WO2010064762A1 - 마이크로ｒｎａ를 유효성분으로 포함하는 항암제 및 그 제조방법 - Google Patents

마이크로ｒｎａ를 유효성분으로 포함하는 항암제 및 그 제조방법 Download PDF

Info

Publication number
WO2010064762A1
WO2010064762A1 PCT/KR2009/000414 KR2009000414W WO2010064762A1 WO 2010064762 A1 WO2010064762 A1 WO 2010064762A1 KR 2009000414 W KR2009000414 W KR 2009000414W WO 2010064762 A1 WO2010064762 A1 WO 2010064762A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
cancer
tumor
seq
anticancer agent
Prior art date
Application number
PCT/KR2009/000414
Other languages
English (en)
French (fr)
Inventor
김빛내리
이정현
박성연
Original Assignee
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교 산학협력단 filed Critical 서울대학교 산학협력단
Publication of WO2010064762A1 publication Critical patent/WO2010064762A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • the present invention relates to an anticancer agent, an anticancer composition, and a method for producing the same, comprising a microRNA (microRNA: hereinafter called “miRNA”) as an active ingredient.
  • microRNA microRNA: hereinafter called “miRNA”
  • the present invention further relates to the use of microRNAs for the manufacture of anticancer agents or anticancer compositions and to the use in the treatment of cancer.
  • Small RNA refers to ribonucleic acid having a length of about 17 to 25 nucleotides (hereinafter referred to as “nt”) that plays a role in regulating gene expression in vivo.
  • sRNAs are largely classified into microRNAs (hereinafter referred to as “miRNA”) and small interfering RNAs (hereinafter referred to as “siRNA”) depending on the manner in which they are generated. miRNAs are partially produced from double-stranded hairpin RNAs, and siRNAs are derived from long double stranded RNAs (hereinafter referred to as “dsRNAs”).
  • the sRNA is miRNA, and the sRNA used to experimentally regulate the expression of a specific gene is classified as siRNA.
  • miRNAs are 19-25 nt long single stranded RNA (hereinafter referred to as 'ssRNA') molecules and are endogenous hairpin-shaped transcripts (Bartel, DP, Cell 116: 281-). 297, 2004; Kim, VN, Mol. Cells.
  • miRNAs complementarily bind to the 3 'untranslated regions (UTRs) of the target mRNA and post-transcriptional gene suppressors (post acts as a transcriptional gene suppressor and suppresses target genes by inducing translation inhibition and mRNA destabilization miRNAs play an important role in a variety of processes, such as development, differentiation, proliferation, apoptosis and metabolism These processes are sometimes disturbed during tumorigenicity, and given that many miRNAs remain low in human cancer, miRNAs appear to play a role in tumorigenicity. New research from Yarrow has emerged (Esquela-kerscher, A. and Slack , FJ, Nat Rev. Cancer 6 (4):..
  • the expression of miRNA is dramatically changing the process development and cell differentiation
  • the miRNA Profiling has shown reliable results in the developmental lineage and disease stages (Lu, J. et al., Nature 435: 834-838, 2005.)
  • the molecule also has been analyzed through previous analysis of regulatory networks for miRNA function. How they are produced and regulated (Kim, VN Nat. Rev. Mol. Cell. Biol. 6: 376-385, 2005).
  • miRNA biosynthesis is initiated via transcription by RNA polymerase II (Cai. X., et al., RNA 10: 1957-1966, 2004; Kim, V.N. Nat. Rev. Mol. Cell. Biol. 6: 376-385, 2005; Lee, Y., et al., EMBO J 21: 4663-4670, 2002; Lee, Y., et al., EMBO J 23: 4051-4060, 2004).
  • Primary miRNAs (hereinafter referred to as “pri-miRNAs”) are usually over several Kb in length and include a 5 ′ cap and poly A tail.
  • pri-miRNA is ribocuclease III, Drosha (Lee, Y., et al., Nature 425: 415-419, 2003) and its sub-element DGCR8 (Gregory, R.I. et al., Nature 432: 235-240, 2004; Han, J., et al., Genes Dev . 18: 3016-3027, 2004; Landthaler, M., et al., Curr. Biol. 14: 2162-2167, 2004), which is first cleaved by a complex called a microprocessor and separated into about 65 nt of hairpin-structure precursor (pre-miRNA).
  • pre-miRNA hairpin-structure precursor
  • Recombinant DGCR8 or Drosha protein singly does not have cleavage activity in the pri-miRNA process, and cleavage activity when the two proteins combine, indicating that these two proteins act as the most important role of the pre-miRNA process.
  • the pre-miRNA process is a central step in miRNA biosynthesis and is defined as the process of generating one end of a molecule containing an mRNA sequence in a long pre-miRNA.
  • the pre-miRNA generated after the initiation process is transported into the cytoplasm by nuclear transport element Exp5 (exportin-5) (Bohnsack, M.T., et al., RNA 10: 185-191, 2004; Lund, E., et al., Science 303: 95-98, 2004; Yi, R., et al., Genes Dev . 17: 3011-3016, 2003).
  • Exp5 nuclear transport element 5
  • Dicer a RNase III type protein in the cytoplasm
  • Dicer product One strand of the Dicer product is present in the cytoplasm as a mature miRNA and assembled with an effector complex called a microribonucleoprotein (miRNP) or a miRNA-induced silencing complex (miRISC) (Khvorova, A., et al., Cell 115: 209-216, 2003; Schwarz, D.S., et al., Cell 115: 199-208, 2003).
  • miRNP microribonucleoprotein
  • miRISC miRNA-induced silencing complex
  • RNAi a gene silecing mechanism by sRNA
  • shRNA small hairpin RNA
  • siRNA small interfering RNA
  • Recent breakthroughs in RNAi technology have been made by constructing shRNA expression cassettes that mimic natural miRNA genes (Dickins, RA, et al., Nat. Genet. 37: 1289-1295, 2005; Silva, JM et al., Nat Genet. 37: 1281-1288, 2005: Zeng, Y., et al., Mol. Cell 9: 1327-1333. 2002).
  • MiRNA-based shRNAs regulated by RNA polymerase II promoters effectively and stably induce gene silencing regulation in cultured cells such as animal models.
  • the p53 gene is a tumor suppressor gene, and the activity of the p53 gene in approximately 50-60% of cancer patients is not changed due to mutation or deletion of the p53 gene. This shows the critical role of p53. Recent studies have shown that the recovery of p53 expression itself is effective in inducing strong inhibition of cancer in mice. Therefore, expressing the p53 gene in cancer cells with p53 mutation or increasing the activity of p53 in cancer cells can induce the death of cancer cells.
  • p53 protein regulates many genes that cause anti-proliferative responses such as cell cycle arrest, DNA repair, cell death and cellular senescence. Intracellular levels of p53 are tightly controlled by the ubiquitin-proteasome system, allowing p53 to respond sensitively to a variety of signals. While cell survival signals accelerate p53 disruption, intracellular stressors, such as DNA damage, stimulate specific sets of kinases to stabilize p53 proteins. To date, several protein factors have been known to regulate p53 levels. However, it is unknown whether regulatory RNA is also involved in the process.
  • the present invention provides an anticancer agent or anticancer composition comprising a miRNA that increases the activity of p53, a miRNA that inhibits the activity of p85 ⁇ or Cdc42 as an active ingredient.
  • the anticancer agent has a therapeutic effect of cancer by inducing cell death in cancer cells whose cell cycle progresses abnormally due to inhibition of p53 activity.
  • 1-4 show functional screening of miRNAs that regulate p53.
  • luciferase reporter gene (pGL3-Luc) comprising 13 p53 binding regions
  • p53 activity was measured after 91 miRNAs were transformed into HeLa cells.
  • miR-29 increases cell death in HdLA cells and MCF-7 cells, but not in MDA-MB-231 and SW480 cells.
  • the sub diploid G1 peak from FACS analysis is used to estimate the number of apoptosis cells.
  • RT-PCR of p53 mRNA of HeLa cells transformed with miR-29 complex or miR-29 mutant, and the product of cells transformed with lipofectamine (Mock) is amplified as a control.
  • 10 and 11 show sequences of miRNA target regions of p85 ⁇ and Cdc42 3′UTRs.
  • 326 nucleotides to 348 nucleotides of 3′UTR of p85 ⁇ are 5′- AGAGGCCUUUAACCAUGGUGCUU-3 ′ and 326 nucleotides to 348 nucleotides of 3′UTR of mutant p85 ⁇ are 5′-AGAGGCCUUUAACCAUGGGUAGU-3 ′ (FIG. 10).
  • From 577 nucleotides of 3'UTR to 599 nucleotides of Cdc42 are 5'-AACAUGUUCCCCAUCUGGUGCUC-3 'and from 577 nucleotides to 599 nucleotides of 3'UTR of mutant Cdc42 are 5'-AACAUGUUCCCCAUCUGGGUAGC-3'.
  • 997 nucleotides of 3′UTR of Cdc42 to 1019 nucleotides are 5′-AGGAAAUACGAGGGGUGGUGCUA-3 ′ and 997 nucleotides to 1019 nucleotides of 3′UTR of mutant Cdc42 are 5′-AGGAAAUACGAGGGGUGGGUAGA-3 ′ (FIG. 11).
  • FIG. 12 is a northern blotting comparing the expression levels of miR-29a, miR-29b and miR-29c in HeLa cells and SNU-638 cells, analyzing synthetic miR-29 family members (0.05 ng) for comparison. It was. HeLa cells express much lower levels of miR-29 compared to SNU-638 cells.
  • Figure 15 shows the RT-PCR results for measuring the levels of p85 ⁇ and Cdc42 mRNA after transforming miRNA in HeLa cells.
  • Knockdown of Cdc42 and p85 ⁇ in FIG. 16 activates p53.
  • p53 activity was measured using pGL3-Luc reporter plasmid in HeLa cells transformed with miRNA or siRNA.
  • Knockdown of Cdc42 and p85 ⁇ in FIG. 17 increases p53 protein levels. Two days after transfection of HeLa cells, p53 protein levels were analyzed using Western blot.
  • FIG. 20 miR-29 and its members were shown to increase p53 protein levels. HeLa cells transformed with each miRNA were analyzed by Western blot.
  • miR-29 increased cell death in HeLa and MCF-7 cells, but not in MDA-MB-231 and SW480 cells.
  • miR-29 ⁇ targets p85 ⁇ 3′UTR.
  • HeLa cells are transformed with a reporter prepared by fusing the luciferase genes downstream of wild type or mutant p85 ⁇ of 3′UTR. Concurrent transformation of miR-29 reduces the reporter activity of wild type 3′UTR, but miR-29Mut does not.
  • miR-29 targets Cdc 42 3′UTR.
  • the reporter assay in FIG. 25 was used except for the Cdc42 3'UTR.
  • the inventors screened miRNAs that activate p53 and treated them with cells, followed by Western blot, MTT, and FACS analysis.
  • miR29 family, miR-29a, miR-29b and miR-29c were selected as candidate miRNAs that activate p53 and induce cell death.
  • the miRNAs induce cell death through p53 activation through p53 protein stabilization.
  • the inventors have found that the miRNAs do not directly target p53, but activate p53 by inhibiting the activity of p85 ⁇ and Cdc42, and found a site in the proteins that reacts with the miRNAs. It was also confirmed that knockdown of p85 ⁇ and Cdc42 actually increased the activity of p53 protein.
  • the present invention provides an anticancer agent or anticancer composition comprising miR-29 as an active ingredient.
  • the present invention provides an anticancer agent or anticancer composition comprising any one miRNA selected from the group consisting of miR-29a, miR-29b and miR-29c as an active ingredient.
  • the present invention also provides the use of miR-29 in the production of the anticancer agent or anticancer composition.
  • the present invention further provides the use of miR-29 for the treatment of cancer.
  • miR-29 is any one miRNA selected from the group consisting of miR-29a, miR-29b and miR-29c.
  • the miR-29a is characterized by having a sequence of SEQ ID NO: 148
  • the miR-29b is characterized by having a sequence of SEQ ID NO: 150
  • the miR-29c is represented by SEQ ID NO: 152 It is characterized by having a sequence of.
  • the cancer is chronic lymphocytic leukemia, breast cancer, cervical cancer, fibrosarcoma, myoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, stromal sarcoma, angiosarcoma, endothelial sarcoma, lymphangiosarcoma, lymphangiopia celloma, synovial sarcoma, mesothelioma Ewing tumor, smooth sarcoma, rhabdomyosarcoma, stomach cancer, esophageal cancer, colon tumor, rectal cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, uterine cancer, head and neck cancer, skin cancer, brain cancer, impression cell tumor, sebaceous tumor, Papillary tumor, Papillary adenocarcinoma, Cyst adenocarcinoma, Medulla tumor, Organ supportive tumor, Kidney cell tumor, Liver cancer, Bile adenocar
  • the therapeutic agent for a disease of the present invention may be formulated to be suitable for the route to be administered.
  • routes of administration include parenteral or oral administration, such as intravenous, blood, subcutaneous, inhalation, transdermal (local), mucosal and rectal.
  • Solutions or suspensions used for oral administration such as blood or subcutaneous administration include solvents for injection, saline solutions, fixed oils, aseptic diluents such as polyethylene glycol, glycerin, propylene glycol or other synthetic solvents, such as benzine alcohol or methyl parabens.
  • Bacterial agents such as ascorbic acid or sodium sulfite; Chelating agents such as ethylenediaminetetraacetic acid; Buffers such as acetate, citrate or phosphate and extender modifiers such as sodium chloride or dextrose may be included.
  • Suitable carriers for the preparation of suppositories are natural and hardened oils, waxes, fats, semi-liquid polyols and the like.
  • the pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • Parenteral formulations may be sealed with ampoules, disposable syringes, multiple dose vials made of glass or plastic.
  • Suitable disease therapeutic agents for injection include sterile aqueous solutions or dispersions and sterile powders for the instant preparation of sterile injections or dispersions.
  • Suitable carriers for intravenous administration include physiological saline, bacteriostatic water, CremophorEL TM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS).
  • the disease treatment agent must be sterile and must be fluid to the extent that it can be easily injected. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier may be, for example, a solvent or spray medium containing water, ethanol, polyols (glycerol, propylene glycol and liquid polyreylene glycol, etc.), and suitable mixtures thereof.
  • a coating such as for example lecithin
  • proper fluidity can be maintained by maintaining the required particle size in the case of by-products and by using surfactants.
  • Microbial action can be prevented by various antibacterial and antibacterial agents such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like.
  • sugars, polyhydric alcohols such as mannitol, sorbitol, and isotonic agents such as sodium chloride are included in the disease treatment agent.
  • Prolonged absorption of the injectable composition can be achieved by, for example, incorporating delayed absorption agents such as aluminum monostearate and gelatin in the treatment of disease.
  • Sterile injectable solutions can be prepared by incorporating the required active ingredient in one or a combination of the ingredients described above in a suitable solvent and, if necessary, by filter sterilization.
  • dispersions can be prepared by incorporating the active ingredient in a sterile vehicle which may contain a basic dispersion medium and the required other ingredients from those described above.
  • sterile powders for the preparation of sterile injectable solutions the preferred methods of preparation are vacuum drying and lyophilization, by which methods powders of the desired components can be obtained from the active ingredient and the previously sterilized filtration solution.
  • suitable carriers for the preparation of injectable solutions include water, alcohols, polyols, glycerin, vegetable oils and the like.
  • Oral disease therapeutic agents generally include an inert diluent or an edible carrier.
  • the active ingredient is incorporated into excipients and used in capsules in the form of tablets, troches, or gelatin.
  • Oral disease therapies can also be prepared using fluid carriers for use as mouthwashes.
  • suitable carriers for soft gelatin capsules are vegetable oils, waxes, fats, semi-solid and liquid polyols and the like.
  • suitable carriers for the preparation of solutions and syrups are water, polyols, saccharose, invert sugar, glucose and the like.
  • compositions may also contain preservatives, stabilizers, wetting agents, emulsifiers, sweeteners, colorants, flavoring agents, salts for controlling osmotic pressure, buffers, coatings or antioxidants.
  • Tablets, pills, capsules, trucks and the like may contain any or a mixture of similar properties of the following components: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; Excipients such as starch or lactose, disintegrants such as alginic acid, Primogel TM or corn starch; Lubricants such as magnesium stearate or Sterotes TM ; Gildants, such as silicon dioxide in the colloidal state; Sweetening agents such as sucrose or saccharin; Or flavoring agents such as peppermint, methyl salicylate, or orange flavor. Oral or parenteral disease therapeutic agents are advantageously formulated in dosage unit form to facilitate uniformity under dose administration.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • Excipients such as starch or lactose, disintegrants such as alginic acid, Primogel TM or corn starch
  • Lubricants such as magnesium stearate or Sterotes TM
  • the miRNAs may be formulated as a medicament in a conventional manner using one or more pharmaceutically acceptable carriers. Lactose, corn starch or derivatives thereof, talc, stearic acid or its salts can be used, for example, as carriers for tablets and hard gelatin capsules.
  • the dosage for the treatment of cancer can vary widely and will, of course, be adjusted to the individual requirements in each particular case.
  • siRNA duplex double siRNA
  • the miRNA may be synthesized by single-stranded RNA (shRNA, short hairpin RNA) or double stranded RNA (siRNA, small intefering RNA) composed of loops and stems by chemical synthesis, and synthesizes a DNA sequence encoding the miRNA.
  • Recombinant vector prepared by inserting into a virus or plasmid vector for siRNA expression may be provided in the form of a plasmid vector.
  • the expression vector comprises a promoter efficient for siRNA expression, the promoter by RNA polymerase II or RNA polymerase III It is preferred to be recognized, in particular to be recognized by RNA polymerase III, most preferably the U6 promoter or the H1 promoter.
  • siRNA expression vectors include pSilencer (Ambion, Inc.), pSiEx (Novagen, Inc.), siXpress (Takara Bio, Inc.) and pBLOCK-iT TM (Invitrogen, Inc.) and SilenCircle TM (Allele). Can be used, but is not limited thereto.
  • miRNAs were co-transfected with HeLa cells along with the reporter plasmid.
  • HeLa cells were cultured in DMEM medium with 10% fetal bovine serum.
  • MCF-7, MDA-MB-231, SW480 and SNU-638 cells were cultured in RPMI1640 medium with 10% fetal bovine serum.
  • Plasmids and RNA oligonucleotides were transformed into mammalian cells using Lipofectamine2000 (Invitrogen) according to the manufacturer's protocol. siRNA oligonucleotides were purchased from Samchully Pharmaceutical.
  • siCdc42 5'-CUGCAGGGCAAGAGGAUUA-3 '(SEQ ID NO: 2);
  • si luciferase 5 ′ CUUACGCUGAGUACUUCGATT-3 ′ (SEQ ID NO: 4);
  • siGFP 5 -UGAAUUAGAUGGCGAUGUU-3 '(SEQ ID NO: 5)
  • the reporter plasmid pGL3-luc has 13 p53 binding sites upstream of the luciferase gene, quantitative measurement of p53 activity is possible.
  • 10 miRNAs that most potentiate p53 (miR-186, miR-187, miR-95, miR-191, miR-181b, miR-155, miR-29a, miR-183, miR-125a) in the pG13-luc measurement , miR-302b), and miR-451 and miR-212 were selected as controls, which do not seem to affect p53 activity.
  • the results of the screening show that miRNAs have different effects on p53 activity (FIG. 1).
  • MTT measurements were inoculated HeLa cells into 96-well plates, transformed with each of the miRNAs, and after 3 days, 50 ⁇ l of MTT solution (2 mg / ml) was added to each well and 2 hours at 37 ° C. Incubated for And 150 ⁇ l of DMSO was added to each well, and was performed by measuring the absorbance at 590 nm using a microplate reader.
  • FACS analysis was performed two days after transformation, cells were fixed with 70% ethanol, treated with RNase (5 ⁇ g / ml) and stained with propidium iodide (50 ⁇ g / ml), and Cell Quest The program was performed by analyzing the DNA content of the stained cells in FACSCalibur (Becton Dickinson). As shown in Figure 1, miR-29a is the only miRNA that showed positive results in all three tests, suggesting the possibility that miR-29a activates p53 and induces cell death.
  • binding buffer 10mM Hepes, pH 7.4, 140mM NaCl, 25mM CaCl2
  • FIG. 21 Cell death induced by miR-29 occurs only in cells expressing wild type p53 (eg HeLa and MCF-7) (FIG. 21). MDA-MB-231 and SW480 cells that inactivate the p53 mutation even in miR-29 treatment did not induce cell death (FIG. 21), indicating that wild type p53 is required for miR-29-induced cell death. In agreement, miR-29c is much less effective at inducing cell death when MCF-7 cells are reduced in p53 by RNAi (FIG. 22). Therefore, this means that miR-29s induce cell death through p53 activation.
  • wild type p53 eg HeLa and MCF-7
  • p85 ⁇ and Cdc42 have regions estimated to be one and two target regions in their 3'UTR, respectively.
  • p85 ⁇ protein is a regulatory unit of phosphatidylinositol 3 kinase (PI3K), which plays an important role in balancing cell survival and cell death
  • Cdc42 protein is a cell type, cell migration And Rho family of GTPases that regulate cell cycle progression.
  • P85 ⁇ 3'UTR was amplified using the following primers.
  • the amplification products were transformed downstream of the luciferase gene in the pGL3_CMV vector (modified form of pGL3 of PRomega).
  • a reporter with p85 ⁇ 3′UTR was generated and tested.
  • luciferase analysis HeLa or SNU-638 cells were seeded in 24-well plates one day before transformation.
  • siRNAs 180 ng of the firefly luciferase reporter plasmid and 20 ng reporter plasmid of renilla luciferase were transformed into HeLa cells rapidly with duplex siRNA 30 nM.
  • p53 activity 500 ng of pGL3-Luc reporter and 20 mg of Renilla Luciferase reporter plasmid were cotransformed with miRNA 30 nM.
  • luciferase activity was measured using Promega's Dual-luciferase assay kit according to the manufacturer's protocol. Firefly luciferase activity was normalized to Renilla luciferase activity, and all experiments were performed three times.
  • 2′-O-Me modified with antisense oligonucleotide was purchased from SAmchully Pharmaceutical and used for specific inhibition of the miR-29 family member.
  • Anti-miR-29a 5'-UAACCGAUUUCAGAUGGUGCUA-3 '(SEQ ID NO: 14);
  • Cdc42 Another potential target of miR-29s is Cdc42 mRNA with two target regions for miR-29s (FIG. 11).
  • the amplification products were transformed downstream of the luciferase gene in the pGL3_CMV vector (modified form of pGL3 of PRomega). As measured by Western blot, Cdc42 protein levels in HeLa cells transformed with miR-29s were reduced. It was confirmed that the decrease (Fig. 26.). In addition, when cells are transformed with miR-29s, luciferase reporters with 3'UTR of Cdc42 mRNA are inhibited by 40% (Fig. 27, black bars), but reporters with mutated target regions It was not inhibited by miR-29s (FIG. 27. white bars). This means that the two regions mediate Cdc42 regulation of miR-29. 2′-O-methyl inhibitors against miR-29s increased the expression of reporter in SNU-638 cells (FIGS. 12 and 13).
  • RNAi for these genes and measured p53 activity. Knockdown of p85 ⁇ and Cdc42 increased p53 protein activity in the pGL3-luc reporter assay (FIG. 16) and increased p53 protein levels (FIG. 17). In this context, FACS analysis confirmed that knockdown of Cdc42 and p85 ⁇ increased the number of apoptotic cells (FIG. 18). These data indicate that Cdc42 and p85 ⁇ negatively regulate p53.

