수로 세척하였다. 세포 침전물을 액체 질소에서 냉각하고 밤새 동결건조 하였다. 건조된 세포 침전물은 에르고스테롤 함량의 표준화를 위해 무게를 재고, 5 ml의 25% 알코올성 포타슘 히드록시드를 첨가하고 무균 봉규산 유리 스크류-캡 튜브로 옮겼다. 그 후에 세포들은 80℃에서 1시간 배양되었고 실온에서 식혔다. 그리고 나서 1 ml의 증류수와 3 ml의 헵탄을 넣고 3분 동안 교반했다. 그리고 200 ㎕의 헵텐층을 샘플 추출하고 800 ㎕의 100% 에탄올과 혼합하였으며, 그것의 광학밀도(OD)를 281.5nm와 230nm 모두에서 측정하였다. 에르고스테롤 함량은 다음과 같이 계산하였다: % 에르고스테롤 = [(OD281.5nm/290) x F]/세포침전물 무게 - [(OD230nm/518) x F]/세포침전물 무게), 여기에서, F는 에탄올 희석 인자이고 290과 518은 각각 결정 에르고스테롤과 24(28) 데히드로에르고스테롤을 결정하는 E값(퍼센테이지/센티미터)이다.
스트레스 민감도 테스트
"Bahn YS, Kojima K, Cox GM, Heitman J (2005) Mol Biol Cell 16: 2285-2300." 및 "Bahn YS, Kojima K, Cox GM, Heitman J (2006) Mol Biol Cell 17: 3122-3135"에서 기술한 방법과 같이, 각 균주를 YPD 배지에서 밤새 30℃로 배양하여 세척한 후 dH2O에서 순차적으로 희석하고(1 내지 104 희석도), 지시된 농도의 스트레스-유도 시약 또는 항진균 약제를 포함한 고체 YPD 배지로 스팟팅하였다. 항진균 약제 민감도를 확인하기 위하여, 세포들을 암포테리신 B(Sigma), 플루코나졸(Sigma), 이트라코나졸(Simga), 케토코나졸(Sigma) 및 플루디옥소닐을 포함하는 고체 YPD 배지에 스팟하였다. 그런 다음, 스팟팅된 세포들을 30℃에서 2 내지 4일 동안 인큐베이션하고 사진을 찍었다.
cAMP 신호전달 의존 유전자의 파괴
유전자의 파괴를 위해, 각각의 유전자에 대한 지노믹 DNA 구조(엑손 및 인트론)의 정보를 serotype A C. neoformans 지놈 데이터베이스(http://www.broadinstitute.org/annotation/genome/cryptococcus_neoformans/MultiHome.html). Bahn et al., 2005, Davidson et al., 2002 에서 기술한 바와 같이, C. neoformans 항원형 A H99 균주에서 GRE2 (CNAG_02182.2), HSP12 (CNAG_03143.2), HSP122 (CNAG_01446.2) 및 PKP1 (CNAG_00396.2) 유전자들을 split markers 및 biolistic transformation로 overlap PCR 또는 double joint PCR (DJ-PCR)에 의해 제거하였다. 각각의 유전자에 대한 5' 및 3' flanking regions의 생성을 위한 프라이머는 표 2에 기재되어 있다. 금 마이크로캐리어 비드 (0.8~1.2-mm [Bioworld Inc] 또는 0.6-mm [BioRad])를 overlap PCR에 의해 생산된 젤-추출된 제거 카세트(gel-extracted deletion cassettes)로 코팅하고 H99 균주로 형질전환하였다. nourseothricin 또는 G418을 함유하는 YPD 배지에서 선택된 안정적인 형질전환체들에 대해 표 2에 기재된 프라이머로 diagnostic PCR에 의해 일차 스크리닝을 수행하였다. 양성 결손변이체들은 표 2에 나열된 프라이머에 의해 제조된 유전자 특이적 프로브를 이용하여 추가로 Southern blot 분석에 의해 확인하였다.
표 2
| 프라이머 명칭 | 서열 | 설명 |
| B79 | TGTGGATGCTGGCGGAGGATA | Screening primer on ACT promtre |
| B1026 | GTAAAACGACGGCCAGTGAGC | M13 forward (extended) |
| B1027 | CAGGAAACAGCTATGACCATG | M13 reverse (extended) |
| B1614 | TGTTTAGCACCAGCGGAGTC | HSP12 - 5' screening primer |
| B1615 | CACGATGAAAGTGCGTTGAAG | HSP12 - left flanking primer 1 |
| B1616 | GCTCACTGGCCGTCGTTTTACACTGTCGGTGAAAGATTGC | HSP12 - left flanking primer 2 |
| B1617 | CATGGTCATAGCTGTTTCCTGAGAACGACAACCAGGAGTC | HSP12 - right flanking primer 1 |
| B1618 | GCTCTGTGCTGACATTATCTGC | HSP12 - right flanking primer 2 |
| B1707 | GAAAGTGCGTTGAAGTGATG | HSP12 - probe primer 1 |
| B1708 | AGTAGAAGCAGCGGACTAAAG | HSP12 - probe primer 2 |
| B1619 | GCGTAGTGGAGATTGGTTTC | GRE2 - 5' screening primer |
| B1620 | ATCCCCTCCACTTTACCTCC | GRE2 - left flanking primer 1 |
| B1621 | GCTCACTGGCCGTCGTTTTACAAGTCTCCCTTAGCGATAG | GRE2 - left flanking primer 2 |
| B1622 | CATGGTCATAGCTGTTTCCTGACCACACCCCTGAAGAAAC | GRE2 - right flanking primer 1 |
| B1623 | AACTGTTTCGTCTTGTGTGC | GRE2 - right flanking primer 2 |
| B1705 | ATAGCAACTTCTTCCGTCG | GRE2 - probe primer 1 |
| B1706 | TGTTGCCTGTGCTCACTTG | GRE2 - probe primer 2 |
| B1629 | CCTCTGACAGCCACATACTG | PKP1 - 5' screening primer |
| B1630 | AATGAAGTTCCTGCGACAG | PKP1 - left flanking primer 1 |
| B1631 | GCTCACTGGCCGTCGTTTTACAATGGGATGAGAACGCAC | PKP1 - left flanking primer 2 |
| B1632 | CATGGTCATAGCTGTTTCCTGAGCATTTTCCAGCATCAGC | PKP1 - right flanking primer 1 |
| B1633 | GGTGTGGAACATCTTTTGAG | PKP1 - right flanking primer 2 |
| B1711 | CTGGTTCATCTTGGGTGTC | PKP1 - probe primer 1 |
| B1712 | TCTGAGCATACCACTCCTTTAC | PKP1 - probe primer 2 |
| B1666 | TCTCATTCGCATCCTCTG | HSP122 - 5' screening primer |
| B1667 | GTTGGGCAGATAATGTTTGTG | HSP122 - left flanking primer 1 |
| B1668 | GCTCACTGGCCGTCGTTTTACACGGCGTCAGACATTGTG | HSP122 - left flanking primer 2 |
| B1669 | CATGGTCATAGCTGTTTCCTGACAAGAGAAGTCCACTACTCAG | HSP122 - right flanking primer 1 |
| B1670 | GCAAGGTAATGATGAGCG | HSP122 - right flanking primer 2 |
| B1709 | GCGACTGAGATGTAGACCAAC | HSP122 - probe primer 1 |
| B1710 | CTCGGAACGACATAATAAGC | HSP122 - probe primer 2 |
| B1673 | CACACCTGGTAAGAGATAGCG | NHA1 - left flanking primer 1 |
| B1674 | GCTCACTGGCCGTCGTTTTACAGTGGTAGAAGTAGGGCAGC | NHA1 - left flanking primer 2 |
| B1675 | CATGGTCATAGCTGTTTCCTGACAGGGTCCAACAAGGATG | NHA1 - right flanking primer 1 |
| B1676 | TGCTACGATTGTGGTCAGCC | NHA1 - right flanking primer 2 |
| B1677 | GGACGAGACGAGTTATCAAAC | NHA1 - screening primer |
| B1698 | CTTCATCAACTTGCGTGC | NHA1 - probe primer |
<실시예 1> 크립토코쿠스 네오포만스 hog1, ssk1, skn7 결손변이체의 DNA 마이크로어레이 분석
크립토코쿠스 네오포만스의 HOG1 신호전달 네트워크를 조사하기 위해, DNA 마이크로어레이 분석 방법을 사용하여 항원형 A 야생형 균주(WT, H99), hog1△, ssk1△, skn7△ 결손변이체주들의 전사체 비교 분석을 보통 배양 조건과 삼투압 충격(1 M NaCl), 산화 충격(2.5 mM H2O2), 항진균 약제 플루디옥소닐(40 ㎍/ml)과 같은 스트레스 조건 모두에서 수행하였다. 0분(스트레스 없는 조건), 30분, 60분 배양 후에 각 스트레스 조건에서 자란 세포들로부터 전체 RNAs를 분리하였다. DNA 마이크로어레이 분석을 위해 생물학적인 복제물로서 각 조건에서의 3개의 독립적인 RNA 샘플들을 얻었다. Cy3 표지의 대조 RNA로서 모든 RNA 샘플들로부터 pooled 된 참조 RNAs를 사용하였다. 우리는 크립토코쿠스 네오포만스 게놈 데이터베이스로부터 얻은 정보에 기초하여 7,936 스팟을 포함하는 70-mer 항원형 D 크립토코쿠스 네오포만스 DNA 마이크로어레이 칩을 사용하였다.
HOG1, SSK1, SKN7 유전자들과, GPP1(글리세롤-3-포스파타아제)와 GPD1(글리세롤-3-포스페이트 데히드로지나제)와 같은 우리의 어레이 데이터에서 알려진 Hog1-연관 유전자들의 발현 레벨을 조사하였다.
