WO2010067013A1

WO2010067013A1 - Novel isolated reovirus, and detection methods and kits

Info

Publication number: WO2010067013A1
Application number: PCT/FR2009/052451
Authority: WO
Inventors: Francis Barin; Marie-Anne Barthez; Alain Goudeau; Florence Komurian-Pradel; Louise Ouattara; Glaucia Paranhos-Baccala; Pierre Thomas-Castelnau
Original assignee: Biomerieux; Centre Hospitalier Regional Universitaire De Tours
Priority date: 2008-12-11
Filing date: 2009-12-08
Publication date: 2010-06-17
Also published as: FR2939807B1; FR2939807A1

Abstract

The invention relates to a novel reovirus isolated in humans, and having a genome containing at least (i) a nucleotide sequence selected from SEQ ID NO : 1, a sequence at least 83% identical to SEQ ID NO : 1, a sequence coding for two proteins in which the peptide sequences are identified in SEQ ID NO : 2 and SEQ ID NO : 3, a sequence coding for two proteins in which the peptide sequences is at least 93% identical to SEQ ID NO : 2 and SEQ ID NO : 3, or (ii) a nucleotide sequence which is the sequence complementary to the sequence defined in (i). The invention also relates to methods and kits for the detection thereof.

Description

New isolated reovirus, methods and detection kits.

Reoviruses belong to the Reoviridae family.

It is the widest and most diverse family of viruses in terms of host species. In fact, viruses of this family can infect plants, insects, mammals, fish, birds, bacteria, arthropods and many other species. It includes twelve genera including the genera Orthoreovirus, Rotavirus, Seadornavirus and Coltivirus that can be pathogenic for humans.

The name "reovirus" is the acronym for "respiratory enteric orphan virus" proposed in 1959 by Sabin AB. "Reoviruses. ECHO type 10 is described "(Science 1959/130: 1387-1389) for viruses isolated from the respiratory and digestive tracts of persons with respiratory or enteric symptoms unrelated to a disease. well defined clinic. Three main serotypes are known, named 1, 2 and 3. The reovirus infections are very common in humans but remain mostly asymptomatic. However, strains of reovirus have been isolated from various cases of symptomatic diseases in humans, ie diseases of the central nervous system such as encephalitis and meningitis sometimes leading to death of the patient. These cases are proof that reoviruses can be pathogens causing serious diseases.

The genome is composed of 10 to 12 segments of double-stranded RNA according to the genus and can have a size ranging from 18 000 to 30

000 base pairs (bp). Each segment encodes at least one protein. The genomic RNA carries a cap at the 5 'end on the positive strand, but does not have a polyadenylation site at the 3' end. The structural characters common to Reoviridae are: the absence of an envelope, the presence of a icosahedral capsid consisting of one, two or three protein layers with diameters between 60 and 80 nanometers (nm).

The mammalian reovirus (MRV) comprises 10 segments of double-stranded RNA, classified according to their size and each coding for a protein except for the Sl segment which codes for two proteins. There are three L segments for "Large" designated L1, L2 and L3, measuring between 3854 base pairs (bp) and 3916 bp and coding respectively for the proteins λ3, λ2 and λl. Then, three M segments for "Medium" named M1, M2 and M3, ranging in size from 2203 bp to 2241 bp and coding respectively for the μ2, μl and μNS proteins. Finally, four S segments for "Small" divided into S2 (1331 bp), S3 (1198 bp), S4 (1196 bp) and Sl coding respectively for σ2, σNS, σ3, σ1 and oiss. The size of the Sl segment varies greatly between serotypes and within a serotype. It is between 1368 and 1463 bp. The eleven viral proteins encoded by the 10 segments are organized into five inner capsid proteins, three outer capsid proteins, and three nonstructural proteins. The 8 viral proteins present in mature reovirus virions (structural proteins) are required for initiation of infection and synthesis of capped viral mRNA. They could also play regulatory roles in infected cells. These are the five proteins present in the inner envelope (λ1, λ2, λ3, μ2 and σ2) and the three proteins constituting the outer capsid of the virion (μl, σ1 and σ3). The λ2 protein forms pentameric turrets that surround the five-fold axes of the inner capsid. As a result, it interacts with other internal and external proteins. The analysis of the proteins in the reovirus-infected cells revealed the presence of two other viral proteins that are not present in the mature virions. These nonstructural proteins are called μNS and σNS. Another non-structural protein that is encoded by the second reading frame of the Sl segment has also been identified.

The present inventors have now isolated and characterized a novel reovirus, referred to as MRV2Tou05. This new reovirus was isolated from three hospitalized patients with respiratory symptoms who rapidly evolved and were diagnosed with encephalitis. This is a girl and her cousin as well as the girl's mother. The common point between these family members is the visit of an uncle returning from a trip to Indonesia. Different samples (serum, urine, cerebrospinal fluid, nasal aspirations) were tested to find the etiological agent responsible. Diagnostic tests based on cell culture, direct antigen and molecular biology methods did not reveal the presence of viruses frequently found in cases of encephalitis.

The subject of the invention is therefore a new isolated mammalian reovirus whose genome comprises

(i) a nucleotide sequence selected from SEQ ID NO: 1, a sequence having at least 83% identity, preferably at least 84%, 85%, 90%, 95%, 98% identity, with SEQ ID NO: 1, a sequence that codes for two proteins whose peptide sequences are identified in SEQ ID NO: 2 and SEQ ID NO: 3, a sequence that codes for two proteins whose peptide sequences have at least 90% identity. with SEQ ID NO:

2 and SEQ ID NO: 3, or

(ii) a nucleotide sequence which is the sequence complementary to a sequence defined in (i).

In addition, its genome comprises a nucleotide sequence chosen from: (i) a nucleotide sequence selected from SEQ ID NO: 4, a sequence having at least 80% identity, preferably at least 83%, 85%, 89%, 90%, 95%, 98% identity , with SEQ ID NO:

4, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 5, a nucleotide sequence chosen from SEQ ID NO: 6, a sequence which has at least 85% identity, preferably at least 90 %, 95%, 98%, 99% identity with SEQ ID NO: 6, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 7, a nucleotide sequence chosen from SEQ ID NO: 8 a sequence which has at least 83% identity, preferably at least 85%, 90%, 95%, 97%, 98% identity with SEQ ID NO: 8, a sequence that encodes a protein whose Peptide sequence is identified in SEQ ID NO: 9, a nucleotide sequence selected from SEQ ID NO: 10, a sequence which has at least 90% identity, preferably at least 95%, 98% identity, with SEQ ID NO: 10, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 11, a sequence nucleotide selected from SEQ ID NO: 12, a sequence that has at least 86% identity, preferably at least 90%, 95%, 98% identity, with SEQ ID NO: 12, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 13, a nucleotide sequence chosen from SEQ ID NO: 14, a sequence which has at least 81% identity, preferably at least 85%, 90%, 95%, 98% identity, with SEQ ID NO: 14, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 15, a nucleotide sequence chosen from SEQ ID NO: 16, a sequence which has at least 89%, preferably at least 90%, 93%, 95%, 98% identity, identity with SEQ ID NO: 16, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 17, a nucleotide sequence chosen from SEQ ID NO: 18, a sequence which has at least 85% identity, preferably at least 90%, 95 %, 98% identity, with SEQ ID NO: 18, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 19, and a nucleotide sequence selected from SEQ ID NO: 20, a sequence which has at least 83% identity, preferably at least 85%, 90%, 95%, 98% identity, with SEQ ID NO: 20, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 21, or

(ii) the nucleotide sequences which are the complementary sequences of the sequences defined in (i).

