WO2010062502A1 - Véhicules pour l’administration d’acides nucléiques à des cellules et procédés d’utilisation de ceux-ci - Google Patents

Véhicules pour l’administration d’acides nucléiques à des cellules et procédés d’utilisation de ceux-ci Download PDF

Info

Publication number
WO2010062502A1
WO2010062502A1 PCT/US2009/061428 US2009061428W WO2010062502A1 WO 2010062502 A1 WO2010062502 A1 WO 2010062502A1 US 2009061428 W US2009061428 W US 2009061428W WO 2010062502 A1 WO2010062502 A1 WO 2010062502A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
compound
cells
complex
nhch
Prior art date
Application number
PCT/US2009/061428
Other languages
English (en)
Inventor
Zheng-Rong Lu
Rongzuo Xu
Original Assignee
University Of Utah Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Utah Research Foundation filed Critical University Of Utah Research Foundation
Publication of WO2010062502A1 publication Critical patent/WO2010062502A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/02—Linear peptides containing at least one abnormal peptide link
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/06—Dipeptides
    • C07K5/06008—Dipeptides with the first amino acid being neutral
    • C07K5/06017—Dipeptides with the first amino acid being neutral and aliphatic
    • C07K5/0606—Dipeptides with the first amino acid being neutral and aliphatic the side chain containing heteroatoms not provided for by C07K5/06086 - C07K5/06139, e.g. Ser, Met, Cys, Thr
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety

Definitions

  • Gene therapy is an effective treatment for diseases including genetic, metabolic diseases and cancers.
  • Gene therapy involves the treatment of a disease by replacing, supplementing or silencing a gene that is absent or abnormal in the cells of the subject.
  • the plasmid DNA can be an efficient vector to inoculate functional gene to replace or supplement disease-related gene into target cells.
  • RNAi provides an effective treatment.
  • the siRNA containing 21-29 bp of RNA can selectively induce the degradation of complementary mRNA leading to the down-regulation of related protein expression.
  • plasmid DNA and siRNA have to be effectively delivered into the target cells.
  • due to their large size and high density of negative charges plasmid DNA and siRNA can barely pass through the negatively charged outer membrane of cells, thus necessitating the use of carriers or delivery devices.
  • siRNA with 21-23 base pairs of nucleotides, is much shorter than DNA which could contain thousands of base pairs. Consequently, nanoparticles formed by siRNA are less stable and more prone to dissociate than the DNA complexes. Secondly, siRNA is more easily degradable than DNA, therefore it requires extra protection in extracellular environments before entering the target cells.
  • a delivery carrier that is non-toxic, non-immunogenic, and protects nucleic acids such as siRNA, microRNA, antisense oligonucleotides, RNA and DNA from enzymatic degradation during the delivery process. It is also desirable that the delivery system prevents rapid elimination from the body, facilitate specific uptake by target tissue and target cells, and rapidly release the nucleic acid intracellularly at the site of action.
  • the compounds and methods described herein address many of the shortcomings of current delivery systems.
  • this invention relates to compounds and methods useful for the delivery of nucleic acids to cells.
  • the compounds and methods are useful in delivering all types of nucleic acids to cells including sensitive nucleic acids such as, for example, siRNA.
  • sensitive nucleic acids such as, for example, siRNA.
  • Figure 1 shows chemical structures of multifunctional functional carriers.
  • Figure 2 shows synthetic procedure of SKACO.
  • Figure 3 shows agarose gel electrophoretic shift assay of plasmid DNA (pCMV-Luc) complexed with multifunctional carriers at different N/P ratios.
  • o.c open circular plasmid DNA
  • s.c supercoiled plasmid DNA.
  • Figure 5 shows hemolytic activity of pDNA complexes formed with MFCs and Lipofectamine-2000 (Lipo-2000) at pH 7.4 and 5.5.
  • the carrier/pDNA complexes were prepared at N/P ratio 12.
  • the relative haemolytic efficiency was normalized to the cells treated with Triton X-100 (1% v/v).
  • Figure 6 shows cellular uptake of pDNA mediated by multifunctional carriers at N/p ratio 12 on U87 cells.
  • 1 ⁇ g pDNA was labeled with YOYO-I.
  • FLl channel was focused on the green fluorescence of YOYO- 1.
  • Figure 7 shows in vitro transfection efficiency of pCMV-Luc (0.5 ⁇ g) mediated by multifunctional carriers at N/P ratio 12 on U87 cell line.
  • Lipofectamine 2000 Lipo-2000 was used as control.
  • Figure 8 shows flow cytometry analysis of multifunctional carriers mediated expression of plasmid DNA encoding GFP plasmid on U87 cell line. Lipofectamine-2000 was used as control. FLl channel was focused on the green fluorescence of GFP.
  • Figure 9 shows cytotoxicity of multifunctional carriers/plasmid DNA complexes at N/P ratio 12 on U87 cell line. Lipofectamine-2000 (Lipo-2000) was used as control.
  • Figure 10 shows cellular uptake of siRNA mediated by multifunctional carriers on U87 cell line.
  • the Lipo-2000 is used as control.
  • Figure 11 shows luciferase gene silencing in U87-Luc cells mediated by complexes formed by anti-Luc siRNA (50 nM) and carriers. The relative gene silencing efficiency was normalized to untreated cells.
  • Figure 12 shows green fluorescent protein (GFP) silencing in CHO-eGFP cells mediated by complexes formed by anti-GFP siRNA (100 nM) and carriers. FL-I channel was set on GFP fluorescence.
  • GFP green fluorescent protein
  • Figure 13 shows cytotoxicity of siRN A/surfactant complex at N/P ratio 12 on U87 cells.
  • siRNA concentration was 50 nM.
  • Lipofectamine 2000 (Lipo-2000) was used as control.
  • Figure 14 shows the synthesis of EKHCO.
  • Figure 15 shows the agarose gel electrophoresis shift assay results of (A) EKHCO;
  • Figure 16 shows the average particle sizes of EHHKCO/plasmid DNA and EKHCO/plasmid DNA at varying N/P ratios.
  • Figure 17 shows average particle sizes of EHHKCO, EKHCO complexed with siRNA at varying N/P ratios.
  • Figure 18 shows the critical micelle concentration (CMC) of EHHKCO, EKHCO in pure water. The CMC are 9.50 ⁇ M and 6.87 ⁇ M for EHHKCO and EKHCO, respectively.
  • CMC critical micelle concentration
  • Figure 19 shows the hemolytic activities of EHHKCO, EKHCO, and DOTAP at variable concentrations at pH 5.5 and pH 7.4. Triton X-IOO (1%, w/v) and PBS were used as controls.
  • Figure 20 shows the hemolytic activities of surfactant/plasmid DNA complexes
  • Figure 21 shows the hemolytic activities of surfactant/siRNA complexes (EHHKCO, EKHCO) with variable surfactant concentrations at pH 5.5 and pH 7.4.
  • Triton X-IOO 1%, w/v) and PBS were used at controls.
  • Figure 22 shows in vitro transfection efficiency of EHHKCO/pCMV-Luc and EKHCO/pCMV-Luc complexes on U87 cell line at varying N/P ratios.
  • Figure 23 shows in vitro transfection efficiency of EHHKCO/pCMV-Luc and
  • Figure 24 shows flow cytometry studies of cellular uptake of plasmid DNA with EHHKCO and EKHCO and expression of GFP encoding plasmid on U87 cell line using DOTAP as a control.
  • Figure 25 shows the flow cytometry analysis of carrier mediated siRNA uptake (EHHKCO, EKHCO) on U87 cell line.
  • siRNA was labeled with AlexaFluor 488.
  • Figure 26 shows flow cytometry analysis of gene silencing in luciferase expressing U87 cells with anti-luc siRNA.
  • Figure 27 shows EKHCO/anti-Luc siRNA and EHHKCO/anti-Luc siRNA complexes mediated luciferase gene silencing in U87-Luc cells. siRNA concentration was fixed at 20 nM in all cases.
  • Figure 28 shows the relative cell viabilities of EHHKCO/pCMV-Luc and EKHCO/pCMV-Luc complexes at different N/P ratios in U87 cell line.
  • Figure 29 shows relative cell viabilities of EHHKCO/siRNA and EKHCO/siRNA complexes at different N/P ratios in U87 cell line.
  • Figure 30 shows the hemolytic activities of surfactant/siRNA complexes (EHHKCO, EKHCO) with variable surfactant concentrations at pH 5.5 and pH 7.4.
  • Triton X-IOO (1%, w/v) and PBS were used at controls.
  • Figure 31 shows the surfactant mediated plasmid DNA transfection and viability on U87 cell line (SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO).
  • Figure 33 shows the flow cytometry results of cellular uptake of YOYO-I labeled plasmid DNA mediated by polymerizable surfactants (SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO).
  • polymerizable surfactants SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO.
  • Figures 34 and 35 show the FACS results of GFP expression from GFP encoding plasmid DNA transfected by polymerizable surfactants (SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO).
  • polymerizable surfactants SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO.
  • Figure 36 shows flow cytometry result of surfactant mediated siRNA uptake (SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO).
  • Figure 37 shows the gene silencing on CHO-GFP cells by SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, and SHHKACO (20 nM siRNA).
  • Figure 38 shows luciferase gene silencing in U87-Luc cells mediated by complexes formed by anti-Luc siRNA and surfactants of the present invention (20 nM siRNA).
  • alkyl group as used herein is a branched or unbranched saturated hydrocarbon group of 1 to 25 carbon atoms, such as methyl, ethyl, w-propyl, isopropyl, « -butyl, isobutyl,
  • a "lower alkyl” group is an alkyl group containing from one to six carbon atoms.
  • cycloalkyl group is a non-aromatic carbon-based ring composed of at least three carbon atoms.
  • examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.
  • heterocycloalkyl group is a cycloalkyl group as defined above where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulphur, or phosphorus.
  • acyl group as used herein is represented by the formula C(O)R, where R is an organic group such as, for example, an alkyl or aromatic group as defined herein.
  • alkylene group as used herein is a group having two or more CH 2 groups linked to one another.
  • the alkylene group can be represented by the formula -(CH 2 ) a -, where a is an integer of from 2 to 25.
  • the aryl group can be substituted with one or more groups including, but not limited to, alkyl, alkynyl, alkenyl, aryl, halide, nitro, amino, ester, ketone, aldehyde, hydroxy, carboxylic acid, or alkoxy.
  • amino group is defined herein as a primary, secondary, or tertiary amino group.
  • the nitrogen containing substituent can be a quaternary ammonium group.
  • the nitrogen containing substituent can be an aromatic or cycloaliphatic group, where the nitrogen atom is either part of the ring or directly or indirectly attached by one or more atoms (i.e., pendant) to the ring.
  • the nitrogen containing substituent can be an alkylamino group having the formula -R-NH 2 , where R is a branched or straight alkyl group, and the amino group can be substituted or unsubstituted.
  • nitrogen containing group is defined herein as any amino group.
  • the nitrogen containing substituent can be a primary, secondary, or tertiary amino group. In the alternative, the nitrogen containing substituent can be a quaternary ammonium group.
  • the nitrogen containing substituent can be an aromatic or cycloaliphatic group, where the nitrogen atom is either part of the ring or directly or indirectly attached (i.e., pendant) to the ring.
  • the nitrogen containing substituent can be an alkylamino group having the formula -R-NH 2 , where R is a branched or straight alkyl group, and the amino group can be substituted or unsubstituted.
  • Variables such as A, AA 1 , AA 2 , AA 3 , F 1 , F 2 , F 3 , R 1 , R 2 , R 14 -R 19 , R 21 -R 29 , X, x, y, and z used throughout the application are the same variables as previously defined unless stated to the contrary.
  • the compounds described herein possess a variety of groups that collectively facilitate the delivery of nucleic acids to cells.
  • the compounds generally are composed of (1) one or more amino acids covalently attached to one another, (2) an alkyl amino group covalently attached to one of the amino acids via an amide bond, and (3) at least one hydrophobic group covalently attached to one of the amino acids.
