WO2010057965A1

WO2010057965A1 - Myometrial-derived mesenchymal stem cells

Info

Publication number: WO2010057965A1
Application number: PCT/EP2009/065523
Authority: WO
Inventors: Beatriz GONZÁLEZ GÁLVEZ; Juan Carlos RODRÍGUEZ CIMADEVILLA
Original assignee: Projech Science To Technology, S.L.
Priority date: 2008-11-20
Filing date: 2009-11-20
Publication date: 2010-05-27
Also published as: JP2012509074A; AU2009317191A1; EP2366023A1; CA2744423A1; BRPI0921414A2

Abstract

The present invention relates to methods of isolating adult stem cells, to the cells thus isolated and to applications thereof. More specifically, the invention relates to isolated adult stem cells which are derived from the myometrium, which can be differentiated into many different mesoderm tissues types, including smooth muscle, adipocytes, osteoblasts, skeletal muscle and neural tissue thus, making them suitable for regenerative medicine.

Description

MYOMETRIAL-DERIVED MESENCHYMAL STEM CELLS

FIELD OF THE INVENTION

The invention relates to methods of isolating adult stem cells, to the cells thus isolated and to applications thereof. More specifically, the invention relates to isolated adult stem cells which are derived from the myometrium, which can be differentiated and give rise to a series of cell lineages and which present specific markers, such as cell surface antigens. The cells provided by the present invention can be used, for example, in cell therapy and in the search for and development of novel medicaments.

BACKGROUND OF THE INVENTION

Currently, technological development in the field of stem cell research has led them to be considered a promising source of organs and tissues for those types of pathologies requiring organ or tissue transplants. Indeed, stem cell therapy holds tremendous promise for repair and/or regeneration of aging and damaged tissue.

Theoretically, the stem cells can undergo cellular division for self-maintenance during an unlimited period of time to originate phenotypically and genotypically identical cells. Furthermore, they have the capacity to differentiate between one or several cell types in the presence of certain signals or stimuli. The generation of organs and cells from the stem cells of the patient or from immunocompatible heterologous cells, so that the immune system of the recipient does not recognise them as foreign, offers a series of associated advantages that solve the problems brought on by the scarcity of donors and the risk of rejection. The use of stem cells for organ and tissue regeneration constitutes a promising alternative therapy for diverse human pathologies including: chondral, bone and muscular lesions, neurodegenerative diseases, immunological rejection, cardiac disease and skin disorders.

In addition to cellular therapy applications, stem cells have many other potential applications related to biomedical technologies that can help to facilitate biopharmaceutical research and development activities. One of these applications lies in the development of cellular models of human and animal diseases that can help to substantially improve the celerity and efficacy of the process of searching for and developing new drugs. At this time, the methods most commonly used to measure the biological activity of a new compound before it goes into clinical trials consist of incomplete biochemical techniques or costly and inadequate animal models. Stem cells could be a potential source of virtually unlimited quantities of cells, both undifferentiated and differentiated, for conducting in vitro tests to search for and develop new therapeutic compounds and to determine their activity, metabolism and toxicity. The development of such tests, particularly high-throughput screening (HTS), would reduce the time and money needed to develop compounds with therapeutic activity, eliminate, to a large extent, the need to use animals for experimentation and would also reduce the exposure of patients to the adverse effects of the compounds during clinical trials. In addition, the availability of different types of cells from various individuals would provide a better understanding of the effects of a potentially therapeutic compound on a specific individual, leading to the full development of the pharmacogenomic field, where the activity of a compound would be correlated with the individual's genetic structure. The stem cells and their differentiated progeny are also very valuable in the process of searching for and characterising new genes involved in a wide variety of biological processes including development, cellular differentiation and neoplastic processes.

Depending on the origin of the stem cells, we can differentiate between embryonic stem cells (ES cells) and adult stem cells. The ES cells come from the internal cellular mass of the blastocyte and their most relevant feature is the fact that they are pluripotential, which means that they can give rise to any adult tissue derived from the three embryonic layers. Adult stem cells are partially compromised cells present in adult tissue which can remain in the human body for decades although they become scarcer with the passage of time.

Despite the high pluripotentiality of ES stem cells, therapies based on the use of adult stem cells offer a series of advantages over those based on ES cells. First of all, it is complicated to control the culturing conditions of ES cells without inducing their differentiation, which raises the economic cost and the work required to use these types of cells. Furthermore, ES cells must go through several intermediate stages before they become the specific cell type needed to treat a particular pathology, a process that is controlled by chemically complex compounds. There are also problems related to the safety of the therapeutic use of ES cells due to the high probabilities that the undifferentiated stem cells from embryonic tissue will produce a type of tumour known as teratocarcinoma. Finally, the cells derived from ES cells are usually rejected by the immunological system due to the fact that the immunological profile of such cells differs from that of the recipient. Although this problem could be addressed by using a process known as "therapeutic cloning", in which autologous ES cells can be obtained by transferring the nucleus of a somatic cell from a patient to the ovocyte of a female donor, this technique has not yet been developed in humans and poses serious ethical and legal problems. Another solution could be the generation of "universal" cellular lines with generalised immune compatibility, but there is no technology at this time that allows obtaining such cells.

