WO2010064231A1 - Procédés d’analyse d’édition d’arn a-i et constructions d’acide nucléique capables de ceux-ci - Google Patents

Procédés d’analyse d’édition d’arn a-i et constructions d’acide nucléique capables de ceux-ci Download PDF

Info

Publication number
WO2010064231A1
WO2010064231A1 PCT/IL2009/001120 IL2009001120W WO2010064231A1 WO 2010064231 A1 WO2010064231 A1 WO 2010064231A1 IL 2009001120 W IL2009001120 W IL 2009001120W WO 2010064231 A1 WO2010064231 A1 WO 2010064231A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
adar
acid construct
expression
acid sequence
Prior art date
Application number
PCT/IL2009/001120
Other languages
English (en)
Inventor
Gideon Rechavi
Ninette Amariglio
Michal Safran
Zohar S. Barbash
Original Assignee
Tel Hashomer Medical Research Infrastructure And Services Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tel Hashomer Medical Research Infrastructure And Services Ltd. filed Critical Tel Hashomer Medical Research Infrastructure And Services Ltd.
Publication of WO2010064231A1 publication Critical patent/WO2010064231A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/914—Hydrolases (3)
    • G01N2333/978—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)

Definitions

  • the present invention in some embodiments thereof, relates to methods of analyzing A-I editing both in vitro and in vivo.
  • RNA editing by adenosine (A) to inosine (I) modification generates RNA and protein diversity in higher eukaryotes selectively altering both coding and non-coding sequences in nuclear transcripts.
  • the enzymes responsible for A-to-I editing the adenosine deaminases acting on RNA (ADARs), are ubiquitously expressed in mammals and specifically recognize partially double-stranded (ds) RNA structures where they modify individual adenosines depending on the local structure and sequence environment.
  • ADARl Since the initial cloning of the first RNA-specific adenosine deaminase, ADARl, a family of A-to-I editing enzymes (ADARl-3) has emerged. Both ADARl and ADAR2 are detected in many tissues, whereas ADAR3 is expressed only in restricted regions of the brain. Members of the ADAR gene family share common structural features such as two or three repeats of a dsRNA binding motif and a separate deaminase or catalytic domain. Certain structural features are unique to particular ADAR members. For instance, ADARl contains two Z-DNA binding motifs, whereas ADAR3 includes an arginine-rich, single-stranded RNA binding domain at the N terminus.
  • ADARs specifically target single nucleotides for editing within the partially double-stranded pre-mRNAs of their substrates, such as neuronal glutamate and serotonin receptor transcripts. Since inosine is read as guanosine by the translation machinery, A-to-I editing may lead to codon changes that result in the alteration of protein function.
  • the best studied A-to-I RNA editing event accrues in the AMPA glutamate receptor subunit GluR2 Q/R site.
  • Virtually 100 % of the transcripts of this gene are edited at this site such that the mRNA contains an arginine (R) codon (CIG) in place of the genomic glutamate (Q) codon (CAG).
  • R arginine
  • CAG genomic glutamate
  • Underediting of the GluR2 Q/R Q/R site greatly increases the Ca2+ permeability of AMPA receptors.
  • the increase in Ca2+ influx through the receptor channel may cause neural cell death.
  • Heterozygous mice, carriers of a modified GluR2 which can not be edited show increased AMPAR Ca2+ permeability causing epileptic seizures and premature death.
  • a to I editing events can also affect splicing, RNA localization (such as retention in the nucleus), RNA stability and translation. Since RNA editing acts on double stranded RNA, it can also affect other basic processes such as RNA interference and microRNA both of which depend on double stranded RNA.
  • nucleic acid constructs which are capable of assaying ADAR activity, whereby a localization of an encoded marker protein correlates with the presence of ADAR.
  • nucleic acid construct comprising a first nucleic acid sequence encoding a detectable expression product operably linked to a second nucleic acid sequence comprising a 3' UTR of HFE.
  • nucleic acid construct comprising a first nucleic acid sequence encoding a detectable expression product, and a second nucleic acid sequence being capable of regulating expression of the detectable expression product in an ADAR (adenosine deaminase acting on RNA) -sensitive fashion.
  • ADAR adenosine deaminase acting on RNA
  • nucleic acid construct of claim 1 wherein the second nucleic acid sequence comprises a target sequence for a miRNA
  • an additional nucleic acid construct comprising a nucleic acid sequence encoding the miRNA, the miRNA being a target for ADAR editing.
  • an isolated cell comprising the nucleic acid construct of the present invention. According to an aspect of some embodiments of the present invention there is provided an isolated cell comprising the nucleic acid construct system of the present invention.
  • transgenic non-human animal comprising the nucleic acid construct of the present invention.
  • a transgenic non-human animal comprising the nucleic acid construct system of the present invention.
  • a method of assaying ADAR activity comprising:
  • a method of identifying an agent capable of altering ADAR activity comprising: (a) expressing the nucleic acid construct of the present invention in a cell;
  • the ADAR is ADAR-I.
  • the second nucleic acid sequence encodes a target for the ADAR.
  • the second nucleic acid sequence hybridizes with the first nucleic acid sequence to generate a target for the ADAR.
  • the target for the ADAR is comprised in a post- transcriptional regulatory site.
  • the post-transcriptional regulatory site is selected from the group consisting of a splice site, a miRNA binding site, a translation initiation site and a nuclear localization signal. According to some embodiments of the invention, the post-transcriptional regulatory site is a miRNA binding site.
  • the nucleic acid construct further comprises a nucleic acid sequence encoding the miRNA, the miRNA being a target for ADAR editing.
  • the second nucleic acid sequence is of a 3' UTR of a gene selected from the group consisting of hemochromatosis (HFE), Malonyl CoA:ACP acyltransferase (mCAT), Lamina- associated polypeptide 2beta (Lap2beta) and Lin 28.
  • HFE hemochromatosis
  • mCAT Malonyl CoA:ACP acyltransferase
  • Lamina- associated polypeptide 2beta Lamina- associated polypeptide 2beta
  • Lin 28 Lin 28.
  • the second nucleic acid sequence comprises a 3' UTR of HFE.
  • the second nucleic acid sequence is as set forth in SEQ ID NO: 1.
  • the introducing is effected in vitro. According to some embodiments of the invention, the introducing is effected in vivo. According to some embodiments of the invention, the introducing is effected ex vivo.
  • a presence of the expression of the detectable expression product is indicative of ADAR activity.
  • an absence of the expression of the detectable expression product is indicative of ADAR activity.
  • FIG. 1 is a photograph illustrating long and short PCR products of the HFE 3'UTR.
  • the large form was detected using primers designed to recognize the intron in the HFE 3 ' UTR.
  • the short form was detected using primer designed to recognize both exons in the HFE 3 ' UTR.
  • FIGs. 2A-D are fluorescent microscope images illustrating the localization of endogenous HFE transcript with or without IFN ⁇ tratment.
  • HepG2 cells were either not treated (A 5 C) or treated with 2000 IU IFN ⁇ for 24 hours (B,D) fixed and hybridized to cye3 fluorescent probe designed against the long, un-spliced form of the HFE 3'UTR (A,B) or to a probe designed against the short spliced form of the HFE 3 'UTR.
  • FIGs. 3A-F are fluorescent microscope images illustrating YFP-3'UTR expression in HepG2 cells with either knockdown or over-expression of the ADARl.
  • Figure 3A YFP-HFE 3'UTR transfected to na ⁇ ve cells
  • Figure 3B YFP-HFE 3'UTR transfected to na ⁇ ve cells treated with IFN ⁇ afterwards
  • Figure 3C YFP-HFE 3'UTR transfected to ADARl knock down cells:
  • Figure 3D YFP-HFE 3'UTR transfected to ADARl knock down cells and treated with IFN ⁇ afterwards.
  • Figure 3E HepG2 cells were co-transfected with YFP-3'UTR and mock PcDNA3 vector.
  • Figure 3F HepG2 cells were co-transfected with ADARl over expression vector and with YFP-3'UTR. 48 hours post transfection, the cells were fixed and stained with DAPI. The pictures were taken using Olympus light microscope.
  • FIG. 4 is a bar graph illustrating CFP-3'UTR expression in cells transfected with mutated CFP-3'UTR.
  • the CFP-3'UTR was mutated in the 7 predicted editing sites of the HFE 3' UTR.
  • a-No mutation b- Mutations in the first site.
  • c-Second site d- Third site, e- Fourth site.
  • f. Fifth site, g- Sixth site, h- Seventh site.
  • the present invention in some embodiments thereof, relates to methods of methods of analyzing A-I editing both in vitro and in vivo and, more particularly, but not exclusively, to nucleic acid constructs capable of same.
  • RNA editing is catalyzed by the Adenosine Deaminase Acting on RNA (ADAR) group of enzymes that are capable of converting adenosine to inosine at a specific location in a double-stranded RNA structure.
  • ADAR Adenosine Deaminase Acting on RNA
  • RNA editing has recently emerged as a global post-transcriptional modification that affects thousands of transcripts. Most of these editing sites reside in 5' and 3' untranslated regions (UTRs) and intronic sequences. Accordingly, RNA editing can affect a wide range of post-transcriptional events including, RNA localization, splicing, gene silencing and miRNAs biogenesis. Alterations in RNA editing have now been linked to various human diseases including inflammation, epilepsy, depression, amyotrophic lateral sclerosis and cancer.
  • the present inventors postulated that a nucleic acid sequence capable of regulating expression of a reporter polypeptide in an ADAR-sensitive fashion may be used for the construction of such a tool.
  • the present inventors selected a sequence comprised in the 3' untranslated region (UTR) of the HFE gene (which had been shown by bioinformatic analyses to undergo A to I editing) and linked it to a polynucleotide encoding a reporter polypeptide.
  • UTR 3' untranslated region
  • the present inventors showed that when A to I editing took place, the reporter polypeptide was expressed ( Figures 3B and 3F). However, in the absence of A to I editing, no reporter polypeptide was expressed ( Figures 3A and 3C).
  • nucleic acid construct comprising a first nucleic acid sequence encoding a detectable expression product, and a second nucleic acid sequence being capable of regulating expression of the detectable expression product in an ADAR-sensitive fashion.
  • ADAR an abbreviation of "adenosine deaminase acting on RNA” refers to an enzyme which is a member of a family of enzymes that deaminate adenosine to inosine in a double stranded RNA.
  • ADARs share a common modulator organization which consists of a variable N-terminal region, a double stranded RNA binding domain and a zinc containing catalytic domain. Accordingly, the ADAR may be ADAR 1, 2 or 3 (EC 3.5.4).
  • ADARs are provided, by the following accession numbers: NP001033821, NP726761, NP569940, NP062629, NP001033676, NP056656, NP056655, NP00102 and NP112268.
  • the ADAR is a human ADAR.
  • the nucleic acid constructs of the present invention typically comprise two segments, a first segment encoding a detectable expression product and a second segment, operably linked to the first segment being capable of regulating expression of the detectable expression product in an ADAR-sensitive fashion.
  • the detectable expression product comprises a detectable moiety.
  • detectable moieties e.g. fluorescent or phosphorecent moieties
  • CAT bacterial chloramphenicol acetyl transferase
  • GFP green fluorescent protein
  • YFP yellow fluorescent protein
  • various bacterial luciferases e.g., the luciferases encoded by Vibrio harveyi, Vibrio fischeri, and Xenorhabdus luminescens, the firefly luciferase FFlux, antigenic tags, and the like.
  • the detectable expression- product may also be detected even in the absence of a "traditional" detectable moiety, such as those listed above.
  • a detectable expression product may be detected by methods including, but not limited to, Northern blots, amplification techniques (e.g. PCR), and the like.
  • the translated protein product can be detected by detecting the characteristic activity of the protein or by detecting the protein product itself (e.g. via Western blot, capillary electrophoresis, and the like).
  • the second segment of the expression construct is capable of regulating expression of the detectable expression product in an ADAR-sensitive fashion.
  • the detectable expression product serves as an indicator of ADAR activity in a present/absent mode (i.e. qualitiative) or by degree (i.e. quantitiative). Further the detectable expression product may be proportional or inversely proportional to ADAR activity. The present invention further contemplates a change in localization of the detectable expression product as an indicator of ADAR activity.
  • ADAR activity refers to the ability of the ADAR to deaminate adenosine to inosine in double stranded RNA.
  • a RNA is generated that comprises a target for ADAR.
  • the target is an adenine residue comprised in a double stranded RNA.
  • ADAR activity may create or destroy a post- transcriptional regulatory site in the transcribed RNA molecule, which in turn effects the expression and/or localization of the operably linked detectable expression product.
  • a splice site is one contemplated post-transcriptional site which may be comprised or created in the transcript of the regulatory region of the expression construct of the present invention.
  • splice site refers to any site which directs shortening of the polypeptide. Accordingly, the “splice site” may refer to both canonical and non- canonical splice sites. Introns are typically flanked by "GT” and "AG” which serve as splice sites.
  • the splice site may be destroyed.
  • an intron is flanked by "AT” and "AA”
  • deamination of the first A may serve to create a splice site.
  • a splice site may be created upon ADAR activity wherein, the long, non- edited transcript is retained in the nucleus and therefore not expressed, whereas the short, edited transcript is transported to the cytoplasm and subsequently expressed.
  • Exemplary sequences which may be used according to this embodiment include, but are not limited the 3' UTR of a gene selected from the group consisting of hemochromatosis (HFE; NM_139003) (e.g. SEQ ID NO: 1), Lamina-associated polypeptide 2beta (Lap2beta; NM_001032283, e.g. SEQ ID NO: 2) and nicolin (e.g.
  • the second nucleic acid sequence comprising the
  • 3'UTR is devoid of the associated coding region (i.e. does not comprise the HFE coding region etc.).
  • a splice site may be destroyed upon ADAR activity, wherein the long edited transcript is not expressed and the short non-edited transcript is expressed.
  • a miRNA binding sequence is another contemplated post-transcriptional site which may be generated in the transcript of the regulatory region of the expression construct of the present invention.
  • the regulatory region of the expression construct may be engineered such that upon transcription, the RNA comprises a target sequence for a miRNA.
  • the regulatory region may comprise the sequence
  • AAGCAAT (SEQ ID NO: 4), a known binding site for miRNA 137 (SEQ ID NO: 5).
  • the miRNA target sequence In the absence of ADAR activity, the miRNA target sequence is not affected and remains intact and, in the presence of the miRNA, expression of the detectable expression product will be down-regulated. However, in the presence of ADAR activity, the miRNA target sequence is destroyed (e.g. it becomes AAGCGAT -SEQ ID NO: 1
  • miRNA124 SEQ ID NO: 7
  • GCCTTA SEQ ID NO: 8
  • GCCTTG SEQ ID NO: 9
  • the regulatory region of the expression construct may be engineered such that upon ADAR activity a miRNA target sequence is created.