Abstract

본 발명은 마이크로RNA를 유효성분으로 포함하는 항암제에 관한 것으로, 보다 구체적으로는 miRNA를 포함하는 항암제, miRNA를 포함하며 p85α 또는 Cdc42의 활성을 억제하는 것을 특징으로 하는 항암제, miRNA를 포함하며 p53의 활성을 촉진하는 것을 특징으로 하는 항암제 및 그 제조방법에 관한 것이다.

Description

[규칙 제26조에 의한 보정 13.05.2009]　마이크로ＲＮＡ를 유효성분으로 포함하는 항암제 및 그 제조방법
본 발명은 마이크로RNA(microRNA: 이하 "miRNA"라 칭함)를 유효성분으로 포함하는 항암제, 항암용 조성물 및 그 제조방법에 관한 것이다. 또한 본 발명은 마이크로 RNA의 항암제 또는 항암용 조성물의 제조를 위한 용도 및 암 치료에의 용도에 관한 것이다.
작은 RNA(small RNA: 이하 ＂sRNA"라 칭함)는 생체 내에서 유전자 발현을 조절하는 역할을 하는 17 내지 25 뉴클레오티드(nucleotide: 이하 ”nt"라 칭함) 정도 길이의 리보핵산을 말한다. sRNA는 그 생성되는 방식에 따라 크게 마이크로RNA(microRNA: 이하 ＂miRNA"라 칭함)와 작은 간섭 RNA(small interfering RNA: 이하 ＂siRNA"라 칭함)로 분류된다. miRNA는 부분적으로 이중나선을 이루는 헤어핀 RNA(hairpin RNA)로부터 생성되며, siRNA는 긴 이중가닥 RNA(double strand RNA: 이하 ＂dsRNA"라 칭함)로부터 유래한다. 일반적으로 생체 내의 여러 조절과정에서 중요한 역할을 하는 sRNA는 miRNA이며, 실험 기술적으로 특정 유전자의 발현을 조절하는데 사용되는 sRNA는 siRNA로 분류된다.
miRNA는 19-25 nt 길이의 단일 가닥 RNA(single strand RNA: 이하 ＂ssRNA"라 칭함) 분자로서 내재적(endogenous) 헤어핀-구조 전사체(hairpin-shaped transcript)(Bartel, D.P., Cell 116:281-297, 2004; Kim, V.N., Mol. Cells. 19:1-15, 2005)에 의해 생성된다. miRNA는 표적 mRNA의 3' 비번역 영역(UTRs)에 상보적으로 결합하여 전사 후 유전자 억압자(post-transcriptional gene suppressor)로서 작용하며, 번역 억제와 mRNA 불안정화를 유도함으로써 표적 유전자를 억제한다. miRNA는 발전(development), 분화, 증식, 세포사멸 및 신진대사(metabolism)과 같은 다양한 과정에서 중요한 역할을 한다. 이러한 과정들은 가끔 종양형성 동안 교란되며, 많은 miRNA들이 인간 암에서 낮게 유지되는 것으로 볼 때, miRNA는 종양형성에서 역할을 하는 것으로 보인다. miRNA와 암 사이의 강한 연관이 최근 증명되어 암 생물학 분야에서 새로운 연구 분야로 떠오르고 있으며(Esquela-kerscher, A. and Slack, FJ., Nat. Rev. Cancer 6(4):259-269, 2006), miRNA의 발현은 발달과 세포 분화 과정 중에 극적으로 변화하고, miRNA의 프로파일(profiling)은 발달 계통과 질병 단계에서 믿을만한 결과들을 보여주었다(Lu, J. et al., Nature 435:834-838, 2005). 또한 miRNA 기능에 대한 조절 네트워크에 대한 이전 분석을 통해 상기 분자들이 어떻게 생성되며 조절되는지 이해할 수 있었다(Kim, V.N. Nat. Rev. Mol. Cell. Biol. 6:376-385, 2005).
miRNA 생합성은 RNA 폴리머레이즈 Ⅱ에 의한 전사를 통해 개시된다(Cai. X., et al., RNA 10:1957-1966, 2004; Kim, V.N. Nat. Rev. Mol. Cell. Biol. 6:376-385, 2005; Lee, Y., et al., EMBO J 21:4663-4670, 2002; Lee, Y., et al., EMBO J 23:4051-4060, 2004). 1차 miRNA(primary microRNA: 이하 ＂pri-miRNA”라 칭함)는 보통 수 Kb의 길이를 넘으며, 5' 캡(cap)과 폴리 A 테일(poly A teil)을 포함한다. pri-miRNA는 리보큐클레아제 Ⅲ, Drosha(Lee, Y., et al., Nature 425:415-419, 2003)와 이의 부요소인 DGCR8(Gregory, R.I. et al., Nature 432:235-240, 2004; Han, J., et al., Genes Dev. 18:3016-3027, 2004; Landthaler, M., et al., Curr. Biol. 14:2162-2167, 2004)로 구성된 마이크로프로세서(microprocessor)라는 복합체에 의해 맨 처음 절단되어 65 nt 정도의 헤어핀-구조 전구체(pre-miRNA)로 분리된다. 재조합 DGCR8 또는 Drosha 단백질 단일로는 pri-miRNA 프로세스에서 절단 활성을 가지지 못하며, 두 단백질이 결합할 때 절단 활성을 보이는데, 이를 통해 상기 두 단백질이 pre-miRNA 프로세스의 가장 중요한 역할로 작용함을 알 수 있다(Gregory, R.I. et al., Nature 432:235-240, 2004; Han, J., et al., Genes Dev. 18:3016-3027, 2004). pre-miRNA 프로세스는 miRNA 생합성에 중심적 단계로서, 길이가 긴 pre-miRNA에 mRNA 서열을 포함하는 분자의 한쪽 말단을 생성하는 과정으로 정의된다. 상기 개시 프로세스 이후 생성된 pre-miRNA는 핵 수송요소인 Exp5(exportin-5)에 의해 세포질로 수송된다(Bohnsack, M.T., et al., RNA 10:185-191, 2004; Lund, E., et al., Science 303:95-98, 2004; Yi, R., et al., Genes Dev. 17:3011-3016, 2003). 세포질 안에서는 세포질내 RNase Ⅲ 타입 단백질인 다이서(Dicer)가 전달된 pre-miRNA를 절단하여 22 nt 정도의 miRNA 이중 가닥을 생성한다. 다이서 생성물의 한쪽 가닥(strand)은 성숙 miRNA로 세포질 속에 존재하여 miRNP(microribonucleoprotein) 또는 miRISC(miRNA-induced silencing complex)라 불리는 실행자 복합체(effector complex)와 조립된다(Khvorova, A., et al., Cell 115:209-216, 2003; Schwarz, D.S., et al., Cell 115:199-208, 2003).
sRNA에 의한 유전자 침묵 기작(gene silecing mechanism)인 RNAi 현상은 포유동물 시스템에서 효과적인 유전자 연구 수단으로 사용되고 있다. 효과적이며 안정한 유전자 넉다운(knockdown)은 작은 헤어핀 RNA(small hairpin RNA: 이하 ＂shRNA”라 칭함)로 발현하여 작은 간섭 RNA(siRNA)로 프로세스 되면서 일어난다. 최근 RNAi 기술의 비약적인 전진은 자연적 miRNA 유전자를 모방한 shRNA 발현 카세트를 제작하면서 이루어졌다(Dickins, R.A., et al., Nat. Genet. 37:1289-1295, 2005; Silva, J.M. et al., Nat. Genet. 37:1281-1288, 2005: Zeng, Y., et al., Mol. Cell 9:1327-1333. 2002). RNA 폴리머라아제 Ⅱ 프로모터에 의해 조정되는 miRNA를 기초한 shRNA는 동물 모델 같은 배양 세포 내에서 효과적이며 안정적으로 유전자 침묵(gene silencing) 조절을 유도한다.
p53 유전자는 암억제 유전자 (tumor suppressor gene) 로 대략 50~60 % 암환자의 p53 유전자가 변이 또는 결손되어 그 활성이 나타나지 않는데, 대부분의 인간의 암에서 p53 경로가 불활성화된다는 것은, 암 억제자로서 p53의 결정적인 역할을 보여주는 것이다. 최근의 연구는 p53 발현의 회복 자체가 쥐에서 암의 강한 억제를 유도하는데 효과적임을 밝혔다. 따라서 p53 변이가 있는 암세포에서 p53 유전자를 발현시키거나 암세포에서 p53의 활성을 증가시키면 암세포의 사멸을 유도할 수 있다.
이는 암의 진행이 p53의 기능 상실을 강하게 필요로 하고, p53의 회복은 암치료에 있어 새롭고 효과적인 접근 방향이 될 수 있다는 것을 의미한다.
전사인자로서, p53단백질은 세포주기 정지(arrest), DNA 리페어, 세포사 및 세포 노화(cellular senescence)와 같은 안티-증식(anti-proliferative) 반응을 일으키는 많은 유전자들을 조절한다. p53의 세포 내 수준은 유비퀴틴-프로테아좀 시스템에 의해 엄격하게 통제되는데, 이로써 p53은 다양한 신호에 예민하게 반응할 수 있다. 세포 생존신호가 p53의 붕괴를 가속화하는 반면, DNA 손상과 같은 세포 내 stressor는, p53 단백질을 안정화시키기 위하여 특정 kinase 세트를 자극한다. 지금까지는 몇몇 단백질 인자들이 p53 수준을 조절하는 것이 알려져 있었다. 그러나 조절(regulatory) RNA 역시 상기 과정에 관련되어 있는지 여부는 알려지지 않은 상태로 있었다.
비록 암억제자(tumor suppressor)인 p53을 조절하는 단백질 요인(factor)들에 대하여 연구가 많이 되어있기는 하지만, p53 조절에 있어서 microRNA(miRNA)의 역할에 대하여는 밝혀지지 않은 상태이다. 본 발명자들은 p53 활성을 조절하는 miRNA의 스크리닝에서, miR-29와 같은 과에 속하는 것들(패밀리 멤버)이, p53을 음성적으로 조절하는 Cdc42 및 p53α를 억제함으로써, p53 레벨을 증가시키는 것을 알아냈다.
본 발명의 목적은 miRNA를 유효성분으로 포함하는 항암제 또는 항암용 조성물을 제공하는 것이다. 또한 본 발명의 목적은 miRNA를 유효성분으로 포함하는 항암제 또는 항암용 조성물의 제조방법을 제공하는 것이다. 또한 본 발명의 목적은 miRNA의 항암제 또는 항암용 조성물 제조에의 용도, 암 치료에의 용도를 제공하는 것이다.
상기 목적을 달성하기 위하여 본 발명은 p53의 활성을 증가시키는 miRNA, p85α 또는 Cdc42의 활성을 억제하는 miRNA를 유효성분으로 포함하는 항암제 또는 항암용 조성물을 제공한다.
상기 항암제는 p53의 활성 저해로 세포주기가 비정상적으로 진행되는 암세포에 있어서 세포사를 유도함으로써 암의 치료 효과를 갖는다.
도 1 내지 도 4는 p53을 조절하는 miRNA들의 기능별 스크리닝을 보여준다.
도 1은 p53 활성에 대한 miRNA 형질전환의 구별되는 영향들을 보여준다.
13개의 p53 결합 지역을 포함하는 루시페라제 리포터 유전자(pGL3-Luc)를 이용하여, HeLa 세포들에 91개의 miRNA들이 형질전환된 후 p53의 활성이 측정되었다. 합성 miRNA(30nM), pGL3-Luc(0.5㎍) 및 레닐라 루시페라제 플라스미드(0.02㎍)를 24 웰 플레이트의 HeLa 세포들에 공동형질전환하고, 형질전환 후 24시간 후 루시페라제 활성을 측정하였다. 리포터 활성 값은 그룹 평균으로 표준화하였으며 감소하는 순서(n=2)대로 나열하였다.
도 2는 HeLa 세포에 MiRNA 형질전환 후 2일 후 p53 단백질 수준의 측정을 위한 웨스턴 블롯팅 결과를 보여준다.
도 3은 miRNA로 형질전환된 HeLa 세포의 3일 후 생존력 측정을 위한 MTT 분석(n=3, 평균±SD) 결과를 보여 준다.
도 4는 miRNA로 형질전환된 HeLa 세포의 FACS 분석 결과를 보여 준다. 도 3(아래 오른쪽, n=3, 평균±SD)에서와 같이, 세포사한 세포의 수를 정량한다.
도 5는 miR-29 패밀리 멤버의 서열 및 게놈을 분석한 결과이다.
도 6 내지 도 8은 miR-29에 의한 세포사의 유도;를 나타내는 도면이다.
도 6은 miR-29가 HeLa 세포에서 세포사를 유도하는 것을 보여준다. miRNA 형질전환 후 이틀 후, HeLa 세포들은 4% 파라포름알데하이드로 고정시킨 후, Annexin V-FITC로 염색된다. 세포들은 형광발광 현미경(400X)로 시각화하였다.
도 7은 miR-29가 HeLa 세포 성장을 저해하는 것을 보여준다. 세포 증식 비율은 혈구계산판(hematocytometer)을 이용하여 매일 측정(estimate)한다.
도 8에서 miR-29는 HdLA 세포와 MCF-7 세포에서 세포사한 세포 수를 증가시키지만, MDA-MB-231 및 SW480 세포에서는 그러하지 않다. FACS 분석으로부터 sub diploid(이배체) G1 피크는 세포사한 세포의 수를 추정하는데 이용된다.
도 9는 miR-29이 p53 mRNA 수준에 영향을 미치지 않는다는 것을 보여주는 도면이다.