In particular, its genome consists of:

(i) a nucleotide sequence selected from SEQ ID NO: 1, a sequence having at least 83% identity, preferably at least 84%, 85%, 90%, 95%, 98% identity, with SEQ ID NO: 1, a sequence that codes for two proteins whose peptide sequences are identified in SEQ ID NO: 2 and SEQ ID NO: 3, a sequence that codes for two proteins whose peptide sequences have at least 90% identity. with SEQ ID NO: 2 and SEQ ID NO: 3, a nucleotide sequence selected from SEQ ID NO: 4, a sequence which has at least 80% identity, preferably at least 83%, 85%, 89%, 90 %, 95%, 98% identity, with SEQ ID NO: 4, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 5, a nucleotide sequence chosen from SEQ ID NO: 6, a sequence which has at least 85% identity, preferably at least 90%, 95%, 98%, 99% identity with SEQ ID NO: 6, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 7, a nucleotide sequence selected from SEQ ID NO: 8, a sequence having at least 83% identity, preferably at least 85%, 90%, 95%, 97%, 98% identity with SEQ ID NO: 8 , a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 9, a nucleotide sequence chosen from SEQ ID NO: 10, a sequence which has at least 90% identity, preferably at least 95% identity. , 98% identity, with SEQ ID NO: 10, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 11, a nucleotide sequence chosen from SEQ ID NO: 12, a sequence which exhibits at least 86% identity, preferably at least 90%, 95%, 98% identity, with SEQ ID NO: 12, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 13, a nucleotide sequence chosen from SEQ ID NO: 14, a sequence which has at least 81% identity, preferably at least 85%, 90%, 95%, 98% identity, with SEQ ID NO: 14, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 15, a nucleotide sequence selected from SEQ ID NO: 16, a sequence that exhibits at least 89%, preferably at least 90%, 93%, 95%, 98% identity, identity with SEQ ID NO: 16, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 17, a nucleotide sequence selected from SEQ ID NO: 18, a sequence which has at least 85% identity, preferably at least 90%, 95%, 98% d identity, with SEQ ID NO: 18, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 19, and a nucleotide sequence selected from SEQ ID NO: 20, a sequence which exhibits at least 83% identity, preferably at least 85%, 90%, 95%, 98% identity, with SEQ ID NO: 20, a a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 21, and / or

Reovirus MRVTou05 whose genome comprises at least one sequence, at least two sequences, at least three sequences, at least four sequences, at least five sequences, at least six sequences, at least seven sequences, at least eight sequences, at least nine sequences at least ten sequences, chosen from SEQ ID NOs: 1, 3, 4, 6, 8, 10, 12, 14, 16, 18 and 20, or MRVTou05 reovirus whose genome consists of SEQ ID NOs: 1, 3, 4, 6, 8, 10, 12, 14, 16, 18 and 20.

The nucleotide sequences listed as SEQ ID NOs: 1, 3, 4, 6, 8, 10, 12, 14, 16, 18 and 20 correspond to the cDNA obtained from the reverse transcription of the genomic RNA.

The correspondence between the different segments of the reovirus, the viral proteins and the sequence listing is given in Table 1 below:

Table 1

size of amplified segments

The invention is also for obj and a nucleic acid molecule which comprises or consists of a nucleotide sequence as defined below:

(i) a nucleotide sequence selected from SEQ ID NO: 1, a sequence having at least 83% identity, preferably at least 84%, 85%, 90%, 95%, 98% identity, with SEQ ID NO: 1, a sequence that codes for two proteins whose peptide sequences are identified in SEQ ID NO: 2 and SEQ ID NO: 3, a sequence that codes for two proteins whose peptide sequences have at least 90% identity. with SEQ ID NO: 2 and SEQ ID NO: 3, a nucleotide sequence selected from SEQ ID NO: 4, a sequence which has at least 89% identity, preferably at least 90%, 95%, 98% of identity with SEQ ID NO: 4, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 5, a nucleotide sequence chosen from SEQ ID NO: 6, a sequence which has at least 99% identity with SEQ ID NO: 6, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 7, a nucleotide sequence selected from SEQ ID NO: 8, a sequence which has at least 97%, 98% identity with SEQ ID NO: 8, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 9, a nucleotide sequence selected from SEQ ID NO: 10, a sequence that has at least 98% identity with SEQ ID NO: 10, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 11 a nucleotide sequence selected from SEQ ID NO: 12, a sequence which has at least 98% identity with SEQ ID NO: 12, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 13, a nucleotide sequence chosen from SEQ ID NO: 14, a sequence which has at least 98% identity with SEQ ID NO: 14, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 15, a nucleotide sequence chosen from SEQ ID NO: 16, a sequence which has at least 93% identity, preferably at least 95% identity. %, 98% identity, with SEQ ID NO: 16, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 17, a nucleotide sequence chosen from SEQ ID NO: 18, a sequence which presents at least 98% identity with SEQ ID NO: 18, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 19, a nucleotide sequence chosen from SEQ ID NO: 20, a sequence which exhibits at least 98% identity with SEQ ID NO: 20, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 21, and

(ii) the nucleotide sequences which are the complementary sequences of the sequences defined in (i). a protein which comprises or consists of a peptide sequence selected from SEQ ID NOs: 2, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, a sequence which has at least 90% identity, preferably at least 95%, 98% of identity, with SEQ ID NO: 2 or SEQ ID NO: 3, a peptide sequence encoded by a nucleotide sequence selected from SEQ ID NO: 1 or by a sequence which exhibits at least 83 % identity, preferably at least 84%, 85%, 90%, 95%, 98% identity, with SEQ ID NO: 1, a sequence encoded by SEQ ID NO: 4, or a sequence which exhibits at least 89% identity, preferably at least 90%, 95%, 98% identity, with SEQ ID NO: 4, a sequence encoded by SEQ ID NO: 6 or a sequence having at least 99% d identity with SEQ ID NO: 6, a sequence encoded by SEQ ID NO: 8 or a sequence that has at least 97% identity, preferably at least 98% identity with SEQ ID NO: 8, a sequence encoded by SEQ ID NO: 10 o u with a sequence which has at least 98% identity with SEQ ID NO: 10, a sequence encoded by SEQ ID NO: 12 or by a sequence that has at least 98% identity with SEQ ID NO: 12, a sequence encoded by SEQ ID NO: 14 or a sequence that has at least 98% identity with SEQ ID NO: 14, a sequence encoded by SEQ ID NO: 16 or a sequence which exhibits at least 93%, preferably at least 95%, 98% identity with SEQ ID NO: 16, a sequence encoded by SEQ ID NO: 18 or with a sequence that has at least 98% identity, with SEQ ID NO: 18, a sequence encoded by SEQ ID NO: 20 or a sequence that has at least 98% identity with SEQ ID NO: 20.

Primers have been defined to amplify and / or detect the nucleic acids of the new reovirus. Thus, the subject of the invention is also a pair of primers for amplifying, for example by PCR, a reovirus as defined above in which at least one of the primers has a nucleotide sequence which consists of a sequence of 18 to 30 contiguous nucleotides. capable of hybridizing to a nucleotide sequence selected from SEQ ID NOs: 1, a sequence having at least 83% identity with SEQ ID NO: 1, SEQ ID NO: 4, a sequence having at least 89% d identity with SEQ ID NO: 4, SEQ ID NO: 6, a sequence that has at least 99% identity with SEQ ID NO: 6, SEQ ID NO: 8, a sequence that has at least 97% identity with SEQ ID NO: 8, SEQ ID NO: 10, a sequence that has at least 98% identity with SEQ ID NO: 10, SEQ ID NO: 12, a sequence that has at least 98% identity with SEQ ID NO: 12, SEQ ID NO: 14, a sequence that has at least 98% identity with SEQ ID NO: 14, SEQ ID NO: 16, a sequence that has at least 93% identity with SEQ ID NO: 16, SEQ ID NO: 18, a sequence that has at least 98% identity with SEQ ID NO: 18, SEQ ID NO: 20, and a sequence that exhibits less than 98% identity with SEQ ID NO: 20. In particular, the pair of primers is chosen from at least one of the following pairs:

SEQ ID NO: 22 and SEQ ID NO: 23

SEQ ID NO: 22 and SEQ ID NO: 24 SEQ ID NO: 25 and SEQ ID NO: 26,

SEQ ID NO: 27 and SEQ ID NO: 28,

SEQ ID NO: 29 and SEQ ID NO: 30,

SEQ ID NO: 31 and SEQ ID NO: 32,

SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36,

SEQ ID NO: 39 and SEQ ID NO: 40,

SEQ ID NO: 41 and SEQ ID NO: 42,

SEQ ID NO: 43 and SEQ ID NO: 44,

SEQ ID NO: 45 and SEQ ID NO: 46, and SEQ ID NO: 45 and SEQ ID NO: 47.

The invention defines a first method for amplifying and / or detecting a reovirus strain, as defined above, in a sample, the method comprising the steps of: (a) extracting the nucleic acids from the sample,

(b) amplifying at least one of said extracted nucleic acids, and

(c) determining the presence of specific nucleic acid sequence (s) of said reovirus, wherein the amplification step is performed by RT-

PCR using at least one pair of primers as defined above.

In this method, the sample can be serum, plasma, cerebrospinal fluid, throat swab, urine.