  • the expression construct may be engineered such that upon transcription, the RNA comprises a sequence that upon adenylation can create a miRNA 145 target sequence - e.g. GCAAAAAA (SEQ ID NO: 10).
  • a miRNA 129 target sequence may be created (e.g. it becomes GCAAAAAG (SEQ ID NO: 11), and the detectable expression product is down-regulated.
  • the expression construct may be engineered such that upon transcription, the RNA comprises a sequence that upon adenylation can create a miRNA 145 target sequence.
  • the RNA may comprise the following sequence: ACTGGAA (SEQ ID NO: 12). In the absence of ADAR activity, this sequence is not affected and has no regulatory effect on the detectable expression product. However, in the presence of ADAR activity, a miRNA 145 target sequence may be created (e.g. it becomes ACTGGAG (SEQ ID NO: 13), and the detectable expression product is down-regulated [Kawahara, Y et al., Science 315: 1137-1140].
  • this embodiment of this aspect of the present invention requires expression of the miRNA. Accordingly, the ADAR activity must either by assayed in cells known to express the particular miRNA or the miRNA may be introduced into the cell using the same expression construct as that used to introduce the detectable expression product into the cell or alternatively, using an additional expression construct.
  • Translation initiation sites and nuclear localization signals are other contemplated post-transcriptional sites which may be comprised or created in the regulatory region of the expression construct of the present invention.
  • Prasanth et al (Cell, 123, 249-263, 2005, incorporated herein by reference) have identified a sequence in the mouse cationic amino-acid transported 2 (mCAT) 3 1 UTR which upon ADAR activity acts to retain the RNA in the nucleus. Such a sequence is contemplated by the present invention.
  • Other contemplated constructs are those described in Chen et al [EMBO Journal 2008, 27, 1694-1705].
  • the expression construct of the present invention is constructed such that the RNA transcribed therefrom comprises a target sequence of a miRNA, the targeting miRNA itself comprising an ADAR targeting sequence.
  • the RNA transcribed therefrom may comprise a target sequence for a non- ADAR compromised miRNA e.g. mil231 (SEQ ID NO: 14), the targeting sequence being for example, AGCCGCC (SEQ ID NO: 15).
  • miRNA 1231 may be adenylated such that it no longer binds to the target sequence and expression of the detectable expression product is unaffected.
  • miRNA 1231 may bind to the target sequence and expression of the detectable expression product is down-regulated.
  • the RNA which is transcribed from the expression construct may comprise a target sequence for a non- ADAR compromised miRNA136 (SEQ ID NO: 16), e.g. ACCACCAA (SEQ ID NO: 17).
  • miRNA 136 may be adenylated such that it no longer binds to the target sequence and expression of the detectable expression product is unaffected.
  • miRNA 1231 may bind to the target sequence and expression of the detectable expression product is down-regulated.
  • the RNA which is transcribed from the expression construct may comprise a target sequence for an ADAR compromised miRNA e.g.
  • miRNA 424 (SEQ D NO: 18), the targeting sequence being for example ACGAACCG (SEQ ID NO: 19).
  • miRNA 424 may be adenylated such that it binds to the target sequence and expression of the detectable expression product is down-regulated.
  • miRNA 424 cannot bind to the target sequence and expression of the detectable expression product is unaffected.
  • the RNA transcribed from the expression construct may comprise a target sequence for miRNA 134 (SEQ ID NO: 20), the targeting sequence being for example TCCGGCCA (SEQ ID NO: 21).
  • miRNA 134 may be adenylated such that it binds to the target sequence and expression of the detectable expression product is down-regulated. In the absence of ADAR, miRNA 134 cannot bind to the target sequence and expression of the detectable expression product is unaffected.
  • this embodiment of this aspect of the present invention also requires expression of the miRNA. Accordingly, the ADAR activity must either by assayed in cells known to express the particular miRNA or the miRNA may be introduced into the cell using the same expression construct as that used to introduce the detectable expression product into the cell or alternatively, using an additional expression construct.
  • the second nucleic acid sequence is engineered such that its transcription product is capable of hybridizing to the transcription product of the first nucleic acid sequence at a position where it interferes with post- transcriptional processing and in doing so, creates a target for ADAR.
  • the second nucleic acid sequence no longer fully hybridizes with the first nucleic acid sequence and the post transcriptional processing is no longer masked.
  • a construct wherein the second nucleic acid sequence comprises an AIu sequence which is sensitive to ADAR.
  • the nucleic acid constructs of the present invention comprise promoters to allow for transcription of the detectable expression product.
  • Constitutive promoters suitable for use with this embodiment of the present invention include sequences which are functional (i.e., capable of directing transcription) under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV).
  • CMV cytomegalovirus
  • RSV Rous sarcoma virus
  • Inducible promoters suitable for use with this embodiment of the present invention include for example the tetracycline-inducible promoter (Srour, M.A., et al., 2003. Thromb. Haemost. 90: 398-405).
  • the promoter utilized by the nucleic acid construct of the present invention is active in the specific cell population transformed.
  • cell type-specific and/or tissue-specific promoters include promoters such as albumin that is liver specific [Pinkert et al., (1987) Genes Dev. 1:268-277], lymphoid specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275]; in particular promoters of T-cell receptors [Winoto et al., (1989) EMBO J. 8:729-733] and immunoglobulins; [Banerji et al.
  • neuron-specific promoters such as the neurofilament promoter [Byrne et al. (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], pancreas- specific promoters [Edlunch et al. (1985) Science 230:912-916] or mammary gland- specific promoters such as the milk whey promoter (U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166).
  • the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
  • the nucleic acid constructs may include additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • Typical cloning vectors contain transcription and translation initiation sequences (e.g., promoters, enhances) and transcription and translation terminators (e.g., polyadenylation signals).
  • Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
  • the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
  • the other upstream promoter elements determine the rate at which transcription is initiated.
  • Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types.
  • enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
  • CMV cytomegalovirus
  • Polyadenylation sequences can also be added to the nucleic acid construct in order to increase the translation efficiency of a polypeptide expressed from the expression vector of the present invention.
  • Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream.
  • Termination and polyadenylation signals that are suitable for the present invention include those derived from S V40.
  • the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
  • a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
  • the nucleic acid construct may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
  • the nucleic acid construct of the present invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single RNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.
  • IRS internal ribosome entry site
  • mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/-), ⁇ GL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
  • SV40 vectors include pSVT7 and pMT2.
  • Vectors derived from bovine papilloma virus include pB V- IMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5.