On the contrary, adult stem cells are not rejected by the immune system if obtained by autologous transplant. Furthermore, the fact that they are partially compromised reduces the number of differentiation stages necessary to generate specialised cells. In addition, the use of this type of cells is not associated with any type of legal or ethical controversy. Moreover, although these types of cells have less differentiation potentiality than ES cells, most of them are really multipotent which means that they can be differentiated to more than one type of tissue. What this suggests is that if an adequate source of adult stem cells is obtained, we could provide different cell types capable or covering multiple therapeutic applications.

A new type of mammal stem cell called "Multipotent Adult Progenitor Cell" (MAPC) was recently isolated from bone marrow and other tissues. This type of stem cells appears to be the progenitor of the so-called mesenchymal stem cells and shows a great deal of multipotentiality. However, the process of isolating and cultivating them is long and costly, and it includes the use of large quantities of diverse growth factors. In the last several years many different types of mesoderm stem cells have been isolated from both mouse and human tissues and characterized to different extent. These include endothelial progenitor cells (EPC), multipotent adult progenitor cells (MAPC), side population cells (SP), mesoangioblasts, stem/progenitor cells from muscle endothelium, sinovia, dermis, and adipose tissue. Different experimental procedures, different sources and partial characterization still prevent a complete understanding of the heterogeneity of these cells; even less is known on their origin and possible lineage relationships. Whatever the case, many of these cells, such as MDSC or MAPC have been shown to differentiate into skeletal muscle in vitro. Some of these cells grow extensively in vitro but others such as EPC and SP do not; on the other hand EPC and SP can circulate whereas systemic delivery has not been tested for most of the other cell types. For example, it was recently shown that cells isolated from adipose tissue can be grown in vitro extensively, differentiate into several tissues including skeletal muscle and give rise to human dystrophin expressing fibers. But few of these cells can differentiate efficiently to other cells types or be obtained and grow easily.

There is, therefore, a need to obtain an easily available source of multipotent stem cells. In particular, cells that can be easily isolated from a live subject without involving significant risk or pain, without high isolation and culturing costs and with minimal contamination from other cell types and not possessing the fear of karyotypic abnormalities during culture and possibility of oncogenesis.

Document EP 1876233 describes the isolation of a cell population which originate in an endometrial tissue or from an endometrial tissue isolated from a menstrual blood, a cord blood or an appendage of a fetus. These cells can differentiate into cardiac muscle cells. Masanori O. et al (PNAS, 2007. vol. 104, 47: 18700-18705) have described the isolation of a side population in human uterine myometrium with phenotypic and functional characteristics of stem cells. Said cells are positive for the surface markers CD90, CD73, CD105, CD34 and STRO-I and negative for CD44. Said cells were able to differentiate into adipocyte, osteocyte and smooth muscle cells. The isolation of said cell population is carried out by means of hysterectomy, i.e. by surgical removal of the uterus.

SUMMARY OF THE INVENTION

The authors of the present invention have isolated a new cell population from the mouse adult uterine wall, in particular, from the myometrial tissue, by means of using a simple and non-invasive approach. These cells are able to differentiate into many different mesoderm tissues types, including smooth muscle, adipocytes, osteoblasts, skeletal muscle and neural tissue thus, making them suitable for regenerative medicine.

Hence, in a first aspect, the present invention refers to an isolated, myometrial- derived mesenchymal stem cell population characterized in that the cells of said cell population are positive for CD31, CD34, CD44, CDl 17, SSEA-4, HLA-DR and WGA- lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl -81 surface markers.

In another aspect, the invention refers to said isolated stem cell population of the invention for use as a medicament.

In a further aspect, the invention relates to the isolated stem cell population of the invention for the treatment of a tissue degenerative condition.

In another aspect, the invention refers to a pharmaceutical composition comprising an isolated stem cell population according to the invention and an acceptable pharmaceutical vehicle.