In another method for detecting the reovirus strain, the sample is contacted with at least one of the proteins of the invention and the presence of at least one protein / antibody complex is detected by any known means. In this method, the sample can be serum, plasma, cerebrospinal fluid, urine, and preferably is serum. The test can be a Western blot or sandwich test. The formation of the protein / antibody complex can be demonstrated by reaction of said complex formed with an antibody ligand, for example an antigen or anti-human immunoglobulin, labeled with any appropriate label, for example by an enzyme such as horseradish peroxidase.

The invention also relates to: a kit for amplifying and / or detecting the reovirus in a sample, which comprises at least one pair of primers as defined above; and a kit for detecting the presence of the reovirus of the invention, in a sample, comprising at least one protein as defined above.

FIG. 1 represents a phylogenetic tree which results from a phylogenetic analysis which has notably made it possible to confirm that the new reovirus is a serotype 2 virus.

Figure 2 is the 1% + TBE agarose gel visualization of L3 segment-based detection molecular test results from nucleic acids extracted from cells infected with the viral strain derived from the boy's urine. The assay comprises a reverse transcription step, a PCR step in which a 696 bp fragment is amplified and a semi-nested PCR step in which a 512 bp fragment is amplified.

Meaning of the tracks:

1: PCR negative water control

1 ': negative control water PCR semi-nichée

2: PCR cell negative control 2 ': negative control cell PCR semi-niched

3: infected cells and supernatant PCR

3 ': infected cells and supernatant PCR semi-niched

M: molecular weight marker FIG. 3 represents the results of a Western blot carried out with goose sera directed against the three different serovars of reovirus (serotype 1: Hall S729, serotype 2:

Jones, serotype 3: Abney).

Significance of the strips: 1 and 2: goose serum anti-reovirus serotype 1

3 and 4: goose serum anti-reovirus serotype 2

5 and 6: goose serum anti-reovirus serotype 3

7 and 8: healthy human serum the odd numbers correspond to the infected cell strips and the even numbers correspond to the uninfected cell strips.

FIG. 4 represents the results of a Western Blot carried out with the serum of the daughter taken at different times after the onset of symptoms (A: D + 6, B: D + 13, C: D + 19: D: negative serum ). I, T and M respectively mean infected cells, uninfected control cells and molecular weight marker.

Examples

Example 1

Infection of BGM cells on a 24-well plate

The viral strain used to infect BGM (Buffalo Green Monkey Kidney) cells was obtained from the girl's urine.

Buffalo Green Monkey Kidney (BGM) cells are cultured 2 days before virus infection at a rate of 0.8 to 10 ⁵ cells per well, in 1.5 ml of the growth medium described below: EMEM IX with Earle Salts (CAMBREX ref .: BE121-1235F) (500 mL) 1% Glutamine 200 Mm (CAMBREX ref .: BE17-605E) (100 mL) 1% non-essential amino acids 100X (CAMBREX)

2% of the mixture Penicillin-Streptomycin (CAMBREX ref .: DE17-602E) (10,000 U penicillin G, 10,000 g streptomycin) 7% inactivated fetal calf serum (CAMBREX ref .: DE14-081F) (500 mL), inactivated for 30 minutes. at 56 ° C.

The culture medium is removed from the wells on the day of infection. The cells are washed in IX PBS. The viral stock is diluted in an infection medium (growth medium without FCS + 0.003% trypsin at 2.5%). 100 μL of uninfected medium are added per well as a negative control and 100 μL of infected medium are added to each of the other wells. The plate is centrifuged at 2370 rpm for 20 minutes. at room temperature. 2 ml of infection medium are added per well. The plate is incubated for 3 hours at 34 ° C. under a 5% CO 2 atmosphere. The entire medium is removed and replaced with 2 mL of fresh medium per well. The plate is incubated at 34 ^° C. under a 5% CO 2 atmosphere. The appearance of cytopathic effects (CPE) is monitored daily. Culture supernatant and cells are recovered when there is about 60-80% ECP. Aliquots of 200 μL are prepared and the material is frozen at -80 ^° C.

Example 2

Infection of BGM cells in cans

The virus strain used for infection is the same as in Example 1. BGM cells were cultured 2 days before viral infection at 1.8 June ¹⁰ to 2 × 10 ⁶ cells for a box ( T75 flask) and 0.6 × 10 ⁶ for a box (T25 flask) in the growth medium described below: IX EMEM with Earle's salts (CAMBREX ref. BE121-1235F) (500 mL) 1% Glutamine 200 Mm (CAMBREX ref .: BE17-605E) (100 mL) 1% non-essential amino acids 100X (CAMBREX)

2% of the Penicillin-Streptomycin mixture (CAMBREX ref .: DE17-602E) (10,000 U penicillin G, 10,000 g streptomycin) 7% inactivated fetal calf serum (CAMBREX ref .: DE14-081F) (500 ml), inactivated for 30 minutes. at 56 ° C.

The culture medium is removed from the box on the day of infection. The cells are washed in IX PBS. The viral stock is diluted in an infection medium (growth medium without FCS + 0.003% trypsin at 2.5%). 1 mL of infected medium is added to the Flask T25 box and a minimum of 3 mL to a Flask T25 box. Negative controls are prepared under the same conditions with uninfected medium. The dishes are incubated for 2 hours at 34 ^° C. under a 5% CO 2 atmosphere, with partial stirring. 4 mL of infection medium is added for Flask T25 and 10 mL for Flask T75. The dishes are incubated for 3 hours at 34 ^° C. under a 5% CO 2 atmosphere. The entire medium is removed and replaced with fresh medium. The dishes are incubated at 34 ° C. under a 5% CO 2 atmosphere. The appearance of cytopathic effects (CPE) is monitored daily. The viral stock from cells and / or culture supernatant is recovered when there is about 60-80% ECP. The cells are detached and the viral stock is frozen at -80 ^° C.

Example 3

Molecular characterization of the Sl segment

The double-stranded viral RNAs are extracted from the infected cells obtained according to Example 2 and are subjected to migration on Elchrom ™ gel (Eurogentec). The fragment corresponding to the Sl segment is recovered after electrophoretic migration on the gel and amplified by "random" RT-PCR under the following conditions: 1. Reverse transcription step using the Thermoscript ™ kit (Invitrogen) The mixture 1 comprises:

1 μL of "random" T7-N primer 10 μM TAATACGCATCACTATAGGG (N) 6 (SEQ ID NO: 22), 2 μL of dNTP (10 mM), 1.4 μL of DMSO and 3.6 μL of H ₂ O The mixture 2 comprises:

4 μL of 5X cDNA synthesis buffer, 1 μL of DTT (0.1M), 1 μL of "Recombinant Rnasin Ribonuclease Inhibitor" and 1 μL of reverse transcriptase Thermoscript RT (15 IU / μL)

5 μl of Sl RNA are added to the mixture 1. The mixture obtained is incubated for 5 min. at 97 ⁰ C then 5 min. on ice. 7 μL of mixture 2 are then added to the sample. The mixture obtained is incubated for 10 minutes. at 18 ° C, 50 min. at 50 ⁰ C, 5 min. at 85 ° C then the temperature went down to 4 ⁰ C to stop the reaction. 2. PCR amplification step using the Expand High Fidelity System ™ kit (Roche)

The amplification is carried out using the following pair of primers:

5 '-TAATACGCATCACTATAGGG (N) 6-3' T7-N sense primer, (SEQ ID NO: 22) 5'-TAATACGCATCACTATAGGG-S 'T7 antisense primer, Tm: 56 ° C (SEQ ID NO: 23)

The mixture comprises 5 μl of 1OX buffer containing MgCl ₂ (15 mM), 1 μl of a mixture of dNTPs (10 mM), 1 μl of T7-N (10 pmol), 1 μl of T7 (40 pmol), 1 μl of Taq High Fidelity polymerase (3.5 IU / μL), QSP 48 μL H ₂ O. 2 μL of cDNA obtained after reverse transcription are added to the above mixture and the mixture obtained is subjected to the following temperature cycles:

5 min. at 94 ° C, 10 min. at 18 ° C, 2 min. at 72 ° C 30 sec. at 94 ^° C., 1 min. at 55 ° C, 1 min. at 72 ° C. (40 cycles) 7 min. at 72 ° C and the temperature went down to 4 ⁰ C to stop the reaction. The product obtained is Sl cDNA which corresponds to about 80% of the total S1 segment. A new RT-PCR is therefore performed to obtain the sequence of S1 in its entirety as described below.