  • the synthesis of the compounds can be accomplished by first covalently attaching the alkylamino group to an amino acid to form an amide bond.
  • the alkylamino group can be attached to a solid support, and an amino group present on the alkylamino group can react with a carboxylic acid group on the amino acid to form a covalent bond (i.e., an amide bond). Additional amino acids can them be attached top the amino acid using techniques known in the art.
  • linear and branched peptides can be produced by the addition of amino acids to the molecule. Techniques for producing peptides with an alkylamino group covalently bonded to the peptide are described in the Examples and Figures 2.
  • the amino acids also possess groups that can react with hydrophobic compounds.
  • free amino groups present on the amino acid can react with fatty acids in order to incorporate hydrophobic groups in the compound.
  • the Examples and Figures 2 also provide exemplary techniques for attaching one or more hydrophobic groups to the compounds herein.
  • the alkylamino groups, amino acids, and hydrophobic groups useful herein will be discussed below.
  • the compound comprises the formula I
  • each amino group of the amino acid is, independently, unsubstituted or substituted with an alkyl group, an alkenyl group, an acyl group, or an aromatic group;
  • x, y and z are each an integer from 0 to 50;
  • T comprises a residue derived from a group comprising at least three functional groups capable of forming a covalent bond with AA 1 , AA 2 and AA 3 , or when AA 1 , AA 2 and/or AA 3 are not present, the functional group is capable of forming a covalent bond with F 1 , F 2 and F 3 , wherein the functional group comprises an amino group, a hydroxyl group, a carboxylic group, a carbonyl group, a carbamate group, a ureyl group, a thiol group or an amide group;
  • R 1 and R 2 are each a hydrophobic group; X comprises an alkylamino group; and
  • amino acid sequences can act as pH buffers, nucleic acid complexation agents, amphiphiles, polymerizable monomers, reactive groups for chemical modifications and conjugating targeting groups, receptor binders, enhance cellular uptake, and facilitate release of the nucleic acid once in the cell.
  • the compound having the formula I comprises at least one thiol (SH) group.
  • one of the amino acids of AA 1 , AA 2 and AA 3 is a residue of cysteine, homocysteine, or a thiol containing derivative of an amino acid. It is also contemplated that one or more amino acids of AA 1 , AA 2 and AA can be derivatized such that thiol groups are introduced into the sequence. Using techniques known in the art, it is possible to react functional groups present on the amino acid with compounds containing thiol groups.
  • the thiol groups can produce disulfide (S-S) bonds by oxidation to form oligomers and polymers or cross-linking to further stabilize the nanoparticles.
  • S-S disulfide bonds
  • the disulfide bonds will be reduced in the cytoplasm to facilitate the release of nucleic acid from the delivery system.
  • T it is a residue derived from a group comprising at least three functional groups that are capable of forming covalent bonds.
  • the functional groups in T can be the same or different. Examples of such functional groups include, but are not limited to, an amino group, a hydroxyl group, a carboxylic group, a carbonyl group, a carbamate group, a ureyl group, a thiol group or an amide group.
  • the compound can be any naturally-occuring or synthetic compound.
  • the compound can be a polyamine or polyol having at least three amino or hydroxyl groups, respectively.
  • alkylamino group possesses at least one amino group.
  • alkylamino group as used herein is any alkyl groups as defined herein possessing at least one amino group, where the amino group can be substituted or unsubstituted.
  • the alkyl groups can be branched or straight chain and can possess a plurality of amino groups.
  • the alkylamino group is incorporated into the compounds of formula I by a functional group F 1 with an amino acid.
  • F 1 when x is zero, F 1 is directly bonded to T in formula I.
  • the functional group F 1 and a functional group present on T are capable of forming covalent bonds with one another.
  • alkylamino compounds useful herein include, but are not limited to, compounds depicted in formulae II- IV -R 14 -NR 15 R 16 II
  • R , R , R , R and R are, independently, a straight chain or branched aliphatic hydrocarbon group, a cyclic aliphatic hydrocarbon group, or an aromatic group;
  • R 15 ' R 16 , R 18 , R 21 , R 22 , R 24 , R 26 , R 28 and R 29 are, independently, hydrogen, an alkyl group, a nitrogen containing group, or a hydrophobic group;
  • A is an integer from 1 to 50.
  • X-F 1 - in formula I is -CH 2 NH 2 , -CH 2 CH 2 NH 2 , -CH 2 CH 2 CH 2 NH 2 , -(CH 2 CH 2 ) 2 NH, - (CH 2 CH 2 ) 2 NCH 3 , - (CH 2 CHa) 2 NCH 2 CH 3 , - (CH 2 CHa) 2 NCH 2 CH 2 NH 2 , -CH 2 CH 2 N(CH 2 CHa) 2 NH, -CH 2 CH 2 N(CH 2 CHa) 2 NCH 3 , -CH 2 CH 2 N(CH 2 CHa) 2 NCH 2 CH 3 , -CH 2 CH 2 CH 2 NH 2 , -CH 2 CH 2 CH 2 CH 2 NH 2 , -CH 2 CH 2 CH 2 CH 2 NH 2 , -CH 2 NHCH 2 CH 2 CH 2 NH 2 , -CH 2 NHCH 2 CH 2 CH 2 NH 2 , -CH 2 NHCH 2 CH 2 CH 2
  • the alkylamino group X can be incorporated at any amino acid in the compound where there is a free carboxylic acid group that is capable of reacting with an alkylamino compound.
  • the terminal amino acid possesses a reactive carboxylic acid group
  • the alkylamino group can be attached at the terminal amino acid.
  • an amino group of the alkylamino group reacts with the carboxylic acid of the amino acid to form an amide bond.
  • X is the residue of the alkylamino group
  • F 1 is an amino group covalently attached to the amino acid.
  • the compounds described herein possess at least one hydrophobic group covalently attached to the compound.
  • an amino group present on an amino acid can react with a hydrophobic compound in order to incorporate the hydrophobic group into the molecule.
  • the hydrophobic group can be derived from a saturated or unsaturated C 1 -C 25 fatty acid (RCOOH, where R is a C 1 -C 25 alkyl or alkylene group) or C 1 -C 25 alkyl or alkylene group.
  • the fatty acid can be oleic acid.
  • the hydrophobic group can be derived from a steroid compound or an aromatic compound.
  • the hydrophobic groups help form compact, stable nanoparticles with the nucleic acids and introduce amphiphilic properties to facilitate pH sensitive escape of nanoparticles from endosomal and lysosomal compartments. This is particularly useful when the compounds are used as in vivo delivery devices.
  • two hydrophobic groups are present (R 1 and R 2 ).
  • the hydrophobic groups are bonded to the molecule via functional groups F and F , respectively.
  • an amide group is formed (F 2 or F 3 ).
  • the hydrophobic groups (R 1 and R 2 ) are separated by a distance of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 atoms.
  • R 1 and R 2 are separated by 5 to 40 atoms, or by 10 to 30 atoms.
  • the atoms which separate the hydrophobic groups (R 1 and R 2 ) include F 2 , (AA ⁇ y , T, (AA 3 ) Z , F 3 or any combination thereof.
  • a targeting group can be attached to at least one amino acid.
  • the targeting agents can be useful in the delivery of nucleic acids into cells.
  • the targeting agent can be a protein, peptide, an antibody, an antibody fragment, one of their derivatives, or other ligands that can specifically bind to receptors on targeted cells.
  • target- specific peptides can be conjugated directly to the compound or indirectly via a second linker (e.g., polyethylene glycol) prior or during the formation of nanoparticles.
  • the targeting group can be covalently bonded to either an amino group present on the amino acid or the thiol group or an amino group present in the compound.
  • the targeting group is indirectly attached to the compounds described herein by a linker.
  • linkers include, but are not limited to, a polyamine group, a polyalkylene group, a polyamino acid group or a polyethylene glycol group.
  • the selection of the linker as well as the molecular weight of the linker can vary depending upon the desired properties.
  • the linker is polyethylene glycol having a molecular weight from 500 to 10,000, 500 to 9,000, 500 to 8,000, 500 to 7,000, or 2,000 to 5,000.
  • the targeting group is first reacted with the linker in a manner such that the targeting group is covalently attached to the linker.
  • the linker can possess one or more groups that can react with an amino group present on a peptide.
  • the linker also possesses additional groups that react with and form covalent bonds with the compounds described herein.
  • the linker can possess maleimide groups that readily react with the thiol groups.
  • the selection of functional groups present on the linker can vary depending upon the functional groups present on the compound.
  • the targeting compound is a peptide such as, for example, an RGD peptide or bombesin peptide that is covalently attached to polyethylene glycol.
  • the compound has the formula I, wherein R 1 and R 2 are Ci to C 25 straight chain or branched alkyl groups or alkenyl groups such as, for example, oleyl groups; and X is -NHCH 2 CH 2 NHCH 2 CH 2 NHCH 2 CH 2 NH 2 , -NHCH 2 CH 2 NH 2 , or -NHCH 2 CH 2 CH 2 NHCH 2 CH 2 CH 2 CH 2 NHCH 2 CH 2 CH 2 NH 2 .
  • the compounds described herein have at least two thiol groups that are capable of forming disulfide (S-S) bonds under oxidative conditions.
  • the disulfide bonds stabilize the delivery systems and help achieve release of the nucleic acid once it is in the cell.
  • the reducing environment in the cytoplasm e.g., the presence of oxy-reductase in released by endosomes and lysosomes
  • the disulfide compounds will be stable in the plasma at very low free thiol concentration (e.g., 15 ⁇ M).
  • the high concentration of thiols present in the cell e.g., cytoplasm
  • the high concentration of thiols present in the cell e.g., cytoplasm
  • the disulfides can be readily produced by reacting the same or different compounds before complexation with nucleic acid or during the complexation in the presence of an oxidant.
  • the oxidant can be air, oxygen or other chemical oxidants.
  • the degree of disulfide formation can vary in free polymers or in complexes with nucleic acids.
  • compounds having the formula I are monomers, and the monomers can be dimerized, oligomerized, or polymerized depending upon the reaction conditions.
  • the salt is a pharmaceutically acceptable salt.
  • the salts can be prepared by treating the free acid with an appropriate amount of a chemically or pharmaceutically acceptable base.
  • Representative chemically or pharmaceutically acceptable bases are ammonium hydroxide, sodium hydroxide, potassium hydroxide, lithium hydroxide, calcium hydroxide, magnesium hydroxide, ferrous hydroxide, zinc hydroxide, copper hydroxide, aluminum hydroxide, ferric hydroxide, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, lysine, arginine, histidine, and the like.