miR-29 혼합체 또는 miR-29 돌연변이로 형질전환한 HeLa 세포의 p53 mRNA의 RT-PCR이며, 리포펙타민(lipofectamine)을 형질전환한 세포(Mock)의 산물은 대조군으로서 증폭시킨다.
도 10 및 도 11은 p85α 및 Cdc42 3'UTR들의 miRNA 타겟 영역의 서열을 보여주는 도면이다.
p85α의 3'UTR의 326 뉴클레오타이드부터 348 뉴클레오타이드는 5'- AGAGGCCUUUAACCAUGGUGCUU-3'이고 돌연변이 p85α의 3'UTR의 326 뉴클레오타이드부터 348 뉴클레오타이드는 5'- AGAGGCCUUUAACCAUGGGUAGU-3'이다(도 10). Cdc42의 3'UTR의 577 뉴클레오타이드부터 599 뉴클레오타이드는 5'-AACAUGUUCCCCAUCUGGUGCUC-3'이고 돌연변이 Cdc42의 3'UTR의 577 뉴클레오타이드부터 599 뉴클레오타이드는 5'-AACAUGUUCCCCAUCUGGGUAGC-3'이다. Cdc42의 3'UTR의 997 뉴클레오타이드부터 1019 뉴클레오타이드는 5'-AGGAAAUACGAGGGGUGGUGCUA-3'이고 돌연변이 Cdc42의 3'UTR의 997 뉴클레오타이드부터 1019 뉴클레오타이드는 5'-AGGAAAUACGAGGGGUGGGUAGA-3'이다(도 11).
도 12 내지 도 15는 miR-29가 p85α 및 Cdc42를 타겟으로 하는 것을 보여주는 도면이다.
도 12는　HeLa 세포 및 SNU-638 세포에서의 miR-29a, miR-29b 및 miR-29c의 발현 정도를 비교한 노던 블롯팅으로, 비교를 위하여 합성 miR-29 패밀리 멤버들(0.05ng)들을 분석하였다. HeLa 세포들은 SNU-638 세포들에 비하여 miR-29를 훨씬 낮은 수준으로 발현시킨다.
도 13은 miR-29의 길항작용이 p85α 발현을 증가시키는 것을 보여준다. miR-29 패밀리 멤버들에 특이적인 miRNA 저해제들과 함께 p85α 3'UTR 플라스미드를 SNU-638 세포들에 형질전환시켰다. 상기 세포들은 siLuc를 발현시키지 않기 때문에 siLuc(항-siLuc)의 안티센스 올리고를 대조군으로 이용하였다(m=3, 평균±SD).
도 14에서는 miR-29의 길항작용이 Cdc42 발현을 증가시키는 것으로 나타났다. Cdc42 3'UTR을 제외하고는 도 13과 동일한 시험을 수행하였다.
도 15는 miRNA를 HeLa 세포들에 형질전환 시킨 후 p85α 및 Cdc42 mRNA의 수준을 측정하기 위한 RT-PCR 결과이다.
도 16 내지 도 18은 Cdc42 및 p85α의 억제가 p53을 활성화시키는 것을 보여주는 도면이다.
도 16에서 Cdc42 및 p85α의 넉다운은 p53을 활성화시킨다. miRNA 또는 siRNA로 형질전환한 HeLa 세포에서 pGL3-Luc 리포터 플라스미드를 이용하여 p53 활성을 측정하였다.
도 17에서 Cdc42 및 p85α의 넉다운은 p53 단백질 수준을 증가시킨다. HeLa 세포들에 형질전환 시키고 이틀 후, 웨스턴 블롯을 이용하여 p53 단백질 수준을 분석하였다.
도 18에서 Cdc42 및 p85α의 넉다운은 세포사을 유도한다. 세포사한 수는 도 1c와 같이 추정하였다.
도 19 내지 도 23는 miR-29 과(family) 멤버들이 p53을 양성조절(positively relgulate)한다는 것을 보여준다.
도 19는 p53을 조절하는 miRNA들의 스크리닝에 대한 요약이다. pGL3-luc 리포터 검사에서 가장 높은 활성을 가진 10개 miRNA의, 음성 대조군들(miR-451 및 miR-212)에 비하여 p53 단백질 수준을 증가시키고(>2 배), 세포 생존력을 감소시키며(30%), 세포사를 유도하는(> 2배) 능력을 시험하였다.
도 20에서는 miR-29 과 멤버들이 p53 단백질 수준을 증가시키는 것으로 나타났다. 각각의 miRNA가 형질전환된 HeLa 세포들은 웨스턴 블럿으로 분석되었다.
도 21에서 miR-29는 HeLa 및 MCF-7 세포에서 세포사하는 세포 수를 증가시켰지만, MDA-MB-231 및 SW480 세포에서는 그러지 않았다. FACS 분석으로부터 sub diploid(이배체) G1 피크는 세포사한 세포의 수를 추정하는데 이용된다(n=3, 평균±3), 대표 plot은 도 9를 참조.
도 22에서 p53의 넉다운은 miR-29c로 형질전환된 MCF-7 세포에서 세포사를 억제한 것이 나타났다. 세포사된 수는 도 21에서와 같이 추정된다.
도 23에서는 MiR-29가 p53 단백질의 안정성을 강화하는 것이 확인되었다. miR-29Mut(왼쪽 패널, 오른쪽)로 처리한 세포들과는 달리, miR-29 mix로 형질전환되고 50㎍/㎖의 사이클로헥시마이드(CHX)를 특정 시간동안 (for the indicated time) 처리한 HeLa 세포들(외쪽 패널, 왼쪽)은 p53 수준을 높게 유지한다. miR-29mix를 처리한 세포들보다 miR-29 Mut을 처리한 세포를 나타내는 blot이 제로 포인트 평형을 이루기까지 더 오래 노출됐다는 점을 주시하라. time 0에서의 단백질 샘플의 반은 비교를 위하여 로딩되었다(0.5X). p53 단백질 밴드의 강도는 정량화되고 GAPDH 강도로 표준화된다(오른쪽 패널, n=3, 평균±SD).
*도 24 내지 도 28은 miR-29가 p85α 와 Cdc42를 직접적으로 타겟으로 한다는 것을 보여주는 도면이다.
도 24에서는 웨스턴 블럿 결과, miR-29 mix는 HeLa 세포에서 p85α 단백질 수준을 감소시키는 것이 확인되었다.
*도 25에서 miR-29α는 p85α 3‘UTR을 타겟으로 한다. 루시페라제 유전자들에 하류 3’UTR의 야생형 또는 돌연변이 p85α를 융합시킴으로써 제조한 리포터로 HeLa 세포들을 형질전환한다. miR-29의 동시(concurrent) 형질전환은 야생형 3‘UTR의 리포터 활성을 감소시키지만, miR-29Mut은 그렇지 않다. 결과는 언급되지 않은(unrelated) siRNA; siGFP로 표준화된다(n=3, 평균±SD).
도 26에서는 웨스턴 블럿 결과, miR-29는 HeLa 세포에서 CDC42 단백질 수준을 감소시킨다는 것이 확인되었다.
도 27에서 miR-29는 Cdc 42 3'UTR을 타겟으로 한다. 상기 Cdc42 3'UTR을 제외하고 도 25에서의 리포터 분석이 사용되었다.
도 28은 pGL3-luc 리포터 분석 결과(n=3, 평균±SD)를 보여주며, HeLa 세포에서 CDC42 및 p85α의 과발현은 miR-29에 의하여 유도된 p53 활성 증가를 억제한다는 것이 확인되었다.
도 29에서는 HeLa 세포에서 CDC42와 p85α의 과발현은 miR-29에 의해 유도되는 세포사를 상쇄 (rescue)한다는 것을 확인하였다. 세포사한 세포들은 도 21에 나타난 바와 같이 정량화된다.
이하, 본 발명을 상세히 설명한다.
본 발명자들은 p53을 활성화시키는 miRNA들을 스크리닝하여 이들을 세포에 처리한 후 웨스턴블럿, MTT, FACS 분석을 하였다. 그 결과 p53을 활성화시키고 세포사를 유도하는 miRNA의 후보로 miR29 family, miR-29a, miR-29b 및 miR-29c를 선택하였다. 이들을 야생형 p53을 가지는 세포 또는 p53이 불활성화된 세포에 처리한 결과 상기 miRNA들이 p53 단백질 안정화를 통한 p53 활성화를 통하여 세포사를 유도하는 것을 알 수 있었다.
본 발명자들은 상기 miRNA들이 p53을 직접적으로 타겟으로 하는 것은 아니고, p85α 및 Cdc42의 활성을 저해함으로써 p53을 활성화시킨다는 것을 확인하고, 상기 단백질들에서 상기 miRNA들과 반응하는 부위를 찾아내었다. 또한 p85α 및 Cdc42의 넉다운이 실제로 p53 단백질의 활성을 증가시킨다는 것을 확인하였다.
본 발명은 miR-29를 유효성분으로 하는 항암제 또는 항암용 조성물을 제공한다. 바람직하게는, 본 발명은 miR-29a, miR-29b 및 miR-29c로 구성된 군으로부터 선택된 어느 하나의 miRNA를 유효성분으로 포함하는 항암제 또는 항암용 조성물을 제공한다. 또한 본 발명은 miR-29의 상기 항암제 또는 항암용 조성물의 제조에의 용도를 제공한다. 아울러 본 발명은 miR-29의 암 치료에의 용도를 제공한다. miR-29의 항암제 또는 항암용 조성물의 제조에의 용도 또는 암 치료에의 용도에 있어서, 상기 miR-29는 miR-29a, miR-29b 및 miR-29c로 구성된 군으로부터 선택된 어느 하나의 miRNA인 것을 특징으로 하는 것이 바람직하며, 더욱 바람직하게는 miR-29a는 서열번호 148의 서열을 갖는 것을 특징으로 하고, miR-29b는 서열번호 150의 서열을 갖는 것을 특징으로 하며, miR-29c는 서열번호 152의 서열을 갖는 것을 특징으로 한다. 이 때, 암은 만성 림프성 백혈병, 유방암, 자궁경부암, 섬유육종, 근육종, 지방육종, 연골육종, 골원성육종, 척삭종, 맥관육종, 내피육종, 림프관육종, 림프관내피아세포종, 활막종, 중피종, 유윙(Ewing) 종양, 평활근육종, 횡문근육종, 위암, 식도암, 결장종양, 직장암, 췌장암, 유방암, 난소암, 전립선암, 자궁암, 머리와 목 암, 피부암, 뇌암, 인상세포종양, 피지선종양, 유두상종양, 유두선종, 낭포선암, 수질종양, 기관지원성종양, 신장세포종양, 간암, 담즙선종양, 융모암, 정상피종, 태아종, 빌름스(Wilm's) 종양, 고환암, 폐종양, 소세포폐종양, 비소세포폐종양, 방광종양, 상피종, 신경교종, 성상세포종, 수아세포종, 두개인두종, 뇌실상의세포종, 송과체종, 혈관아세포종, 청음신경종, 회돌기교종, 수악종, 흑색종, 신경아세포종, 망막아세포종, 백혈병, 림프종 및 카포시(Kaposi) 육종 으로 구성된 군으로부터 선택된 어느 하나인 암의 치료 또는 증상의 경감을 목적으로 하는 것이 바람직하다.
본 발명의 질환 치료제는 투여하고자 하는 경로에 적합하게 제형화 할 수 있다. 투여 경로의 예로는 정맥내, 혈액내, 피하, 흡입, 경피(국부), 점막 및 직장같은 비경구 투여 또는 경구 투여가 있다. 혈액 또는 피하 투여와 같은 경구 투여에 사용되는 용액 또는 현탁액에는 주사용 용매, 염수액, 고정유, 폴리에틸렌 글리콜, 글리세린, 프로필렌 글리콜 또는 그 밖의 합성 용매와 같은 무균 희석제, 벤진 알코올 또는 메틸 파라벤과 같은 항박테리아제; 아스코르브산 또는 아황산나트륨과 같은 항산화제; 에틸렌디아민테트라아세트산과 같은 킬레이트화제; 아세테이트, 시트레이트 또는 포스페이트같은 완충제 및 염화나트륨 또는 덱스트로스와 같은 증장성 조절제가 포함될 수 있다. 좌제의 제조에 적합한 담체는 천연 및 경화 오일, 왁스, 지방, 반-액체 폴리올 등이다. pH는 염산 또는 수산화나트륨과 같은 산 또는 염기로 조절될 수 있다. 비경구 제제는 앰플, 1회용 주사기, 유리 또는 플라스틱으로 제조된 다중 용량 바이알로 밀봉될 수 있다.
주사용으로 적합한 질환 치료제는 무균 수용액 또는 분산액 및 무균 주사액 또는 분산액의 즉석 제제용 무균 분말을 포함한다. 정맥내 투여용으로 적합한 담체로는 생리 식염수, 정균수, CremophorELTM(BASF, Parsippany, NJ) 또는 인산염 완충염수(PBS)가 포함된다. 모든 경우에 있어서, 질환 치료제는 살균되어야하고, 용이하게 주사될 수 있는 정도의 유체여야 한다. 제조 및 저장 조건 하에서 안정해야 하며, 박테리아 및 균류와 같은 미생물의 오염 작용에 있어서 보존되어야 한다. 담체는 예를 들어, 물, 에탄올, 폴리올(글리세롤, 프로필렌글리콜 및 액체 폴리레틸렌 글리콜 등), 및 이들의 적합한 혼합물을 함유하는 용매 또는 분사 매질일 수 있다. 예를 들어 레시틴과 같은 코팅을 사용하므로써, 부산액의 경우에 요구되는 입도를 유지시킴으로써, 그리고 계면활성제를 사용함으로써 적합한 유동성이 유지될 수 있다. 미생물 작용은 다양한 항세균제 및 항균제, 예를 들어 파라벤, 클로로부탄올, 페놀, 아스코르브산, 티메로살 등에 의해 방지될 수 있다. 당, 만니톨, 소르비톨과 같은 다가 알코올, 염화나트륨과 같은 등장제가 질환 치료제 중에 포함되는 것이 바람직하다. 주사용 조성물의 흡수 연장은 예를 들어, 알루미늄 모노스테아레이트 및 젤라틴과 같은 흡수 지연제를 질환 치료제에 포함시킴으로써 달성될 수 있다.
무균 주사액은 적합한 용매 중에서 상기 기재된 하나 또는 조합된 성분에 필요 활성 성분을 혼입하고, 필요에 따라 여과 살균시킴으로써 제조할 수 있다. 일반적으로, 분산액은 활성 성분을, 염기성 분산 매질 및 상기 기재된 것들로부터 필요한 다른 성분을 함유할 수 있는 무균 비히클을 혼입하여 제조할 수 있다. 무균 주사액을 제조하기 위한 무균 분말의 경우, 바람직한 제조 방법은 진공 건조 및 동결 건조이며, 이들 방법에 의해 활성 성분과 이전에 살균된 여과 용액으로부터 바람직한 성분의 분말을 얻을 수 있다. 주사 액제의 제조에 적합한 담체의 예로는 물, 알콜, 폴리올, 글리세린, 식물성 오일 등이 있다.