The total viral RNA is extracted from the infected cells obtained according to Example 2 and amplified under the following conditions: 3. Reverse transcription step using the Superscript III ™ -RNase H-reverse transcriptase kit (ref .: 18080) (Invitrogen) The following GSP2 specific antisense primer was synthesized 5'-ATCTTCGCAATCATTCCCGA-3 'Tm: 58 ° C (SEQ ID NO: 24) The mixture 1 comprises:

1 μL of GSP2 primer (10 pmol / μL), 1 μL of dNTP (10 Mm) and 7.6 μL of H ₂ O. Mixture 2 comprises:

4 μL of 5X cDNA synthesis buffer, 1 μL of DTT (0.1M), 1 μL of "Recombinant Rnasin Ribonuclease Inhibitor" and 1 μL of Superscript III reverse transcriptase.

2 μl of viral RNA are added to mixture 1, then 1.4 μl of DMSO. The mixture is incubated for 5 minutes. at 97 ⁰ C then 5 min. at 4 ^° C. 7 μl of mixture 2 are then added to the sample. The mixture obtained is incubated for 60 min. at 50 ⁰ C, 10 min. at 72 ° C then the temperature went back down to 4 ⁰ C to stop the reaction.

The cDNA obtained can be stored at -20 ^° C. 4. PCR amplification step using the Expand High kit

Fidelity System ™ (ref .: 1732650) (Roche)

The amplification is carried out using the following pair of primers:

5 '-TAATACGCATCACTATAGGG (N) 6-3' T7-N sense primer, (SEQ ID NO: 22) 5'-ATCTTCGCAATCATTCCCGA-3 'GSP2 antisense primer, Tm: 58 ° C

(SEQ ID NO: 24)

The mixture comprises 5 .mu.l of 1OX buffer containing MgCl ₂ (15 mM), 1 .mu.l of mixture of dNTPs (10 mM), 1 .mu.l of T7-N (10 pmol) TAATACGCATCACTATAGGG (N) 6, 1 μL of GSP2 primer (40 pmol), 1 μL of Taq High Fidelity polymerase (3.5 IU / μL), QSP 45 μL H ₂ O. 5 μL of cDNA obtained after reverse transcription are added to the above mixture and the resulting mixture is subjected to the following temperature cycles:

5 min. at 94 ° C, 10 min. at 18 ° C, 2 min. at 72 ° C for 30 sec at 94 ^° C., 1 min. at 55 ° C, 1 min. at 72 ° C. (40 cycles) 7 min. at 72 ° C and the temperature went down to 4 ⁰ C to stop the reaction.

The amplification product obtained, after cloning and sequencing, is a fragment of the S1 segment of 684 bp.

The complete Sl segment was characterized by RT-PCR.

A couple of specific primers has been synthesized.

5 '-CCGATGTCCGAACTTCAACA-3' sense primer (SEQ ID NO: 25)

5'-ATGAATTGCCGTCGTGCCG-S 'antisense primer (SEQ ID NO: 26)

The viral RNA is amplified under the following conditions: 1. Reverse transcription step using the Improp II ™ kit - reverse transcriptase (Promega)

The mixture 1 comprises:

1 μL of sense primer (10 pmol / μL), 1 μL of antisense primer (10 pmol / μL), 1 μL of dNTP (10 mM) and 2.2 μL of H ₂ O. Mixture 2 comprises :

4 μL of 5X cDNA synthesis buffer, 2.4 μL of MgCl ₂ , 1 μL of "Recombinant Rnasin Ribonuclease Inhibitor" and 1 μL of Improp II reverse transcriptase.

5 μl of viral RNA are added to mixture 1 and 1.4 μl of DMSO are added. The mixture obtained is incubated for 8 min. at 97 ⁰ C then 5 min. at 4 ° C. 8.4 μL of mixture 2 are then added to the sample. The mixture obtained is incubated for 5 min. at 25 ° C, 60 min. at 53 ° C, 10 min. at 72 ° C then the temperature went down to 4 ° C to stop the reaction. The cDNA obtained can be stored at -20 ^° C.

2. PCR amplification step using the Expand High kit

Fidelity System ™ (ref .: 1732650) (Roche)

The amplification is carried out using the pair of primers defined for the reverse transcription.

The mixture comprises 1 μL of sense primer (50 pmol / μL), 1 μL of antisense primer (50 pmol / μL), 5 μL of 1OX buffer containing

MgCl ₂ (15mM), 1 μL of dNTP mixture (10 mM), 1 μL of polymerase

Taq High Fidelity (3.5 IU / μL), QSP 45 μL H ₂ O. 5 μL of cDNA obtained after reverse transcription are added to the above mixture and the mixture obtained is subjected to the following temperature cycles:

4 min. at 95 ° C

30 sec at 95 ⁰ C, 30 sec. at 59 ° C, 2 min. at 72 ° C. (35 cycles) 10 min. at 72 ° C and the temperature went down to 4 ⁰ C to stop the reaction.

The band obtained on gel is of the expected size. After purification, cloning and sequencing, the 1423 bp amplification product corresponds to a segment Sl identified in the sequence listing in SEQ ID NO: 1.

Example 4

Molecular Characterization of the S2 Segment The nucleic acids are extracted from the infected cells and the culture supernatant obtained according to Example 1 or Example 2. The following specific primers were synthesized: 5'-CTATTCGCTGGTCAGTTATG-S 'sense primer (SEQ ID NO: 27) 5'-GATGAATGTGTGGTCAGTCG-S 'antisense primer (SEQ ID NO: 28) The viral RNA is amplified under the following conditions:

1. Reverse transcription step using the Superscript III ™ -Rnase H-reverse transcriptase kit (ref .: 18080) (Invitrogen) The mixture 1 comprises: 1 μL sense primer (10 pmol / μL), 1 μL antisense primer (10 pmol / μL), 1 μL dNTP (10 mM) and 5 μL H ₂ O. Mixture 2 comprises:

5 μl of viral RNA are added to the mixture 1. The mixture obtained is incubated for 5 min. at 97 ° C then 5 min. at 4 ° C. 7 μL of mixture 2 are then added to the sample. The mixture obtained is incubated for 60 min. at 50 ⁰ C, 10 min. at 72 ° C then the temperature went back down to 4 ⁰ C to stop the reaction.

The cDNA obtained can be stored at -20 ^° C.

2. PCR amplification step using the Expand High kit

Fidelity System ™ (ref .: 1732650) (Roche) Amplification is performed using the primer pair defined for reverse transcription.

The mixture comprises 1 μL of sense primer (50 pmol / μL), 1 μL of antisense primer (50 pmol / μL), 5 μL of 10X Tp with 15 mM of

MgCl ₂ , 1 μL of dNTP mixture (100 mM), 1 μL of Taq High Fidelity polymerase (3.5 IU / μL), QSP 45 μL H ₂ O.

5 μl of cDNA obtained after reverse transcription are added to the mixture above and the mixture obtained is subjected to the following temperature cycles:

4 min. at 95 ° C. for 30 sec at 94 ^° C., for 30 sec. at 56 ° C, 2 min. at 72 ° C. (30 cycles)

10 minutes. at 72 ° C and the temperature went down to 4 ⁰ C to stop the reaction.

The band obtained on gel is of the expected size. After purification, cloning and sequencing, the amplification product of 1330 bp corresponds to a segment S2 identified in the sequence listing in SEQ ID NO: 4.

Example 5 Molecular characterization of the S3 segment

The nucleic acids are extracted from the infected cells and the culture supernatant obtained according to Example 1 or Example 2. The following specific primers were synthesized: 5 '-TAAAGTCACGCCTGTTGTCG-3' sense primer (SEQ ID NO: 29)

5'-ACCACCAAGACATCGGCAC-3 'antisense primer (SEQ ID NO: 30) The viral RNA is amplified under the following conditions:

1. Reverse transcription step using the Superscript III ™ -RNase H-reverse transcriptase kit (ref .: 18080) (Invitrogen) The mixture 1 comprises:

1 μL sense primer (10 pmol / μL), 1 μL antisense primer (10 pmol / μL), 1 μL dNTP (10 mM) and 5 μL H ₂ O. Mixture 2 comprises:

5 μl of viral RNA are added to the mixture 1. The mixture obtained is incubated for 5 min. at 97 ° C then 5 min. at 4 ° C. 7 μL of mixture 2 are then added to the sample. The mixture obtained is incubated for 60 min. at 50 ⁰ C, 10 min. at 72 ° C then the temperature went back down to 4 ⁰ C to stop the reaction. The cDNA obtained can be stored at -20 ^° C.