  • the reaction is conducted in water, alone or in combination with an inert, water- miscible organic solvent, at a temperature of from about 0 0 C to about 100 0 C such as at room temperature.
  • the molar ratio of the compound to base used is chosen to provide the ratio desired for any particular salts.
  • the starting material can be treated with approximately one equivalent of base to yield a salt.
  • any of the compounds described herein can exist or be converted to the salt with a Lewis base thereof.
  • the compounds can be treated with an appropriate amount of Lewis base.
  • Representative Lewis bases are ammonium hydroxide, sodium hydroxide, potassium hydroxide, lithium hydroxide, calcium hydroxide, magnesium hydroxide, ferrous hydroxide, zinc hydroxide, copper hydroxide, aluminum hydroxide, ferric hydroxide, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2- dimethylaminoethanol, 2-diethylaminoethanol, lysine, arginine, histidine, THF, ether, thiol reagent, alcohols, thiol ethers, carboxylates, phenolates, alkoxides, water, and the like.
  • the reaction is conducted in water, alone or in combination with an inert, water-miscible organic solvent, at a temperature of from about 0 0 C to about 100 0 C such as at room temperature.
  • the molar ratio of the compound to base used is chosen to provide the ratio desired for any particular complexes.
  • the ammonium salts of the free acid starting material the starting material can be treated with approximately one equivalent of chemically or pharmaceutically acceptable Lewis base to yield a complex.
  • these groups can be converted to pharmaceutically acceptable esters or amides using techniques known in the art.
  • an ester is present on the dendrimer, the ester can be converted to a pharmaceutically acceptable ester using transesterification techniques.
  • the compounds described herein have numerous applications with respect to the delivery of nucleic acids to a subject. In other aspect, the compounds described herein can be used in gene therapy to deliver genetic materials to cells and tissues.
  • the nucleic acid can be an oligonucleotide, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or peptide nucleic acid (PNA).
  • the nucleic acid of interest introduced by the present method can be nucleic acid from any source, such as a nucleic acid obtained from cells in which it occurs in nature, recombinantly produced nucleic acid, or chemically synthesized nucleic acid.
  • the nucleic acid can be cDNA or genomic DNA or DNA synthesized to have the nucleotide sequence corresponding to that of naturally-occurring DNA.
  • the nucleic acid can also be a mutated or altered form of nucleic acid (e.g., DNA that differs from a naturally occurring DNA by an alteration, deletion, substitution or addition of at least one nucleic acid residue) or nucleic acid that does not occur in nature.
  • a mutated or altered form of nucleic acid e.g., DNA that differs from a naturally occurring DNA by an alteration, deletion, substitution or addition of at least one nucleic acid residue
  • nucleic acid that does not occur in nature e.g., DNA that differs from a naturally occurring DNA by an alteration, deletion, substitution or addition of at least one nucleic acid residue
  • the nucleic acid can be a functional nucleic acid.
  • Functional nucleic acids are nucleic acid molecules that have a specific function, such as binding a target molecule or catalyzing a specific reaction.
  • Functional nucleic acid molecules can be divided into the following categories, which are not meant to be limiting.
  • functional nucleic acids include antisense molecules, aptamers, ribozymes, triplex forming molecules, siRNA, miRNA, shRNA and external guide sequences.
  • the functional nucleic acid molecules can act as affectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules.
  • Functional nucleic acids can be a small gene fragment that encodes dominant- acting synthetic genetic elements (SGEs), e.g., molecules that interfere with the function of genes from which they are derived (antagonists) or that are dominant constitutively active fragments (agonists) of such genes.
  • SGEs can include, but are not limited to, polypeptides, inhibitory antisense RNA molecules, ribozymes, nucleic acid decoys, and small peptides.
  • SGEs can include, but are not limited to, polypeptides, inhibitory antisense RNA molecules, ribozymes, nucleic acid decoys, and small peptides.
  • the functional nucleic acids of the present method can function to inhibit the function of an endogenous gene at the level of nucleic acids, e.g., by an antisense, RNAi or decoy mechanism.
  • certain functional nucleic acids can function to potentiate (including mimicking) the function of an endogenous gene by encoding a polypeptide that retains at least a portion of the bioactivity of the corresponding endogenous gene, and may in particular instances be constitutively active.
  • nucleic acids include antisense polynucleotide sequences useful in eliminating or reducing the production of a gene product, as described by Tso, P. et al Annals New York Acad. Sci. 570:220-241 (1987). Also contemplated is the delivery of ribozymes. These antisense nucleic acids or ribozymes can be expressed (replicated) in the transfected cells.
  • Therapeutic polynucleotides useful herein can also code for immunity- conferring polypeptides, which can act as endogenous immunogens to provoke a humoral or cellular response, or both.
  • the polynucleotides employed according to the present invention can also code for an antibody.
  • antibody encompasses whole immunoglobulin of any class, chimeric antibodies and hybrid antibodies with dual or multiple antigen or epitope specificities, and fragments, such as F(ab) 2 , Fab 2 , Fab and the like, including hybrid fragments. Also included within the meaning of “antibody” are conjugates of such fragments, and so-called antigen binding proteins (single chain antibodies) as described, for example, in U.S. Patent No. 4,704,692, the contents of which are hereby incorporated by reference.
  • the nucleic acid is siRNA.
  • siRNAs are double stranded RNA molecules (dsRNAs) with approximately 20 to 25 nucleotides, which are generated by the cytoplasmic cleavage of long RNA with the RNase III enzyme Dicer.
  • siRNAs specifically incorporate into the RNA-induced silencing complex (RISC) and then guide the RNAi machinery to destroy the target mRNA containing the complementary sequences. Since RNAi is based on nucleotide base-pairing interactions, it can be tailored to target any gene of interest, rendering siRNA an ideal tool for treating diseases with gene silencing. Gene silencing with siRNAs has a great potential for the treatment of human diseases as a new therapeutic modality.
  • RISC RNA-induced silencing complex
  • siRNAs Numerous siRNAs have been designed and reported for various therapeutic purposes and some of the siRNAs have demonstrated specific and effective silencing of genes related to human diseases.
  • Therapeutic applications of siRNAs include, but are not limited to, inhibition of viral gene expression and replication in antiviral therapy, anti- angiogenic therapy of ocular diseases, treatment of autoimmune diseases and neurological disorders, and anticancer therapy.
  • Therapeutic gene silencing has been demonstrated in mammals, which bodes well for the clinical application of siRNA. It is believed that siRNA can target every gene in human genome and has unlimited potential to treat human disease with RNAi.
  • the nucleic acid can be complexed to the compounds described herein by admixing the nucleic acid and the compound or, in certain aspects, the corresponding disulfide oligomer or polymer.
  • the pH of the reaction can be modified to convert the amino groups present on the compounds described herein to cationic groups.
  • the pH can be adjusted to protonate the amino groups present on the alkylamino group or amino acid.
  • the nucleic acid can electrostatically bond (i.e., complex) to the compound.
  • the pH is from 1 to 7.4.
  • the N/P ratio is from 0.5 to 100, where N is the number of nitrogen atoms present on the compound that can be form a positive charge and P is the number of phosphate groups present on the nucleic acid.
  • N is the number of nitrogen atoms present on the compound that can be form a positive charge
  • P is the number of phosphate groups present on the nucleic acid.
  • the nucleic acid/carrier complex is a nanoparticle.
  • the nanoparticle has a diameter of about 1,000 nanometers or less.
  • the compounds described herein can be designed so that the resulting nucleic acid nanoparticle escapes endosomal and/or lysosomal compartments at the endosomal- lysosomal pH.
  • the compound forming nanoparticles with nucleic acids can be designed such that its structure and amphiphilicity in the nanoparticles changes at endosomal- lysosomal pH (5.0 - 6.0) and disrupts endosomal-lysosomal membranes, which allows entry of the nanoparticles into the cytoplasm.
  • the pH sensitivity of the carriers can be modified by adjusting the distance between two lipid tails.
  • the compound forming nanoparticles with nucleic acids can be designed such that its structure and amphilicity in the nanoparticels changes at endosomal-lysosomal pH 5.5, which permits entry of the nanoparticles into the cytoplasm and subsequent pH-sensitive endosomal escape.
  • the ability of specific endosomal-lysosomal membrane disruption of the compounds described herein can be tuned by modifying their pH sensitive amphiphlicity by altering the number and structure of protonatable amines and lipophilic groups. For example, decreasing the number of protonatable amino groups can reduce the amphiphilicity of a nanoparticle produced by the compound at neutral pH.
  • the compounds herein have 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 8, 1 to 6, 1 to 4, or 2 protonatable amino or substituted amino or aromatic amino groups.
  • the amino and/or substituted and/or imidazolyl amino groups e.g., histidine
  • the compounds include 2, 3, 4, 5, 6, 7, 8, 9, or 10 histidine residues.
  • the pH- sensitive amphiphilicity of the compounds and nanoparticles produced by the compounds can be used to fine-tune the overall pKa of the nanoparticle.
  • Low amphiphilicity of the nanoparticles at physiological pH can minimize non-specific cell membrane disruption and nonspecific tissue uptake of the nucleic acid nanoparticles.
  • the surface of the nanoparticle complexes can be modified. For example, polyethylene glycol can be reacted with unpolymerized free thiol compounds (e.g., of formula I) of the nanoparticle to reduce non-specific tissue uptake in vivo.