경구용 질환 치료제는 일반적으로 불활성 희석제 또는 식용 담체를 포함한다. 경구 치료적 투여를 위해, 활성 성분은 부형제에 혼입되어 정제, 트로우키(troches), 또는 젤라틴 형태의 캡슐로 사용된다. 또한 경구용 질환 치료제는 구강 세척액으로서 사용하기 위한 유체 담체를 사용하여 제조될 수 있다. 연질 젤라틴 캡슐에 대한 적합한 담체의 예로는 식물성 오일, 왁스, 지방, 반-고형 및 액체 폴리올등이 있다. 액제 및 시럽의 제조에 적합한 담체의 예로는 물, 폴리올, 사카로즈, 전화당, 글루코스 등이 있다.
약제학적으로 적합한 결합제 및/또는 어주번트 물질이 질환 치료제의 일부로 포함될 수 있다. 약학 제제는 또한 보존제, 안정화제, 습윤제, 유화제, 감미제, 착색제, 풍미제, 삼투압 조절용 염, 완충제, 코팅제 또는 산화방지제를 함유할 수 있다. 정제, 알약, 캡슐, 트로우키 등은 하기의 성분의 어느 하나 또는 유사한 특성의 혼합물을 함유할 수 있다: 미정질 셀루로오스, 검 트라가칸트 또는 젤라틴과 같은 결합제; 전분 또는 락토스와 같은 부형제, 알긴산, PrimogelTM 또는 옥수수 전분과 같은 붕해제; 마그네슘 스테아레이트 또는 SterotesTM와 같은 윤활제; 콜로이드 상태의 이산화규소와 같은 길던트(gildant); 수크로오스 또는 사카린과 같은 감미제; 또는 페퍼민트, 메틸 살리실레이트, 또는 오렌지향과 같은 향미제. 경구 또는 비경구용 질환 치료제는 용량의 투여 밑 균일성을 용이하게 하기 위하여 용량 단위형으로 제형하는 것이 유리하다. 상기 miRNA들은 하나 이상의 약학적으로 허용가능한 담체를 사용하여 통상적인 방법으로 약제로서 제형화시킬 수 있다. 락토오즈, 옥수수 전분 또는 그의 유도체, 활석, 스테아르산 또는 그의 염을 예를들어, 정제 및 경질 젤라틴 캡슐에 대한 담체로서 사용할 수 있다.
암치료를 위한 투여량은 광범위하게 변화시킬 수 있으며, 물론, 각각의 특별한 경우에 개별적인 필요 조건에 따라 조절될 것이다.
이하, 본 발명을 실시예에 의하여 상세히 설명한다.
단, 하기 실시예는 본 발명을 구체적으로 예시하는 것이며, 본 발명의 내용이 실시예에 의하여 한정되는 것은 아니다.
< 실시예 1> p53을 활성화시키는 miRNA의 스크리닝
본 발명자들은 인간의 암에서 높게 또는 낮게 유지되는 것으로 알려진 91개 miRNA들을 선택하였다. 선택된 miRNA들은 이중 siRNA (siRNA duplex)의 형태로 화학적 합성되었다 (표 1).
표 1
miRNA 5' to 3' sequence nt
let-7a guide UGAGGUAGUAGGUUGUAUAGUU (서열번호 20) 22
passenger CUAUACAACCUACUACCUCAUU (서열번호 21) 22
let-7d guide AGAGGUAGUAGGUUGCAUAGU (서열번호 22) 21
passenger UAUGCAACCUACUACCUUUUU (서열번호 23) 21
miR-1 guide UGGAAUGUAAAGAAGUAUGUA (서열번호 24) 21
passenger CAUACUUCUUUACAUUCCAUU (서열번호 25) 21
miR-100 guide AACCCGUAGAUCCGAACUUGUG (서열번호 26) 22
passenger CAAGUUCGGAUCUACGGGUUUU (서열번호 27) 22
miR-101 guide UACAGUACUGUGAUAACUGAAG (서열번호 28) 22
passenger UCAGUUAUCACAGUACUGUAUU (서열번호 29) 22
miR-106a guide AAAAGUGCUUACAGUGCAGGUAGC (서열번호 30) 24
passenger UACCUGCACUGUAAGCACUUUUUU (서열번호 31) 24
miR-106b guide UAAAGUGCUGACAGUGCAGAU (서열번호 32) 21
passenger CUGCACUGUCAGCACUUUAUG (서열번호 33) 21
miR-107 guide AGCAGCAUUGUACAGGGCUAUCA (서열번호 34) 23
passenger AUAGCCCUGUACAAUGCUGUUUU (서열번호 35) 23
miR-124a guide UUAAGGCACGCGGUGAAUGCCA (서열번호 36) 22
passenger GCAUUCACCGCGUGCCUUAAUU (서열번호 37) 22
miR-125a guide UCCCUGAGACCCUUUAACCUGUG (서열번호 38) 23
passenger CAGGUUAAAGGGUCUCAGGGAUU (서열번호 39) 23
miR-125b guide UCCCUGAGACCCUAACUUGUGA (서열번호 40) 22
passenger ACAAGUUAGGGUCUCAGGAAUU (서열번호 41) 22
miR-128b guide UCACAGUGAACCGGUCUCUUUC (서열번호 42) 22
passenger AAGAGACCGGUUCACUGUCAUU (서열번호 43) 22
miR-130a guide CAGUGCAAUGUUAAAAGGGCAU (서열번호 44) 22
passenger GCCCUUUUAACAUUGCACUGUU (서열번호 45) 22
miR-133a guide UUGGUCCCCUUCAACCAGCUGU (서열번호 46) 22
passenger AGCUGGUUGAAGGGGACCAAUU (서열번호 47) 22
miR-135a guide UAUGGCUUUUUAUUCCUAUGUGA (서열번호 48) 23
passenger ACAUAGGAAUAAAAAGCCAUAUU (서열번호 49) 23
miR-138 guide AGCUGGUGUUGUGAAUC (서열번호 50) 17
passenger UUCACAACACCAGUUUU (서열번호 51) 17
miR-141 guide UAACACUGUCUGGUAAAGAUGG (서열번호 52) 22
passenger AUCUUUACCAGACAGUGUUAUU (서열번호 53) 22
miR-145 guide GUCCAGUUUUCCCAGGAAUCCCUU (서열번호 54) 24
passenger GGGAUUCCUGGGAAAACUGGAUUU (서열번호 55) 24
miR-146 guide UGAGAACUGAAUUCCAUGGGUU (서열번호 56) 22
passenger CCCAUGGAAUUCAGUUCUCAUU (서열번호 57) 22
miR-148a guide UCAGUGCACUACAGAACUUUGU (서열번호 58) 22
passenger AAAGUUCUGUAGUGCACUCAUU (서열번호 59) 22
miR-148b guide UCAGUGCAUCACAGAACUUUGU (서열번호 60) 22
passenger AAAGUUCUGUGAUGCACUAAUU (서열번호 61) 22
miR-149 guide UCUGGCUCCGUGUCUUCACUCC (서열번호 62) 22
passenger AGUGAAGACACGGAGCUAGUUU (서열번호 63) 22
miR-151 guide ACUAGACUGAAGCUCCUUGAGG (서열번호 64) 22
passenger UCAAGGAGCUUCAGUCUAAUUU (서열번호 65) 22
miR-152 guide UCAGUGCAUGACAGAACUUGGG (서열번호 66) 22
passenger CAAGUUCUGUCAUGCACUGAUU (서열번호 67) 22
miR-153 guide UUGCAUAGUCACAAAAGUGA (서열번호 68) 20
passenger ACUUUUGUGACUAUGCAAUU (서열번호 69) 20
miR-155 guide UUAAUGCUAAUCGUGAUAGGGG (서열번호 70) 22
passenger CCUAUCACGAUUAGCAUUAAUU (서열번호 71) 22
miR-15a guide UAGCAGCACAUAAUGGUUUGUG (서열번호 72) 22
passenger CAAACCAUUAUGUGCUGCUAUU (서열번호 73) 22
miR-16 guide UAGCAGCACGUAAAUAUUGGCG (서열번호 74) 22
passenger CCAAUAUUUACGUGCUGCUGUU (서열번호 75) 22
miR-17-5p guide CAAAGUGCUUACAGUGCAGGUAGU (서열번호 76) 24
passenger UACCUGCACUGUAAGCACUUUAUU (서열번호 77) 24
miR-181b guide AACAUUCAUUGCUGUCGGUGGG (서열번호 78) 22
passenger CACCGACAGCAAUGAAUGUUUU (서열번호 79) 22
miR-182 guide UGGUUCUAGACUUGCCAACUA (서열번호 80) 21
passenger GUUGGCAAGUCUAGAACCAUU (서열번호 81) 21
miR-183 guide UAUGGCACUGGUAGAAUUCACUG (서열번호 82) 23
passenger GUGAAUUCUACCAGUGCCAUAUU (서열번호 83) 23
miR-184 guide UGGACGGAGAACUGAUAAGGGU (서열번호 84) 22
passenger CCUUAUCAGUUCUCCGUCCAUU (서열번호 85) 22
miR-186 guide CAAAGAAUUCUCCUUUUGGGCUU (서열번호 86) 23
passenger GCCCAAAAGGAGAAUUCUUUGUU (서열번호 87) 23
miR-187 guide UCGUGUCUUGUGUUGCAGCCG (서열번호 88) 21
passenger GCUGCAACACAAGACACGAUU (서열번호 89) 21
miR-18a guide UAAGGUGCAUCUAGUGCAGAUA (서열번호 90) 22
passenger UCUGCACUAGAUGCACCUUAUU (서열번호 91) 22
miR-191 guide CAACGGAAUCCCAAAAGCAGCU (서열번호 92) 22
passenger CUGCUUUUGGGAUUCCGUUGUU (서열번호 93) 22
miR-194 guide UGUAACAGCAACUCCAUGUGGA (서열번호 94) 22
passenger CACAUGGAGUUGCUGUUACAUU (서열번호 95) 22
miR-196a guide UAGGUAGUUUCAUGUUGUUGG (서열번호 96) 21
passenger AACAACAUGAAACUACUUAUU (서열번호 97) 21
miR-197 guide UUCACCACCUUCUCCACCCAGC (서열번호 98) 22
passenger UGGGUGGAGAAGGUGGUGAAUU (서열번호 99) 22
miR-198 guide GGUCCAGAGGGGAGAUAGG (서열번호 100) 19
passenger UAUCUCCCCUCUGGAUUUU (서열번호 101) 19
miR-199a guide CCCAGUGUUCAGACUACCUGUUC (서열번호 102) 23
passenger ACAGGUAGUCUGAACACUGGUUU (서열번호 103) 23
miR-19a guide UGUGCAAAUCUAUGCAAAACUGA (서열번호 104) 23
passenger AGUUUUGCAUAGAUUUGCACAUU (서열번호 105) 23
miR-19b guide UGUGCAAAUCCAUGCAAAACUGA (서열번호 106) 23
passenger AGUUUUGCAUGGAUUUGCAUAUU (서열번호 107) 23
miR-200b guide UAAUACUGCCUGGUAAUGAUGAC (서열번호 108) 23
passenger CAUCAUUACCAGGCAGUAUUAUU (서열번호 109) 23
miR-203 guide GUGAAAUGUUUAGGACCACUAG (서열번호 110) 22
passenger AGUGGUCCUAAACAUUUCAUUU (서열번호 111) 22
miR-205 guide UCCUUCAUUCCACCGGAGUCUG (서열번호 112) 22
passenger GACUCCGGUGGAAUGAAGGAUU (서열번호 113) 22
miR-206 guide UGGAAUGUAAGGAAGUGUGUGG (서열번호 114) 22
passenger ACACACUUCCUUACAUUCUAUU (서열번호 115) 22
miR-20a guide UAAAGUGCUUAUAGUGCAGGUAG (서열번호 116) 23
passenger ACCUGCACUAUAAGCACUUUAUU (서열번호 117) 23
miR-21 guide UAGCUUAUCAGACUGAUGUUGA (서열번호 118) 22
passenger AACAUCAGUCUGAUAAGUUAUU (서열번호 119) 22
miR-212 guide UAACAGUCUCCAGUCACGGCC (서열번호 120) 21
passenger CCGUGACUGGAGACUGUUAUU (서열번호 121) 21
miR-214 guide ACAGCAGGCACAGACAGGCAG (서열번호 122) 21
passenger GCCUGUCUGUGCCUGCUGUUU (서열번호 123) 21
miR-215 guide AUGACCUAUGAAUUGACAGAC (서열번호 124) 21
passenger CUGUCAAUUCAUAGGUCAUUU (서열번호 125) 21