  • nucleic acid constructs of the present invention are engineered for assaying cellular ADAR activity.
  • a method of assaying ADAR activity comprising:
  • the cells may be isolated cells or non-isolated cells (i.e. comprised in tissues, organs or organisms); primary cells or cell lines; diseased cells or healthy cells; animal cells (e.g. human or mouse) or plant cells.
  • the preparation of transgenic mammals that express the constructs of the present invention requires introducing the nucleic acid constructs into an undifferentiated cell type.
  • the cell is an embryonic stem (ES) cell.
  • ES embryonic stem
  • the transformed ES cell is then injected into a mammalian embryo, where it will integrate into the developing embryo.
  • the embryo is then implanted into a foster mother for the duration of gestation.
  • Embryonic stem cells are typically selected for their ability to integrate into and become part of the germ line of a developing embryo so as to create germ line transmission of the heterologous gene construct.
  • any ES cell line that has this capability is suitable for use herein.
  • One mouse strain that is typically used for production of ES cells is the 129 J strain.
  • a preferred ES cell line is murine cell line D3 (American Type Culture Collection catalog no. CRL 1934).
  • the cells are cultured and prepared for DNA insertion using methods well known in the art, such as those set forth by Robertson (Robertson, In: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed., IRL Press, Washington, D.C., 1987.).
  • recombinant viral vectors are useful for in vivo expression of a desired nucleic acid because they offer advantages such as lateral infection and targeting specificity.
  • Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny.
  • Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
  • nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
  • viral or non-viral constructs such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
  • Useful lipids for lipid- mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Choi [Tonkinson et al., Cancer Investigation, 14(1): 54-65 (1996)].
  • the most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses.
  • a viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger.
  • Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct.
  • LTRs long terminal repeats
  • such a construct typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed.
  • the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of the present invention.
  • the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence.
  • a signal that directs polyadenylation will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
  • Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.
  • Transformed cells are cultured under effective conditions, which allow for the expression of the detectable expression product.
  • Effective in vitro culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit protein production.
  • An effective medium refers to any medium in which a cell is cultured to produce the recombinant polypeptide of the present invention.
  • Such a medium typically includes an aqueous solution having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins.
  • Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
  • Analysis of the detectable expression product expressed in the cells is dependent upon the type of detectable moiety comprised in the expression product and also upon the environment in which the cells are situated.
  • an expression product may be analyzed using a fluorescent microscope if it comprises a fluorescent moiety, or a luminescent reader if it comprises a luminescent moiety.
  • Detectable expression products produced within a cell of a transgenic animal are capable of being imaged or detected by a variety of means well known in the art. Since the imaging, or measuring photon emission from the subject, may last up to tens of minutes, the subject is desirably immobilized during the imaging process. Imaging of the light-generating polypeptide moiety involves the use of, e.g., a photodetector capable of detecting extremely low levels of light—typically single photon events—and integrating photon emission until an image can be constructed. Examples of such sensitive photodetectors include devices that intensify the single photon events before the events are detected by a camera, and cameras (cooled, for example, with liquid nitrogen) that are capable of detecting single photons over the background noise inherent in a detection system.
  • a photodetector capable of detecting extremely low levels of light—typically single photon events—and integrating photon emission until an image can be constructed. Examples of such sensitive photodetectors include devices that intensify the single photon events before the events
  • the "photodetector device” used should have a high enough sensitivity to enable the imaging of faint light from within an animal in a reasonable amount of time, and to use the signal from such a device to construct an image.
  • a pair of "night-vision" goggles or a standard high-sensitivity video camera such as a Silicon Intensified Tube (SIT) camera (e.g., from Hammamatsu).
  • SIT Silicon Intensified Tube
  • Photonic Systems Bridgewater, N.J.
  • an image appears as scintillating points of light, each representing a single detected photon.
  • a digital image processor By accumulating these detected photons in a digital image processor over time, an image can be acquired and constructed.
  • the signal at each image point is assigned an intensity value
  • photon counting imaging the amplitude of the signal carries no significance.
  • the objective is to simply detect the presence of a signal (photon) and to count the occurrence of the signal with respect to its position over time.
  • At least two types of photodetector devices can detect individual photons and generate a signal which can be analyzed by an image processor.
  • Reduced-Noise Photodetection Devices achieve sensitivity by reducing the background noise in the photon detector, as opposed to amplifying the photon signal. Noise is reduced primarily by cooling the detector array.
  • the devices include charge coupled device (CCD) cameras referred to as "backthinned", cooled CCD cameras. In the more sensitive instruments, the cooling is achieved using, for example, liquid nitrogen, which brings the temperature of the CCD array to approximately -120. degree. C.
  • “Backthinned” refers to an ultra-thin backplate that reduces the path length that a photon 5 follows to be detected, thereby increasing the quantum efficiency.
  • a particularly sensitive backthinned cryogenic CCD camera is the "TECH 512", a series 200 camera available from Photometries, Ltd. (Tucson, Ariz.).
  • Photon amplification devices amplify photons before they hit the detection screen.
  • This class includes CCD cameras with intensifiers, such as microchannel
  • a microchannel intensifier typically contains a metal array of channels perpendicular to and co-extensive with the detection screen of the camera.
  • the microchannel array is placed between the sample, subject, or animal to be imaged, and the camera. Most of the photons entering the channels of the array contact a side of a channel before exiting. A voltage applied across the array results in the release of many
  • RNA editing As mentioned, alterations in RNA editing have now been linked to various 20 human diseases including inflammation, epilepsy, depression, amyotrophic lateral sclerosis and cancer.
  • nucleic acid constructs of the present invention may be used to identify therapeutic agents for the treatment of such diseases.
  • a 25 method of identifying an agent capable of altering ADAR activity comprising:
  • agents that may be tested as potential ADAR altering agents include, but are not limited to, nucleic acids, e.g., polynucleotides, ribozymes, siRNA and antisense molecules (including without limitation RNA, DNA, RNA/DNA hybrids, peptide nucleic acids, and polynucleotide analogs having altered backbone and/or bass structures or other chemical modifications); proteins, polypeptides (e.g.