2. PCR amplification step using the Expand High Fidelity System ™ kit (ref .: 1732650) (Roche) The amplification is carried out using the pair of primers defined for reverse transcription.

The mixture comprises 1 μL sense primer (50 pmol / μL), 1 μL antisense primer (50 pmol / μL), 5 μL of 1OX buffer containing MgCl ₂ (15 mM), 1 μL of dNTP (10 mM), 1 μL of Taq High Fidelity polymerase (3.5 IU / μL), QSP 45 μL H ₂ O.

5 μl of cDNA obtained after reverse transcription are added to the mixture above and the mixture obtained is subjected to the following temperature cycles: 4 min. at 95 ° C 30 sec at 95 ^° C., 30 sec. at 56 ° C, 2 min. at 72 ° C. (30 cycles) 10 min. at 72 ° C and the temperature went down to 4 ⁰ C to stop the reaction. The band obtained on gel is of the expected size. After purification, cloning and sequencing, the 1178 bp amplification product corresponds to an S3 segment identified in the sequence listing in SEQ ID NO: 6.

Example 6

Molecular characterization of the S4 segment

The nucleic acids are extracted from the infected cells and the culture supernatant obtained according to Example 1 or Example 2. The following specific primers were synthesized: 5'-GTTGTCGCAATGGAGGTGTG-S 'sense primer (SEQ ID NO: 31)

5 '- TCCCACGTCACACCAGGTT-3' antisense primer (SEQ ID NO: 32) The viral RNA is amplified under the following conditions:

2. PCR amplification step using the Expand High Fidelity System ™ kit (ref .: 1732650) (Roche) The amplification is carried out using the pair of primers defined for the reverse transcription.

5 μl of cDNA obtained after reverse transcription are added to the mixture above and the mixture obtained is subjected to the following temperature cycles: 4 min. at 95 ° C

30 sec. at 95 ° C, 30 sec. at * 65 ° C, 1 min. at 72 ° C (7 cycles)

30 sec at 95 ^° C., 30 sec at 58 ° C., 1 min. at 72 ° C. (23 cycles)

* means that the temperature decreases by 1 ° C each cycle.

The band obtained on gel is of the expected size. After purification, cloning and sequencing, the amplification product of 1158 bp corresponds to an S4 segment identified in the sequence listing in SEQ ID NO: 8.

Example 7

Molecular characterization of the Ll segment

The nucleic acids are extracted from the infected cells and the culture supernatant obtained according to Example 1 or Example 2. The following specific primers were synthesized: 5'-GCTACACGTTCCACGACAAT-3 'sense primer (SEQ ID NO: 33)

5 '-TGAGTTGACGCACCACGACCCA-S' antisense primer (SEQ ID NO: 34) The viral RNA is amplified under the following conditions: 1. Reverse transcription step using the Superscript III ™ -RNase H-reverse transcriptase kit (ref. : 18080) (Invitrogen) The mixture 1 comprises:

1 μL sense primer (10 pmol / μL), 1 μL antisense primer (10 pmol / μL), 1 μL dNTP (10 mM) and 5 μL H ₂ O.

Mixture 2 comprises: 4 μL of 5X cDNA synthesis buffer, 1 μL of DTT (0.1M), 1 μL of "Recombinant Rnasin Ribonuclease Inhibitor" and 1 μL of Superscript III reverse transcriptase.

5 .mu.l of viral RNA are added to the mixture 1. The mixture obtained is incubated for 8 min. at 97 ° C then 5 min. at 4 ° C. 7 μL of mixture 2 are then added to the sample. The mixture obtained is incubated for 60 min. at 50 ⁰ C, 10 min. at 72 ° C then the temperature went back down to 4 ⁰ C to stop the reaction.

The cDNA obtained can be stored at -20 ^° C.

2. PCR amplification step using the Expand High Fidelity System ™ kit (ref .: 1732650) (Roche)

The mixture comprises 1 μL of sense primer (50 pmol / μL), 1 μL of antisense primer (50 pmol / μL), 5 μL of 10X buffer containing MgCl ₂ (15 mM), 1 μL of a mixture of dNTP (10 mM), 1 μL of Taq High Fidelity polymerase (3.5 IU / μL), QSP 45 μL H ₂ O.

30 sec. at 95 ° C, 60 sec. at 59 ° C, 4 min. at 68 ° C (30 cycles)

10 minutes. at 68 ° C and the temperature went back down to 4 ⁰ C to stop the reaction.

The band obtained on gel is of the expected size. After purification, cloning and sequencing, the 3852 bp amplification product corresponds to an L1 segment identified in the sequence listing in SEQ ID NO: 10. Example 8

Molecular characterization of the L2 segment

The nucleic acids are extracted from the infected cells and the culture supernatant obtained according to Example 1 or Example 2. The following specific primers were synthesized: 5 '-ATGGCGAACGTTTGGGGAGT-3' sense primer (SEQ ID NO: 35) -GATGAATTAGGCACGCTCACG-S 'antisense primer (SEQ ID NO: 36) The viral RNA is amplified under the following conditions: 1. Reverse transcription step using the Superscript III ™ -RNase H-reverse transcriptase kit (ref .: 18080) (Invitrogen) The mixture 1 comprises:

5 .mu.l of viral RNA are added to the mixture 1. The mixture obtained is incubated for 8 min. at 97 ⁰ C then 5 min. at 4 ^° C. 7 μl of mixture 2 are then added to the sample. The mixture obtained is incubated for 60 min. at 50 ⁰ C, 10 min. at 72 ° C then the temperature went back down to 4 ⁰ C to stop the reaction.

The cDNA obtained can be stored at -20 ^° C. 2. PCR amplification step using the Expand High kit

Fidelity System ™ (ref .: 1732650) (Roche)

MgCl ₂ (15 mM), 1 μL of dNTP mixture (10 mM), 1 μL of Taq High Fidelity polymerase (3.5 IU / μL), QSP 45 μL H ₂ O. 5 μl of cDNA obtained after reverse transcription are added to the mixture above and the mixture obtained is subjected to the following temperature cycles: 4 min. at 95 ° C 30 sec. at 95 ° C, 30 sec. at 58 ° C, 4 min. at 68 ° C (30 cycles) 10 min. at 68 ° C and the temperature went back down to 4 ⁰ C to stop the reaction.

The band obtained on gel is of the expected size. After purification, cloning and sequencing, the 3903 bp amplification product corresponds to an L2 segment identified in the sequence listing in SEQ ID NO: 12.

Example 9

Molecular characterization of the L3 segment

The nucleic acids are extracted from the infected cells and the culture supernatant obtained according to Example 1 or Example 2. The following specific primers were synthesized: 5'-TAATCGTCAGGATGAAGCGGA-S 'sense primer (SEQ ID NO: 37)

5 '- TGAATCGGCCCAACTAGCAT-3' antisense primer (SEQ ID NO: 38) The viral RNA is amplified under the following conditions: 1. Reverse transcription step using the Superscript III ™ -RNase H-reverse transcriptase kit (ref. : 18080) (Invitrogen) The mixture 1 comprises:

The mixture 2 comprises:

1 μl of viral RNA is added to the mixture 1. The mixture obtained is incubated for 8 min. at 97 ⁰ C then 5 min. at 4 ^° C. 7 μl of mixture 2 are then added to the sample. The resulting mixture is incubated 60 min. at 50 ⁰ C, 10 min. at 72 ° C then the temperature went back down to 4 ⁰ C to stop the reaction.

The cDNA obtained can be stored at -20 ^° C.

30 sec. at 95 ° C, 30 sec. at 59 ° C, 4 min. at 68 ° C (30 cycles)

The band obtained on gel is of the expected size. After purification, cloning and sequencing, the 3897 bp amplification product corresponds to an L3 segment identified in the sequence listing in SEQ ID NO: 14.

Example 10 Molecular Characterization of the Ml Segment

The nucleic acids are extracted from the infected cells and the culture supernatant obtained according to Example 1 or Example 2. The following specific primers were synthesized: 5 '-ATGGCTTACATCGCAGTTCCT-S' sense primer (SEQ ID NO: 39) 5 '- CGTAGTCTTAGCCCGCCCC-3' antisense primer (SEQ ID NO: 40) The viral RNA is amplified under the following conditions:

5 μl of viral RNA is added to the mixture 1. The mixture obtained is incubated for 5 min. at 97 ⁰ C then 5 min. at 4 ^° C. 7 μl of mixture 2 are then added to the sample. The mixture obtained is incubated for 60 min. at 50 ⁰ C, 10 min. at 72 ° C then the temperature went back down to 4 ⁰ C to stop the reaction. The cDNA obtained can be stored at -20 ^° C.