도 1은 스트레스 없는 정상 성장 조건에서 C. neoformans Hog, Ssk1, Skn7에 의해 발현이 조절되는 유전자들의 유전체수준의 동정 결과를 보여준다(Fold 변화는 색으로 표현하였다). 도 1A는 각각 hog1△ (YSB64), ssk1△ (YSB261), skn7△ (YSB349) 결손변이체 배경에서 야생형 균주(H99)와 비교한 SKN7, SSK1, HOG1 유전자들의 상대적 발현 레벨을 나타내며, 도 1B는 WT, hog1△, ssk1△, skn7△ 결손변이체에서의 광범위한 발현 수준의 컨디셔널 트리 분석 결과를 보여준다. 도 1C는 정상 성장 조건(YDP, 30℃)에서 적어도 하나의 결손변이체주에서 현저하게 다른 발현 패턴(ANOVA 테스트, P < 0.01)을 나타낸 950개의 유전자들의 계층적 클러스터링 분석 결과를 보여주며, 도 1D는 Hog1, Ssk1, Skn7-의존 유전자들을 나타낸 벤다이어그램을 보여준다. 각 결손변이체주에서 2배 이상 상당한 상향조절 또는 하향조절을 나타내는 유전자들을 포함한다.
도 1에서 볼 수 있는 바와 같이, 예상한 대로 각각의 상응하는 결손변이체주에서 HOG1, SSK1, SKN7 유전자들의 비교 발현 레벨이 야생형 균주에 비교하여 매우 낮았다. 또한 다른 진균에서는 Hog1-관련 스트레스 방어 유전자로 알려진 GPD1(CNAG_01745)와 GPP1(CNAG_01744) 동종 유전자들의 발현은 hog1과 ssk1 결손변이체에서 매우 감소하여(각각 4.5배와 2.5배 감소) 우리의 어레이 데이터의 퀄리티를 지지해준다.
크립토코쿠스 네오포만스에서 어떻게 hog1△, ssk1△, skn7△ 결손변이체들이 유전자 발현 패턴에 영향을 미치는지 조사하였다. 조사된 7,936개의 스팟 중에서 3,858개의 스팟이 크로스-진 에러 모델(컷오프 10)에 기초하여 신뢰성 높은 것으로 나타났다. 이전의 발견을 뒷받침하듯이, 컨디션 트리 분석에 기초할 때 hog1 결손변이체의 전사 수준은 ssk1 결손변이체와 상당히 유사했다(도 1B). hog1△, ssk1△, skn7△ 결손변이체에서 신뢰성 높은 유전자들 중 950개의 유전자들 전부가 야생형과 비교할 때 상당히 다른 발현 패턴을 나타내었으며(ANOVA 테스트, P < 0.01)(도 1C), 이는 전체 크립토코쿠스 네오포만스 유전자들의 약 15%가 스트레스 없는 정상 조건에서도 Two-component 시스템과 HOG 신호전달 경로의 동요에 의해 전사적으로 영향을 받음을 의미한다. 그 중 559개의 유전자들이 적어도 하나의 결손변이체에서 2배 이상의 유도를 나타냈다(도 1D). 몇몇 핵심적인 발견들이 다음에 의해 이루어졌다. 먼저, 단지 51개의 유전자들(9%)이 Skn7에 의해 조절된 반면 대다수의 유전자들은(555개의 유전자들, 99%) 스트레스 없는 조건에서 Ssk1 또는 Hog1에 의해 발현이 증가 혹은 감소되었다. Skn7-의존 유전자들 중에서 단지 4개의 유전자들만이 Skn7-특이적인 것으로 발견되었다(도 1D). 따라서 HOG1과 SSK1 결손변이체들이 정상 조건 하에서 유전체수준에서 전사 양상을 바꾼다는 것은 명백해 보인다. 둘째로, Skn7-과 Hog1-의존 유전자들 사이보다(467 개의 유전자들 중 45개, 10%) Ssk1-과 Hog1-의존 유전자들 사이에(555개의 유전자들 중 422개, 76%) 중복이 훨씬 많이 존재하여, Ssk1이 Hog1 MAPK의 주요한 상위체계의 조절자임을 더욱 검증해 준다. 셋째로, Ssk1과 Hog1에 의해 조절되는 유전자의 중요한 중복에 관계없이, 얼마만큼의 Ssk1-특이적(90개의 유전자들), Hog1-특이적(40개의 유전자들) 유전자들이 있었고, Ssk1과 Hog1이 정확히 선형 경로에 있지 않고 각각 다른 타깃(들)이나 상위체계 조절자들을 가질 수 있음을 강하게 암시한다(도 1D). 이것은 ssk1 결손변이체주가 왜 hog1 결손변이체주에 비해 다소 다른 표현형(즉 높은 과산화수소 민감도)을 갖는지와, Hog1이 NaCl에 노출된 상태에서 Ssk1 반응 조절자가 없이도 여전히 인산화될 수 있는지를 설명한다.
Hog1과 Ssk1에 의해 조절되는 유전자들은 에너지 생산과 전환, 아미노산/탄수화물/지방 이송과 대사, 번역과 단백질 생합성, 번역 후 수식, 신호 전달, 스트레스-방어 메커니즘 등을 포함하는 다양한 기능적 카테고리를 다루며, 세포 기능의 다양한 측면에서의 리모델링이 외부 스트레스 없이도 HOG 경로의 동요에 의해 간단히 발생할 수 있음을 나타낸다. 게다가 Hog1-과 Ssk1-의존 유전자들의 3분의 1 이상이 다른 생물들이 가진 어떤 기능적인 ortholog도 갖지 않음을 알아야 하며, 이는 크립토코쿠스 네오포만스가 크립토코커스-특이적인 Hog1/Ssk1-의존 유전자들을 발생시키는 것으로 보임을 나타낸다.
우리의 어레이 분석을 통해 확인한 Ssk1-과 Hog1-조절 유전자들 중에서 몇몇 그룹의 유전자들은 크립토코쿠스 네오포만스의 발병 인자와 유성 생식을 조절하는 HOG 경로의 가능한 메커니즘에 대한 새로운 견해를 제공하였다. 먼저, 철 수송과 조절에 관련된 한 그룹의 유전자들은 야생형 균주에 비해 ssk1과 hog1 결손변이체주에서 많이 유도된 것을 발견하였다. 이 유전자들은 시데로포어를 인코딩하는 SIT1 (CNAG_00815 와 CNAG_07138), 페록시다아제를 인코딩하는 CFO1 (CNAG_06241)와 CFO2 (CNAG_02958), Fe 전달체를 인코딩하는 CFT1 (CNAG_06242)을 포함한다. 크립토코쿠스 네오포만스 Sit1은 히드록사메이트 시데로포어 페리옥사민에 높은 친화력을 갖는 S. cerevisiae Arn3/Sit1와 동종이며, S. cerevisiae에서 크립토코쿠스 네오포만스Cfo1/Cfo2와 Cft1는 철 퍼미에이즈/멀티카퍼 페록시다아제 복합체(Ftr1-Fet3)와 동종이다. 크립토코쿠스 네오포만스에서 철 수송 조절과 멜라닌 합성이 매우 연관된 것처럼 보이기 때문에, hog1과 ssk1 결손변이체 모두에서 관찰된 증가된 멜라닌 합성은 철 수송과 관련된 한 그룹 유전자들의 증가된 발현과 서로 관련될 수 있다.
둘째로, 페로몬 반응 MAPK 경로에서 G-protein subunit를 인코딩하는 GPA2 유전자(CNAG_00179)는 ssk1이나 hog1 결손변이체에서 현저하게 상향조절된다 (각각 12.1배 13.3배 증가). 이 발견은 ssk1과 hog1 결손변이체에서 발견된 증가된 페로몬 생산과 유성생식이 교배 중에 유도된 Gpa2의 증가된 발현으로부터 비롯되었을지도 모르며 크립토코쿠스 네오포만스의 교배 절차를 증진시킬지도 모름을 보여준다.
셋째로, 산화 스트레스 방어에 관련된 몇몇 유전자들은 HOG1과 SSK1 결손변이체에 의해 차별적으로 조절되었다. hog1△과 ssk1△ 결손변이체가 과산화수소에 과민증을 보인다는 앞서의 발견으로부터 예상했듯이, H2O2 를 H2O 로 해독하는 카탈라아제 A를 인코딩하는 CTA1 유전자와 동종인 두 유전자들 (CNAG_04981과 CNAG_00575)은 두 결손변이체 모두에서 현저하게 다운 조절되었다. 또한 SOD2 유전자(미토콘드리아 수퍼옥사이드 디스뮤타제)의 기초 발현 레벨은 hog1과 ssk1 결손변이체 모두에서 감소했고, 산화 스트레스 조절에 있어 HOG 경로의 역할을 더욱 검증했다. 그러나 흥미롭게도 산화 스트레스 반응과 관련된 몇몇 유전자들[TRR1 (티오레독신 환원효소), TSA1 (티오레독신 과산화효소), GRX5 (글루타티온-의존성 산화환원효소), CCP1 (미토콘드리아 시토크롬-c 과산화효소)]의 기초 발현 레벨은 hog1△ 결손변이체에서 2배 이상 증가하였지만 (각각 3.8배, 3.1배, 2.1배, 9.5배 변화) ssk1△ 결손변이체에서는 그렇지 않았다. 역시 산화 스트레스 반응에 관련된 SRX1 유전자(설피레독신)도 hog1△ 결손변이체보다(1.3배 감소) ssk1△ 결손변이체에서(4.2배 감소) 더 감소되었다. 이러한 결과들은 hog1△ 결손변이체들이 왜 ssk1△ 결손변이체보다 더 비교적 H2O2 저항성이 강한지를 설명할 수도 있다.