According to a further aspect, the invention refers to a method for isolating a stem cell population from myometrial tissue, wherein the cells of said cell population are characterized in that are positive for CD31, CD34, CD44, CDl 17, SSEA-4 and WGA- lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl -81 surface markers, said method comprising the steps of: i) incubating a myometrial tissue sample in a suitable cell culture medium on a solid surface under conditions allowing cells of said sample to adhere to said solid surface; ii) recovering the cells from said cell culture which do not adhere to said solid surface or which present low adherence capacity; and iii) confirm that the selected cell population presents the phenotype of interest.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Surface markers expression analyzed by flow cytometry. FACS analysis using a panel of antibodies: CD13, CD31, CD34, CD44, CD45, CD80, CD90, CDl 17,

CD133, CD146, PAL, HLA-DR, TRAl-60, TRAl-81, SSEA-4, WGA and TMRM.

Figure 2. Expression of MAMps markers analyzed by PCR. RNA extracted from the different clones cells was analyzed for the presence of markers genes like Sox2, hTERT, MEF2a/2c and Tbx2/5 by PCR. Figure 3. Staining for alkaline phosphatase revealing expression at varying levels in

100% of the cell population. Figure 4: EMSCs immuno staining for nestin after one week in culture in neural stem cell proliferation medium. Phase contrast (left panel), Nestin (middle panel), nuclei (right panel). (Microphoto graphs taken with a Nikon camera in a Nikon Fluorescence Inverted Microscope with a 2Ox objective).

DETAILED DESCRIPTION OF THE INVENTION

The present invention refers to a new mesenchymal stem cell population which has been isolated from myometrial tissue, said stem cell population showing capability to differentiate into multiple cell types in vitro. Thus, in a first aspect, the present invention refers to an isolated, myometrial- derived mesenchymal stem cell population, hereinafter referred to as "cell population of the invention", characterized in that the cells of said cell population are positive for CD31, CD34, CD44, CDl 17, SSEA-4 (Stage-specific embryonic antigen-4), HLA-DR and WGA-lectin (wheat germ agglutinin- lectin) surface markers and negative for CD 13, CD45, CD80, CD133, CD146, TRAl-60 and TRA1-81 (Tumor Rejection Antigen 1) surface markers.

As used herein, the term "MHC" (major histocompatibility complex) refers to a subset of genes that encodes cell-surface antigen-presenting proteins. In humans, these genes are referred to as human leukocyte antigen (HLA) genes. Herein, the abbreviations MHC or HLA are used interchangeably.

As used herein, the term "isolated" applied to a cell population refers to a cell population, isolated from the human or animal body, which is substantially free of one or more cell populations that are associated with said cell population in vivo or in vitro. The cells of the cell population of the invention, hereinafter referred to as the "cells of the invention", derive from the myometrial tissue. The term "myometrial tissue" refers to tissue derived from the middle layer of the uterine wall. The term "uterus" as used herein, encompasses the cervical canal and uterine cavity. Hence, it is noted that throughout the specification and claims, the term "uterine tissue" refers to any material in the cervical canal and uterine cavity. The cells of the invention can be obtained from any suitable source of myometrial tissue from any suitable animal, including humans. In general, said cells are obtained from non-pathological post-natal mammalian myometrial tissue. In a particular embodiment, the cells of the cell population of the invention are from a mammal, e.g , a rodent, primate, etc, preferably, from a human.

As mentioned above, the cells of the invention are characterized in that are positive for CD31, CD34, CD44, CDl 17, SSEA-4, HLA-DR and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl -81 surface markers.

As used herein, "negative" with respect to cell surface markers means that, in a cell population comprising the cells of the invention, less than 10%, preferably 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 % or none of the cells show a signal for a specific cell surface marker in flow cytometry above the background signal, using conventional methods and apparatus (for example a Calibur (Becton Dickinson) FACS system used with commercially available antibodies and standard protocols known in the art).

In a particular embodiment, the cells of the invention are characterised in that they express the following cell surface markers CD31, CD34, CD44, CDl 17, SSEA-4, HLA-DR and WGA-lectin, i.e., the cells of the invention are positive for said cell surface markers. Preferably, the cells of the invention are characterised in that they have significant expression levels of said cell surface markers. As used herein, the expression "significant expression" means that, in a cell population comprising the cells of the invention, more than 10%, preferably 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or all of the cells show a signal for a specific cell surface marker by flow cytometry above the background signal using conventional methods and apparatus (for example a Calibur (Becton Dickinson) FACS system used with commercially available antibodies and standard protocols known in the art). The background signal is defined as the signal intensity given by a non-specific antibody of the same isotype as the specific antibody used to detect each surface marker in conventional FACS analysis Thus for a marker to be considered positive the specific signal observed is stronger than 10%, preferably 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 500%, 1000%, 5000%, 10000% or above, than the background signal intensity using conventional methods and apparatus (for example a Calibur (Becton Dickinson) FACS system used with commercially available antibodies and standard protocols known in the art). Commercially available and known monoclonal antibodies against said cell- surface markers (e.g., cellular receptors and transmembrane proteins) can be used to identify the cells of the invention.