  • PEG- maleimide reacts rapidly with free thiol groups.
  • the molecular weight of the PEG can vary depending upon the desired amount of hydrophilicity to be imparted on the carrier.
  • PEG- modification of the carrier can also protect nanoparticles composed of the nucleic acid from enzymatic degradation upon uptake by the cell (e.g., endonucleases).
  • Targeting agents including peptides, proteins, antibodies, antibody fragment or other receptor-binding molecules, can also be incorporated into the nanoparticle complexes during the preparation of the complexes to enhance the delivery specificity and efficiency of the genetic materials to the target cells.
  • Polyethylene glycol can be used as the spacer to conjugate targeting agents to the nanoparticle complexes.
  • the compounds described herein can be used to introduce a nucleic acid into a cell.
  • the method generally involves contacting the cell with a complex, wherein the nucleic acid is taken up into the cell.
  • the compounds described herein can facilitate the delivery of DNA or RNA as therapy for genetic disease by supplying deficient or absent gene products to treat any genetic disease or by silencing gene expression. Techniques known in the art can be used to measure the efficiency of the compounds described herein to deliver nucleic acids to a cell.
  • cell as used herein is intended to refer to well-characterized homogenous, biologically pure populations of cells. These cells may be eukaryotic cells that are neoplastic or which have been "immortalized” in vitro by methods known in the art, as well as primary cells, or prokaryotic cells.
  • the cell line or host cell is preferably of mammalian origin, but cell lines or host cells of non-mammalian origin may be employed, including plant, insect, yeast, fungal or bacterial sources.
  • the cell comprises stem cells, committed stem cells, differentiated cells, primary cells, and tumor cells.
  • stem cells include, but are not limited to, embryonic stem cells, bone marrow stem cells and umbilical cord stem cells.
  • Other examples of cells used in various embodiments include, but are not limited to, osteoblasts, myoblasts, neuroblasts, fibroblasts, glioblasts, germ cells, hepatocytes, chondrocytes, keratinocytes, smooth muscle cells, cardiac muscle cells, connective tissue cells, glial cells, epithelial cells, endothelial cells, hormone- secreting cells, cells of the immune system, and neurons.
  • Tumor cells cultured on substrates described herein can provide more accurate representations of the native tumor environment in the body for the assessment of drug treatments. Growth of tumor cells on the substrates described herein can facilitate characterization of biochemical pathways and activities of the tumor, including gene expression, receptor expression, and polypeptide production, in an in vivo-like environment allowing for the development of drugs that specifically target the tumor.
  • the complexes (i.e., nanoparticles) described above can be administered to a subject using techniques known in the art.
  • pharmaceutical compositions can be prepared with the complexes.
  • Dosages for a given host can be determined using conventional considerations, e.g., by customary comparison of the differential activities of the subject compounds and of a known agent, e.g., by means of an appropriate conventional pharmacological protocol. Physicians and formulators, skilled in the art of determining doses of pharmaceutical compounds, will have no problems determining dose according to standard recommendations (Physicians Desk).
  • compositions described herein can be formulated in any excipient the biological system or entity can tolerate.
  • excipients include, but are not limited to, water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions.
  • Nonaqueous vehicles such as fixed oils, vegetable oils such as olive oil and sesame oil, triglycerides, propylene glycol, polyethylene glycol, and injectable organic esters such as ethyl oleate can also be used.
  • Other useful formulations include suspensions containing viscosity enhancing agents, such as sodium carboxymethylcellulose, sorbitol, or dextran.
  • Excipients can also contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability.
  • buffers include phosphate buffer, bicarbonate buffer and Tris buffer, while examples of preservatives include thimerosol, cresols, formalin and benzyl alcohol.
  • Pharmaceutical carriers are known to those skilled in the art. These most typically would be standard carriers for administration to humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH.
  • Molecules intended for pharmaceutical delivery can be formulated in a pharmaceutical composition.
  • Pharmaceutical compositions can include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice.
  • Pharmaceutical compositions can also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like.
  • the pharmaceutical composition can be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration can be topically, including ophthalmically, vaginally, rectally, intranasally. Administration can also be intravenously or intraperitoneally. In the case of contacting cells with the nanoparticular complexes of nucleic acid and MFC described herein, it is possible to contact the cells in vivo or ex vivo.
  • Formulations for topical administration can include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable.
  • reaction conditions e.g., component concentrations, desired solvents, solvent mixtures, temperatures, pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.
  • Example 1 Synthesis and Characterization of SKCO, SKHCO, SHKCO, SHHKCO, SKACO, SKAHCO, SHKACO, and SHHKACO i. Materials and Methods a. Materials and Methods
  • 2-Chlorotrityl chloride resin N-a-Fmoc-N- ⁇ -l -(4, 4-dimethyl-2, 6-dioxocyclohex-l- ylidene)ethyl-L-Lysine (Fmoc-Lys(Dde)-OH), N-fluorenylmethoxycarbonyl-N-im-trityl-L- histidine (Fmoc-His(Trt)-OH), N- ⁇ -Fmoc-L-alanine, N-fluorenylmethoxycarbonyl-S-trityl-L- cysteine (Fmoc-Cys(Trt)-OH), PyBOP, oleic acid and 2-acetyldimedone (Dde-OH) were purchased from EMD bioscience (San Diego, CA).
  • DMSO dimethyl sulfoxide
  • DMF dimethylformamide
  • DCM dichloromethane
  • YOYO-I was purchased from Pierce (Rockford, IL).
  • ISOLUTE columns (Charlottesville, VA) were used for solid phase synthesis.
  • U87 MG cell line was purchased from ATCC.
  • the plasmid pCMV-GFP containing a green fluorescent protein gene and the plasmid pCMV-Luc containing firefly lucif erase gene were purchased from Promega (Madison, WI).
  • anti-luc siRNA sense sequence: 5'-CUUACGCUGAGUACUUCGAdTdT-3'; antisense sequence: 5'-UCGAAGUACUCAGCGUAAGdTdT-S'
  • anti-GFP siRNA sense sequence: 5'-GCAAGCUGACCCUGAAGUUCAU -3'; antisense sequence: 5'- GAACUUCAGGGUCAGCUUGCCG -3'
  • Alexa Fluor 488 labeled negative control siRNA were purchased from Qiagen (Valencia, CA).
  • the Dde- protection group was removed by 2% hydrazine in DMF.
  • Fmoc-Lys(ivDde)-OH (0.24 g) was then coupled to the resin using PyBOP (0.52 g) and DIPEA (0.13 g) for 2 hours. After that, the Fmoc- protection was removed by 20% piperidine in anhydrous DMF.
  • the resin was then reacted with N- ⁇ -Fmoc- ⁇ -alanine, followed by sequential treatment with 2% hydrazine in DMF and 20% piperidine in DMF.
  • the Fmoc-Cys(Trt)-OH was added to the resin using PyBOP (0.52 g) and DIPEA (0.13 g) in DMF, followed by Fmoc- removal.
  • oleic acid (0.28 g) with PyBOP (0.52 g) and DIPEA (0.13g) in DMF was reacted with the resin for 2 hours to introduce oleicyl groups.
  • Each previous coupling and deprotection reaction steps were followed by extensive washing with anhydrous DCM and DMF, and the reaction quality was assured with a Kaiser test.
  • the product was cleaved out of the resin by the cocktail DCM/TFA/H 2 O/EDT/TIBS (50/47.5/1.25/1.25/0.5) for 3 hours at room temperature.
  • the final product SKACO was purified by preparative-HPLC (1100 series, Agilent) equipped with a ZORBAX PrepHT C-18 column.
  • the chemical structure of SKACO was analyzed by MALDI-TOF mass spectrometry and 1 H NMR spectrometry (400 MHz) using a Varian Mercury 400 (Palo Alto, CA).
  • agarose gel (0.8% w/v) containing 0.5 ⁇ g/ml ethidium bromide was prepared in TAE buffer.
  • Multifunctional carrier/plasmid DNA complexes prepared by mixing 0.5 ⁇ g pDNA and multifunctional carrier at certain N/P ratios between 0 and 5 and incubating 30 minutes, were loaded on the gel and run at 100 V electric field for 30 minutes, and visualized with a UV illuminator using a Gel Documentation System (Bio-Rad, Hercules, CA).
  • the agarose gel retardation assay (Figure 3) shows that all those eight surfactants can compact with DNA and completely retard the DNA shift in agarose gel from N/P ratio 2. d. Particle size measurements
  • Nanoparticular multifunctional carrier/ pDNA or siRNA complexes were prepared by mixing 1 ⁇ g plasmid DNA or siRNA with multifunctional carriers at an N/P ratio of 12 and incubating at room temperature for 30 minutes. The size of the nanoparticles was analyzed using a Brookhaven Instruments BI- 200SM equipped with a 5 mW helium- neon laser with output at 633 nm (Brookhaven Instrument Incorporation, Holtsville, NY). Measurements were performed at room temperature in triplicate. The effective diameters were computed using BIC Dynamic Light Scattering Software (Brookhaven Instrument Incorporation, Holtsville, NY). e. pH-sensitive hemolytic activity study Triton X-100 (1%, w/v) and pDNA/multifunctional carrier complexes at an N/P ratio of
  • pDNA/Lipofectamine-2000 complex with Lipofectamine-2000 concentration at 2.5 mg/ml was used as control.
  • the relative hemolytic efficiency was calculated by normalizing the absorbance of the samples to that treated with Triton X-100.
  • the pH-sensitive hemolytic activities were determined by the hemolysis imposed on fresh rat red blood cells.
  • the hemolytic activities of the surfactants are concentration dependent and much higher than that of DOTAP.
  • the pH had little influence, as seen in both pH 5.5 and pH 7.4, the pH representing endosomal-lysosomal compartments and extracellular matrix, the hemolytic activities of those surfactants are similar.
  • the hemolytic activities of surfactant/plasmid DNA nanoparticles were determined to be pH- dependent.
  • Figure 5 shows that at pH 5.5, the surfactant/plasmid complexes have much higher hemolytic activities than in pH 7.4, where the hemolytic activities of the complexes are very low.
  • the SKACO/plasmid DNA complex has the highest hemolytic activity in the presence of both low and high concentration of surfactant.
  • the hemolytic results suggest that the complexation with plasmid DNA provides pH-sensitive amphiphilic membrane disrupting abilities to the surfactants.