  • Small molecules can be, for example, naturally occurring compounds (e.g., compounds derived from plant extracts, microbial broths, and the like) or synthetic organic or organometallic compounds having molecular weights of less than about 10,000 daltons, preferably less than about 5,000 daltons, and most preferably less than about 1,500 daltons.
  • the agents are contacted with the cells for a period long enough to have an effect on ADAR.
  • This time period is typically greater than three hours, e.g. 24 hours or 48 hours.
  • the agent may be contacted with the cells either in vitro or in vivo (i.e. in the transgenic model).
  • detectable expression product It is expected that during the life of a patent maturing from this application many relevant detectable expression products will be developed and the scope of the term detectable expression product is intended to include all such new technologies a priori. Further, it is expected that during the life of a patent maturing from this application many relevant diseases will be identified that are linked to ADAR activity and the constructs of the present invention may be used in the analysis of such diseases and the search for therapeutic products for the treatment of such diseases. As used herein the term “about” refers to + 10 %.
  • the terms “comprises”, “comprising”, “includes”, “including”, “having” and their conjugates mean “including but not limited to”.
  • compositions, methods or structures may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
  • the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.
  • the term “a compound” or “at least one compound” may include a plurality of compounds, including mixtures thereof.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
  • ROSA26 ERFP-3'UTR HFE The 3' UTR of the HFE gene was PCR amplified by using PFU DNA polymerase and primers (3' UTR HFE F: 5' GGAAGATCTTAAGGGACGTGGCTAGTCATAACCTT 3' (SEQ ID NO: 22) 3' UTR HFE R 5' CCCAAGCTTCAATGTCCCTAGAGTGAAGAAACACG 3' (SEQ ID NO: 23) that introduced a 5' BgIII and 3' HindIII site.
  • the PCR product was subcloned into pERFP-Cl (Clontech).
  • pBigT contains two LoxP sites that flank a Neo expression cassette and a strong transcriptional stop sequence.
  • the Rosa-26 PA plasmid contains the Rosa-26 genomic sequence within which is inserted a linker that contains Pad and Ascl sites.
  • this plasmid contains a diphtheria toxin cassette (PGK-DTA) 3' of the ROSA26 genomic DNA to facilitate selection against nonhomologous recombinants.
  • PGK-DTA diphtheria toxin cassette
  • ERFP-3'UTR HFE plasmid was cut with Nhel and Apal. The liberated fluorescence cDNA was then ligated into pBig T that had been cut with the same enzymes.
  • the Pacl-Ascl fragment from pBigT- fluorescence containing the floxed neomycin cassette and ERFP-3'UTR HFE cDNA were ligated into pRosa-26PA cut with the same enzymes to make the L-S-L ERFP-3'UTR HFE ROSA26 targeting construct.
  • HEPG2 cells were transfected with 1 ⁇ g of either ERFP-3'UTR HFE or ERFP plasmids using Fugene transfection reagent according to the manufacturer's instructions. The next day, cells were split to 60-mm plates and allowed to recover for 6 hours before treatment INF ⁇ or ⁇ (up to 20,000 u) Twenty-four to 72 hours later, the intensity of the fluorescence light was measured using flouresnce microscopy.
  • HEPG2 cells were co-transfected with 1 ⁇ g of either CFP-3'UTR HFE and 1-2 ⁇ g of either ADARl or ADAR2, both of which were placed under the control of a CMV promoter.
  • 3'UTR HFE targeting construct was linearized with Kpnl and electroporated into TCl embryonic stem (ES) cells (derived from 129SvEv strain) by using standard techniques. Two of 100 G418-resistant ES clones underwent successful homologous recombination, as determined by Southern blot with a 5' ROSA26 probe (External Probe), and were microinjected into C57/BL6 blastocysts. High-percentage chimeric mice were obtained and bred to FVB-EIIA-Cre mice.
  • ES TCl embryonic stem
  • mice Genotyping PCR of genomic DNA was performed with AmpliTaq Gold DNA (Applied Biosystems) according to the manufacturer's instruction with forward primer 5'-CGGTATCGTAGAGTCGAGGCC-S' (SEQ ID NO: 24) and reverse primer 5'-GAACAGGTAGCTTCCCAGTAGTGC (SEQ ID NO: 25) from the RFP gene.
  • Detecting ERFP Expression in Vivo Intravital Confocal Laser Scanning Microscopy (CLSM) Imaging. All confocal analyses were carried out using an LSM 510 META (Zeiss, Jena, Germany) confocal laser scanning microscope with the following configurations: 25-mW krypton/ argon (488, 514, and 568 nm) and HeNe (633 nm) lasers, and a Ti-sapphire tunable pulse laser. To overcome the problem of high background fluorescence signals from an intact live mouse or an intact organ, spectral analysis was performed using a META detector. To isolate GFP fluorescence, lambda unmixing algorithm was used.
  • Intravital imaging of live mice was carried out using the above CLSM system. Mice were anesthetized with isoflurane (2.5 % in oxygen), hair from the imaged area was removed using a depilatory cream, and the anesthetized mouse was placed on the microscope stage and kept anesthetized while being imaged. To avoid GFP signal reduction, frozen sections of different tissues were imaged unfixed using the META detector and the lambda unmixing algorithm. Image analysis of average fluorescence intensity per square micrometer was carried out using MICA image analysis software (Cy to view LTD, Petach Tikva, Israel). The statistical difference in average area intensity in the different mice groups was calculated either by Student's t test or by analysis of variance using Microsoft Excel software (Microsoft, Redmond, WA). RESULTS
  • ESTs expressed sequence tags
  • UCSC public data base www.genomedotucscdotedu/indexdothtml. Sequence analysis revealed 7 A- to-I RNA editing sites in the 3' UTR of HFE.
  • the UCSC gene predictions indicated the presence of putative alternative splicing within the 3' UTR of the HFE gene.
  • HepG2 human hepatoma cell line
  • HFE 3 1 UTR Two RNA forms of HFE 3 1 UTR were detected; the full length form that is identical to the genomic sequence, and a shorter form in which a part of the sequence was removed (Figure 1). The full-length isoform was not edited whereas the short form underwent several editing events in six of the seven predicted A- to-I editing points. These results suggest that the HFE 3'UTR shortening is correlated with A-to-I editing of sites neighboring the splice sites. No canonical splice consensus sequences were identified.
  • RNA FISH was performed on untreated and IFN ⁇ - treated HepG2 cells using two probes; a probe specific for the long form, derived from the spliced out sequence, and a probe that recognizes both the short and the long forms ( Figures 2A-D).
  • Image analyses of the RNA FISH indicated that the long form is present in the nucleus only, independently of IFN ⁇ treatments ( Figures 2A, C).
  • short transcript expression was up- regulated and localized to the cytoplasm ( Figure 2 B 5 D).
  • each one of the seven putative edited adenosines to guanosine sites were site-directed mutated in the CFP- HFE3'UTR mini-gene.
  • HepG2 cells were transfected separately with each of the different mutated mini-genes and the fluorescence level was measured using confocal microscopy.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne une construction d’acide nucléique. La construction d’acide nucléique comprend une première séquence d’acide nucléique codant pour un produit d’expression détectable, et une seconde séquence d’acide nucléique capable de réguler l’expression du produit d’expression détectable de manière sensible à ADAR (adénosine désaminase active sur l’ARN). La présente invention concerne également des cellules et des animaux transgéniques comprenant ceux-ci. La présente invention concerne en outre des utilisations des constructions d’acide nucléique.
PCT/IL2009/001120 2008-12-02 2009-11-29 Procédés d’analyse d’édition d’arn a-i et constructions d’acide nucléique capables de ceux-ci WO2010064231A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US19347208P 2008-12-02 2008-12-02
US61/193,472 2008-12-02