<실시예 2> 에르고스테롤 생합성 유전자들의 발현 분석
HOG1과 SSK1 유전자 변이에 의해 상향조절된 유전자들 중에서, ERG28 (CNAG_07208)에 대한 상동성 유전자가 진균의 에르고스테롤 생합성에 핵심적인 역할을 하기에 주목할 만했다. S. cerevisiae에 행해진 이전의 마이크로어레이 분석은 ERG28의 발현이 다른 에르고스테롤 생합성 유전자들과 단단히 상호 관련성이 있음을 밝혀냈다. Erg28은 소포체(ER) 막 골격 단백질이며, Erg27, Erg25, Erg11, Erg6과 강하게 상호작용하고 Erg26, Erg1과 약하게 상호작용함으로써 이스트 에르코스테롤 생합성 하는 데에 필수적이다. 이 발견은 어레이 데이터의 다른 에르고스테롤 생합성 유전자들의 발현 패턴을 확인하도록 만들었다.
도 2A는 야생형과 비교한 hog1, ssk1, skn7 결손변이체들에서 에르고스테롤 생합성의 상대적 발현 수준을 보여준다. Fold 변화는 색으로 표현하였고, 각 유전자의 정확한 수치는 계층적 클러스터링(Hierarchical clustering) 다이아그램의 오른쪽에 위치한 표에 나타냈다. 도 2B는 WT (H99), skn7△(YSB349), ssk1△(YSB261), ssk2△ (YSB264), hog1△(YSB64) 결손변이체들에서 세포 에르고스테롤 함량을 보여준다. 왼쪽과 오른쪽 그래프들은 각각 각 균주와, 야생형과 비교한 에르고스테롤 내용물의 상대적으로 증가된 에르고스테롤 %를 보여준다. 각각의 막대는 4개의 독립된 실험으로부터의 평균을 나타내며, 에러 막대는 표준 편차를 의미한다. (*): ssk1△, ssk2△, pbs2△, 및 hog1△ 결손변이체들은 야생형에 비해 상당히 높은 에르고스테롤 레벨을 갖는다 (P < 0.05, Bonferroni multiple comparison test).
도 2A에서 알 수 있는 바와 같이, 흥미롭게도 대부분의 에르고스테롤 생합성 유전자들은 야생형 균주와 비교할 때 hog1과 ssk1 결손변이체에서 상향조절되었고 skn7 결손변이체에서는 그렇지 않았다. ERG27, ERG13, ERG26, ERG10, IDI1, HMG1, 및 ERG8과 같은 유전자들은 ssk1△ 결손변이체에서 상향조절 된 반면, ERG11, ERG6, MVD1, ERG5, ERG25, ERG20, ERG4와 같은 유전자들은 ssk1△과 hog1△ 결손변이체 모두에서 상향조절 되었다. 이와 대조적으로 skn7 결손변이체에서는 어떤 유전자도 현저하게 상향조절 되지 않았고, 실제로 ERG13, ERG1, ERG3, ERG7, ERG2 유전자들을 포함하는 몇몇 유전자들은 skn7△ 결손변이체에서 하향조절 되었다.
마이크로어레이 데이터를 검증하기 위하여, hog1△과 ssk1△ 결손변이체에서 몇몇 에르고스테롤 생합성 유전자들의 증가된 발현 레벨이 실제로 세포의 에르고스테롤 함량에 영향을 미치는지 여부를 시험하였다. 그 결과 도 2B로부터 알 수 있는 바와 같이, 세포의 에르고스테롤 함량이 야생형과 skn7△ 결손변이체에서보다 hog1△과 ssk1△ 결손변이체에서 훨씬 높았으며, 이는 몇몇 에르고스테롤 생합성 유전자들의 증가된 발현이 세포의 에르고스테롤의 증가된 생산을 야기했음을 나타낸다. HOG 경로에서 ssk2△ (MAPKKK)와 pbs2△ (MAPKK) 결손변이체들은 야생형과 skn7△ 결손변이체들보다 세포 에르고스테롤 레벨이 훨씬 높은 것으로 나타나며(도 2B), 이는 우리의 어레이 데이터를 더 검증해 준다.
이 발견은 two-component 시스템과 HOG 경로에서 에르고스테롤 생합성 유전자들 또는 에르고스테롤 그 자체를 타깃으로 하는 항진균 약제에 대한 결손변이체의 감수성을 조사하도록 자극하였다. 첫째로, 항원형 A H99 균주 배경에서 만들어진 ssk1, skn7, ssk2, pbs2, hog1 결손변이체들의 폴리엔 항진균 약제, 암포테리신 B에 대한 감수성을 시험하였다. 암포테리신 B는 진균 세포막에 있는 에르고스테롤에 결합하여 막 통합성을 붕괴시킴으로써 궁극적으로 치사를 일으킨다. ssk1, ssk2, pbs2, hog1 결손변이체에서 관찰된 증가된 에르고스테롤 함량이 증가된 약물 타깃 수 때문에 그들을 암포테리신 B에 과민성이 되게 할 수 있다고 가정했다.
도 3은 HOG 경로의 억제가 C. neoformans에서 암포테리신 B와 함께 상승된 항진균 효과를 나타냄을 보여주는 분석 결과이다. 도 3A 내지 3B는 지시된 농도의 암포테리신 B를 포함하는 YPD 고체배지에 스팟된 각각의 C. neoformans 균주를 30△에서 72시간 배양하여 촬영한 사진을 보여주며 도 3C는 지시된 농도의 암포테리신 B를 포함하는 YPD 고체배지에 스팟된 C. neoformans 항원형 A 균주들, 항원형 D 균주들을 30△에서 72시간 배양하여 촬영한 사진을 보여준다.
도 3으로부터 알 수 있는 바와 같이, 가설을 검증하듯, ssk1, ssk2, pbs2, hog1 결손변이체들은 야생형에 비해 암포테리신 B 처리에 현저한 과민성을 나타내었고(도 3A), 이는 에르고스테롤 함량이 야생형보다 HOG 경로 결손변이체에서 훨씬 높았다는 발견과 일치하는 것이다 (도 2B). 반대로, skn7 결손변이체는 암포테리신 B에 대하여 야생형 수준의 저항성을 보였고(도 3A), 이것은 skn7 결손변이체에서 세포의 에르고스테롤 함량이 야생형과 유사했다는 이전의 데이터에 의해서도 또한 설명된다(도 2B).
또한 Ssk1 반응 조절자의 상위에서 작용하는 결손변이체 하이브리드 센서 카이네이즈(Tco1, Tco2, Tco3, Tco4, Tco5, Tco7)를 가진 크립토코쿠스 네오포만스 균주의 암포테리신 B-감수성을 검사했다. 본 발명자들은 이전 연구에서 Tco1 와 Tco2가 Hog1-의존 표현형의 일부를 조절하는 데에 차별화되는 동시에 중복된 역할을 하는 것을 보였었다. 여기서 우리는 Tco1 와 Tco2가 암포테리신 B를 감지하고 반응하는 각각의 역할을 함을 발견했다. Tco 단백질 중에서, 하나의 폴리펩타이드에 2개의 반응 조절자 영역과 2개의 히스티딘 카이네이즈 영역을 갖는 더블 하이브리드 센서 카이네이즈인 Tco2만이 암포테리신 B에 과민성을 나타냈으며(도 3B), 이는 Tco2가 HOG 경로를 통해 약물 저항성을 주기 위해 암포테리신 B의 감지와 반응에 관련됨을 나타낸다. 그러나 tco2 결손변이체에서 관찰된 과민성의 정도가 ssk1 결손변이체보다 적다는 사실은 다른 가능성들을 나타낸다. 하나의 가능성은 다른 미지의 수용체/센서가 암포테리신 B에 반응하도록 존재할지도 모른다는 것이다. 또 다른 가능성은 Ssk1, Ssk2, Pbs2 (Tco2은 제외)가 모두 Hog1의 구조적 인산화 레벨과 관련있기 때문에, 수용체/센서의 존재여부에 상관 없이 구조적으로 인산화된 Hog1이 정상 조건에서 에르고스테롤 생합성 경로를 억제할 수도 있다는 것이다.
가설을 검증하기 위하여 JEC21, B3501-A 같은 다른 크립토코쿠스 네오포만스 균주들의 암포테리신 B 민감도를 시험하였고, 차별적인 Hog1 인산화 레벨을 나타냈다. 두 번째 가설의 검증에 있어, Hog1이 상시적으로 인산화되지 않은 JEC21 균주에서는 암포테리신 B에 과민성을 나타내었고, 심지어 H99 균주 배경에서의 ssk2 결손변이체보다 더했다(도 3C). JEC21 균주 배경에서, SSK2, PBS2, HOG1 유전자의 결손변이체는 암포테리신 B에 대한 민감도에 영향을 주지 못했다(도 3C). 반대로, Hog1이 상시적으로 인산화된 B3501 균주에서, H99 균주에서보다 적은 정도이기는 하지만, JEC21보다 암포테리신 B에 대한 높은 저항성을 보였다(도 3C). H99 균주와 유사하게, Hog1 인산화를 파괴하는 SSK2 MAPKKK 결손변이체는 암포테리신 B 민감도가 증가하였다(도 3C). 이 모든 데이터들은 상시적으로 인산화된 Hog1이 정상 조건에서 에르고스테롤 생합성 경로를 억제함을 나타낸다.
이 발견을 검증하기 위하여, 우리는 진균의 시토크롬 P450 효소 14-디메틸라아제를 억제하고 궁극적으로 라노스테롤을 에르고스테롤로 변환하는 것을 막는 트리아졸(플루코나졸과 이트라코나졸)과 이미다졸(케토코나졸)을 포함하는 아졸 화합물에 대한 결손변이체들의 감수성을 시험하였다.