In a particular embodiment of the invention, the cells of the cell population of the invention are characterized in that they express at least one of the following genes: MefZc (myocyte enhancer factor 2C), Sox2 (SRY (sex determining region Y)-box 2), Tbx5 (T -box 5) and hTERT (telomerase reverse transcriptase catalytic subunit). In a more particular embodiment, said cells do not express Mef2a (myocyte enhancer factor 2A) and Tbx2 (T -box 5) genes. The term "gene" as used herein, may be a gene comprising transcriptional and/or translational regulatory sequences and/or a coding region and/or non- translated sequences (e.g., introns, 5'- and 3 '-untranslated sequences). The coding region of a gene may be a nucleotide sequence coding for an amino acid sequence or a functional RNA, such as tRNA, rRNA, catalytic RNA, siRNA, miRNA or antisense RNA. A gene, may also be an mRNA or cDNA corresponding to the coding regions (e.g., exons and miRNA) optionally comprising 5'- or 3 '-untranslated sequences linked thereto. A gene may also be an amplified nucleic acid molecule produced in vitro comprising all or a part of the coding region and/or 5'- or 3 '-untranslated sequences linked thereto.

The term "gene expression" refers to a process that involves transcription of the DNA code into mRNA, translocation of mRNA to ribosomes, and translation of the RNA message into proteins. The determination of the expression levels of said genes can be carried out by any standard method known in the state of the art. As an illustrative, non limitative, example, said methods include measuring the expression levels of the mRNA encoded by the above mentioned genes. For this purpose, a biological sample comprising the cells of the invention may be treated to physically or mechanically disrupt cell structure, to release intracellular components into an aqueous or organic solution to prepare nucleic acids for further analysis. The nucleic acids are extracted from the sample by procedures known to the skilled person and commercially available. RNA is then extracted by any of the methods typical in the art, for example, Sambrook, Fischer and Maniatis, Molecular Cloning, a laboratory manual, (2nd ed.), Cold Spring Harbor Laboratory Press, New York, (1989). Preferably, care is taken to avoid degradation of the RNA during the extraction process. While all techniques of gene expression profiling are suitable for use in performing the foregoing aspects of the invention, the gene mRNA expression levels are often determined by reverse transcription polymerase chain reaction (RT-PCR).

In order to normalize the values of mRNA expression among the different samples, it is possible to compare the expression levels of the mRNA of interest in the test samples with the expression of a control RNA. Preferably, the control RNA is mRNA derived from housekeeping genes and which code for proteins which are constitutively expressed and carry out essential cellular functions. Preferred housekeeping genes for use in the present invention include β-2-microglobulin, ubiquitin, 18-S ribosomal protein, cyclophilin, GAPDH and actin.

Preferably, in the various embodiments of the invention, the detection method provides an output (i.e., readout or signal) with information concerning the presence, absence of the marker(s) in a sample. According to the present invention, the output may be qualitative (e.g., "positive" or "negative"). In this sense, "positive gene expression" is considered when an amplification product of said gene using any standard amplification reaction is obtained. Means for evaluating or detecting said amplification product are well known in the state of the art. In an illustrative way, said methods include, for example, visualisation of a band in an agarose gel as shown in the Example 1 accompanying the present invention. In order to carry out said amplification reaction, specific amplification oligonucleotides for said genes are used.

The terms "oligonucleotide primers" or "amplification oligonucleotides" are herein used indistinguishably and refer to a polymeric nucleic acid having generally less than 1 ,000 residues, including those in a size range having a lower limit of about 2 to 5 residues and an upper limit of about 500 to 900 residues. In preferred embodiments, oligonucleotide primers are in a size range having a lower limit of about 5 to about 15 residues and an upper limit of about 100 to 200 residues. More preferably, oligonucleotide primers of the present invention are in a size range having a lower limit of about 10 to about 15 residues and an upper limit of about 17 to 100 residues. Although oligonucleotide primers may be purified from naturally occurring nucleic acids, they are generally synthesized using any of a variety of well known enzymatic or chemical methods. The term "amplification oligonucleotide" refers to an oligonucleotide that hybridizes to a target nucleic acid, or its complement, and participates in a nucleic acid amplification reaction. Amplification oligonucleotides include primers and promoter primers in which the 3' end of the oligonucleotide is extended enzymatically using another nucleic acid strand as the template. In some embodiments, an amplification oligonucleotide contains at least about 10 contiguous bases, and more preferably about 12 contiguous bases, that are complementary to a region of the target sequence (or its complementary strand). Target-binding bases are preferably at least about 80%, and more preferably about 90% to 100% complementary to the sequence to which it binds. An amplification oligonucleotide is preferably about 10 to about 60 bases long and may include modified nucleotides or base analogues. Illustrative, non limitative, amplification oligonucleotides for use according to the present invention, include the ones disclosed in the Example 1 accompanying the present invention.