miR-218 guide UUGUGCUUGAUCUAACCAUGU (서열번호 126) 21
passenger AUGGUUAGAUCAAGCAUAAUU (서열번호 127) 21
miR-219 guide UGAUUGUCCAAACGCAAUUCU (서열번호 128) 21
passenger AAUUGCGUUUGGACAAUUAUU (서열번호 129) 21
miR-221 guide AGCUACAUUGUCUGCUGGGUUUC (서열번호 130) 23
passenger AACCCAGCAGACAAUGUAGUUGU (서열번호 131) 23
miR-222 guide AGCUACAUCUGGCUACUGGGUCUC (서열번호 132) 24
passenger GACCCAGUAGCCAGAUGUAGCUCC (서열번호 133) 24
miR-223 guide UGUCAGUUUGUCAAAUACCCC (서열번호 134) 21
passenger GGUAUUUGACAAACUGACAUU (서열번호 135) 21
miR-23b guide AUCACAUUGCCAGGGAUUACC (서열번호 136) 21
passenger UAAUCCCUGGCAAUGUGCUUU (서열번호 137) 21
miR-24 guide UGGCUCAGUUCAGCAGGAACAG (서열번호 138) 22
passenger GUUCCUGCUGAACUGAGCCAUU (서열번호 139) 22
miR-25 guide CAUUGCACUUGUCUCGGUCUGA (서열번호 140) 22
passenger AGACCGAGACAAGUGCAAUUCU (서열번호 141) 22
miR-26a guide UUCAAGUAAUCCAGGAUAGGC (서열번호 142) 21
passenger CUAUCCUGGAUUACUUGAAUU (서열번호 143) 21
miR-27a guide UUCACAGUGGCUAAGUUCCGC (서열번호 144) 21
passenger GGAACUUAGCCACUGUGAAUU (서열번호 145) 21
miR-296 guide AGGGCCCCCCCUCAAUCCUGU (서열번호 146) 21
passenger AGGAUUGAGGGGGGGCUUUUU (서열번호 147) 21
miR-29a guide UAGCACCAUCUGAAAUCGGUUA (서열번호 148) 22
passenger ACCGAUUUCAGAUGGUGCUAUU (서열번호 149) 22
miR-29b guide UAGCACCAUUUGAAAUCAGUGUU (서열번호 150) 23
passenger CACUGAUUUCAAAUGGUGCUAUU (서열번호 151) 23
miR-29c guide UAGCACCAUUUGAAAUCGGUUA (서열번호 152) 22
passenger ACCGAUUUCAAAUGGUGCUAUU (서열번호 153) 22
miR-301 guide CAGUGCAAUAGUAUUGUCAAAGC (서열번호 154) 23
passenger UUUGACAAUACUAUUGCAUUAUU (서열번호 155) 23
miR-302b guide UAAGUGCUUCCAUGUUUUAGUAG (서열번호 156) 23
passenger ACUAAAACAUGGAAGCACUUAUU (서열번호 157) 23
miR-30a guide UGUAAACAUCCUCGACUGGAAG (서열번호 158) 22
passenger UCCAGUCGAGGAUGUUUAUAUU (서열번호 159) 22
miR-30c guide UGUAAACAUCCUACACUCUCAGC (서열번호 160) 23
passenger UGAGAGUGUAGGAUGUUUAUAUU (서열번호 161) 23
miR-31 guide GGCAAGAUGCUGGCAUAGCUG (서열번호 162) 21
passenger GCUAUGCCAGCAUCUUGUUUU (서열번호 163) 21
miR-32 guide UAUUGCACAUUACUAAGUUGC (서열번호 164) 21
passenger AACUUAGUAAUGUGCAAUAUU (서열번호 165) 21
miR-320 guide AAAAGCUGGGUUGAGAGGGCGAA (서열번호 166) 23
passenger CGCCCUCUCAACCCAGCUUUUUU (서열번호 167) 23
miR-324-3p guide CCACUGCCCCAGGUGCUGCUGG (서열번호 168) 22
passenger AGCAGCACCUGGGGCAGUAGUU (서열번호 169) 22
miR-338 guide UCCAGCAUCAGUGAUUUUGUUGA (서열번호 170) 23
passenger AACAAAAUCACUGAUGCUGCAUU (서열번호 171) 23
miR-339 guide UCCCUGUCCUCCAGGAGCUCA (서열번호 172) 21
passenger AGCUCCUGGAGGACAGGAAUU (서열번호 173) 21
miR-345 guide UGCUGACUCCUAGUCCAGGGC (서열번호 174) 21
passenger CCUGGACUAGGAGUCAGCAUU (서열번호 175) 21
miR-34a guide UGGCAGUGUCUUAGCUGGUUGUU (서열번호 176) 23
passenger CAACCAGCUAAGACACUGCCAUU (서열번호 177) 23
miR-367 guide AAUUGCACUUUAGCAAUGGUGA (서열번호 178) 22
passenger ACCAUUGCUAAAGUGCAAUUUU (서열번호 179) 22
miR-372 guide AAAGUGCUGCGACAUUUGAGCGU (서열번호 180) 23
passenger GCUCAAAUGUCGCAGCACUUUUU (서열번호 181) 23
miR-373 guide GAAGUGCUUCGAUUUUGGGGUGU (서열번호 182) 23
passenger ACCCCAAAAUCGAAGCACUUUUU (서열번호 183) 23
miR-383 guide AGAUCAGAAGGUGAUUGUGGCU (서열번호 184) 22
passenger CCACAAUCACCUUCUGAUCUUU (서열번호 185) 22
miR-429 guide UAAUACUGUCUGGUAAAACCGU (서열번호 186) 22
passenger GGUUUUACCAGACAGUAUUAUU (서열번호 187) 22
miR-451 guide AAACCGUUACCAUUACUGAGUUU (서열번호 188) 23
passenger ACUCAGUAAUGGUAACGGUUUUU (서열번호 189) 23
miR-452 guide UGUUUGCAGAGGAAACUGAGAC (서열번호 190) 22
passenger CUCAGUUUCCUCUGCAAACAUU (서열번호 191) 22
miR-488 guide CCCAGAUAAUGGCACUCUCAA (서열번호 192) 21
passenger GAGAGUGCCAUUAUCUGUGUU (서열번호 193) 21
miR-7 guide UGGAAGACUAGUGAUUUUGUUG (서열번호 194) 22
passenger ACAAAAUCACUAGUCUUCUAUU (서열번호 195) 22
miR-9 guide UCUUUGGUUAUCUAGCUGUAUGA (서열번호 196) 23
passenger AUACAGCUAGAUAACCAAAGGUU (서열번호 197) 23
miR-92 guide UAUUGCACUUGUCCCGGCCUG (서열번호 198) 21
passenger GGCCGGGACAAGUGCAAUAUU (서열번호 199) 21
miR-93 guide AAAGUGCUGUUCGUGCAGGUAG (서열번호 200) 22
passenger ACCUGCACGAACAGCACUUUCC (서열번호 201) 22
miR-95 guide UUCAACGGGUAUUUAUUGAGCA (서열번호 202) 22
passenger CUCAAUAAAUACCCGUUGAAUU (서열번호 203) 22
miR-99b guide CACCCGUAGAACCGACCUUGCG (서열번호 204) 22
passenger CAAGGUCGGUUCUACGGGUCUU (서열번호 205) 22
상기 miRNA는 화학합성에 의해 루프 및 스템으로 구성된 헤어핀 구조의 단일가닥 RNA (shRNA, short hairpin RNA) 또는 이중가닥 RNA(siRNA, small intefering RNA)로 합성될 수 있으며, 상기 miRNA를 코드하는 DNA 서열을 siRNA 발현용 바이러스 또는 플라스미드 벡터에 삽입하여 제조한 재조합 벡터로 플라스미드 벡터의 형태로 제공될 수 있다.상기 발현벡터는 siRNA 발현에 효율적인 프로모터를 포함하는데, 상기 프로모터는 RNA polymerase II 또는 RNA polymerase III에 의해 인식되는 것이 바람직하며, 특히 RNA polymerase III에 의해 인식되는 것이 더욱 바람직하며, U6 프로모터 또는 H1 프로모터인 것이 가장 바람직하다. 상기와 같은 siRNA 발현벡터는 pSilencer (Ambion, Inc.), pSiEx (Novagen, Inc.), siXpress (Takara Bio, Inc.) 및 pBLOCK-iT™ (Invitrogen, Inc.) 및 SilenCircle™ (Allele) 등을 사용할 수 있으며, 이에 제한되는 것은 아니다.
miRNA들을 리포터 플라스미드와 함께 HeLa 세포로 공동형질전환(co-transfect)하였다. HeLa 세포들은 소 태아 혈청(fetal bovine serum) 10%를 첨가한 DMEM 배지에서 배양되었다. MCF-7, MDA-MB-231, SW480 및 SNU-638 세포들은 소 태아 혈청 10%를 첨가한 RPMI1640 배지에서 배양하였다. 플라스미드와 RNA 올리고뉴클레오타이드는 제조자의 프로토콜에 따라 Lipofectamine2000(Invitrogen)을 이용하여 포유류 세포에 형질전환시켰다. siRNA 올리고뉴클레오타이드는 Samchully Pharmaceutical에서 구입하였다.
sip85α 5'-UAUUGAAGCUGUAGGGAAA-3' (서열번호 1);
siCdc42 5'-CUGCAGGGCAAGAGGAUUA-3' (서열번호 2);
sip53 5'-AACUACUUCCUGAAAACAA-3' (서열번호 3);
si루시페라제 5‘CUUACGCUGAGUACUUCGATT-3＇(서열번호 4);및
siGFP 5’-UGAAUUAGAUGGCGAUGUU-3＇ (서열번호 5)
상기 리포터 플라스미드인 pGL3-luc는 루시페라제 유전자의 상류에 p53 결합 부위를 13개 가지고 있어서, p53 활성의 정량적 측정이 가능하다. 상기 pG13-luc 측정에서 p53을 가장 강화하는 10개 miRNA(miR-186, miR-187, miR-95, miR-191, miR-181b, miR-155, miR-29a, miR-183, miR-125a, miR-302b)를 선택하였으며, 대조군으로는 p53의 활성에 영향을 미치지 않는 것으로 보이는 miR-451과 miR-212를 선택하였다. 상기 스크리닝의 결과는 miRNA들이 p53 활성에 대하여 각각 다른 효과를 가진다는 것을 보여준다(도 1).
<실시예 2> miR-29의 p53 활성 촉진 및 세포사 유도
상기 miRNA들을 처리한 세포에 웨스턴블럿(도 2), MTT 측정(도 3) 및 FACS 분석(도 4)을 실시하였다. MTT 측정은 HeLa 세포들을 96-웰 플레이트에 접종(seed)하고, miRNA 각각으로 형질전환시켜, 3일 후, 각각의 웰에 MTT 용액(2mg/ml) 50㎕를 첨가하였으며, 37℃에서 2시간 동안 배양하였다. 그리고 DMSO 150㎕를 각각의 웰에 첨가하였으며, 마이크로플레이트 리더(microplate reader)를 이용하여 590nm에서의 흡광도를 측정함으로써 수행하였다. FACS 분석은 형질전환 후 이틀 후, 70% 에탄올로 세포들을 고정하고, RNase(5 ㎍/㎖)로 처리한 후 프로피디움 아이오다이드(propidium iodide) (50 μg/ml) 으로 염색하고, Cell Quest program를 이용하여 FACSCalibur (Becton Dickinson)에서 상기 염색된 세포들의 DNA 함량을 분석함으로써 수행하였다. 도 1에서 보듯, miR-29a는 상기 세 개 시험에서 모두 양성 결과를 보인 유일한 miRNA로, 이는 miR-29a가 p53을 활성화시키고 세포사를 유도할 가능성을 제시한다.
miR-29a와 2개의 유사체, miR-29b 와 miR-29c(도 5)는 각각 또는 혼합물(mixture)로, 형질전환된 HeLa 세포에서 p53 단백질 수준을 증가시킨다(도 20). miR-29 miRNA들(miR-29)들이 세포사를 유도하는 것이 Annexin V 염색에 의하여 확인되었다(도 6). Annexin V 염색은 형질전환 후 하루 후, HeLa 세포들을 PBS로 씻어내고, 4% 파라포름알데하이드(paraformaldehyde)로 1시간동안 고정시켰으며, 세포들을 두 차례 씻어내고, FITC-결합된 Annexin V로 결합 버퍼(binding buffer, 10mM Hepes, pH7.4, 140mM NaCl, 25mM CaCl2)에서 2시간 동안 염색하여 수행하였다. 염색된 세포들은 형광발광 현미경(40X)로 시각화하였다. 　