도 4는 C. neoformans에서의 HOG 경로의 억제가 몇몇 아졸 약물에 대해 길항적인 항진균 효과를 나타냄을 보여주는 분석 결과로서, 각각의 C. neoformans 균주를 지시된 농도의 플루코나졸, 케토코나졸, 이트라코나졸을 포함하는 YPD 고체배지에 스팟한 후 30℃에서 72시간 배양하여 촬영한 사진을 나타낸다.
우리는 특히 ERG11을 포함한 많은 에르고스테롤 생합성 유전자들의 증가된 발현을 보이는 ssk1과 hog1 결손변이체들이 아졸 화합물에 대하여 높은 저항성을 보일 것이라고 예상했었다. 도 4로부터 알 수 있는 바와 같이, ssk1, ssk2, pbs2, hog1 결손변이체들 모두 플루코나졸과 케토코나졸에 민감한 저항성을 보였지만, 이트라코나졸에는 그렇지 않았다. 흥미롭게도 skn7 결손변이체들 역시 플루코나졸과 케토코나졸에 야생형보다 높은 저항성을 보였다. 하이브리드 센서 카이네이즈 중에서, 오직 Tco1과 Tco2만이 아졸 화합물에 대해 차별적인 민감도를 나타낸다. HOG 결손변이체보다 정도는 작지만, tco2 결손변이체는 플루코나졸과 케토코나졸에 대해 야생형보다 높은 저항성을 보였다. 반대로 tco1 결손변이체는 모든 아졸 약물에 과민성을 나타내며, 이는 Tco1이 크립토코쿠스 네오포만스에서 Tco2와 반대로 HOG 경로를 조절할지도 모른다는 것을 나타낸다. 결과적으로 HOG 경로의 불활성화는 에르고스테롤 생합성 유전자의 유도에 의해 에르고스테롤 함량을 증가시키고 따라서 암포테리신 B 처리에는 상승 효과를 주지만, 플루코나졸과 케토코나졸에는 길항효과를 준다.
<실시예 3> HOG 경로에 의해 조절을 받는 하위체계 타깃 유전자의 발굴 및 특성 규명
상기 DNA 마이크로어레이 실험에서 밝혀진 HOG 경로에 의해 조절을 받는 하위체계 타깃 유전자로서 ENA1 (serotype A ID: CNAG_00531.2)과 NHA1 (serotype A ID: CNAG_01678.2) 유전자를 발굴하고, 이에 대한 추가 실험을 실시하였다. 세포는 정상조건에서 Pma1와 같은 H+-ATPase pump를 이용해서 H+(proton)을 세포막 밖으로 배출하여 세포생장에 필수적인 membrane potential을 유지하는 역할을 한다. 반대로 세포성장에 유용한 ion인 potassium ion(K+)을 Trk1/Trk2 와 같은 K+ influx pump를 이용하여 세포안으로 유입한다. K+와는 다르게 Na+은 독성 ion으로 분류되며 세포내에 높은 농도의 Na+이 존재 할 경우, 이를 efflux pump를 통해 배출해내야 한다. K+도 독성은 작지만 세포내에 과농도로 존재할 경우 독성이 있기 때문에 역시 이를 효과적으로 조절하는 efflux pump가 존재해야 한다. 이러한 Na+과 K+의 efflux pump 역할을 하는 것이 Ena1과 Nha1이다.
실험 결과, 이들 유전자의 HOG 경로에 대한 흥미롭게도 이 두 efflux pump를 코딩하는 유전자가 C. neoformans에서 모두 HOG 경로에 의해 조절받는 사실이 밝혀졌다. 도 5A에서 볼 수 있는 바와 같이, 상기 실시예와 유사한 방법으로 야생형 균주와 함께 skn7△, ssk1△ 또는 hog1△ 결손변이체주에 대해 삼투압 스트레스를 준 결과 ENA1과 NHA1의 발현량이 HOG 경로의 유전자의 결손변이체 여부에 의존적임을 알 수 있었다.
따라서 이들 두 유전자의 특성을 규명하기 위해 각각의 유전자의 결손변이체(deletion mutant)를 제조하였으며, 두 유전자를 동시에 특이적으로 제거한 이중결손변이체(ena1△ nha1△)를 제조하여, 암포테리신 B(AmpB)와 같은 폴리엔 계열의 항진균제와 플루코나졸, 케토코나졸 및 이트라코나졸과 같은 아졸계 항진균제에 대한 감수성을 확인하였다. ena1△과 nha1△ 결손변이체는 AmpB에 특별히 높은 감수성을 보이지 않았다. 하지만 놀랍게도 ena1△ nha1△ 이중결손변이체는 AmpB에 상당히 증가된 감수성을 보임을 확인할 수 있었다 (도 5B). 물론 hog1△ 보다는 감수성이 높지 않았지만 ena1△ nha1△이 가지는 높은 AmpB 감수성은 이 두 efflux pump가 폴리엔 계열의 약물저항성에 매우 중요한 역할을 함을 짐작할 수 있다. 더욱 특기할 만한 사실은 ena1△ 및 ena1△ nha1△ 결손변이체가 아졸 계열의 약물에도 매우 높은 감수성을 보인다는 사실이다 (도 5C). 이는 hog1△ 변이균이 아졸 계열의 항진균제에는 높은 저항성을 보이는 것과는 매우 구별되는 특징으로 Enal과 Nhal을 동시 혹은 개별적으로 타켓팅하는 저해제들과 폴리엔계 또는 아졸계 항진균제를 병용사용하면 매우 높은 항진균활성을 보일 수 있음을 증명한다.
<실시예 4> 크립토코쿠스 네오포만스의
ras1
△
, aca1
△
, gpa1
△
, cac1
△
,
및
pka1
△
pka2
△
결손변이체의 전사체 비교 분석
Ras1-, Aca1-, 및 Gpa1-의존 신호전달 경로의 하위체계 신호전달 네트워크를 비교하기 위해, 위에서 설명한 DNA 마이크로어레이 분석방법을 사용하여 항원형 A 야생형 (WT, H99) 균주, ras1△, aca1△, gpa1△, cac1△, 및 pka1△ pka2△ 결손변이체의 전사체 비교분석을 수행하였다. 분석 품질의 기본적인 검증을 위해, 어레이 데이터 내의 RAS1, ACA1, GPA1, CAC1, PKA1, 및 PKA2 유전자의 발현 수준을 체크하였다. 각각 상응하는 결손변이체에서의 RAS1, ACA1, GPA1, CAC1, PKA1, 및 PKA2의 상대적인 발현은 야생형 쥰주에서의 발현에 비해 매우 낮았다 (각각 0.08, 0.03, 0.09, 0.06, 0.07, 및 0.12) (도 6A). 이는 상기 어레이의 품질을 뒷받침한다.
이 DNA 마이크로 어레이에 의해 모니터된 총 7,936 개의 유전자로부터, 565개의 유전자들이 야생형 균주와 비교하여 통계적으로 유의한 수준으로 Ras- 및 cAMP 결손변이체에서 상이한 발현 패턴을 나타냈다(ANOVA test, P < 0.05) (도 6B). Ras- 또는 cAMP-의존적 유전자의 계층적 클러스터링 분석은 몇가지 중요한 사실에 다다랐다. 첫번째, Ras1-신호전달 경로에 의해 좌우되는 전사체 패턴은 cAMP/PKA-신호전달 경로에 의해 조절되는 것과는 구별된다. 통계학적 분석은 총 400 개의 유전자의 기초 발현 수준이 야생형과 비교할 때 ras1△ 결손변이체에서 유의하게 변화하였고, 반면 132개의 유전자의 발현 수준이 aca1△, gpa1△, cac1△, 및 pka1△ pka2△ 결손변이체에서 유의하게 변화하였다 (도 6C 및 5D). 조절되는 유전자의 수뿐만 아니라, 주요 Ras1-의존성 유전자의 발현 패턴 또한 cAMP-의존성 유전자의 발현 패턴과는 구별되었으며, 이는 C. neoformans에서 Ras1-신호전달 경로가 cAMP-신호전달 경로와는 매우 독립적임을 지지해 준다. 둘째, aca1△ 및 gpa1△ 결손변이체는 cac1△ 및 pka1△ pka2△ 결손변이체와 유사한 전사체 패턴을 보였으며, 이는 Aca1 및 Gpa1이 cAMP-신호전달 경로에 있어서 두 개의 주요한 신호전달 조절자임을 나타낸다 (도 6D). aca1△ 및 gpa1△ 결손변이체 간에 발현이 상이하게 조절되는 소그룹의 유전자들이 있었다. 이는 Aca1 및 Gpa1이 다른 비주류의 신호전달 가지를 가질 수 있음을 나타낸다(도 6D). 기대했던 대로, cac1△ 결손변이체는 pka1△ pka2△ 와 거의 동일한 유전체 발현 패턴을 나타냈으며, 이는 추가로 C. neoformans에서 아데닐일 사이클라제의 필요하고 충분한 단백질 키나아제 단백질 하위체계임을 제시한다(도 6D).
Ras- 및 cAMP-신호전달 경로에 의해 조절되는 유전자들은 넣고 다양한 세포 기능을 커버한다(도 7). cAMP-신호전달 의존적 유전자들은 신호 유도 메커니즘 (15.2%), 탄수화물 수송 및 대사 (9.6%), 및 아미노산 수송 및 대사(8.0%)에 연관된 것들에 대해 걸쳐 나타난다. cAMP-경로는 성장, 분화, 및 C. 네오포만스의 병독력을 조절하는 중추 신호 유도 케스케이드 중 하나이고, 글루코스 및 아미노산을 센싱하는 것으로 알려져 있었으므로 (Bahn et al., 2004, Xue et al., 2006) 이는 다소 예측된 결과였다. 유사하게, 신호 유도 메커니즘에 관련된 유전자들이 대부분 ras1△ 결손변이체에서 대부분에 걸쳐 나타났다 (12.1%) (도 7). 그러나, cAMP-경로와는 대조적으로, 세포벽/막/껍질 생합성에 관련된 유전자들이 전반적으로 나타났으며 (2.9%), 이는 Ras1이 세포벽 완전성의 유지에 연관되어 있을 것임을 암시한다.