Publications (1)

Publication Number Publication Date
WO2010064231A1 true WO2010064231A1 (fr) 2010-06-10

Family

ID=41796443

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2009/001120 WO2010064231A1 (fr) 2008-12-02 2009-11-29 Procédés d’analyse d’édition d’arn a-i et constructions d’acide nucléique capables de ceux-ci

Country Status (1)

Country Link
WO (1) WO2010064231A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017153849A1 (fr) * 2016-03-11 2017-09-14 Alcediag Algorithme et procédé in vitro basé sur l'édition d'arn visant à sélectionner l'effet particulier induit par des composés actifs
CN108165543A (zh) * 2017-12-26 2018-06-15 山东省农业科学院生物技术研究中心 水稻腺苷脱氨酶OsAD1及其编码基因在叶绿体基因RNA编辑中的应用
KR20190042660A (ko) * 2016-09-01 2019-04-24 프로큐알 테라퓨틱스 Ⅱ 비.브이. 화학적으로 변형된 단일 가닥 rna-편집 올리고뉴클레오타이드
CN114958834A (zh) * 2020-03-09 2022-08-30 中山大学 一种adar蛋白细胞内高效结合底物及应用

Citations (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3791932A (en) 1971-02-10 1974-02-12 Akzona Inc Process for the demonstration and determination of reaction components having specific binding affinity for each other
US3839153A (en) 1970-12-28 1974-10-01 Akzona Inc Process for the detection and determination of specific binding proteins and their corresponding bindable substances
US3850752A (en) 1970-11-10 1974-11-26 Akzona Inc Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically
US3850578A (en) 1973-03-12 1974-11-26 H Mcconnell Process for assaying for biologically active molecules
US3853987A (en) 1971-09-01 1974-12-10 W Dreyer Immunological reagent and radioimmuno assay
US3867517A (en) 1971-12-21 1975-02-18 Abbott Lab Direct radioimmunoassay for antigens and their antibodies
US3879262A (en) 1972-05-11 1975-04-22 Akzona Inc Detection and determination of haptens
US3901654A (en) 1971-06-21 1975-08-26 Biological Developments Receptor assays of biologically active compounds employing biologically specific receptors
US3935074A (en) 1973-12-17 1976-01-27 Syva Company Antibody steric hindrance immunoassay with two antibodies
US3984533A (en) 1975-11-13 1976-10-05 General Electric Company Electrophoretic method of detecting antigen-antibody reaction
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4034074A (en) 1974-09-19 1977-07-05 The Board Of Trustees Of Leland Stanford Junior University Universal reagent 2-site immunoradiometric assay using labelled anti (IgG)
US4098876A (en) 1976-10-26 1978-07-04 Corning Glass Works Reverse sandwich immunoassay
US4666828A (en) 1984-08-15 1987-05-19 The General Hospital Corporation Test for Huntington's disease
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
EP0264166A1 (fr) 1986-04-09 1988-04-20 Genzyme Corporation Animaux transformés génétiquement sécrétant une protéine désirée dans le lait
US4801531A (en) 1985-04-17 1989-01-31 Biotechnology Research Partners, Ltd. Apo AI/CIII genomic polymorphisms predictive of atherosclerosis
US4873316A (en) 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals
US4879219A (en) 1980-09-19 1989-11-07 General Hospital Corporation Immunoassay utilizing monoclonal high affinity IgM antibodies
US5011771A (en) 1984-04-12 1991-04-30 The General Hospital Corporation Multiepitopic immunometric assay
US5192659A (en) 1989-08-25 1993-03-09 Genetype Ag Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5272057A (en) 1988-10-14 1993-12-21 Georgetown University Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase
US5281521A (en) 1992-07-20 1994-01-25 The Trustees Of The University Of Pennsylvania Modified avidin-biotin technique
US5464764A (en) 1989-08-22 1995-11-07 University Of Utah Research Foundation Positive-negative selection methods and vectors
US7176345B2 (en) 2001-03-20 2007-02-13 Dana-Farber Cancer Institute, Inc. Transgenic animals expressing light-emitting fusion proteins and diagnostic and therapeutic methods therefor