이와 역시 일치하는 것인데, 배양 내 HeLa 세포의 숫자 역시 miR-29 처리에 따라 감소하였다(도 7). 그러나 돌연변이 miR-29(miR-29Mut, 4nt 대체, 도 5)는 p53을 유도하지 못하였다(도 20). 돌연변이는 Stratagene의 Quick-Change Site-Directed Mutagenesis kit를 이용하여 위치지정 돌연변이를 유도한 것이다.
p85α 3'UTR 돌연변이를 위한 프라이머 세트는
5’-CAAAGAGGCCTTTAACCATGGGTAGTGTTAATGCTTTCTGAAGC-3’ (forward : 서열번호 6);및
5’-GCTTCAGAAAGCATTAACACTACCCATGGTTAAAGGCCTCTTTG-3’ (reverse : 서열번호 7)이다.
Cdc42 3' UTR의 상류 타겟영역(위치 577~599)에 사용된 프라이머는
5’-CATGTTCCCCATCTGGGTAGCTTAGGAAGGAGTATAG-3’ (forward : 서열번호 8);및
5’-CTATACTCCTTCCTAAGCTACCCAGATGGGGAACATG-3’ (reverse : 서열번호 9)이다.
Cdc42 UTR의 하류 타겟영역(위치 997~1019)에 사용된 프라이머는
5’-GAGGAAATACGAGGGGTGGGTAGAGAAGACAGACATCTGTGG-3’ (서열번호 10);및
5’-CCACAGATGTCTGTCTTCTCTACCCACCCCTCGTATTTCCTC-3’ (서열번호 11)이다.
miR-29에 의하여 유도되는 세포사는 야생형 p53을 발현시키는 세포(예. HeLa 및 MCF-7)에서만 일어난다(도 21). miR-29 처리에도 p53 돌연변이를 불활성화시키는 MDA-MB-231 와 SW480 세포들은 세포사가 유도되지 않았는데(도 21), 이는 miR-29-유도되는 세포사에 야생형 p53이 필요하다는 것을 의미한다. 이와 일치하는 것으로, MCF-7 세포들이 RNAi에 의하여 p53이 감소될 때, miR-29c는 세포 사멸(cell death)를 유도하는데 훨씬 덜 효과적이다(도 22). 그러므로 이는 miR-29들이 p53 활성화를 통하여 세포사를 유도한다는 것을 의미한다.
본 발명자들은 단백질 합성을 저해하는 cycloheximide의 처리 후 p53의 반감기를 측정하였다(도 23). p53의 턴오버(turnover) 비율은 보통 HeLa 세포에서 매우 높은데, miR-29들이 존재할 때에는, p53은 상당히 많이 안정해진다.RT-PCR 분석 결과, miR-29들의 처리는 p53 mRNA 수준에 영향을 미치지 않았다는 것을 알 수 있었는데(도 9), 이는 p53이 단백질 안정화를 통하여 축적된다는 것을 의미한다. RT-PCR 수행시 RNA 전체는 Invitrogen의 Trizol를 이용하여 제조하였으며, Takara의 DNase I으로 처리하였으며, 역전사는 M-MuLV 역전사효소(Fermentas)로 제조사의 프로토콜에 따라 수행하였다. p53 mRNA가 miR-29 결합 부위를 전혀 가지고 있지 않는 것으로 보아 miR29들이 p53을 직접적으로 타겟으로 하지는 않는 것으로 보인다.
<실시예 3> miR-29의 p85α 활성 억제
본 발명자들은 타겟스캔(TargetScan, www.targetscan.org)를 이용하여, p85α와 Cdc42(Cell division cycle 42)가 그것들의 3´UTR에 각각 하나 및 두 개의 타겟 영역으로 추정되는 영역을 가지는 것을 발견하였다(도 10 및 도 11). p85α 단백질은, 세포 생존 및 세포사의 균형을 유지하는데 있어서 중점적인 역할을 하는 파스파티딜이노시톨 3 키나제(phosphatidylinositol 3 kinase, PI3K)의 조절 단위(subunit)이며, Cdc42 단밸질은 세포 형태, 세포 이동(migration) 및 세포주기 진행을 조절하는 GTPase의 Rho 과(family) 중 하나이다. 하기의 프라이머들을 이용하여 p85α 3'UTR을 증폭하였다.
5’-CACACGTTCCTAAGCTGGAGTG-3’ (서열번호 12); 및
5’-CAGTCCAGAGCAGTGACAGTATGAC-3’ (서열번호 13)
증폭산물들은 pGL3_CMV 벡터(PRomega의 pGL3의 변형된 형태) 내의 루시페라제 유전자의 하류에 형질전환시켰다.
웨스턴 블럿으로 측정한 결과, miR-29들의 존재 하, p85α 단백질 수준이 감소하는 것이 관찰되었다(도 24). 웨스턴 블럿의 수행을 위하여, miRNA 및 siRNA의 형질전환 후 2일 후 세포 용해물 전체를 RIPA 버퍼(25mM Tris (pH 7.4), 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS)를 이용하여 제조하였으며, 각각의 단백질 샘플들 30~50 ㎍은 SDS-PAGE 10~12.5%에 의하여 분리되었다. 단백질들은 Amersham semi-dry transfer system을 이용하여 PVDF막에 이식(transfer)하여 웨스턴 블럿을 수행하였다. 이 때, p85α 단일클론 항체는 Cell Signaling에서 구입하였으며, p53, Cdc42 및 GAPDH 단일클론항체는 SantaCruz에서 구입하였다.
miR-29가 p85α을 직접적으로 타겟으로 하는지 여부를 확인하기 위하여 p85α 3´UTR을 갖는 리포터를 제조하여(generate) 시험하였다. 루시페라제 분석을 위하여, HeLa 또는 SNU-638 세포들을 형질전환되기 하루 전에 24-웰 플레이트에 접종(seed)하였다. siRNA의 공동형질전환을 위하여 반딧불이의 루시페라제 리포터 플라스미드 180ng 및 레닐라(renilla) 루시페라제의 20ng 리포터 플라스미드를 2가닥(duplex) siRNA 30nM 와 함께 HeLa 세포들에 재빨리(transiently) 형질전환하였다.
2'-O-Me miRNA 저해제의 공동형질전환을 위하여 반딧불이의 루시페라제 리포터 플라스미드 90ng 및 레닐라(renilla) 루시페라제의 10ng 리포터 플라스미드를 2'-O-Me miRNA 저해제 200nM와 함께 SNU-638 세포들에 일시적으로 재빨리(transiently) 형질전환하였다.
p53 활성 측정을 위하여, pGL3-Luc 리포터 500ng 및 레닐라 루시페라제 리포터 플라스미드 20mg이 miRNA 30nM과 함께 공동형질전환되었다.
p85α와 Cdc42 과발현을 위하여 단백질 발현 플라스미드 200ng가 pGL3-Luc 400ng 및 레닐라 루시페라제 리포터 플라스미드 20ng와 함께 공동형질전환되었다.
48시간 후, 루시페라제 활성은 제조사의 프로토콜에 따라 Promega사의 Dual-luciferase assay kit를 이용하여 측정되었다. 반딧불이 루시페라제 활성은 레닐라 루시페라제 활성으로 표준화하였으며, 모든 실험은 3번씩 수행되었다.
miR-29와 함께 HeLa 세포에 형질전환되었을 때, 루시페라제 활성이 20-30 % 감소하는 것을 알 수 있었다(도 25. 검은 막대). 반면, miR-29 타겟 부위로 예측되는 곳에 돌연변이를 가진 리포터(도 25. 흰 막대)는 miR-29들에 의하여 억제되지 않았다. 게다가, 2‘-O-메틸 변이(modification)을 가진 안티센스 올리고뉴클레오타이드를 이용한 내생 miR-29들의 억제는, miR-29들을 높은 수준으로 가진 SNU-638 세포들에서 루시페라제 발현을 증가시켰다(도 12, 도 13 및 도 14).
miRNA의 발현 정도는 노던 블롯팅으로 측정하였는데, RNA 전체는 15% 요소-아크릴아마이드 겔에서 용해한 후 Zetaprobe-GT-membrane (Bio-Rad)로 이식(transfer)하였으며, 각각의 miRNA에 상보적인 올리고뉴클레오타이드 프로브들은 T4 폴리뉴클레오타이드 활성효소(Takara)를 이용하여 말단-표지하였다.
안티센스 올리고뉴클레오타이드로 변형(modify)된 2‘-O-Me는 SAmchully Pharmaceutical에서 구입하였으며, miR-29 과(family member)의 특이적 억제에 사용하였다.
안티-miR-29a 5'-UAACCGAUUUCAGAUGGUGCUA-3' (서열번호 14);
안티-miR-29b 5'-AACACUGAUUUCAAAUGGUGCUA-3' (서열번호 15);
안티-miR-29c 5'-UAACCGAUUUCAAAUGGUGCUA-3' (서열번호 16);및
안티-siLuc 5'-AACUUACGCUGAGUACUUCGA-3' (서열번호 17)
<실시예 4> miR-29의 Cdc42 활성 억제
miR-29들의 또 다른 잠재적인 타겟은, miR-29들을 위한 타겟 영역을 두 개 가진 Cdc42 mRNA이다(도 11). Cdc42 3'UTR 프라이머들은
5’-CTCTCCAGAGCCCTTTCTGC-3’ (서열번호 18);및
5’-CAAAGAATTGAGACATGAGAAAGC-3’ (서열번호 19)를 사용하여 실시하였다.
증폭산물들은 pGL3_CMV 벡터(PRomega의 pGL3의 변형된 형태) 내의 루시페라제 유전자의 하류에 형질전환시켰다.웨스턴 블롯으로 측정한 결과, miR-29들로 형질전환된 HeLa 세포들에서의 Cdc42 단백질 수준이 감소한 것이 확인되었다(도. 26.). 게다가, 세포가 miR-29들로 형질전환되는 경우, Cdc42 mRNA의 3‘UTR을 가진 루시페라제 리포터는 40% 정도까지 억제되지만(도. 27, 검은 막대), 돌연변이된 타겟 영역을 가진 리포터는 miR-29들에 의하여 억제되지 않았다(도. 27. 하얀 막대). 이는 상기 두 영역이 miR-29의 Cdc42 조절을 중재한다는 것을 의미한다. miR-29들에 대한 2’-O-메틸 억제자(inhibitor)들은 SNU-638 세포들에서 리포터의 발현을 증가시켰다(도 12 및 도 13).
<실시예 5> Cdc42 및 p85α의 넉다운을 이용한 Cdc42 및 p85α의 p53 음성조절여부 확인
p85α와 Cdc42가 miR-29-중재(mediated) p53 활성화에 필요한지 시험하기 위하여, 본 발명자들은 먼저 상기 유전자들에 대한 RNAi를 제작(perform)하고, p53 활성을 측정하였다. p85α 및 Cdc42의 넉다운은 pGL3-luc 리포터 검사에서 p53 단백질 활성을 증가시키며(도 16), p53 단백질 수준을 증가시키는 것이 확인되었다(도 17). 이것과 같은 맥락으로, FACS 분석 결과, Cdc42 및 p85α의 넉다운이 세포사(apoptotic)한 세포의 수를 증가시키는 것이 확인되었다(도. 18). 이러한 데이터는 Cdc42와 p85α가 p53을 음성조절(negatively regulate)한다는 것을 의미한다.
<실시예 6> miR-29에 의한 Cdc42 및 p85α억제가 p53의 활성을 촉진하는지 여부의 확인
만약 miR-29들에 의한 Cdc42와 p85α의 억제가 p53의 유도에 정말로 결정적이라면, 상기 단백질들의 과발현은 p53에 대한 miR-29들의 효과를 회복시켜야 한다. 이것을 시험하기 위하여, Cdc42 또는 p85α를 발현시키는 플라스미드를 miR-29 mix와 함께 HeLa 세포에 형질전환시켰다. Cdc42, p85α, 또는 양쪽 다의 과발현은 p53 유도를 전환(reverse)하는데(도. 28, 하얀 막대), 이는 야생형 miR-29일 때만 일어나고 miR-29 돌연변이의 존재 하 Cdc42 또는 p85α의 발현은 p53의 활성에 거의 영향을 미치지 못하는 것을 확인하였다(도. 28, 회색 막대).
본 발명자들은 Cdc42와 p85α의 과발현이 miR-29들이 유도하는 세포사로부터 세포를 보호할 수 있을지 여부에 대하여 시험하였다. FACS 분석은, Cdc42와 p85α가 miR-29들과 함께 발현된 경우, 세포사된 세포의 수가 정말로 감소한다는 것을 보여주는데(도. 29), 이는 miR-29들이 Cdc42와 p85α의 억제를 통하여 p53을 활성화시킨다는 것을 의미한다.
본 명세서에 기재된 방법은, 대장암, 자궁경부암, 유방암을 포함한 다양한 암들의 치료 및 경감에 유용할 것이다. 게다가, 본 명세서에서 보고된 데이터는 암의 포괄적 이해를 돕고, 새로운 진단 전략의 발전을 촉진시키며, 치료제와 예방 물질들을 만들기 위한 분자적 타겟들을 규명하는데 단서를 제공한다. 이러한 정보는 종양발생을 더 깊이 이해하는데 도움이 되며, 암의 진단, 치료, 궁극적으로는 예방을 위한 새로운 전략을 발전시키는데 지표가 될 것이다. 본 발명이, 상세히 그리고 특정 실시예를 언급해가며 기재되었지만, 상기 기재는 사실 본보기나 설명적인 것이며, 발명과 그것의 적절한 예들을 설명하려는 것이다. 정형적인 설명을 통해, 당업자는 본 발명의 범위와 사상을 벗어나지 않고도 다양한 변화와 변형이 가능하다는 것을 쉽게 깨달을 것이다. 따라서, 본 상기 기재로 본 발명을 한정하려는 것이 아니고, 하기 청구의 범위 및 이와 균등한 범위로 본 발명의 범위를 정하려 한다.