Ras- 및 cAMP-의존적 유전자 중 유의한 비율이 환경적 스트레스에 조절되는 것으로 나타났다 (도 8). 우리의 이전 분석은 크립토코쿠스 네오포만스 에서의 많은 ESR (Environmental Stress Regulated) 유전자를 발견했었다 (Ko et al., 2009). 총 1,959개의 유전자들이 삼투압 스트레스, 산화적 스트레스 또는 항진균제(플루디옥소닐) 처리에 반응하여 2배 이상 상향조절되거나 하향조절됨이 발견되었다 (Ko et al., 2009). 흥미롭게도, 우리의 금번 어레이 분석은 ESR 유전자 (총 225개의 ESR 유전자)의 한 서브세트가 야생형 균주와 비교하여 ras1△ 또는 cAMP에서 발현 수준에 유의한 변화를 나타냄을 밝혔다 (ANOVA test, P < 0.05) (Fig. 2B 및 Table S4). 이들 중, 86개의 ESR 유전자는 결손변이체에서의 2배 이상의 유도 또는 감소를 나타냈다 (도 8). 나아가, 총 55개의 CSR (Common Stress Response) 유전자가 상이하게 조절됨이 발견되었으며 (ANOVA test, P < 0.05), 그들 중 31개의 유전자가 결손변이체에서 2배 이상의 유도 또는 감소를 나타내었다 (도 8). Ras- 또는 cAMP-경로-의존적 ESR 및 CSR 유전자의 상당 비율은 유의한 상동성을 갖는 어떠한 다른 호모로그도 갖지 않았다. 그럼에도 불구하고, 이들 결과는 Ras- 및 cAMP-신호전달 경로가 크립토코쿠스 네오포만스의 다양한 스트레스 반응에 관련되어 있음을 암시했다.
<실시예 5> 크립토코쿠스 네오포만스에서의 Ras- 또는 cAMP-의존적 유전자의 확인
실시예 4의 전사체 분석에 의해 확인된 개별적인 Ras1- 및 cAMP-의존적 유전자를 조사했다.
선택된 161개의 Ras-의존적 유전자 (2-fold cutoff, 도 6C) 중에서, 그들 중 다수(101 유전자, 63%)는 다른 균류에서의 어떠한 ortholog도 갖지 않았는데, 이는 크립토코쿠스 네오포만스가 독특한 세트의 Ras-의존적 유전자를 포함함을 제시한다. 진화적으로 보존된 Ras-의존적 유전자 중에서, 그의 ortholog가 S. cerevisiae 에서 Rho-GTPase Cdc42의 조절에 연관되어 있는 것으로 알려진 세 개의 유전자, PXL1, RDI1, 및 BEM3는 Ras1-Cdc24 신호전달 경로가 크립토코쿠스 네오포만스 에서의 Cdc42 호모로그 중 하나에 의해 조절됨이 보고된 바 있으므로 주목할만 했다 (Nichols et al., 2007). RDI1 및 BEM3는 각각 Rho-GDP 해리 저해제 및 Rho-GTPase 활성화 단백질을 코딩한다 (Price et al., 2008, Zheng et al., 1994). 특히, 크립토코쿠스 네오포만스의 유전자독성 스트레스 반응에서의 Ras1의 역할과 잘 일치하여, DNA 손상 수복의 조절에 관련된 다수의 유전자들이 Ras-의존적 유전자로서 확인되었다. 이들은 RNR2/RNR3 (Ribonucleotide-diphosphate reductase), RAD3 (DNA helicase, a subunit of nucleotide excision repair factor 3), RAD14 (a subunit of nucleotide excision repair factor 1), MSH6 (a protein required for mismatch repair), MND1 (a protein required for recombination 및 repair of DNA double strand breaks), 및 DNA2 (ATP-의존적 뉴클레아제)를 포함한다. 최종적으로, 세포벽 완전성을 통제하는 것에 관련된 수 개의 유전자, CHS1 (Chitin synthase 1), CDA2 (Chitin deacetylase), BGL2 (glucan 1,3-b-glucosidase), 및 GSC2 (Glucan synthase)가 또한 Ras-의존적 유전자로서 확인되었으며, 이는 크립토코쿠스 네오포만스의 세포벽 완전성을 유지하는데 있어서의 Ras1의 역할을 추가로 뒷받침해준다.
cAMP 결손변이체 (aca1△, gpa1△, cac1△, 및 pka1△ pka2△) 로부터 얻은 전사체 데이터와 야생형 균주(ANOVA, P < 0.05)와의 통계학적 비교 결과 163개의 유전자를 확인했다 (도 6C). 이들 중, 38개의 유전자는 CAC1, ACA1, PKA1, 및 GPA1 를 제외하고는, cAMP 결손변이체에서 보다 2배 이상의 유도 또는 감소를 나타냈다(도 9). 대다수의 cAMP-의존적 유전자 (31 유전자, 81%)는 크립토코쿠스 네오포만스에서의 어떠한 알려진 기능이나 S. cerevisiae에서의 orthorog는 갖지 않았는데, 이는 크립토코쿠스 네오포만스가 Ras-의존적 유전자 와 유사하게 독특한 세트의 cAMP-의존적 유전자를 포함함을 나타낸다. 이러한 관찰은 추가로 크립토코쿠스 네오포만스 cAMP 결손변이체가 다른 균류에서 관찰된 적 없는 독특한 표현형적 특성을 가짐을 확증한다. 크립토코쿠스 네오포만스에서의 5개의 cAMP-의존적 유전자(GRE2, ENA1, HSP12, CAT1, 및 PKP1)가 다른 균류에서 진화적으로 보존되어 있는 것으로 나타났다. 흥미롭게도, GRE2, ENA1, 및 HSP12 유전자는 S. cerevisiae에서 환경적 스트레스에 의해 전사적으로 조절되는 것으로 알려져 있다. 크립토코쿠스 네오포만스에서, Ena1이 탄소 결핍 조건에서 삼투압 스트레스를 조절 (Ko et al., 2009) 할 뿐만 아니라, 염기성 pH 및 인 비보 독성에서의 생존을 위해 요구(Idnurm et al., 2009)되는 것으로 최근 보고된 바 있다. 포유동물 3-b-하이드록시스테로이드 디하이드로제나제의 호모로그인 GRE2 ( genes de r espuesta a e stres, stress-responsive gene)는, S. cerevisiae에서 프로모터 영역에서의 CRE (cAMP response element)에 HOG-의존적 Sko1 전사 인자가 결합할 때 삼투압 및 산화적 스트레스를 포함한 다양한 스트레스에 반응하여 강력하게 유도된다 (Garay-Arroyo & Covarrubias, 1999, Rep et al., 2001). Heat shock protein인 HSP12 (03143)는 그의 발현이 다양한 스트레스에 의해 유도되고 HOG 및 cAMP 신호전달 경로에 의해 조절되는 작은 소수성 단백질이다 (Varela et al., 1995). C. neoformans의 genome database의 분석결과 HSP12의 또 다른 homolog가 존재(여기서 HSP122로 명명, CNAG_01446.2)하고 HSP122 역시 그 본 어레이 분석과 northern 분석 결과 cAMP 및 HOG 신호전달체계에 의해 그 발현이 조절됨을 확인할 수 있었다.
<실시예 6> Ras 및 cAMP-신호전달 경로의 저해에 따른 항진균제에 대한 반응 분석
GRE2는 ERG6, ERG10, 및 ERG19/MVD1을 포함한 일부 에르고스테롤 생합성 유전자의 조절에 관여한다(Warringer & Blomberg, 2006). 또한, GRE2는 S. cerevisiae에서 암포테리신 B (AmpB)에 저항하여 그의 발현이 증가되는 6개의 유전자 중 하나로 보고되었다(Anderson et al., 2009). 그러므로, 우리는 크립토코쿠스 네오포만스 Ras- 및 cAMP-결손변이체들이 야생형에 비해 AmpB 처리에 감수성이 있는지를 조사하였다.
그 결과, 도 9에서 볼 수 있는 바와 같이, ras1△ 결손변이체는 야생형에 비해 AmpB에 대한 더 높은 감수성을 나타낸 반면, aca1△ 결손변이체는 약간 더 높은 AmpB 감수성을 나타냈다(도 10A). ras1△ aca1△ 이중 결손변이체는 각각의 단독 결손변이체에 비해 더 높은 AmpB-민감성을 나타냈다 (도 10B). 이는 Ras1 및 Aca1이 중복적으로 또는 독립적으로 AmpB 민감성을 조절함을 나타낸다. Cdc24는 폴리엔 약물 저항성의 조절을 위해 Ras1의 다운스트림을 작동시키는 것으로 나타났다 (도 10C). 흥미롭게도, ras2D 결손변이체는 또한 야생형에 비해 약간 더 AmpB에 대해 민감성인 것으로 나타났는데, 이는 Ras 단백질들이 모두 크립토코쿠스 네오포만스에서 폴리엔 약물에 대한 저항성을 조절함을 나타낸다.