Patent Citations (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3850752A (en) 1970-11-10 1974-11-26 Akzona Inc Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically
US3839153A (en) 1970-12-28 1974-10-01 Akzona Inc Process for the detection and determination of specific binding proteins and their corresponding bindable substances
US3791932A (en) 1971-02-10 1974-02-12 Akzona Inc Process for the demonstration and determination of reaction components having specific binding affinity for each other
US3901654A (en) 1971-06-21 1975-08-26 Biological Developments Receptor assays of biologically active compounds employing biologically specific receptors
US3853987A (en) 1971-09-01 1974-12-10 W Dreyer Immunological reagent and radioimmuno assay
US3867517A (en) 1971-12-21 1975-02-18 Abbott Lab Direct radioimmunoassay for antigens and their antibodies
US3879262A (en) 1972-05-11 1975-04-22 Akzona Inc Detection and determination of haptens
US3850578A (en) 1973-03-12 1974-11-26 H Mcconnell Process for assaying for biologically active molecules
US3935074A (en) 1973-12-17 1976-01-27 Syva Company Antibody steric hindrance immunoassay with two antibodies
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4034074A (en) 1974-09-19 1977-07-05 The Board Of Trustees Of Leland Stanford Junior University Universal reagent 2-site immunoradiometric assay using labelled anti (IgG)
US3984533A (en) 1975-11-13 1976-10-05 General Electric Company Electrophoretic method of detecting antigen-antibody reaction
US4098876A (en) 1976-10-26 1978-07-04 Corning Glass Works Reverse sandwich immunoassay
US4879219A (en) 1980-09-19 1989-11-07 General Hospital Corporation Immunoassay utilizing monoclonal high affinity IgM antibodies
US5011771A (en) 1984-04-12 1991-04-30 The General Hospital Corporation Multiepitopic immunometric assay
US4666828A (en) 1984-08-15 1987-05-19 The General Hospital Corporation Test for Huntington's disease
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (fr) 1985-03-28 1990-11-27 Cetus Corp
US4801531A (en) 1985-04-17 1989-01-31 Biotechnology Research Partners, Ltd. Apo AI/CIII genomic polymorphisms predictive of atherosclerosis
EP0264166A1 (fr) 1986-04-09 1988-04-20 Genzyme Corporation Animaux transformés génétiquement sécrétant une protéine désirée dans le lait
US4873316A (en) 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals
US5272057A (en) 1988-10-14 1993-12-21 Georgetown University Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase
US5464764A (en) 1989-08-22 1995-11-07 University Of Utah Research Foundation Positive-negative selection methods and vectors
US5487992A (en) 1989-08-22 1996-01-30 University Of Utah Research Foundation Cells and non-human organisms containing predetermined genomic modifications and positive-negative selection methods and vectors for making same
US5192659A (en) 1989-08-25 1993-03-09 Genetype Ag Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5281521A (en) 1992-07-20 1994-01-25 The Trustees Of The University Of Pennsylvania Modified avidin-biotin technique
US7176345B2 (en) 2001-03-20 2007-02-13 Dana-Farber Cancer Institute, Inc. Transgenic animals expressing light-emitting fusion proteins and diagnostic and therapeutic methods therefor

Non-Patent Citations (48)

* Cited by examiner, † Cited by third party
Title
"Animal Cell Culture", 1986
"Basic and Clinical Immunology", 1994, APPLETON & LANGE
"Cell Biology: A Laboratory Handbook", vol. I-III, 1994
"Current Protocols in Immunology", vol. I-III, 1994
"Current Protocols in Molecular Biology", vol. I-III, 1994
"Enhancers and Eukaryotic Expression", 1983, COLD SPRING HARBOR PRESS
"Genome Analysis: A Laboratory Manual Series", vol. 1-4, 1998, COLD SPRING HARBOR LABORATORY PRESS
"Immobilized Cells and Enzymes", 1986, IRL PRESS
"Methods in Enzymology", vol. 1-317, ACADEMIC PRESS
"Nucleic Acid Hybridization", 1985
"Oligonucleotide Synthesis", 1984
"PCR Protocols: A Guide To Methods And Applications", 1990, ACADEMIC PRESS
"Selected Methods in Cellular Immunology", 1980, W. H. FREEMAN AND CO.
"Transcription and Translation", 1984
ATHANASIADIS ET AL., PLOS BIOL., vol. 2, no. 12, December 2004 (2004-12-01)
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989, JOHN WILEY AND SONS
BANERJI ET AL., CELL, vol. 33, 1983, pages 729 - 740
BYRNE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 5473 - 5477
CALAME ET AL., ADV. IMMUNOL., vol. 43, 1988, pages 235 - 275
CHANG ET AL.: "Gene Therapy", 1995, CRC PRESS, ANN ARBOR, MICH.
CHEN ET AL., EMBO JOURNAL, vol. 27, 2008, pages 1694 - 1705
CHEN LING-LING ET AL: "Alu element-mediated gene silencing", EMBO (EUROPEAN MOLECULAR BIOLOGY ORGANIZATION) JOURNAL, vol. 27, no. 12, June 2008 (2008-06-01), pages 1694 - 1705, XP002573373, ISSN: 0261-4189 *
D.D. KIM ET AL., GENOME RES., vol. 14, 2004, pages 1719 - 1725
E.Y. LEVANON ET AL., NAT. BIOTECHNOL., vol. 22, 2004, pages 1001 - 1005
EDLUNCH ET AL., SCIENCE, vol. 230, 1985, pages 912 - 916
FRESHNEY: "Culture of Animal Cells - A Manual of Basic Technique", 1994, WILEY-LISS
GALLO ANGELA ET AL: "A-to-I RNA editing and cancer From pathology to basic science", RNA BIOLOGY, vol. 5, no. 3, July 2008 (2008-07-01), pages 135 - 139, XP002573375 *
GILBOA, BIOTECHNIQUES, vol. 4, no. 6, 1986, pages 504 - 512
KAWAHARA, Y ET AL., SCIENCE, vol. 315, pages 1137 - 1140
LEVANON E Y ET AL: "Systematic identification of abundant A-to-I editing sites in the human transcriptome", NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 22, no. 8, 1 August 2004 (2004-08-01), pages 1001 - 1005, XP002336893, ISSN: 1087-0156 *
LIANG H; LANDWEBER L, RNA, vol. 13, 2007, pages 463 - 467
LIANG HAN ET AL: "Hypothesis: RNA editing of microRNA target sites in humans?", RNA (COLD SPRING HARBOR), vol. 13, no. 4, April 2007 (2007-04-01), pages 463 - 467, XP002573374, ISSN: 1355-8382 *
MARSHAK ET AL.: "Strategies for Protein Purification and Characterization - A Laboratory Course Manual", 1996, CSHL PRESS
MORSE ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 99, 2002, pages 7906 - 7911
NATURE, vol. 427, February 2004 (2004-02-01)
PERBAL, B., A PRACTICAL GUIDE TO MOLECULAR CLONING, 1984
PERBAL: "A Practical Guide to Molecular Cloning", 1988, JOHN WILEY & SONS
PINKERT ET AL., GENES DEV., vol. 1, 1987, pages 268 - 277
PRASANTH ET AL., CELL, vol. 123, 2005, pages 249 - 263
ROBERTSON: "Teratocarcinomas and Embryonic Stem Cells: A Practical Approach", 1987, IRL PRESS
SAMBROOK ET AL.: "Molecular Cloning: A laboratory Manual", 1989
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRINGS HARBOR LABORATORY
SROUR, M.A. ET AL., THROMB. HAEMOST., vol. 90, 2003, pages 398 - 405
TONKINSON ET AL., CANCER INVESTIGATION, vol. 14, no. 1, 1996, pages 54 - 65
VECTORS: A SURVEY OF MOLECULAR CLONING VECTORS AND THEIR USES, 1988
VEGA ET AL.: "Gene Targeting", 1995, CRC PRESS, ANN ARBOR MICH.
WATSON ET AL.: "Recombinant DNA", SCIENTIFIC AMERICAN BOOKS
WINOTO ET AL., EMBO J., vol. 8, 1989, pages 729 - 733