Claims (33)

  1. miR-29를 유효성분으로 포함하는 항암제.
  2. 제 1항에 있어서, 상기 miR-29는 miR-29a, miR-29b 및 miR-29c로 구성된 군으로부터 선택된 어느 하나의 miRNA인 것을 특징으로 하는 항암제.
  3. 제 2항에 있어서, 상기 miR-29a는 서열번호 148의 서열을 갖는 것을 특징으로 하는 항암제.
  4. 제 2항에 있어서, 상기 miR-29b는 서열번호 150의 서열을 갖는 것을 특징으로 하는 항암제.
  5. 제 2항에 있어서, 상기 miR-29c는 서열번호 152의 서열을 갖는 것을 특징으로 하는 항암제.
  6. 제 1항 내지 제 5항 중 어느 한 항에 있어서, 상기 항암제는 만성 림프성 백혈병, 유방암, 자궁경부암, 섬유육종, 근육종, 지방육종, 연골육종, 골원성육종, 척삭종, 맥관육종, 내피육종, 림프관육종, 림프관내피아세포종, 활막종, 중피종, 유윙(Ewing) 종양, 평활근육종, 횡문근육종, 위암, 식도암, 결장종양, 직장암, 췌장암, 유방암, 난소암, 전립선암, 자궁암, 머리와 목 암, 피부암, 뇌암, 인상세포종양, 피지선종양, 유두상종양, 유두선종, 낭포선암, 수질종양, 기관지원성종양, 신장세포종양, 간암, 담즙선종양, 융모암, 정상피종, 태아종, 빌름스(Wilm's) 종양, 고환암, 폐종양, 소세포폐종양, 비소세포폐종양, 방광종양, 상피종, 신경교종, 성상세포종, 수아세포종, 두개인두종, 뇌실상의세포종, 송과체종, 혈관아세포종, 청음신경종, 회돌기교종, 수악종, 흑색종, 신경아세포종, 망막아세포종, 백혈병, 림프종 및 카포시(Kaposi) 육종 으로 구성된 군으로부터 선택된 어느 하나의 암의 치료 및 경감을 목적으로 하는 것을 특징으로 하는 항암제 .
  7. 제 1항 내지 제 5항 중 어느 한 항에 있어서, 상기 항암제는 p85α의 활성을 억제하는 것을 특징으로 하는 항암제.
  8. 제 1항 내지 제 5항 중 어느 한 항에 있어서, 상기 항암제는 Cdc42의 활성을 억제하는 것을 특징으로 하는 항암제.
  9. 제 1항 내지 제 5항 중 어느 한 항에 있어서, 상기 항암제는 p53의 활성을 촉진하는 것을 특징으로 하는 항암제.
  10. miR-29와 약학적으로 허용되는 담체 또는 매체를 혼합하는 공정을 포함하는 항암제의 제조방법.
  11. 제 10항에 있어서, 상기 miR-29는 miR-29a, miR-29b 및 miR-29c로 구성된 군으로부터 선택된 어느 하나의 miRNA인 것을 특징으로 하는 항암제의 제조방법.
  12. 제 11항에 있어서, 상기 miR-29a는 서열번호 148의 서열을 갖는 것을 특징으로 하는 항암제의 제조방법.
  13. 제 11항에 있어서, 상기 miR-29b는 서열번호 150의 서열을 갖는 것을 특징으로 하는 항암제의 제조방법.
  14. 제 11항에 있어서, 상기 miR-29c는 서열번호 152의 서열을 갖는 것을 특징으로 하는 항암제의 제조방법.
  15. 제 10항 내지 제 14항 중 어느 한 항에 있어서, 상기 항암제는 만성 림프성 백혈병, 유방암, 자궁경부암, 섬유육종, 근육종, 지방육종, 연골육종, 골원성육종, 척삭종, 맥관육종, 내피육종, 림프관육종, 림프관내피아세포종, 활막종, 중피종, 유윙(Ewing) 종양, 평활근육종, 횡문근육종, 위암, 식도암, 결장종양, 직장암, 췌장암, 유방암, 난소암, 전립선암, 자궁암, 머리와 목 암, 피부암, 뇌암, 인상세포종양, 피지선종양, 유두상종양, 유두선종, 낭포선암, 수질종양, 기관지원성종양, 신장세포종양, 간암, 담즙선종양, 융모암, 정상피종, 태아종, 빌름스(Wilm's) 종양, 고환암, 폐종양, 소세포폐종양, 비소세포폐종양, 방광종양, 상피종, 신경교종, 성상세포종, 수아세포종, 두개인두종, 뇌실상의세포종, 송과체종, 혈관아세포종, 청음신경종, 회돌기교종, 수악종, 흑색종, 신경아세포종, 망막아세포종, 백혈병, 림프종 및 카포시(Kaposi) 육종 으로 구성된 군으로부터 선택된 어느 하나의 암의 치료 및 경감을 목적으로 하는 것을 특징으로 하는 항암제의 제조방법.
  16. 약학적으로 유효한 양의, 하나 또는 그 이상의 miR-29를 개체에 투여하는 단계를 포함하는 암의 치료 방법.
  17. 제 16항에 있어서, 상기 miR-29는 miR-29a, miR-29b 및 miR-29c로 구성된 군으로부터 선택된 어느 하나의 miRNA인 것을 특징으로 하는 암의 치료방법.
  18. 제 17항에 있어서, 상기 miR-29a는 서열번호 148의 서열을 갖는 것을 특징으로 하는 암의 치료방법.
  19. 제 17항에 있어서, 상기 miR-29b는 서열번호 150의 서열을 갖는 것을 특징으로 하는 암의 치료방법.
  20. 제 17항에 있어서, 상기 miR-29c는 서열번호 152의 서열을 갖는 것을 특징으로 하는 암의 치료방법.
  21. 제 16항 내지 제 20항 중 어느 한 항에 있어서, 상기 치료 방법은 만성 림프성 백혈병, 유방암, 자궁경부암, 섬유육종, 근육종, 지방육종, 연골육종, 골원성육종, 척삭종, 맥관육종, 내피육종, 림프관육종, 림프관내피아세포종, 활막종, 중피종, 유윙(Ewing) 종양, 평활근육종, 횡문근육종, 위암, 식도암, 결장종양, 직장암, 췌장암, 유방암, 난소암, 전립선암, 자궁암, 머리와 목 암, 피부암, 뇌암, 인상세포종양, 피지선종양, 유두상종양, 유두선종, 낭포선암, 수질종양, 기관지원성종양, 신장세포종양, 간암, 담즙선종양, 융모암, 정상피종, 태아종, 빌름스(Wilm's) 종양, 고환암, 폐종양, 소세포폐종양, 비소세포폐종양, 방광종양, 상피종, 신경교종, 성상세포종, 수아세포종, 두개인두종, 뇌실상의세포종, 송과체종, 혈관아세포종, 청음신경종, 회돌기교종, 수악종, 흑색종, 신경아세포종, 망막아세포종, 백혈병, 림프종 및 카포시(Kaposi) 육종 으로 구성된 군으로부터 선택된 어느 하나의 암의 치료 및 경감을 목적으로 하는 것을 특징으로 하는 암의 치료방법.
  22. 제 16항 내지 제 20항 중 어느 한 항에 있어서, 상기 치료방법은 인간 또는 인간을 제외한 포유동물을 개체로 하는 것을 특징으로 하는 암의 치료방법.
  23. miR-29의 암 치료에의 용도.
  24. 제 23항에 있어서, 상기 miR-29는 miR-29a, miR-29b 및 miR-29c로 구성된 군으로부터 선택된 어느 하나의 miRNA인 것을 특징으로 하는 암 치료에의 용도.
  25. 제 24항에 있어서, 상기 miR-29a는 서열번호 148의 서열을 갖는 것을 특징으로 하는 암 치료에의 용도.
  26. 제 24항에 있어서, 상기 miR-29b는 서열번호 150의 서열을 갖는 것을 특징으로 하는 암 치료에의 용도.
  27. 제 24항에 있어서, 상기 miR-29c는 서열번호 152의 서열을 갖는 것을 특징으로 하는 암 치료에의 용도.
  28. 제 23항 내지 제 27항 중 어느 한 항에 있어서, 상기 암은 만성 림프성 백혈병, 유방암, 자궁경부암, 섬유육종, 근육종, 지방육종, 연골육종, 골원성육종, 척삭종, 맥관육종, 내피육종, 림프관육종, 림프관내피아세포종, 활막종, 중피종, 유윙(Ewing) 종양, 평활근육종, 횡문근육종, 위암, 식도암, 결장종양, 직장암, 췌장암, 유방암, 난소암, 전립선암, 자궁암, 머리와 목 암, 피부암, 뇌암, 인상세포종양, 피지선종양, 유두상종양, 유두선종, 낭포선암, 수질종양, 기관지원성종양, 신장세포종양, 간암, 담즙선종양, 융모암, 정상피종, 태아종, 빌름스(Wilm's) 종양, 고환암, 폐종양, 소세포폐종양, 비소세포폐종양, 방광종양, 상피종, 신경교종, 성상세포종, 수아세포종, 두개인두종, 뇌실상의세포종, 송과체종, 혈관아세포종, 청음신경종, 회돌기교종, 수악종, 흑색종, 신경아세포종, 망막아세포종, 백혈병, 림프종 및 카포시(Kaposi) 육종 으로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 암 치료에의 용도.
  29. miR-29의 항암제의 제조에 대한 용도.
  30. 제 29항에 있어서, 상기 miR-29는 miR-29a, miR-29b 및 miR-29c로 구성된 군으로부터 선택된 어느 하나의 miRNA인 것을 특징으로 하는 항암제의 제조에 대한 용도.
  31. 제 30항에 있어서, 상기 miR-29a는 서열번호 148의 서열을 갖는 것을 특징으로 하는 항암제의 제조에 대한 용도.
  32. 제 30항에 있어서, 상기 miR-29b는 서열번호 150의 서열을 갖는 것을 특징으로 하는 항암제의 제조에 대한 용도.
  33. 제 30항에 있어서, 상기 miR-29c는 서열번호 152의 서열을 갖는 것을 특징으로 하는 항암제의 제조에 대한 용도.
PCT/KR2009/000414 2008-12-05 2009-01-28 마이크로ｒｎａ를 유효성분으로 포함하는 항암제 및 그 제조방법 WO2010064762A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2008-0122995 2008-12-05
KR1020080122995A KR20100064516A (ko) 2008-12-05 2008-12-05 마이크로ｒｎａ를 유효성분으로 포함하는 항암제 및 그 제조방법