특히, gpa1△ 및 cac1△ 결손변이체는 야생형에 비해 훨씬 더 높은 AmpB-민감성을 나타냈으며, ras1△ 또는 aca1△ 결손변이체에 비해서도 더 높은 AmpB-민감성을 나타냈다 (도 10A). Cac1 아데닐일 사이클라아제(adenylyl cyclase)의 하위체계, pka1△ 결손변이체(pka2△ 결손변이체는 아님)는 AmpB에 대해 증가된 감수성을 보였다 (도 10A). 이는 Gpa1-Cac1-Pka1 신호전달체계가 폴리엔 약물 민감성을 조절하기 위한 신호전달 회로의 하나임을 보여준다. ras1△ cac1△ 이중 결손변이체는 각각의 단독의 결손변이체에 비해 더 높은 AmpB 감수성을 나타냈는데 (도 10B), 이는 Ras- 및 Gpa1-Cac1-Pka1 경로가 AmpB 감수성과 독립적으로 연관되어 있음을 나타낸다. MAT
a background (KN99 균주)에서 생성된 ras1△ 및 ras1△ cac1△ 결손변이체는 동일한 표현형을 나타냈다(데이터 미도시).
폴리엔 민감성에 대한 Ras- 및 cAMP-경로의 관여가 에르고스테롤 생합성의 수준과 연관되어 있는지 확인하기 위해, 우리는 우리의 어레이 데이터로부터 결손변이체에서의 에르고스테롤 생합성의 발현 수준을 체크하였다. 흥미롭게도, ERG3 및 ERG25 (<2배 미만)를 제외하고는 어떠한 에르고스테롤 생합성 유전자도 ras1△, aca1△, gpa1△, cac1△, 또는 pka1△ pka2△ 결손변이체에서 야생형과 비교하여 에르고스테롤의 발현 수준의 변화를 나타내지 않았다. 노던 블롯 분석은 결손변이체에서의 ERG3 및 ERG25 유전자의 발현 수준이 야생형과 유의하게 다르지 않음을 보여주었다(도 10D). 우리는 또한 Ras- 및 cAMP-결손변이체에서의 세포적 에르고스테롤 함량을 조사하였고, 세포적 에르고스테롤 함량이 야생형에 비해 Ras- 및 cAMP-결손변이체에서 유의하게 증가하지 않음을 확인했다. 이는 이전의 보고에서 hog1△ 결손변이체에서 에르고스테롤의 함량이 증가된 것과는 상반된다 (데이터 미도시) (Ko et al., 2009). 또한, ras1△ 및 cAMP 결손변이체에서의 ERG11의 발현 수준은 야생형과 유의하게 다르지 않았다(도 10D). 이러한 발견은, gpa1△, cac1△, pka1△, pka2△, 및 pka1△ pka2△ 결손변이체가 균류의 사이토크롬 P450 효소 14a-디메틸라아제를 타겟팅하고 라노스테롤의 에르고스테롤로의 전환을 저해하는 플루코나졸에 거의 저항성을 나타냈다는 점을 지지한다(데이터 미도시). 이러한 모든 데이터는 Ras 및 cAMP-신호전달 경로가 에르고스테롤 생합성에 영향을 미치지 않고 독립적으로 폴리엔 민감성에 영향을 미친다는 점을 강력하게 시사한다.
상기 실시예 1 내지 3으로부터, HOG 경로가 비스트레스 조건 하에서 크립토코쿠스 네오포만스의 에르고스테롤 생합성을 조절하며, HOG 경로 결손변이체는 결손변이체 내에 증가된 세포적 에르고스테롤 함량으로 인해 AmpB에 대해서는 과민감성이나, 플루코나졸에는 매우 높은 저항성을 나타냄을 확인한 바 있다. 그러므로, HOG 및 cAMP 경로는 서로 다른 방식으로 폴리엔 민감성에 영향을 미친다는 것을 생각할 수 있다. 이를 뒷받침하는 것으로, 우리는 hog1△ cac1△ 및 hog1△ pka1△ 이중 결손변이체가 hog1△, cac1△, 또는 pka1△ 단독의 결손변이체에 비해 AmpB 에 대해 보다 더 민감함을 발견했다 (도 10E). 예상치 못하게, hog1△ cac1△ 이중 결손변이체는 또한 플루코나졸, 케토코나졸 및 이트라코나졸과 같은 다양한 아졸계 약물에 대해 과민감성을 나타냈다 (도 10F). 흥미롭게도, ras1△, aca1△, gpa1△, cac1△, 및 pka1△ 결손변이체는 모두 이트라코나졸에 대해 증가된 민감성을 보였다 (도 10G). 특히, Ras1 및 Ras2는 둘 다 Cdc24에 의존적인 방식으로 이트라코나졸 감수성에 관련된 것으로 나타났다(도 10H). 종합해 보면, 이들 데이터는 HOG 경로 및 cAMP-신호전달 경로가 독립적으로 폴리엔 및 아졸계 항진균제에 대한 감수성을 조절함을 나타낸다.
상기 분석 결과를 정리해 보면, 우리는 Ras- 및 cAMP-신호전달 경로가 크립토코쿠스 네오포만스에서 폴리엔계 또는 아졸계 항진균제에 대한 감수성을 조절한다는 것을 발혔다. Ras1 및 Ras2 모두 하위조절인자로서 Cdc24를 이용하여 폴리엔 감수성에 관여하는 것으로 나타났다. 흥미롭게도 ras1△ aca1△ 결손변이체 또한 암포테리신 B에 과민감성인 것으로 나타났다. 이는 Ras1 및 Aca1가 폴리엔계 약물에 대한 감수성에서 부차적인 역할을 할지도 모른다는 점을 제시한다. ras1 및 aca1 변이에 의해 동요된 세포골격 조절 및 세포벽 완전성이 세포를 폴리엔계 약물에 대해 보다 감수성이 있게 만들었을 가능성이 있다.
cAMP-신호전달 경로는 또한 Ras-신호전달 경로에 비해 폴리엔계 감수성에서 보다 더 유의하게 관련되어 있었다. GPA1, CAC1, 및 PKA1의 결손변이체는, 크립토코쿠스 네오포만스 세포를 암포테리신 B (AmpB)와 같은 폴리엔계 약물에 대해 과민감성이 되도록 했다. 위에서 살펴본 바와 같이, HOG 경로의 동요가 또한 크립토코쿠스 네오포만스 세포를 AmpB에 대해 과민감성이 되도록 함을 확인한 바 있다. 그러나, cAMP 및 HOG 경로는 폴리엔계 약물 감수성의 조절에 대해 상이하게 작용하는 것으로 보인다. HOG 경로는 에르고스테롤의 생합성을 증가시켜, 폴리엔계 약물의 감수성을 향상시키고 아졸계 약물의 저항성을 향상시킨다 (Ko et al., 2009). 또한, hog1△ 결손변이체는 cAMP 결손변이체에 비해 AmpB에 대한 더 높은 감수성을 나타냈다.
<실시예 7> 크립토코쿠스 네오포만스의 항진균제 감수성에 대한 cAMP-의존적 유전자의 역할 분석
상기 살펴본 바와 같이, cAMP-신호전달 경로는 Ras-신호전달 경로에 비해 폴리엔계 감수성에서 보다 더 유의하게 관련되어 있는 것으로 나타났으므로, 우리는 크립토코쿠스 네오포만스의 항진균제 감수성에 대한 cAMP-의존적 유전자의 역할을 추가로 분석했다.
분석 결과, 폴리엔계 약물에 대한 cAMP 결손변이체의 과민감성은 두 개의 heat shock protein Hsp12의 C. neoformans homolog인 HSP12 (H99 gene ID: CNAG_03143.2)과 HSP122 (H99 gene ID: CNAG_01446.2)의 감소된 발현이 일부 기여하고 있는 것으로 나타났다 (도 11).
흥미롭게도, cac1△ 결손변이체가 hsp12△ 또는 hsp122△ 결손변이체에 비해 AmpB 에 대한 감수성이 더 높긴 했으나, hsp12△ 또는 hsp122△ 결손변이체가 야생형에 비해 AmpB 에 대한 감수성이 약간 더 높은 것으로 나타났다 (도 11A). 그러므로, Hsp12 또는 HSP122의 감소된 발현은 AmpB에 대한 cAMP 결손변이체의 감수성에 기여할 것임을 생각할 수 있었다.
Hsp12 및 Hsp122의 조절 메커니즘을 보다 명확히 하기 위해, 우리는 cAMP-신호전달 경로가 Hsp12 및 Hsp122 유전자의 발현을 조정함을 확인하기 위해 Northern blot 분석을 수행하였다. S. cerevisiae에서, HSP12는 글루코스 풍부한 조건의 비스트레스 하에서는 발현되지 않으나, 환경적인 스트레스에 반응해 발현이 유도된다 (Praekelt & Meacock, 1990, Siderius et al., 1997). 그러나, 예기치 않게도, 크립토코쿠스 네오포만스에서 Hsp12 및 Hsp122 유전자는 글루코스가 풍부한 조건의 비스트레스 하에서 야생형 균주에서 매우 높게 발현되는 유전자로 나타났다 (도 11A). 마이크로어레이 데이터와 잘 일치하게도, Hsp12 및 Hsp122의발현은 gpa1△, cac1△, 및 pka1△ pka2△ 결손변이체들을 포함한 cAMP 결손변이체에서 유의하게 하향조절되었다(도 11A). aca1△ 결손변이체 및 ras1△ 결손변이체에서, Hsp12 및 Hsp122 유전자의 발현 수준은 약간만 영향을 받았다 (도 11A). 이들 데이터는 우리의 마이크로어레이 데이터를 확인해줄 뿐만 아니라 Hsp12 및 Hsp122가 cAMP-신호전달 경로에 의해 양성적으로 조절됨을 나타냈다.