  • Multifunctional carriers mediated cellular uptake of plasmid DNA Approximate 3xlO 5 U87 cells per well were plated in 12-well plates. After 24 hours, nanoparticles prepared by complexing multifunctional carrier with 1 ⁇ g of YOYO-I labeled plasmid DNA at an N/P ratio of 12 were incubated with cells in each well for 4 hours at 37 0 C in serum free medium, using complexes formed with bPEI at an N/P ratio of 10 was used as control. The medium was removed and cells were washed twice with PBS and then trypsinized. Cells were collected and fixed by 4% para-formaldehyde in ice-cold PBS for 20 minutes. Samples were analyzed using a FACSCalibur flow cytometer (BD Bioscience). FL-I channel was focused on the green fluorescence of YOYO-I. Results were analyzed using Cell-Quest (BD Bioscience) software.
  • the medium was replaced with 0.5 ml of fresh medium without serum.
  • the plasmid pCMV-Luc complexed with the multifunctional carriers at an N/P ratio of 12 or bPEI at an N/P ratio of 10 was incubated with the cells for 4 hours at 37 0 C. The medium was then replaced with complete medium. After 44 hours, cells were washed with fresh PBS, treated with 200 ⁇ l reporter lysis buffer and subjected to a freezing-thawing cycle. Cell debris was precipitated through 1.5xlO 4 g centrifugation for 5 minutes. The luciferase activity in 20 ⁇ l of each sample was analyzed by Luminmeter (Dynex Technologies, Inc., Chantilly, VA). The relative light units (RLU) were normalized by protein concentration in cell lysates which was determined by a BCA kit (Pierce, Rockford, IL). h. Multifunctional carriers mediated GFP encoding plasmid expression
  • the cytotoxicity of pDNA/multifunctional carrier complexes was evaluated using U87 cells.
  • the cells were seeded in 96- well plates at a density of 5x10 4 cells per well and cultured for 24 hours. After that, 0.1 ⁇ g DNA complexed with the MFCs at N/P ratios between 4 and 20 was incubated with cells for 4 hours in 1 ml serum free DMEM medium. Cells were incubated in complete medium for additional 20 hours. MTT solution (20 ⁇ l, 5 mg/ml) was then added and incubated in 37 0 C for 2 hours.
  • the nanoparticles which were prepared by mixing 1 ⁇ g AlexaFluor 488 labeled all negative siRNA (Qiagen, Valencia, CA) with multifunctional carrier at an N/P ratio of 12 or lipofectamine-2000 for 30 minutes, were added into each well and incubated for 4 hours at 37 0 C in 1 ml serum free medium. The medium was removed and the cells were washed twice with PBS and then trypsinized. The cells were collected and fixed by 4% paraformaldehyde in PBS for 20 minutes. The samples were analyzed using a FACSCalibur flow cytometer (BD
  • the surfactant mediated cellular uptake of siRNA labeled with Alexa Fluor-488 was measured by flow cytometry.
  • Figure 36 shows that the surfactant can deliver siRNA from 23.1 % to 83.5 % of cells in situ, which is lower than DOTAP, which delivered siRNA to 87.8 +/- 1.3% of cells.
  • Multifunctional carrier mediated silencing of lucif erase with siRNA siRNA delivery efficiency of the multifunctional carriers was measured through delivering anti-Luc siRNA into U87-Luc cells, which stably expressed firefly luciferase.
  • U87-luc cells were seeded in 96 well plates at a density of 5x10 3 cells/well in DMEM medium containing 10% FBS, G418 (300 ⁇ g/ml), streptomycin (100 ⁇ g/ml) and penicillin (100 units/ml) 24 hours prior transfection.
  • Anti-luc siRNA was complexed with multifunctional carriers at an N/P ratio of 12 or lipofectamine-2000 for 30 minutes and then incubated with cells for 4 hours at 37 0 C in serum free DMEM medium.
  • Multifunctional carrier mediated GFP silencing with siRNA CHO cells integrated with GFP gene are cultured in F12-K medium. Cells are seeded into 12- well plates at the density of 2x10 5 cells per well and further cultured overnight. The nanoparticles formed by incubating 1 ⁇ g anti-GFP siRNA with multifunctional carriers at an N/P ratio of 12 or lipofectamine-2000 for 30 minutes at room temperature. The formed nanoparticles were then added to CHO-GFP cells in serum free F-12K medium. After 4 hours incubation at 37 0 C, the medium is replaced with fresh complete F12-K medium and cultured for additional 20 hours.
  • the relative cell viability was calculated by the equation: ([Abs] sample - [Abs] Wank ) / ([Abs] contro i-[Abs] b i ank )xl00%. ii. Results
  • Spermine a natural oligoamine can bind nucleic acids and stabilize its double helical structures, is incorporated into the novel multifunctional carriers to pack nucleic acids.
  • SKCO SKHCO
  • SHKCO and SHHKCO L-lysine is used to provide "Y" form joint.
  • the ⁇ -alanine is coupled to ⁇ - amine group of lysine to further extend the hydrophobic tails, aiming to increase the packing parameter of the carrier.
  • the dual unsaturated oleic acids were introduced into the surfactant carrier as lipid tails; the unsaturation would avoid crystal-like packing of saturated lipids, bring more flexibility and correspondently facilitate the phase transition (23).
  • the histidine residual was added to the surfactant to variable extent, aiming to improve the transfection efficiency by introducing pH- sensitive amphophilicity (22).
  • the cationic surfactant can pack nucleic acids through charge-charge interaction and hydrophobic interactions (25).
  • the agarose gel electrophoretic shift assay in Figure 3 shows that all those eight carriers compact with plasmid DNA and completely eliminates its electrophoretic mobility from N/P ratio 2.
  • the sizes of the nanoparticles formed by plasmid DNA or siRNA with multifunctional carriers at N/P ratio 12 were measured by dynamic light scattering; their effective diameters are around 100 nm, with little fluctuation, as seen in Figure 4.
  • Lipofectamine-2000 complexed plasmid DNA or siRNA to form nanoparticles with similar sizes.
  • the pH-sensitive membrane disrupting activities were determined by the haemolysis assay on rat red blood cells.
  • the hemolytic activities of nanoparticular pDNA/multifunctional carrier complexes at N/P ratio 12 were determined to be pH-dependent.
  • Figure 5 shows that at pH 5.5, the complexes have much higher hemolytic activities than at pH 7.4, where complexes at both low and high concentrations induce low hemolysis.
  • the pDNA/SKACO complex enticed the highest hemolytic activity.
  • the concentrations of the pDNA/carrier complexes are within the range used in transfection. Therefore, it would allow for low toxicity on cells owing to low cellular membrane disruption in physiological pH, while high endosomal-lysosomal breaking down to released loaded plasmid DNA by their significantly high membrane disrupting abilities in lower pH. Under the same condition, the lipofectamine-2000/plasmid DNA complex at the dose used for transfection only induced low hemolytic activity.
  • the in vitro accumulative transfection efficiency of multifunctional carriers is evaluated by transfect luciferase gene into U87 cells.
  • Figure 7 shows that those eight carriers could produce much higher transfection efficiency than Lipofectamine-2000.
  • the multifunctional carrier/pDNA complexes were prepared at N/P ratio 12, an N/P ratio predetermined to have optimal gene delivery efficiency.
  • SKACO transfected pDNA encoding luciferase into U87 cells to induce luciferase activity as high as approximate 425 times of that transfected by Lipofectamine-2000.
  • Other carriers, including SKCO, SHKCO, SHHKCO and SHKACO also preserve higher luciferase transfection efficiency that Lipofectamine-2000.
  • FIG 10 shows that MFCs can deliver siRNA to 91.78% to 96.33% of U87 cells, which is higher than the 73.48% by Lipofectamine-2000.
  • In vitro accumulative siRNA delivery efficiency was evaluated by delivering anti-Luc siRNA to U87-Luc cells constantly expressing luciferase and measured through luciferase assay. As shown in Figure 11, these MFCs mediated as high as 84.6+/-5.5% gene silencing efficiency (SKAHCO, N/P ratio 12) with 50 nM siRNA. In contrast, Lipofectamine-2000 only mediated 62.8+/-3.4% gene silencing efficiency. The siRNA delivery efficiency was further measured by delivering anti-GFP siRNA to CHO cells integrated with GFP gene.
  • the cytotoxicity of siRNA/multifunctional carrier complexes was evaluated on U87 cell line.
  • the MTT assay shows that those carriers when complex with siRNA at the 50 nM, the concentration used for luciferase silencing assay, induces low cytotoxicity, with more than 82.3% cells survived in all cases.
  • DOTAP N-(2,3- dioleoyloxy-1 -propyl) trimethylammonium methyl sulfate
  • BSA bovine serum albumin
  • MTT 2,5-diphenyl-3-(4,5-dimethyl-2-thiazolyl)tetrazolium bromide
  • the Fmoc- was removed and the resin was washed by similar protocol as above.
  • the Fmoc-Cys(Trt)-OH (0.3g) was coupled to the resin with PyBOP (0.52 g) and DIPEA (0.13 g) in DMF, followed by Fmoc- removal and DCM and DMF washing.
  • oleicyl groups were incorporated by reacting the resin with oleic acid (0.28 g) in presence of PyBOP (0.52 g) and DIPEA (0.13g) in DMF for 2 hours.
  • the reaction quality of each coupling step and Fmoc- removal step was assured with Kaiser test.
  • the resin was then extensively washed with anhydrous DCM and anhydrous DMF, and the product was cleaved out of the resin by the cocktail DCM/TFA/H 2 O/EDT/TIBS (50/47.5/1.25/1.25/0.5) for 3 hours at room temperature.
  • the final product EKHCO was purified by preparative HPLC (1100 series, Agilent) equipped with a ZORBAX PrepHT C- 18 column.
  • the chemical structure of EKHCO was analyzed by MALDI-TOF mass spectrometry and 1 H NMR spectrometry (400 MHz) using a Varian Mercury 400 (Palo Alto, CA).
  • EHHKCO was synthesized by sequentially incorporating ethylenediamine, Fmoc-His(Trt)-OH, Fmoc-His(TrT)-OH, Fmoc-Lys(Fmoc)-OH, Fmoc- Cys(TrT)-OH and oleic acid into the 2-clorotrityl resin.
  • EKHCO or EHHKCO /plasmid DNA complexes prepared by mixing 0.5 ⁇ g DNA and surfactant solution at certain N/P ratios were loaded on the gel and ran at 100 V for 30 minutes, followed by visualized with a UV illuminator using a Gel Documentation System (Bio-Rad, Hercules, CA).
  • the surfactant can complex with nucleic acids through charge-charge interaction with nucleic acids and hydrophobic interaction among lipid tails.
  • Gel retardation study (Figure 15) showed that from N/P ratio 2, all those eight surfactants can completely retard the shift of plasmid DNA in 0.8 % agarose gel. d. Particle Size Measurements
  • Plasmid/carrier complex nanoparticles were prepared by mixing plasmid solution with surfactants at predetermined N/P ratios and incubating for 30 minutes. The size of the nanoparticles was analyzed using a Brookhaven Instruments BI- 200SM equipped with a 5 mW helium-neon laser with output at 633 nm. Measurements were performed at room temperature in triplicates. The effective diameters were computed using software of the instruments.
  • size of plasmid DNA/ EKHCO complex is around 150 nm in diameter.