In another particular embodiment of the invention, the cells of the invention express alkaline phosphatase protein. Alkaline phosphatase (ALP) is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules, including nucleotides, proteins, and alkaloids. Alkaline phosphatase is a stem cell membrane marker and elevated expression of this enzyme is associated with undifferentiated pluripotent stem cell. All primate pluripotent stem cells, like Embryonic stem (ES), embryonic germ (EG) and embryonal carcinoma (EC) cells, express alkaline phosphatase activity.

There are different methods known in the state of the art for the detection of ALP such as methods based on enzymatic reaction followed by colorimetric or fast red violet dye, fluorescent detection and immuno staining.

According to the present invention, any standard technique of protein expression profiling is suitable for use in performing the foregoing aspects of the invention. In particular, alkaline phosphatase protein expression may be detected by means of flow cytometry technique using conventional methods and apparatus (for example a Calibur (Becton Dickinson) FACS system used with commercially available antibodies and standard protocols known in the art). Alternatively, alkaline phosphatase protein expression can be determined by means standard protein expression assays in which specific antibodies against said protein are used. Such assays include radioimmunoassays, enzyme immunoassay (e.g., ELISA), immunofluorescence, immunoprecipitation, latex agglutination, hemagglutination, and histochemical tests. As an illustrative, non limitative, example alkaline phosphatase protein expression is determined as described in the Example 1 accompanying the present invention.

The mitochondrial membrane potential (ΔΨm) is a key indicator o f mitochondrial function and the characterization of ΔΨm in situ allows for an accurate determination of mitochondrial bioenergetics and cellular metabolism. Methods for measuring ΔΨm include using monovalent cationic fluorescent dyes such as tetramethylrhodamine methyl ester (TMRM) due to their non-invasive nature. The fluorescent membrane-permeant cationic probe TMRM has become one of the more readily used probes in the analysis of ΔΨm in intact cells. The ability to measure ΔΨm paralleled to cellular and mitochondrial physiology, protein localization and real time enzymatic kinetics enables the characterization of the progression of necrotic and apoptotic cell death as well as cell survival following the addition of stimuli and drugs.

In a particular embodiment, the cells of said cell population present a low mitochondrial membrane potential. According to the present invention, the term "low mitochondrial membrane potential" means that, in a cell population comprising the cells of the invention, less than 10%, preferably 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 % or none of the cells show a signal for a specific mitochondrial membrane marker in flow cytometry above the background signal, using conventional methods and apparatus (for example a Calibur (Becton Dickinson) FACS system).

Advantageously, the cells of the invention lack in vivo tumorigenic activity. Thus, in another particular embodiment of the invention, the cell population of the invention does not present tumorigenic activity. The expression "tumorigenic activity" as used here in refers to an altered behaviour or proliferative phenotype which gives rise to a tumour cell.

The tumorigenic activity of the cells of the invention can be tested by performing animal studies using immunodefϊcient mice strains. In these experiments, several million cells are implanted subcutaneously in the recipient animals, which are maintained for several weeks and analyzed for tumour formation. A particular assay is disclosed in Example 1 accompanying the present invention.

The cells of the invention present the capacity to proliferate and be differentiated into several cell lineages. In a preferred embodiment, the cells of the invention present capacity to be differentiated into at least two, more preferably three, four, five, six, seven or more cell lineages. In this sense, the cells of the invention can proliferate and differentiate into cells of other lineages by conventional methods.

In a particular embodiment of the invention, the cells of the cell population of the invention present capacity to be differentiated into smooth muscle cells. In another particular embodiment, the cells of said population present capacity to be differentiated into adipocytes. In a further embodiment, the cells of said population present capacity to be differentiated into osteoblasts. In another particular embodiment, the cells of said population present capacity to be differentiated into neural cells. Methods for identifying and subsequently isolating differentiated cells from their undifferentiated counterparts can be also earned out by methods well known in the art.