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017153849A1 (fr) * 2016-03-11 2017-09-14 Alcediag Algorithme et procédé in vitro basé sur l'édition d'arn visant à sélectionner l'effet particulier induit par des composés actifs
KR20190042660A (ko) * 2016-09-01 2019-04-24 프로큐알 테라퓨틱스 Ⅱ 비.브이. 화학적으로 변형된 단일 가닥 rna-편집 올리고뉴클레오타이드
KR102501980B1 (ko) 2016-09-01 2023-02-20 프로큐알 테라퓨틱스 Ⅱ 비.브이. 화학적으로 변형된 단일 가닥 rna-편집 올리고뉴클레오타이드
CN108165543A (zh) * 2017-12-26 2018-06-15 山东省农业科学院生物技术研究中心 水稻腺苷脱氨酶OsAD1及其编码基因在叶绿体基因RNA编辑中的应用
CN108165543B (zh) * 2017-12-26 2021-01-22 山东省农业科学院生物技术研究中心 水稻腺苷脱氨酶OsAD1及其编码基因在叶绿体基因RNA编辑中的应用
CN114958834A (zh) * 2020-03-09 2022-08-30 中山大学 一种adar蛋白细胞内高效结合底物及应用

Similar Documents

Publication Publication Date Title
US20040002077A1 (en) siRNA expression system and method for producing functional gene knock-down cell using the system
EP1462525B1 (fr) Systeme d'expression d'arnsi et procede de production de cellule knockdown a gene fonctionnel ou analogue utilisant ce systeme
US7422896B1 (en) Compositions for DNA mediated gene silencing
US20100129914A1 (en) Tol1 FACTOR TRANSPOSASE AND DNA INTRODUCTION SYSTEM USING THE SAME
Kondo et al. Control of colinearity in AbdB genes of the mouse HoxD complex
Hochberg-Laufer et al. Availability of splicing factors in the nucleoplasm can regulate the release of mRNA from the gene after transcription
US7732658B2 (en) Composition and method for imaging cells
Hims et al. A humanized IKBKAP transgenic mouse models a tissue-specific human splicing defect
Li et al. Mini-dCas13X–mediated RNA editing restores dystrophin expression in a humanized mouse model of Duchenne muscular dystrophy
WO2010064231A1 (fr) Procédés d’analyse d’édition d’arn a-i et constructions d’acide nucléique capables de ceux-ci
JP4293990B2 (ja) 哺乳類人工染色体
Drews et al. Multiple transcripts of sodium channel SCN8A (NaV1. 6) with alternative 5′-and 3′-untranslated regions and initial characterization of the SCN8A promoter
Kaufman et al. Methods to study maternal regulation of germ cell specification in zebrafish
CN106399369B (zh) 构建在海马体区域特异性敲除IKKα基因的小鼠模型的方法及打靶载体和试剂盒
KR20240042363A (ko) 뇌전증을 치료하기 위한 방법 및 조성물
EP4355906A2 (fr) Capteurs d'arn à base de désaminase
Edwards-Faret et al. A new technical approach for cross-species examination of neuronal wiring and adult neuron-glia functions
Zhang et al. The regulation of retina specific expression of rhodopsin gene in vertebrates
Moffa et al. Cell specific single viral vector CRISPR/Cas9 editing and genetically encoded tool delivery in the central and peripheral nervous systems
Xie et al. Sp2 is a maternally inherited transcription factor required for embryonic development
Miano et al. Expression of human smooth muscle calponin in transgenic mice revealed with a bacterial artificial chromosome
Aronoff et al. Layer-and column-specific knockout of NMDA receptors in pyramidal neurons of the mouse barrel cortex.
Wörtge et al. Tetracycline-controlled transgene activation using the ROSA26-iM2-GFP knock-in mouse strain permits GFP monitoring of DOX-regulated transgene-expression
Shi et al. RNA splicing based on reporter genes system: Detection, imaging and applications
Hogan Chapter 4—Principles and techniques of molecular biology

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09796825

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09796825

Country of ref document: EP

Kind code of ref document: A1