  • EHHKCO and plasmid DNA formed nanoparticles with a diameter around 200 nm. All these sizes are suitable for endocytosis. Both sizes are smaller than 250 nm, which is the reported cut-off size for efficient cellular uptake.
  • EKHCO and EHHKCO formed and maintained stable nanoparticles with siRNA below their CMCs as shown by dynamic light scattering.
  • EKHCO and EHHKCO complexed with siRNA formed stable nanoparticles at the N/P ratio of 6 or higher ( Figure 17).
  • the sizes of EHHKCO/siRNA nanoparticles were around 100 nm, while EKHCO formed nanoparticles with siRNA with sizes in range of 200-250 nm.
  • the difference between the sizes of pDNA and siRNA complexes could be attributed to the different sizes and topography of pDNA and siRNA.
  • a known amount of pyrene in ethanol was added to each series of 2 ml of various concentrations of surfactants to reach a final concentration of 0.6 ⁇ M.
  • the aqueous surfactant solutions were shaken at room temperature for 48 hours.
  • the fluorescent spectra were scanned using a Shimadzu RF-5301PC spectrofluorometer with slit with of 3 nm. Emission wavelength was set at 393 nm, while the excitation wavelength was scanned from 330 to 340 nm. With increased surfactant concentration, the fluorescent intensity was enhanced. A red shift in excitation wavelength was also observed when pyrene transferred from water to a more hydrophobic domain.
  • the ratio I 336 /I 333 was plotted against the surfactant concentration.
  • the critical micelle concentration was determined by the onset of I 336 /I 333 shifting. Using fluorescent method, the critical micelle concentration of EKHCO and EHHKCO were determined to be 6.87 ⁇ M and 9.50 ⁇ M, respectively ( Figure 18). Both CMC values are lower than the CMC of those surfactants with one lipid tail, indicating that by incorporating two lipid tails, the lipophiphilicity of the surfactants was increased as indicted by the lowering of CMC value. Furthermore, with low CMC values, the surfactants are expected to form stable nanoparticles with nucleic acids against dilution as well as against the dissociation force from cellular lipid bilayers.
  • the surfactants, Triton X-IOO (1%, w/v), free surfactants, surfactant/plasmid DNA complexes and surfactant/siRNA complexes at N/P ratio 12 with surfactants at variant concentrations were dissolved in 50 ⁇ l phosphate buffer saline (PBS) with pH adjusted to 7.4 and 5.5 and plated in 0.6 ml microcentrifuge tubes.
  • Rat erythrocytes (RBCs) were suspended in PBS at appropriate pH at the concentration 1% (w/v) and 200 ⁇ l of RBC solution was mixed with the sample solution and incubated at 37 0 C for 1 hour. The mixture was then centrifuged at 1500 rpm for 5 minutes.
  • Amphiphilic cellular membrane disruption is a common phenomenon is nature. Some viruses take the advantage of membrane disrupting oligo-peptides by incorporating them into their outer shells. Furthermore, cationic lipids were also reported to have membrane disrupting abilities since it was proposed that they can bind and neutralize the anionic lipids in cellular membranes. The membrane disrupting ability was already applied in gene delivery, and some carriers were developed by incorporating membrane disrupting moieties. However, the pH sensitive membrane disrupting abilities were more appreciated since such materials show little hemolytic activity in pH 7.4, the pH of extracellular environment, therefore little cytotoxicity, and the high hemolytic activity in pH around 5-6, the pH of endosomal-lysosomal compartment, facilitating endosomal escape of loaded nucleic acids.
  • the pH sensitive amphiphilic membrane disruption abilities of the free surfactants were evaluated by the hemolysis of rat red blood cells at different pH (Figure 19).
  • the hemolytic activity was measured in PBS buffer at pH 7.4 and pH 5.5, the pH representing extracellular environment and endosomal-lysosomal compartment.
  • the Triton X-100 1% w/v
  • the PBS buffer alone caused less than 5% hemolysis. Little hemolysis was observed with DOTAP at 40 ⁇ M at both pH 7.4 and pH 5.5. EHHKCO and EKHCO, however, resulted in pH-dependent hemolytic activity.
  • both EHHKCO and EKHCO resulted in significant hemolysis.
  • the hemolytic activity increased with increasing surfactant concentration at both pH values.
  • EHHKCO and EKHCO resulted in higher hemolytic activity at pH 5.5 than at pH 7.4.
  • EHHKCO exhibited higher hemolytic activities than EKHCO, which is probably due to charge distribution since the positive charge of EHHKCO is more localized at the head while the positive charges of EKHCO are more evenly distributed throughout the whole lipid.
  • the surfactant with dual lipid tails can readily complex with nucleic acids to form nanoparticles even in lower CMC concentrations.
  • EHHKCO and EKHCO were dissolved in PBS at a pH of 5.5 or 7.4 and complexed with plasmid DNA at N/P ratio of 12.
  • the hemolytic activity of the DNA/surfactant complex was evaluated through the same procedure above.
  • Figure 20 shows that the DNA/surfactant nanoparticles have significant hemolytic activity at pH 5.5 and minimal hemolytic activity at pH 7.4. Compared to free surfactants, the DNA/surfactant complexes lost almost all hemolytic activity at pH 7.4 and gain extra hemolytic activity at pH 5.5.
  • the plasmid DNA/DOTAP nanoparticles with a DOTAP concentration of 40 ⁇ M showed little hemolytic activity at both pH 7.4 and pH 5.5.
  • siRNA complexed with both EHHKCO and EKHCO showed higher membrane disruption ability at pH 5.5 than at pH 7.4.
  • the results of the hemolytic studies showed that the surfactants, surfactants/plasmid DNA complex and surfactant/siRNA complex have significant Ph-sensitive hemolytic activities at very low concentrations. With high hemolytic activity at pH 5.5, the pH for endosomal- lysosomal compartment, these surfactants are expected to facilitate the endosomal-lysosomal escape of loaded genetic materials and result in high transfection efficiency.
  • the complexes containing 0.5 ⁇ g luciferase-encoding plasmid DNA (pCMV-Luc) and surfactants at different N/P ratios were incubated with the cells for 4 hours at 37 0 C. After that, the medium was replaced 1 ml of fresh complete DMDM medium and incubated for additional 44 hours. The cells were then washed with pre- warmed PBS, treated with lysis buffer at 200 ⁇ l/well, and subjected to a freeze-thaw cycle. Cell debris was removed by centrifuge at 10000 g for 5 min. The luciferase activity in cell lysate (20 ⁇ l) was measured by a luciferase kit (Promega, Madison, WI).
  • RLU relative luciferase unit
  • FIG. 23 shows intracellular expression of luciferase in U87 cells mediated by EHHKCO and EKHCO at various N/P ratios. Both carriers resulted in the highest transfection efficiency of luciferase at the N/P ratio of 12, which was less than that mediated by DOTAP. EKHCO was more effective in luciferase transfection than EHHKCO. EHHKCO, EKHCO resulted in GFP expression in 9.8% and 3.3% of the cells at the N/P ratio of 12, respectively, much higher than 0.5% expression mediated by DOTAP. h. Plasmid DNA Cellular Uptake Approximately 300,000 U87 cells per well were plated in 12-well plate. After 24 hours,
  • YOYO-I labeled plasmid DNA nanoparticles (1 ⁇ g per well) were incubated with cells for 4 hours at 37 0 C in serum free medium. The medium was removed and the cells were washed twice with PBS and then trypsinized. The cells were collected and fixed by 4% paraformaldehyde in PBS for 20 minutes. The samples were analyzed using a FACSCalibur flow cytometer (BD Bioscience). Results were analyzed using Cell-Quest (BD Bioscience) software.
  • FIG. 24 shows the flow cytometry diagrams of cellular uptake in U87 cells of fluorescence labeled pDNA complexes of EKHCO and EHHKCO. Both carriers resulted in approximately 93% of cellular uptake of plasmid DNA, while DOTAP only transfects 65.6% of the cells.
  • the siRNA delivery efficiency of the surfactants was measured using anti-Luc siRNA in U87-Luc cell line which can stably express firefly luciferase.
  • U87-luc cells were seeded in 96 well plates at the density of 5xlO 3 cells/well in DMEM medium containing 10% FBS, G418 (300 ⁇ g/ml), streptomycin (100 ⁇ g/ml) and penicillin (100 units/ml) 24 hours prior transfection.
  • Anti- luc siRNA (sequence of antisense is 5'-UCGAAGUACUCAGCGUAAGdTdT-S' and that of sense is 3'-dTdTAGCUUCAUGAGUCGCAUUC-5 ⁇ from Dharmacon, Chicago, IL) was complexed with surfactants for 30 minutes and then incubated with cells for 4 hours at 37 0 C in serum free DMEM medium. The medium was then replaced with complete DMEM medium and incubated for additional 44 hours. The cells were washed with pre-warmed PBS, and treated with 200 ⁇ l/well reporter lysis buffer followed by a freezing-thawing cycle.
  • Luciferase activity in cell lysates was then measured by a luciferase assay kit (Promega, Madison, WI) on a luminometer (Dynex Tech., Chantilly, VA). The gene silencing efficiency was normalized against the luciferase activity of untreated cells.
  • siRNA delivery was evaluated using anti-luciferase siRNA on a U87 cell line with stable expression of firefly luciferase.
  • siRNA was complexed with EKHCO and EHHKCO at N/P ratios raging from 4 to 20. Cells in 96 well plates were incubated with 20 nM siRNA, where little to no cytotoxicity.
  • the gene silencing efficiency mediated by the multifunctional carriers was evaluated in luciferase expressing U87 cells with an anti-luc siRNA.
  • the complexes of anti-Luc siRNA with EKHCO and EHHKCO showed N/P ratio dependent gene silencing efficiency in U87-luc cells, Figure 26.
  • EKHCO with 20 nM siRNA resulted in 57.4+12.3 % silencing efficiency at the N/P ratio of 12 and EHHKCO at the N/P ratio of 12 resulted in 71.4+18.8% gene silencing efficiency, while DOTAP only mediated 45.3 + 2.6 % of gene silencing efficiency under the same condition, EKHCO mediated gene silencing efficiency as high as 57.4+/-12.3% at N/P ratio 8 ( Figure 27).
  • EHHKCO at N/P ratio 12 mediated the highest gene silencing efficiency at 71.4+/-18.8%.
  • PEI only induced -70% gene silencing efficiency with siRNA concentration as high as 100 nM.
  • MG cell line The cells were seeded in 96-well plates at a density of 5xlO 4 cell/well and cultured for 24 hours. After that, 0.1 ⁇ g DNA complexed with surfactants at certain N/P ratios were incubated with cells for 4 hours in serum free DMEM medium. After that, cells were incubated in complete medium for addition 20 hours. MTT solution (20 ⁇ l, 5 mg/ml) was then added and incubated in 37 0 C for 2 hours. After that, the medium was drained and 200 ⁇ l DMSO was added to each well, and the absorption was read at 570 nm using a micro plate reader (model 680, Bio- Rad, Hercules, CA). The relative cell viability was calculated by the equation: ([Abs] samp i e -