The mixture comprises 1 μL of sense primer (50 pmol / μL), 1 μL of antisense primer (50 pmol / μL), 5 μL of 10X buffer containing

MgCl ₂ (15 mM), 1 μL of dNTP mixture (10 mM), 1 μL of Taq High Fidelity polymerase (3.5 IU / μL), QSP 45 μL H ₂ O.

4 min. at 95 ° C 30 sec. at 95 ° C, 30 sec. at 58 ° C, 2 min. at 72 ° C (30 cycles)

10 minutes. at 72 ° C and the temperature went down to 4 ⁰ C to stop the reaction. The band obtained on gel is of the expected size. After purification, cloning and sequencing, the 2278 bp amplification product corresponds to an M1 segment identified in the sequence listing in SEQ ID NO: 16.

Example 11

Molecular characterization of the M2 segment

The nucleic acids are extracted from the infected cells and the culture supernatant obtained according to Example 1 or Example 2. The following specific primers were synthesized: 5'-TAATCTGCTGACCGTCACTC-3 'sense primer (SEQ ID NO: 41) '- GTGCCTGCATCCCTTAACC-3' antisense primer (SEQ ID NO: 42) The viral RNA is amplified under the following conditions:

1. Reverse transcription step using the Superscript III ™ -RNase H-reverse transcriptase kit (ref .: 18080) (Invitrogen)

The mixture 1 comprises:

5 μl of viral RNA is added to the mixture 1. The mixture obtained is incubated for 5 min. at 97 ⁰ C then 5 min. at 4 ^° C. 7 μl of mixture 2 are then added to the sample. The mixture obtained is incubated for 60 min. at 50 ⁰ C, 10 min. at 72 ° C then the temperature went back down to 4 ⁰ C to stop the reaction.

The cDNA obtained can be stored at -20 ^° C.

The mixture comprises 1 μL of sense primer (50 pmol / μL), 1 μL of antisense primer (50 pmol / μL), 5 μL of 1OX buffer containing MgCl ₂ (15 IΓLM), 1 μL of dNTP mixture (10 mM), 1 μL of Taq High Fidelity polymerase (3.5 IU / μL), QSP 45 μL H ₂ O. 5 μL of cDNA obtained after reverse transcription are added to the above mixture and the resulting mixture is subjected to the following temperature cycles: 4 min. at 95 ° C

30 sec. at 95 ° C, 30 sec. at 58 ° C, 2 min. at 72 ° C (30 cycles) 10 min. at 72 ° C and the temperature went down to 4 ⁰ C to stop the reaction.

The band obtained on gel is of the expected size. After purification, cloning and sequencing, the amplification product of 2195 bp corresponds to an M2 segment identified in the sequence listing in SEQ ID NO: 18.

Example 12

Molecular characterization of the M3 segment The nucleic acids are extracted from the infected cells and the culture supernatant obtained according to Example 1 or Example 2. The following specific primers were synthesized: 5'-CGTGGTCATGGCTTCATTC-S 'sense primer (SEQ ID NO: 43) 5 '-GATGAATAGGGGTCGGGAA-3' antisense primer (SEQ ID NO: 44) The viral RNA is amplified under the following conditions:

1. Reverse transcription step using the Superscript III ™ -RNase H-reverse transcriptase kit (ref .: 18080) (Invitrogen) The mixture 1 comprises: 1 μL sense primer (10 pmol / μL), 1 μL primer antisense (10 pmol / μL), 1 μL of dNTP (10 mM) and 5 μL of H ₂ O. The mixture 2 comprises:

4 μL of 5X cDNA synthesis buffer, 1 μL of DTT (0.1M), 1 μL of "Recombinant Rnasin Ribonuclease Inhibitor" and 1 μL of Superscript III reverse transcriptase. 5 .mu.l of viral RNA is added to the mixture 1. The mixture obtained is incubated for 8 min. at 97 ⁰ C then 5 min. at 4 ^° C. 7 μl of mixture 2 are then added to the sample. The mixture obtained is incubated for 60 min. at 50 ⁰ C, 10 min. at 72 ° C then the temperature went back down to 4 ⁰ C to stop the reaction. The cDNA obtained can be stored at -20 ^° C.

The mixture comprises 1 μL of sense primer (50 pmol / μL), 1 μL of antisense primer (50 pmol / μL), 5 μL of 10X buffer containing MgCl ₂ (15 mM), 1 μL of mixture of dNTP (10 mM), 1 μl of Taq High Fidelity polymerase (3.5 IU / μl), QSP 45 μl H ₂ O. 5 μl of cDNA obtained after reverse transcription are added to the above mixture and the mixture obtained is subjected to the following temperature cycles: 4 min. at 95 ° C 30 sec. at 95 ° C, 30 sec. at 57 ° C, 2 min. at 72 ° C (30 cycles) 10 min. at 72 ° C and the temperature went down to 4 ⁰ C to stop the reaction.

The band obtained on gel is of the expected size. After purification, cloning and sequencing, the 2230 bp amplification product corresponds to an M3 segment identified in the sequence listing in SEQ ID NO: 20.

Example 13

Analysis of the different segments

After sequencing of the 10 segments, a query is performed on blastn (NCBI) in order to determine for each segment the percentage of nucleotide identity with the nearest reovirus strain (for each serotype).

The results are shown in Table 2 below:

Table 2

Identity (%) of the nucleotide sequences determined for each segment of the reovirus of the invention studied in comparison with the reoviruses serotype 1, serotype 2, serotype 3 and reovirus SC-A isolated from the pig.

In the absence of precision, all reoviruses are human reoviruses. Isolate SC-A: accession number DQ911244 The Sl segment codes for the σ1 protein that determines the serotype. As shown in Table 2, Sl has 82% identity with two human strains of serotype 2 (isolate 302II accession number EU049604 and accession number 3021 accession number EU049603), isolated from faecal samples of two children in Beijing in 1982 The S3 segment has an identity percentage of 98% with the T1N84 and T2N73 human strains. The other segments, with the exception of the M1 segment, which has almost identical identity% with the human and pork strains, are much closer to SC-A pig reovirus isolated from pig stool in China than human reoviruses. .

It is therefore a reovirus that has been reassorted between a porcine strain and a human strain. Phylogenetic analysis confirmed that the reovirus strain isolated from viral strains belongs to serotype 2. The phylogenetic tree is shown in FIG.

Example 14

Detection of the virus in patient samples

A detection test based on the L3 segment coding for a helicase has been implemented. This test comprises a reverse transcription step, a PCR amplification step and a semi-nested PCR step.

The test was performed on nucleic acids (i) extracted from the boy's urine, (ii) extracted from the girl's urine and (iii) extracted from the boy's serum taken 21 days after the onset of symptoms, with the following conditions.

The following specific primers have been synthesized:

5 '- CAGGATGAAGCGGATTCCAA-3' sense primer L3-1 (SEQ ID NO: 45)

5'-GGATGATTCTGCCATGAGCT-S 'L3-2 antisense primer (SEQ ID NO:

46) 1. Reverse transcription step using the Improp II Reverse trancripstase kit (Promega) The mixture 1 comprises:

1 μL sense primer L3-1 (10 pmol / μL), 1 μL L3-2 antisense primer (10 pmol / μL) and 1 μL dNTP (10 mM). The mixture 2 comprises:

4 μL of 5X cDNA synthesis buffer, 2.4 μL of MgCl ₂ (25 mM), 1 μL of "Recombinant Rnasin Ribonuclease Inhibitor" and 1 μL of Improp II reverse transcriptase. 7.2 μl of RNA are added to mixture 1, then 1.4 μl of DMSO. The mixture obtained is incubated for 5 min. at 97 ° C then 5 min. at 4 ° C. 8.4 μL of mixture 2 are then added to the sample. The mixture obtained is incubated for 5 min. at 25 ° C, 60 min. at 53 ° C, 10 min. at 72 ° C then the temperature went down to 4 ° C to stop the reaction. The cDNA obtained can be stored at -20 ^° C.