Publications (1)

Publication Number Publication Date
WO2010064762A1 true WO2010064762A1 (ko) 2010-06-10

Family

ID=42233400

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2009/000414 WO2010064762A1 (ko) 2008-12-05 2009-01-28 마이크로ｒｎａ를 유효성분으로 포함하는 항암제 및 그 제조방법

Country Status (2)

Country Link
KR (1) KR20100064516A (ko)
WO (1) WO2010064762A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102031308A (zh) * 2010-11-30 2011-04-27 华东师范大学 miRNA-29a化合物作为脑胶质瘤标志物的应用
CN102188718A (zh) * 2011-03-11 2011-09-21 山东大学 小分子RNA has-miR-29c在制备治疗肝癌的药物中的应用
US11261421B2 (en) 2016-06-27 2022-03-01 Cosmax Co., Ltd. Sporichthyaceae microorganism and use thereof

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101232119B1 (ko) * 2010-12-30 2013-02-12 연세대학교 산학협력단 ｍｉＲＮＡ를 유효성분으로 포함하는 종양성 질환 예방 또는 치료용 조성물
KR101286154B1 (ko) * 2011-08-10 2013-07-15 연세대학교 산학협력단 안티센스 올리고뉴클레오타이드를 포함하는 줄기세포로부터 연골세포 분화 촉진용 및 항암 약제학적 조성물
KR101662868B1 (ko) 2012-06-08 2016-10-05 가톨릭대학교 산학협력단 ｍｉＲ-29를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
KR102207608B1 (ko) 2019-04-24 2021-01-26 윤종오 카르복실산으로 유기화된 규소 이온 복합체 및 복합체의 제조방법과 이를 이용한 제품

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008097277A2 (en) * 2006-09-19 2008-08-14 The Ohio State University Research Foundation Tcl1 expression in chronic lymphocytic leukemia (cll) regulated by mir-29 and mir-181

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008097277A2 (en) * 2006-09-19 2008-08-14 The Ohio State University Research Foundation Tcl1 expression in chronic lymphocytic leukemia (cll) regulated by mir-29 and mir-181

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FABBI, M. ET AL.: "MicroRNA-29 Family Reverts A berrant Methylation in Lung Cancer by Targeting DNA methyltransferases 3A and 3B", PNAS, vol. 104, no. 40, 2 October 2007 (2007-10-02), pages 15805 - 15810 *
MOTT, J. L. ET AL.: "miR-29 Regulates Mcl-1 Protein Expression and Apoptosis", ONCOGENE, vol. 26, no. 42, 2 April 2007 (2007-04-02), pages 6133 - 6140 *
PEKARSKY, Y ET AL.: "Tcll Expression in Chronic Lymphocytic Leukemia Is Regulated by miR-29 and miR-181", CANCER RESEARCH, vol. 66, no. 24, 15 December 2006 (2006-12-15), pages 11590 - 11593 *
WANG, H. ET AL.: "NF-kappaB-YYl-miR-29 Regulatory Circuitry in Skeletal Myogenesis and Rhabdomyosarcoma.", CANCER CELL, vol. 14, no. 5, 4 November 2008 (2008-11-04), pages 369 - 381 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102031308A (zh) * 2010-11-30 2011-04-27 华东师范大学 miRNA-29a化合物作为脑胶质瘤标志物的应用
CN102188718A (zh) * 2011-03-11 2011-09-21 山东大学 小分子RNA has-miR-29c在制备治疗肝癌的药物中的应用
US11261421B2 (en) 2016-06-27 2022-03-01 Cosmax Co., Ltd. Sporichthyaceae microorganism and use thereof
US11634685B2 (en) 2016-06-27 2023-04-25 Cosmax Co., Ltd. Sporichthyaceae microorganism and use thereof

Also Published As

Publication number Publication date
KR20100064516A (ko) 2010-06-15

Similar Documents

Publication Publication Date Title
Diao et al. miR-203, a tumor suppressor frequently down-regulated by promoter hypermethylation in rhabdomyosarcoma
Abba et al. MicroRNAs as novel targets and tools in cancer therapy
KR101862080B1 (ko) 마이크로 rna 를 유효 성분으로 포함하는 암 치료용 약학 조성물
Bhaskaran et al. MicroRNAs: history, biogenesis, and their evolving role in animal development and disease
Liu et al. MicroRNAs, an active and versatile group in cancers
Karius et al. MicroRNAs in cancer management and their modulation by dietary agents
Fasanaro et al. microRNA: emerging therapeutic targets in acute ischemic diseases
US9072764B2 (en) MicroRNAs that regulate muscle cell proliferation and differentiation
Wahid et al. MicroRNA and diseases: therapeutic potential as new generation of drugs
US10227591B2 (en) Modulation of human cytomegalovirus replication by micro-RNA 132 (miR132), micro-RNA 145 (miR145) and micro-RNA 212 (miR212)
EP2208499A1 (en) Nucleic acid capable of regulating the proliferation of cell
WO2010064762A1 (ko) 마이크로ｒｎａ를 유효성분으로 포함하는 항암제 및 그 제조방법
Palma Flores et al. MicroRNAs driving invasion and metastasis in ovarian cancer: Opportunities for translational medicine
D’Adamo et al. MicroRNAs and autophagy: fine players in the control of chondrocyte homeostatic activities in osteoarthritis
Hyttinen et al. MicroRNAs in the regulation of autophagy and their possible use in age-related macular degeneration therapy
KR101667169B1 (ko) 암 치료제
Mirzaei et al. Exosomes and MicroRNAs in biomedical science
WO2011111715A1 (ja) 細胞周期を制御する核酸
Sempere et al. Translational implications of microRNAs in clinical diagnostics and therapeutics
KR20200026106A (ko) miRNA 억제제-알부민의 복합체를 유효성분으로 포함하는 암 치료제
Li et al. Small Activating RNAs: Towards Development of New Therapeutic Agents and Clinical Treatments
KR102180550B1 (ko) FAF1 단백질의 발현을 억제하는 miRNA를 유효성분으로 함유하는 신경 퇴행성 질환 예방 또는 치료용 약학적 조성물
González-Barriga et al. Role of miRNAs in muscle atrophy: the myotonic dystrophy paradigm
Mahmoud et al. MicroRNAs Role in Non-Communicable Diseases and Link to Multidrug Resistance, Regulation or Alteration
Ankenbruck Detection and Perturbation of MicroRNAs using Synthetic Chemical Probes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09830500

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09830500

Country of ref document: EP

Kind code of ref document: A1