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des composés et des procédés utiles pour l’administration d’acides nucléiques à des cellules. Les composés et les procédés sont utiles dans l’administration de tous types d’acides nucléiques à des cellules comprenant des acides nucléiques sensibles tels que, par exemple, des ARNsi.
PCT/US2009/061428 2008-11-03 2009-10-21 Véhicules pour l’administration d’acides nucléiques à des cellules et procédés d’utilisation de ceux-ci WO2010062502A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US11066108P 2008-11-03 2008-11-03
US61/110,661 2008-11-03
US16691609P 2009-04-06 2009-04-06
US61/166,916 2009-04-06

Publications (1)

Publication Number Publication Date
WO2010062502A1 true WO2010062502A1 (fr) 2010-06-03

Family

ID=42225976

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/061428 WO2010062502A1 (fr) 2008-11-03 2009-10-21 Véhicules pour l’administration d’acides nucléiques à des cellules et procédés d’utilisation de ceux-ci

Country Status (1)

Country Link
WO (1) WO2010062502A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9381208B2 (en) 2006-08-08 2016-07-05 Rheinische Friedrich-Wilhelms-Universität Structure and use of 5′ phosphate oligonucleotides
US9399658B2 (en) 2011-03-28 2016-07-26 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
US9738680B2 (en) 2008-05-21 2017-08-22 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US10059943B2 (en) 2012-09-27 2018-08-28 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
US20200316001A1 (en) * 2017-11-24 2020-10-08 Stemdr Inc. Composition for treating atopy or pruritus containing n-acetyl or n-acylamino acid
US11129845B2 (en) * 2014-06-18 2021-09-28 Case Western Reserve University Compositions and methods for the delivery of nucleic acids
US11407786B2 (en) 2015-06-18 2022-08-09 Case Western Reserve University Compositions and methods for the delivery of nucleic acids
CN115197157A (zh) * 2022-07-14 2022-10-18 北京市创伤骨科研究所 还原响应型的核酸递送载体及其制备方法、应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008042686A2 (fr) * 2006-09-29 2008-04-10 University Of Utah Research Foundation Porteurs multifonctionnels pour délivrer des acides nucléiques, et leurs procédés d'utilisation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008042686A2 (fr) * 2006-09-29 2008-04-10 University Of Utah Research Foundation Porteurs multifonctionnels pour délivrer des acides nucléiques, et leurs procédés d'utilisation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
WANG ET AL.: "A multifunctional and reversibly polymerizable carrier for efficient siRNA delivery.", BIOMATERIALS, vol. 29, no. 1, 17 October 2007 (2007-10-17), pages 15 - 22 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10238682B2 (en) 2006-08-08 2019-03-26 Rheinische Friedrich-Wilhelms-Universität Bonn Structure and use of 5′ phosphate oligonucleotides
US9381208B2 (en) 2006-08-08 2016-07-05 Rheinische Friedrich-Wilhelms-Universität Structure and use of 5′ phosphate oligonucleotides
US10196638B2 (en) 2008-05-21 2019-02-05 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US9738680B2 (en) 2008-05-21 2017-08-22 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US10036021B2 (en) 2008-05-21 2018-07-31 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US9399658B2 (en) 2011-03-28 2016-07-26 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
US9896689B2 (en) 2011-03-28 2018-02-20 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
US10072262B2 (en) 2012-09-27 2018-09-11 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
US10059943B2 (en) 2012-09-27 2018-08-28 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
US11142763B2 (en) 2012-09-27 2021-10-12 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
US11129845B2 (en) * 2014-06-18 2021-09-28 Case Western Reserve University Compositions and methods for the delivery of nucleic acids
US11407786B2 (en) 2015-06-18 2022-08-09 Case Western Reserve University Compositions and methods for the delivery of nucleic acids
US20200316001A1 (en) * 2017-11-24 2020-10-08 Stemdr Inc. Composition for treating atopy or pruritus containing n-acetyl or n-acylamino acid
CN115197157A (zh) * 2022-07-14 2022-10-18 北京市创伤骨科研究所 还原响应型的核酸递送载体及其制备方法、应用
CN115197157B (zh) * 2022-07-14 2023-10-24 北京市创伤骨科研究所 还原响应型的核酸递送载体及其制备方法、应用

Similar Documents

Publication Publication Date Title
WO2010062502A1 (fr) Véhicules pour l’administration d’acides nucléiques à des cellules et procédés d’utilisation de ceux-ci
US20100004316A1 (en) Multifunctional carriers for the delivery of nucleic acids and methods of use thereof
Pichon et al. Histidine-rich peptides and polymers for nucleic acids delivery
EP2007432B1 (fr) Polymeres cationiques biodegradables
EP1859812B1 (fr) Polymère chargeable de polycations et utilisation comme vecteur d'acides nucléiques
Wang et al. A multifunctional and reversibly polymerizable carrier for efficient siRNA delivery
Gabrielson et al. Multiplexed supramolecular self-assembly for non-viral gene delivery
Zavradashvili et al. Library of cationic polymers composed of polyamines and arginine as gene transfection agents
US20230000999A1 (en) Compositions and methods for nucleic acid delivery
US20230313181A1 (en) Histidine-lysine polymers and methods for delivering mrna using the same
Hussein et al. Peptide-based targeted polymeric nanoparticles for siRNA delivery
US20220331441A1 (en) Tumor-Targeting Polypeptide Nanoparticle Delivery System for Nucleic Acid Therapeutics
EP4373804A1 (fr) Lipidoïdes de cyclohexane pour la transfection d'acides nucléiques et leur utilisation
Xu et al. Design, synthesis and evaluation of spermine-based pH-sensitive amphiphilic gene delivery systems: Multifunctional non-viral gene carriers
Liu et al. Zinc coordinated cationic polymers break up the paradox between low molecular weight and high transfection efficacy
US10858484B2 (en) Biodegradable dendritic structure, methods and uses thereof
AU2021348717B2 (en) Lipidoids for nucleic acid transfection and use thereof
US20230127080A1 (en) Novel cationic lipid having cystine skeleton
Arote et al. Folate conjugated poly (ester amine) for lung cancer therapy
EP2395041A1 (fr) Polymères pour l'administration d'acides nucléiques
Pambudi et al. Inclusion of TAT and NLS sequences in lipopeptide molecules generates homogenous nanoparticles for gene delivery applications
WO2024110492A1 (fr) Nouveaux vecteurs pour l'administration d'acide nucléique et/ou de protéines
Arbianto et al. DNA Condensation Studies of Fully Synthesized Lipopeptide-Based Transfection Agent for Gene Delivery Vehicle
Restiani et al. Optimization transgene expression of short fully synthesized lipopeptide-based transfection agent for non-viral gene delivery vehicle
Kimura et al. Synthesis and Transport Activities of HIV–Tat Peptide-modified Cholesterol Pullulan

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09829546

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09829546

Country of ref document: EP

Kind code of ref document: A1