흥미롭게도 우리의 이전 어레이 분석은 Hsp12 및 Hsp122가 HOG 경로의 조절하에 있을 수도 있음을 보여주었다. Hsp12 및 Hsp122 발현 수준은 hog1△ 결손변이체 및 ssk1△ 결손변이체에서 고려할만 하게 낮았으나, skn7△ 결손변이체에서는 그렇지 않았다 (도 11B). 이를 확인하기 위해, 우리는 Northern blot 분석을 수행하였으며, Hsp12 및 Hsp122 의 발현 수준이 야생형 및 skn7△ 결손변이체에서는 매우 높으나, hog1△ 및 ssk1△ 결손변이체에서는 탐지할 수 없음을 발견하였다(도 11B). 이 모든 데이터는 Hsp12 및 Hsp122 유전자가 cAMP 및 HOG 신호전달 경로에 의해 공동-조절됨을 나타낸다.
이상 살펴본 바와 같이, 폴리엔계 약물에 대한 cAMP 결손변이체의 과민감성은 heat shock protein Hsp12 및 Hsp122의 감소된 발현이 일부 기여하고 있는 것으로 나타났다. S. cerevisiae에서, Hsp12는 세포벽 유연제와 물 치환 분자로서 세포막을 안정화시키는데 역할을 하고 있으므로 (Sales et al., 2000, Shamrock & Lindsey, 2008) , S. cerevisiae에서 스트레스 조건 하에서 세포벽 완전성을 유지하는데 관여한다 (Shamrock et al., 2009). 그러므로, hsp12△ 결손변이체는 세포벽 불안정화제인 콩고 레드의 존재 하에서 자랄 수 없다 (Motshwene et al., 2004). 따라서, cAMP-신호전달 경로의 동요는 Hsp12의 기초발현 수준을 감소시키고, 이는 크립토코쿠스 네오포만스의 세포벽 완전성 및 막 유연성을 계속적으로 약화시킨다. 유사하게, 폴리엔계 약물에 대한 HOG 경로 결손변이체의 과민감성은 일부 HSP12의 감소된 발현에 기인한다. 그러나, cac1△ 결손변이체가 hsp12△ 결손변이체에 비해 AmpB에 대해 훨씬 더 민감성을 나타내므로, 에르고스테롤 생합성을 제외한 다른 인자들이 폴리엔계 약물에 대한 저항성에 영향을 줄지도 모른다. 이를 뒷받침하는 것으로, hog1△ cac1△ 또는 hog1△ pka1△ 이중 결손변이체는 각각의 단독의 결손변이체에 비해 훨씬 더 높은 폴리엔계 약물 민감성을 나타냈는데, 이는 두 개의 경로가 폴리엔계 약물 감수성에서 독립적인 역할을 함을 나타낸다. 특히, HOG1 및 CAC1 유전자의 이중 결손변이체는 크립토코쿠스 네오포만스 세포가 플루코나졸, 케토코나졸, 및 이트라코나졸을 포함한 대부분의 아졸계 약물에 대해 알수 없는 이유로 고민감성을 나타내도록 했다.
어떠한 경우에서도, Ras-, cAMP/PKA-, 및 HOG-신호전달 경로 (또는 그들의 조합)의 변형은 폴리엔계 및 아졸계 약물과의 배합에서의 새로운 항진균 치료 접근법을 제공할 것이다. 암포테리신 B와 같은 폴리엔계 약물로 치료할 때 cAMP 및 HOG 경로의 동시적 저해는 크립토코쿠스감염의 치료를 위한 가장 강력한 복합 요법의 하나가 될 수 있을 것이다.
Claims (38)
- 크립토코쿠스 네오포만스(Cryptococcus neoformans)의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 저해제를 포함하는 항진균용 의약 조성물.
- 제1항에 있어서,상기 항진균용 의약 조성물은 Ssk1, Ena1 및 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 하나 이상의 저해제를 포함하는 것인 항진균용 의약 조성물.
- 제1항에 있어서,상기 항진균용 의약 조성물은 에르고스테롤-결합성 항진균제 또는 아졸계 항진균제와 순차적으로 또는 동시에 투여되는 것을 특징으로 하는 항진균용 의약 조성물.
- 제3항에 있어서,상기 에르고스테롤-결합성 항진균제는 폴리엔계 항진균제인 항진균용 의약 조성물.
- 제4항에 있어서,상기 폴리엔계 항진균제는 암포테리신 B, 나타마이신, 리모시딘, 필리핀, 니스타틴 및 캔디신으로 구성되는 군으로부터 선택되는 하나 이상의 항진균제인 항진균용 의약 조성물.
- 제5항에 있어서,상기 폴리엔계 항진균제는 암포테리신 B인 항진균용 의약 조성물.
- 제3항에 있어서,상기 아졸계 항진균제는 케토코나졸, 플루코나졸, 이트라코나졸, 및 보리코나졸로 구성되는 군으로부터 선택되는 하나 이상의 항진균제인 항진균용 의약 조성물.
- 크립토코쿠스 네오포만스(Cryptococcus neoformans)의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 대한 저해제를 포함하는 항진균용 의약 조성물.
- 제8항에 있어서,상기 항진균용 의약 조성물은 SSK1, ENA1 및 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 대한 하나 이상의 저해제를 포함하는 것인 항진균용 의약 조성물.
- 제8항에 있어서,상기 항진균용 의약 조성물은 에르고스테롤-결합성 항진균제 또는 아졸계 항진균제와 순차적으로 또는 동시에 투여되는 것을 특징으로 하는 항진균용 의약 조성물.
- 제10항에 있어서,상기 에르고스테롤-결합성 항진균제는 폴리엔계 항진균제인 항진균용 의약 조성물.
- 제11항에 있어서,상기 폴리엔계 항진균제는 암포테리신 B, 나타마이신, 리모시딘, 필리핀, 니스타틴 및 캔디신으로 구성되는 군으로부터 선택되는 하나 이상의 항진균제인 항진균용 의약 조성물.
- 제12항에 있어서,상기 폴리엔계 항진균제는 암포테리신 B인 항진균용 의약 조성물.
- 제10항에 있어서,상기 아졸계 항진균제는 케토코나졸, 플루코나졸, 이트라코나졸, 및 보리코나졸로 구성되는 군으로부터 선택되는 하나 이상의 항진균제인 항진균용 의약 조성물.
- 제1항 내지 제14항 중 어느 한 항의 항진균용 의약 조성물; 및에르고스테롤-결합성 항진균제 또는 아졸계 항진균제를 포함하는 항진균 복합 제제.
- 크립토코쿠스 네오포만스(Cryptococcus neoformans)의 Ssk1, Tco2, Ssk2, Pbs2, Hog1, Ena1 또는 Nha1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질을 포함하는 항진균제 스크리닝용 조성물.
- 제16항에 있어서,상기 항진균제는 Ssk1, Ena1 또는 Nha1 단백질에 대한 저해제인 항진균제 스크리닝용 조성물.
- 크립토코쿠스 네오포만스(Cryptococcus neoformans)의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 유전자를 포함하는 항진균제 스크리닝용 조성물.
- 제18항에 있어서,상기 항진균제는 SSK1, ENA1 또는 NHA1 유전자에 대한 저해제인 항진균제 스크리닝용 조성물.
- 크립토코쿠스 네오포만스(Cryptococcus neoformans)의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 저해제를 포함하는 항진균용 의약 조성물.
- 제20항에 있어서,상기 저해제는 Cac1 또는 Pka1 단백질에 대한 저해제인 항진균용 의약 조성물.
- 제20항에 있어서,상기 항진균용 의약 조성물은 폴리엔계 또는 아졸계 항진균제와 순차적으로 또는 동시에 투여되는 것인 항진균용 의약 조성물.
- 제22항에 있어서,상기 폴리엔계 항진균제는 암포테리신 B, 나타마이신, 리모시딘, 필리핀, 니스타틴 및 캔디신으로 구성되는 군으로부터 선택되는 하나 이상의 항진균제인 항진균용 의약 조성물.
- 제23항에 있어서,상기 폴리엔계 항진균제는 암포테리신 B인 항진균용 의약 조성물.
- 제22항에 있어서,상기 아졸계 항진균제는 케토코나졸, 플루코나졸, 이트라코나졸, 및 보리코나졸로 구성되는 군으로부터 선택되는 하나 이상의 항진균제인 항진균용 의약 조성물.
- 제20항에 있어서,상기 항진균용 의약 조성물은 크립토코쿠스 네오포만스의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질에 대한 저해제와 순차적으로 또는 동시에 투여되는 것인 항진균용 의약 조성물.
- 크립토코쿠스 네오포만스의 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1, HSP12 및 HSP122로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 대한 저해제를 포함하는 항진균용 의약 조성물.
- 제27항에 있어서,상기 저해제는 CAC1 또는 PKA1 유전자에 대한 저해제인 항진균용 의약 조성물.
- 제27항에 있어서,상기 항진균용 의약 조성물은 폴리엔계 또는 아졸계 항진균제와 순차적으로 또는 동시에 투여되는 것인 항진균용 의약 조성물.
- 제29항에 있어서,상기 폴리엔계 항진균제는 암포테리신 B, 나타마이신, 리모시딘, 필리핀, 니스타틴 및 캔디신으로 구성되는 군으로부터 선택되는 하나 이상의 항진균제인 항진균용 의약 조성물.
- 제30항에 있어서,상기 폴리엔계 항진균제는 암포테리신 B인 항진균용 의약 조성물.
- 제29항에 있어서,상기 아졸계 항진균제는 케토코나졸, 플루코나졸, 이트라코나졸, 및 보리코나졸로 구성되는 군으로부터 선택되는 하나 이상의 항진균제인 항진균용 의약 조성물.
- 제27항에 있어서,상기 항진균용 의약 조성물은 크립토코쿠스 네오포만스(Cryptococcus neoformans)의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 대한 저해제와 순차적으로 또는 동시에 투여되는 것인 항진균용 의약 조성물.