The cells of the invention are also capable of being expanded ex vivo. That is, after isolation, the cells of the invention can be maintained and allowed to proliferate ex vivo in culture medium. Such medium is composed of, for example, Dulbecco's Modified Eagle's Medium (DMEM), with antibiotics (for example, 100units/ml Penicillin and 100 μg/ml Streptomycin) or without antibiotics, and 5 mM glutamine, and supplemented with 2-20% fetal bovine serum (FBS). It is within the skill of one in the art to modify or modulate concentrations of media and/or media supplements as necessary for the cells used. Sera often contain cellular and non-cellular factors and components that are necessary for viability and expansion. Examples of sera include FBS, bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum (HS), porcine serum, sheep serum, rabbit serum, rat serum (RS), etc. Also contemplated is, if the cells of the invention are of human origin, supplementation of cell culture medium with a human serum, preferably of autologous origin. It is understood that sera can be heat- inactivated at 55-65 ⁰C if deemed necessary to inactivate components of the complement cascade. Modulation of serum concentrations, withdrawal of serum from the culture medium can also be used to promote survival of one or more desired cell types. Preferably, cells of the invention will benefit from FBS concentrations of about 2% to about 25%. In another embodiment, the cells of the invention can be expanded in a culture medium of definite composition, in which the serum is replaced by a combination of serum albumin, serum transferrin, selenium, and recombinant proteins including but not limited to insulin, platelet-derived growth factor (PDGF), and basic fibroblast growth factor (bFGF) as known in the art.

Many cell culture media already contain amino acids, however some require supplementation prior to cultunng cells. Such amino acids include, but are not limited to, L-alanine, L- arginine, L-aspartic acid, L-asparagine, L cysteine, L-cystine, L- glutamic acid, L-glutamine, L-glycine, and the like.

Antimicrobial agents are also typically used in cell culture to mitigate bacterial, mycoplasmal, and fungal contamination. Typically, antibiotics or anti-mycotic compounds used are mixtures of penicillin/streptomycin, but can also include, but are not limited to amphotericin (Fungizone(R)), ampicillin, gentamicin, bleomycin, hygromacin, kanamycin, mitomycin, etc.

Hormones can also be advantageously used in cell culture and include, but are not limited to, D-aldosterone, diethylstilbestrol (DES), dexamethasone, b-estradiol, hydrocortisone, insulin, prolactin, progesterone, somato statin/human growth hormone (HGH), etc.

The maintenance conditions of the cells of the invention can also contain cellular factors that allow cells to remain in an undifferentiated form. It is apparent to those skilled in the art that prior to differentiation, supplements that inhibit cell differentiation must be removed from the culture medium. It is also apparent that not all cells will require these factors. In fact, these factors may elicit unwanted effects, depending on the cell type.

In another particular embodiment of the invention, said cells present a limited proliferation rate. Indeed, the data herewith presented demonstrate that the cells of the invention can be grown extensively but not indefinitely in vitro. These cells undergo senescence after approximately 30 passages in vitro.

The cells of the invention can be transfected or genetically engineered to express, at least, one polypeptide of interest. Thus, in another particular embodiment, the cells of the invention are genetically modified.

A cell is said to be "genetically modified", "transfected", or "genetically transformed" when a polynucleotide has been transferred into the cell by any suitable means of artificial manipulation, or where the cell is a progeny of the originally altered cell that has inherited the polynucleotide. The polynucleotide will often comprise a transcribable sequence encoding a protein of interest, which enables the cell to express the protein at an elevated level. The genetic alteration is said to be "inheritable" if progeny of the altered cell have the same alteration. "Transformed cell" means a cell into which (or into predecessor or an ancestor of which) a nucleic acid molecule encoding a polypeptide of the invention has been introduced, by means of, for example, recombinant DNA techniques or viruses. "Nucleic acid" or "nucleic acid molecule" refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or double- stranded form, and unless otherwise limited, can encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides. The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but which functions in a manner similar to a naturally occurring amino acid.

In recent years, MSC have been increasingly given a role in tissue repair and regeneration. In different models of tissue damage, MSC improve the recovery of injured tissues.

The cells of the invention express some of the proteins that leukocytes use to adhere to and cross the endothelium (CD44) and thus can diffuse into the interstitium of the skeletal muscle, inside the osteogenic tissue and between the adypocytes, when delivered intra-arterially. On the other hand, the data presented herein demonstrate that the cells of the invention can be grown extensively but not indefinitely in vitro, which is of vital importance considering that an additional concern for future cell therapy protocols is the risk that extensive expansion in vitro may compromise differentiation and/or self-renewal ability or even lead to malignant transformation. Indeed, as mentioned above, said cells undergo senescence after approximately 30 passages in vitro. Additionally, these cells maintain a diploid karyotype and are not tumorigenic in immune deficient mice. The term "karyotype" as used herein, refers to the chromosome characteristics of an individual cell or cell line of a given species, as defined by both the number and morphology of the chromosomes. Typically, the karyotype is presented as a systematized array of prophase or metaphase (or otherwise condensed) chromosomes from a photomicrograph or computer-generated image. Alternatively, interphase chromosomes may be examined as histone-depleted DNA fibres released from interphase cell nuclei. It is considered a normal karyotype when the number of chromosomes is not altered compared to the number of chromosomes of the specie.