The mixture comprises 1 μL of L3-1 sense primer (50 pmol / μL), 1 μL of L3-2 antisense primer (50 pmol / μL), 5 μL of 1OX buffer containing MgCl ₂ (15 mM). , 1 μL of dNTP mixture (10 mM), 1 μL of Taq High Fidelity polymerase (3.5 IU / μL), QSP 45 μL H ₂ O. 5 μL of cDNA obtained after reverse transcription are added to the above mixture. above and the resulting mixture is subjected to the following temperature cycles:

4 min. at 95 ° C

30 sec. at 95 ° C, 30 sec. at 58 ° C, 1 min. at 72 ° C (30 cycles) 10 min. at 72 ° C and the temperature went down to 4 ⁰ C to stop the reaction.

The amplification product is a 696 bp fragment. as shown in Figure 2A.

3. Semi-nested PCR using the Expand High Fidelity System ™ kit (ref .: 1732650) (Roche) based on the L3 segment.

The following primers are used. 5 '-CAGGATGAAGCGGATTCCAA-3' sense primer L3-1 (SEQ ID NO: 45)

5'-CCAACACGCGCAGGATGTTT-3 'antisense primer (SEQ ID NO: 47) the following mixture was prepared:

1 μL sense primer L3-1 (50 pmol / μL), 1 μL antisense primer

L3-5 (50 pmol / μL), 5 μL of 1OX buffer containing MgCl ₂ (15 mM), 1 μL of dNTP mixture (10 mM), 1 μL of Taq High polymerase

Fidelity (3.5 IU / μL), QSP 45 μL H ₂ O.

5 μl of the PCR product obtained in the preceding step 2 are added to the above mixture and the mixture obtained is subjected to the following temperature cycles: 4 min. at 95 ° C

30 sec. at 95 ° C, 30 sec. at 59 ° C, 1 min. at 72 ° C (35 cycles) 10 min. at 72 ° C and the temperature went down to 4 ⁰ C to stop the reaction.

The amplification product obtained is a fragment of 512 bp. as shown in Figure 2B.

The virus is detected in the urine of the girl, in the urine of the boy and in the serum of the boy collected 21 days after the first symptoms.

Example 15 Serological Analysis

The serological analysis is carried out by Western Blot with a cell lysate infected with the reovirus strain isolated from the urine of the children. Uninfected cell lysate was used as a negative control. A positive control is performed with three goose sera each directed against reovirus serotype 1 (Hall S729), reovirus serotype 2 (Jones) and reovirus serotype 3 (Abney). These sera are usually used in haemagglutination inhibition tests to determine the serotype.

Three bands were observed for the anti-reovirus type 1 serum and two bands for the type 2 anti-reovirus sera. A band of molecular weight between 37 and 50kDa is observed only for the anti-reovirus type 1 serum. may be one of the proteins encoded by the S segments. In fact, the segment S1 codes for a σ1 protein of size 49 kDa, the segment S2 for a protein σ2 of size 47 kDa and the segments S3 and S4 encode for two proteins σNS and σ3 respectively of equal size (41 kDa). Two bands of molecular weight between 75 kDa and 100 kDa are observed with the anti-reovirus type 1 and 2 sera.

(Figure 3). They can correspond to either μlc protein

(76 kDa) encoded by the M2 segment, either to the μ2 protein (83 kDa) encoded by the M1 segment or to the μNS protein (80 kDa) encoded by the M3 segment, or to the three proteins encoded by the three M segments.

The serum of the daughter was taken at different times after the onset of symptoms (D + 6, D + 13, D + 19) and a search for anti-reovirus IgG antibody was performed by Western Blot using a revelation. goat anti-human IgG with peroxidase.

The 3 sera of the daughter and a control serum provided by the French blood establishment (EFS) were diluted to 1 / 100th and put in contact for 1 hour.

The results are shown in Figure 4 where a band of approximately 150 kDa is observed only in the infected cells in contact with the sera of the diseased daughter. The signal is retained even after strong dilutions. No signal is observed in the case of a negative human serum.

The 150 kDa band can correspond either to the λ3 protein of the L1 segment (142 kDa), to the λ2 protein of the L2 segment (145 kDa) or to the λ1 protein of the L3 segment (143 kDa) or to the three proteins encoded by the three larger segments. It is interesting to note that the intensity of the band increases at 15 days and 21 days after the onset of symptoms, suggesting an increase in the amount of anti-reovirus antibodies over time.

For the boy and the mother, the results are less significant than those obtained for the girl. The sera of the mother (J + J + 7 and 13) and the boy (J + + J 6 and 20) were diluted to l / ^100th and contacted for 4 hours time.

A band at about 150 kDa is observed only in the infected cells in contact with the sera of the mother and the boy, but the intensity of the band is lower than that obtained with the sera of the girl. The results are summarized in Table 3 below

Table 3

ND: not available J: day

38 sera from persons controls (blood donors) provided by EFS Lyon were diluted to l / ^100th and the presence of anti-reovirus antibodies was investigated. The protocol is the same as that used for antibody research in patients in the study.

No directed reaction against the reovirus strain, isolated from the study patients, was observed.

The prevalence of antibodies against prototype strains of reovirus in these 38 blood donors was studied. BGM cells were infected with type 1 Lang, type 2 Jones and type 3 Dearing (ATCC) strains. Serological analysis was performed by Western Blot with an infected cell lysate using these different prototype strains. Uninfected cell lysate was used as a negative control.

Approximately 53% of the population tested has antibodies specifically against the Lang strain, the Jones strain and / or the Dearing strain (Table 4), whereas no reaction specific was observed against the isolated reovirus of the patients in the study, indicating that its prevalence is much lower.

Table 4

Claims

An isolated mammalian reovirus, characterized in that its genome comprises at least

(i) a nucleotide sequence chosen from SEQ ID NO: 1, a sequence which has at least 83% identity with SEQ ID NO:

1, a sequence which codes for two proteins whose peptide sequences are identified in SEQ ID NO: 2 and SEQ ID NO: 3, a sequence which codes for two proteins whose peptide sequences have at least 90% identity with SEQ ID NO:

2 and SEQ ID NO: 3, or

2. Reovirus according to claim 1, characterized in that its genome comprises:

(i) a nucleotide sequence chosen from SEQ ID NO: 4, a sequence which has at least 80% identity with SEQ ID NO: 4, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 5, a nucleotide sequence selected from SEQ ID NO: 6, a sequence which has at least 85% identity with SEQ ID NO: 6, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 7 a nucleotide sequence selected from SEQ ID NO: 8, a sequence which has at least 83% identity with SEQ ID NO: 8, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 9, a nucleotide sequence selected from SEQ ID NO: 10, a sequence which has at least 90% identity with SEQ ID NO: 10, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 11, a nucleotide sequence chosen from SEQ ID NO: 12, a sequence that has at least 86% identity with SEQ ID NO: 12, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 13, a nucleotide sequence chosen from SEQ ID NO: 14, a sequence which has at least 81% identity with SEQ ID NO: 14 , a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 15, a nucleotide sequence chosen from SEQ ID NO: 16, a sequence which has at least 89% identity with SEQ ID NO:

16, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 17, a nucleotide sequence chosen from SEQ ID NO: 18, a sequence which has at least 85% identity with SEQ ID NO:

18, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 19, and a nucleotide sequence selected from SEQ ID NO: 20, a sequence which has at least 83% identity with SEQ ID NO:

20, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 21, or

3. Reovirus according to claim 1, characterized in that its genome comprises:

(i) a nucleotide sequence selected from SEQ ID NO: 4, a sequence which has at least 89% identity with SEQ ID NO:

4, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 5, a nucleotide sequence chosen from SEQ ID NO: 6, a sequence which has at least 99% identity with SEQ ID NO: 6 , a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 7, a nucleotide sequence chosen from SEQ ID NO: 8, a sequence which has at least 97% identity with SEQ ID NO: 8, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 9, a nucleotide sequence chosen from SEQ ID NO: 10, a sequence which has at least 98% identity with SEQ ID NO: 10 , a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 11, a nucleotide sequence chosen from SEQ ID NO: 12, a sequence which has at least 98% identity with SEQ ID NO:

12, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 13, a nucleotide sequence chosen from SEQ ID NO: 14, a sequence which has at least 98% identity with SEQ ID NO:

14, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 15, a nucleotide sequence chosen from SEQ ID NO: 16, a sequence which has at least 93% identity with SEQ ID NO:

16, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 17, a nucleotide sequence chosen from SEQ ID NO: 18, a sequence which has at least 98% identity with SEQ ID NO:

18, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 19, and a nucleotide sequence selected from SEQ ID NO: 20, a sequence which has at least 98% identity with SEQ ID NO: 20, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 21, or

4. Reovirus, characterized in that its genome consists of:

(i) a nucleotide sequence chosen from SEQ ID NO: 1, a sequence which has at least 83% identity with SEQ ID NO: 1, a sequence which codes for two proteins whose peptide sequences are identified in SEQ ID NO: 2 and SEQ ID NO: 3, a sequence which codes for two proteins whose peptide sequences have at least 90% identity with SEQ ID NO: 2 and SEQ ID NO: 3, a nucleotide sequence chosen from SEQ ID NO: 4, a sequence which has at least 80 % identity with SEQ ID NO: 4, a sequence that has at least 89% identity with SEQ ID NO: 4, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 5, a nucleotide sequence chosen from SEQ ID NO: 6, a sequence which has at least 85% identity with SEQ ID NO: 6, a sequence which has at least 99% identity with SEQ ID NO: 6, a sequence which codes for a protein whose peptide sequence is identified in SEQ ID NO: 7, a nucleotide sequence chosen from SEQ ID NO: 8, a sequence which has at least 83% identity with SEQ ID NO: 8, a sequence which exhibits less than 97% identity with SEQ ID NO: 8, a sequence that codes for a protein whose peptide sequence is identified in SEQ ID NO: 9, a nucleotide sequence chosen from SEQ ID NO: 10, a sequence which has at least 90% identity with SEQ ID NO: 10, a sequence which has at least 98% identity with SEQ ID NO: 10, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 11, a nucleotide sequence chosen from SEQ ID NO: 12, a sequence which exhibits at least 86 % identity with SEQ ID NO: 12, a sequence that has at least 98% identity with SEQ ID NO: 12, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 13, a nucleotide sequence chosen from SEQ ID NO: 14, a sequence which has at least 81% identity with SEQ ID NO: 14, a sequence which has at least 98% identity with SEQ ID NO: 14, a sequence which codes for a protein whose peptide sequence is identified by SEQ ID NO: 15, a nucleotide sequence chosen from SEQ ID NO: 16, a sequence which has at least 89% identity with SEQ ID NO: 16, a sequence which has at least 89% identity with SEQ ID NO: 93%, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 17, a nucleotide sequence selected from SEQ ID NO: 18, a sequence which has at least 85% identity with SEQ ID NO: 18, a sequence which has at least 98% identity with SEQ ID NO: 18, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 19, and a nucleotide sequence selected from SEQ ID NO: 20, a sequence which has at least 83% identity with SEQ ID NO: 20, a sequence that has at least 98% identity with SEQ ID NO: 20, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO. : 21, or

5. A nucleic acid molecule characterized in that it comprises or consists of a nucleotide sequence chosen from:

And SEQ ID NO: 3, a nucleotide sequence selected from SEQ ID NO: 4, a sequence which has at least 89% identity with SEQ ID NO:

4, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 5, a nucleotide sequence chosen from SEQ ID NO: 6, a sequence which has at least 99% identity with SEQ ID NO: 6, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 7, a nucleotide sequence chosen from SEQ ID NO: 8, a sequence which has at least 97% identity with SEQ ID NO: 8 , a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 9, a nucleotide sequence chosen from SEQ ID NO: 10, a sequence which has at least 98% identity with SEQ ID NO:

10, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 11, a nucleotide sequence chosen from SEQ ID NO: 12, a sequence which has at least 98% identity with SEQ ID NO:

16, a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 17, a nucleotide sequence chosen from SEQ ID NO: 18, a sequence which has at least 98% identity with SEQ ID NO: 18 , a sequence which encodes a protein whose peptide sequence is identified in SEQ ID NO: 19, a nucleotide sequence chosen from SEQ ID NO: 20, a sequence which has at least 98% identity with SEQ ID NO:

20, a sequence that encodes a protein whose peptide sequence is identified in SEQ ID NO: 21, and

6. Protein characterized in that it comprises or consists of a peptide sequence chosen from SEQ ID NOs: 2, 3, 5, 7,

9, 11, 13, 15, 17, 19, 21 and a sequence which has at least 90% identity with SEQ ID NO: 2 or SEQ ID NO: 3.

7. Protein characterized in that it comprises or consists of a peptide sequence encoded by a nucleotide sequence chosen from SEQ ID NO: 1 or by a sequence which has at least 83% identity with SEQ ID NO: 1, a sequence encoded by SEQ ID NO: 4 or by a sequence that has at least 89% identity with SEQ ID NO: 4, a sequence encoded by SEQ ID NO: 6 or a sequence that has at least 99% identity with SEQ ID NO: 6, a sequence encoded by SEQ ID NO: 8 or by a sequence which has at least 97% identity with SEQ ID NO: 8, a sequence encoded by SEQ ID NO: 10 or a sequence which presents at least 98% identity with SEQ ID NO:

10, a sequence encoded by SEQ ID NO: 12 or a sequence that has at least 98% identity with SEQ ID NO: 12, a sequence encoded by SEQ ID NO: 14 or a sequence that has at least 98% identity with SEQ ID NO: 14, a sequence encoded by SEQ ID NO: 16 or by a sequence that has at least 93% identity with SEQ ID NO: 16, a sequence encoded by SEQ ID NO: 18 or by a sequence that has at least 98% identity, with SEQ ID NO: 18, a sequence encoded by SEQ ID NO: 20 or a sequence that has at least 98% identity with SEQ ID NO: 20.

8. Pair of primers for amplifying a reovirus as defined in any one of claims 1 to 3, in a sample, characterized in that at least one of the primers has a nucleotide sequence which consists of a sequence of 18 to Contiguous nucleotides capable of hybridizing to a nucleotide sequence selected from SEQ ID NOs: 1, a sequence having at least 83% identity with SEQ ID NO: 1, SEQ ID NO: 4, a sequence that has at least 89% identity with SEQ ID NO: 4, SEQ ID NO: 6, a sequence that has at least 99% identity with SEQ ID NO: 6, SEQ ID NO: 8, a sequence that has at least 97% identity with SEQ ID NO: 8, SEQ ID NO: 10, a sequence that has at least 98% identity with SEQ ID NO: 10, SEQ ID NO: 12, a sequence which has at least 98% identity with SEQ ID NO: 12, SEQ ID NO: 14, a sequence that has at least 98% identity with SEQ ID NO: 14, SEQ ID NO: 16, a sequence that exhibits at least 93% identity with SEQ ID NO: 16, SEQ ID NO: 18, a sequence that has at least 98% identity with SEQ ID NO: 18, SEQ ID NO: 20 and a sequence that has at least 98% identity with SEQ ID NO: 20.

9. Pair of primers according to claim 8, characterized in that it is chosen from at least one of the following pairs of primers:

SEQ ID NO: 22 and SEQ ID NO: 23

SEQ ID NO: 22 and SEQ ID NO: 24 SEQ ID NO: 25 and SEQ ID NO: 26,

SEQ ID NO: 27 and SEQ ID NO: 28,

SEQ ID NO: 29 and SEQ ID NO: 30,

SEQ ID NO: 31 and SEQ ID NO: 32,

SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36,

SEQ ID NO: 39 and SEQ ID NO: 40,

SEQ ID NO: 41 and SEQ ID NO: 42,

SEQ ID NO: 43 and SEQ ID NO: 44,

SEQ ID NO: 45 and SEQ ID NO: 46, and SEQ ID NO: 45 and SEQ ID NO: 47.

A method for detecting the presence of a strain of a reovirus, as defined in any one of Claims 1 to 4, in a sample, comprising the steps of:

(a) extracting the nucleic acids from the sample,

(b) amplifying at least one of said extracted nucleic acids, and (c) determining the presence of specific nucleic acid sequence (s) of said reovirus, wherein the amplification step is performed by RT-PCR in using at least one pair of primers as defined in claim 8 or 9.

Kit for amplifying and / or detecting a reovirus, as defined in any one of Claims 1 to 4, in a sample, characterized in that it comprises at least one pair of primers as defined in the claim 8 or 9.

12. A method for detecting the presence of a reovirus, as defined in any one of claims 1 to 4, in a sample, characterized in that it comprises the steps of:

(a) contacting said sample with at least one protein as defined in claim 6 or 7, and

(b) demonstrating the presence of at least one protein / antibody complex.

13. Kit for detecting the presence of a strain of reovirus, as defined in any one of claims 1 to 4, in a sample, characterized in that it comprises at least one protein as defined in claim 6 or 7.