- 제20항 내지 제33항 중 어느 한 항의 항진균용 의약 조성물; 및폴리엔계 항진균제, 아졸계 항진균제 및 크립토코쿠스 네오포만스의 SSK1, TCO2, SSK2, PBS2, HOG1, ENA1 및 NHA1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질 또는 이를 코딩하는 유전자에 대한 저해제로 구성되는 군으로부터 선택되는 하나 이상의 항진균제를 포함하는 항진균 복합 제제.
- 크립토코쿠스 네오포만스의 Ras1, Ras2, Cdc24, Gpa1, Cac1, Aca1, Pka1, Hsp12 또는 Hsp122로 이루어진 군으로부터 선택되는 하나 이상의 단백질을 포함하는 항진균제 스크리닝용 조성물.
- 제35항에 있어서,상기 항진균제는 Cac1 또는 Pka1 단백질에 대한 저해제인 항진균제 스크리닝용 조성물.
- 크립토코쿠스 네오포만스의 RAS1, RAS2, CDC24, GPA1, CAC1, ACA1, PKA1, HSP12 및 HSP122로 이루어진 군으로부터 선택되는 하나 이상의 유전자를 포함하는 항진균제 스크리닝용 조성물.
- 제37항에 있어서,상기 항진균제는 CAC1 또는 PKA1 유전자에 대한 저해제인 항진균제 스크리닝용 조성물.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/143,921 US20120093817A1 (en) | 2009-01-09 | 2010-01-08 | USE OF THE GENES IN THE HOG, Ras AND cAMP PATHWAY FOR TREATMENT OF FUNGAL INFECTION |
| US13/862,666 US9017956B2 (en) | 2009-01-09 | 2013-04-15 | Use of the genes in the Hog, Ras and cAMP pathway for treatment of fungal infection |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2009-0001947 | 2009-01-09 | ||
| KR1020090001947A KR101079278B1 (ko) | 2009-01-09 | 2009-01-09 | 진균 감염의 치료를 위한 hog 신호전달경로 유전자의 용도 |
| KR10-2009-0127206 | 2009-12-18 | ||
| KR1020090127206A KR101167988B1 (ko) | 2009-12-18 | 2009-12-18 | 진균 감염의 치료를 위한 Ras 및 cAMP 신호전달경로 유전자의 용도 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/143,921 A-371-Of-International US20120093817A1 (en) | 2009-01-09 | 2010-01-08 | USE OF THE GENES IN THE HOG, Ras AND cAMP PATHWAY FOR TREATMENT OF FUNGAL INFECTION |
| US13/862,666 Continuation US9017956B2 (en) | 2009-01-09 | 2013-04-15 | Use of the genes in the Hog, Ras and cAMP pathway for treatment of fungal infection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010079998A2 true WO2010079998A2 (ko) | 2010-07-15 |
| WO2010079998A3 WO2010079998A3 (ko) | 2010-11-04 |
Family
ID=42317011
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2010/000137 Ceased WO2010079998A2 (ko) | 2009-01-09 | 2010-01-08 | 진균 감염의 치료를 위한 hog, ras 및 camp 신호전달경로 유전자의 용도 |
Country Status (2)
| Country | Link |
|---|---|
| US (2) | US20120093817A1 (ko) |
| WO (1) | WO2010079998A2 (ko) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3279330A4 (en) * | 2015-03-30 | 2019-02-20 | Amtixbio Co., Ltd. | NEW GENE REGULATING VIRULENCE DECRYPTOCOCCUS NEOFORMANS |
| WO2021054786A3 (ko) * | 2019-09-18 | 2021-05-14 | (주)앰틱스바이오 | 뇌수막뇌염 유발 진균의 뇌-혈관 장벽 통과 및 뇌-내부 생존 관련 유전자의 용도 |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014130922A1 (en) | 2013-02-25 | 2014-08-28 | Trustees Of Boston University | Compositions and methods for treating fungal infections |
| KR20170054190A (ko) * | 2015-11-09 | 2017-05-17 | (주)앰틱스바이오 | 진균 감염 치료 및 예방을 위한 신규한 키나아제 및 이들의 용도 |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1993011777A1 (en) * | 1991-12-11 | 1993-06-24 | Temple University - Of The Commonwealth System Of Higher Education | Amphotericin b composition with enhanced antifungal activity |
| US6660761B2 (en) * | 2002-02-06 | 2003-12-09 | Council Of Scientific And Industrial Research | Method of treatment for fungal infections with a synergistic formulation of antifungal agents |
| WO2007002120A2 (en) * | 2005-06-23 | 2007-01-04 | Duke University | Fungicidal effect by regulating signal transduction pathways |
-
2010
- 2010-01-08 US US13/143,921 patent/US20120093817A1/en not_active Abandoned
- 2010-01-08 WO PCT/KR2010/000137 patent/WO2010079998A2/ko not_active Ceased
-
2013
- 2013-04-15 US US13/862,666 patent/US9017956B2/en active Active
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3279330A4 (en) * | 2015-03-30 | 2019-02-20 | Amtixbio Co., Ltd. | NEW GENE REGULATING VIRULENCE DECRYPTOCOCCUS NEOFORMANS |
| EP3739058A3 (en) * | 2015-03-30 | 2021-01-27 | Amtixbio Co., Ltd. | Novel gene regulating virulence of crptrococcus neoformans, and use thereof |
| WO2021054786A3 (ko) * | 2019-09-18 | 2021-05-14 | (주)앰틱스바이오 | 뇌수막뇌염 유발 진균의 뇌-혈관 장벽 통과 및 뇌-내부 생존 관련 유전자의 용도 |
| CN115176160A (zh) * | 2019-09-18 | 2022-10-11 | 阿米蒂比奥有限公司 | 致脑膜脑炎真菌的血脑屏障穿过以及脑内生存相关基因的用途 |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2010079998A3 (ko) | 2010-11-04 |
| US20130237446A1 (en) | 2013-09-12 |
| US20120093817A1 (en) | 2012-04-19 |
| US9017956B2 (en) | 2015-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Casanova | Regulation of Arf activation: the Sec7 family of guanine nucleotide exchange factors | |
| Yin et al. | Phosphodiesterase MoPdeH targets MoM ck1 of the conserved mitogen‐activated protein (MAP) kinase signalling pathway to regulate cell wall integrity in rice blast fungus M agnaporthe oryzae | |
| Zachara et al. | The dynamic stress-induced “O-GlcNAc-ome” highlights functions for O-GlcNAc in regulating DNA damage/repair and other cellular pathways | |
| Kim et al. | Two Saccharomyces cerevisiae JmjC Domain Proteins Demethylate Histone H3 Lys36 in Transcribed Regions to Promote Elongation*♦ | |
| Niimi et al. | Specific interactions between the Candida albicans ABC transporter Cdr1p ectodomain and ad‐octapeptide derivative inhibitor | |
| Chen et al. | cAMP blocks MAPK activation and sclerotial development via Rap‐1 in a PKA‐independent manner in Sclerotinia sclerotiorum | |
| WO2012087004A2 (en) | Use of upr signaling pathway genes ire1 and hxl1 for treatment of fungal infection and meningitis | |
| Tsao et al. | A small G protein Rhb1 and a GTPase-activating protein Tsc2 involved in nitrogen starvation-induced morphogenesis and cell wall integrity of Candida albicans | |
| Lohmar et al. | The Aspergillus flavus rtfA gene regulates plant and animal pathogenesis and secondary metabolism | |
| Fox et al. | Phospholipid-binding protein Cts1 controls septation and functions coordinately with calcineurin in Cryptococcus neoformans | |
| Vanhalewyn et al. | A mutation in Saccharomyces cerevisiae adenylate cyclase, Cyr1K1876M, specifically affects glucose‐and acidification‐induced cAMP signalling and not the basal cAMP level | |
| WO2010079998A2 (ko) | 진균 감염의 치료를 위한 hog, ras 및 camp 신호전달경로 유전자의 용도 | |
| Cho et al. | Anti-inflammatory activity of calmodulin-lysine N-methyltransferase through suppressing the caspase-11 non-canonical inflammasome | |
| Miller et al. | Adenovirus E1A specifically blocks SWI/SNF-dependent transcriptional activation | |
| Petrakis et al. | Physical and functional interaction between Elongator and the chromatin-associated Kti12 protein | |
| Deshmukh et al. | Cdk-related kinase 9 regulates RNA polymerase II mediated transcription in Toxoplasma gondii | |
| KR101167988B1 (ko) | 진균 감염의 치료를 위한 Ras 및 cAMP 신호전달경로 유전자의 용도 | |
| Xu et al. | cGASa and cGASb from grass carp (Ctenopharyngodon idellus) play opposite roles in mediating type I interferon response | |
| Wiedemann et al. | Agents that activate the high osmolarity glycerol pathway as a means to combat pathogenic molds | |
| Mitra et al. | Characterization of Toxoplasma gondii Spt5 like transcription elongation factor | |
| Kamthan et al. | Characterization of a putative spindle assembly checkpoint kinase Mps1, suggests its involvement in cell division, morphogenesis and oxidative stress tolerance in Candida albicans | |
| KR101079278B1 (ko) | 진균 감염의 치료를 위한 hog 신호전달경로 유전자의 용도 | |
| Gao et al. | FpOGT is required for fungal growth, stress response, and virulence of Fusarium proliferatum by affecting the expression of glucokinase and other glucose metabolism-related genes | |
| WO2006059111A2 (en) | Fungal signalling and metabolic enzymes | |
| WO2021177518A1 (ko) | 혈중 콜레스테롤 저하용, 심혈관 대사질환의 예방 또는 치료용 및 항염용 약학적 조성물 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10729340 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13143921 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10729340 Country of ref document: EP Kind code of ref document: A2 |