Therefore, in a further aspect, the present invention refers to the isolated stem cell population of the invention for use as a medicament. In a particular embodiment, the cell population of the invention is used as a medicament for the treatment of a tissue degenerative condition. The term "tissue degenerative condition" as used herein, refers to tissue which exhibits a pathological condition. Thus, according to the present invention, said cell population or composition of the invention can be used as a medicament for tissue repair and/or regeneration. In this sense, the cell population of the invention can be used for enhancing the proliferation, regeneration and/or engrafting of stem cells in said tissue, i.e. for the repair and/or regeneration of aging and/or damaged tissue.

In a more particular embodiment, said tissue degenerative condition is skeletal muscle degeneration, cardiac tissue degeneration, bone tissue degeneration, neural tissue degeneration, lung degeneration, liver degeneration, kidney degeneration or more than one of said tissue degenerative conditions simultaneously.

As used herein, the terms "treat", "treatment" and "treating" refer to the amelioration of one or more symptoms associated with a disorder that results from the administration of the cell population of the invention or a pharmaceutical composition comprising same, to a subject in need of said treatment. Thus, "treatment" as used herein covers any treatment of a disorder, disease or condition of a mammal, particularly a human, and includes: (a) preventing the disease or condition from occurring in a subject which may be predisposed to the disease or condition but has not yet been diagnosed as having it; (b) inhibiting the disease or condition, i.e., arresting its development; or (c) relieving the disease or condition, i.e., causing regression of the disease or condition or amelioration of one or more symptoms of the disease or condition. The population of subjects treated by the method includes a subject suffering from the undesirable condition or disease, as well as subjects at risk for development of the condition or disease. As used herein, the terms "disorder" and "disease" are used interchangeably to refer to an abnormal or pathological condition in a subject that impairs bodily functions and can be deadly.

The term "subject" refers to an animal, preferably a mammal including a non- primate (e.g. a cow, pig, horse, cat, dog, rat, or mouse) and a primate (e.g. a monkey or a human). In a preferred embodiment, the subject is a human.

While it is possible for the active agent, i.e. the cell population of the invention, to be administered alone, it is preferable to present it as part of a pharmaceutical formulation or composition, comprising as active ingredient an effective amount of a cell population according to the invention. The pharmaceutical formulation or composition in the context of the invention is intended to mean a combination of the active agent(s), together or separately, with a pharmaceutically acceptable carrier as well as other additives. Thus, in another aspect, the present invention refers to a pharmaceutical composition comprising an isolated stem cell population of the invention and an acceptable pharmaceutical vehicle or carrier.

In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the US Pharmacopeia, or European Pharmacopeia, or other generally recognized pharmacopeia for use in animals and, more particularly, in humans.

The term "carrier" in the context of the present invention denotes any one of inert, non-toxic materials, which do not react with the cell population of the invention and which can be added to formulations as diluents, adjuvants, excipients, or vehicle or to give form or consistency to the formulation. The carrier may at times have the effect of the improving the delivery or penetration of the active ingredient to the target tissue, for reducing undesired side effects etc. The carrier may also be a substance that stabilizes the formulation (e.g. a preservative), for providing the formulation with an edible flavor, etc. For examples of carriers, stabilizers and adjuvants, see E. W. Martin, REMINGTON'S PHARMACEUTICAL SCIENCES, MacK Pub Co (June, 1990). The composition, if desired, can also contain minor amounts of pH buffering agents. Such compositions will contain a prophylactic or therapeutically effective amount of a prophylactic or therapeutic agent preferably in purified form, together with a suitable amount of earner so as to provide the form for proper administration to the subject. The formulation should suit the mode of administration. In a preferred embodiment, the pharmaceutical compositions are sterile and in suitable form for administration to a subject, preferably an animal subject, more preferably a mammalian subject, and most preferably a human subject.

The pharmaceutical composition of the invention may be in a variety of forms. These include, for example, solid, semi-solid, and liquid dosage forms, such as lyophilized preparations, liquids solutions or suspensions, injectable and infusible solutions, etc. The preferred form depends on the intended mode of administration and therapeutic application.

The administration of the cell population of the invention, or the pharmaceutical composition comprising same, to the subject in need thereof can be earned out by conventional means. In a particular embodiment, said cell population is administered to the subject by a method which involves transferring the cells to the desired tissue, either in vitro (e.g., as a graft prior to implantation or engrafting) or in vivo, to the animal tissue directly. The cells can be transferred to the desired tissue by any appropriate method, which generally will vary according to the tissue type. For example, cells can be transferred to graft by bathing the graft (or infusing it) with culture medium containing the cells. Alternatively, the cells can be seeded onto the desired site within the tissue to establish a population. Cells can be transferred to sites in vivo using devices such as catheters, trocars, cannulae, stents (which can be seeded with the cells), etc.

In addition, the active materials can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, or have another action. The compounds, i.e. the cell population of the invention, may be formulated as the sole pharmaceutically active ingredient in the composition or may be combined with other active ingredients, such as, for example other agents useful in the treatment of a tissue degenerative condition. Hence, the cell population and composition of the invention may be administered in a combination therapy. The term "combination therapy" refers to the use of the cell populations of the present invention with other active agents or treatment modalities, in the manner of the present invention for the amelioration of one or more symptoms associated with a disorder. These other agents or treatments may include known drugs and therapies for the treatment of such disorders. The combined use of the agents of the present invention with other therapies or treatment modalities may be concurrent, or given sequentially, that is, the two treatments may be divided up such that a cell population or a pharmaceutical composition comprising same of the present invention may be given prior to or after the other therapy or treatment modality. The attending physician may decide on the appropriate sequence of administering the cell population, or a pharmaceutical composition comprising same, in combination with other agents, therapy or treatment modality.

In other aspect, the present invention relates to the use of the cells of the invention for the preparation of a medicament for preventing, treating or ameliorating one or more symptoms associated with a tissue degenerative condition including, but not limited to, skeletal muscle degeneration, cardiac tissue degeneration, bone tissue degeneration, neural tissue degeneration, lung degeneration, liver degeneration, kidney degeneration or more than one of said tissue degenerative conditions simultaneously.

In another aspect, the present invention refers to a method, hereinafter referred to as the "method of the invention", for isolating a stem cell population from myometrial tissue, wherein the cells of said cell population are characterized in that are positive for CD31, CD34, CD44, CDl 17, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRAl -81 surface markers, said method comprising the steps of: i) incubating a myometrial tissue sample in a suitable cell culture medium on a solid surface under conditions allowing cells of said sample to adhere to said solid surface; ii) recovering the cells from said cell culture which do not adhere to said solid surface or which present low adherence capacity; and iii) confirm that the selected cell population presents the phenotype of interest.

As used herein, the term "solid surface" refers to any material that allows cells to adhere. In a particular embodiment said material is gelatin. As shown in the Example 1 accompanying the present invention, myometrial tissue samples were transferred to a Petri dish coated with gelatin 1% as previously described for other cell types (Minasi, M.G., et al cited supra; Sampaolesi M, et al. 2003. Science. 301 :487-492). These samples were cultured for 15 days and after the initial outgrowth of fibroblast-like cells, small round and refractile cells appeared. . Those cells, which adhered poorly to the substratum and floated, were easily collected by gently pipetting from the original culture. Said floating cells were either grown as a polyclonal population or, in some cases, cloned by limited dilution. Thus, according to step ii) of the method of the invention, the expression "low adherence capacity" as used herein, refers to cells which, under standard conditions allowing cells (such as, for example, fibroblast) adhere to said solid surface, either do not adhere to said solid surface and thus, float in the culture medium, or can easily be collected from said culture medium by means, for example, of gently pipetting.

The cells of the invention can be obtained by conventional means from any suitable source of myometrial tissue from any suitable animal, including humans. In a particular case, myometrial tissue samples are obtained from the lower uterine segment of the corpus uteri by uterine exfolation. Sampling involves collecting exfoliated cells from the endocervical uterine canal with an appropiate tool as explained in the Example 1 accompanying the present invention. In general, said cells are obtained from non- pathological post-natal mammalian myometrial tissue. In a particular embodiment, the cells of the cell population of the invention are from a mammal, e.g, a rodent, primate, etc, preferably, from a human. The animal can be alive or dead, so long as myometrial tissue cells within the animal are viable. Typically, human myometrial cells are obtained from living donors, using well-recognized protocols as explained above.

The sample of miometrial tissue is, preferably, washed before being processed to separate the cells of the invention from the remainder of the material. The remaining cells generally will be present in clumps of various sizes, and the protocol can proceed using steps gauged to degrade the gross structure while minimizing damage to the cells themselves. The lumps of cells can be degraded using treatments, such as mechanical agitation, sonic energy, thermal energy, etc. Following the final isolation, the cells can be cultured and, if desired, assayed for number and viability to assess the yield. Desirably, the cells will be cultured without differentiation, on a solid surface, using a suitable cell culture media, at the appropriate cell densities and culture conditions. Thus, in a particular embodiment, cells are cultured without differentiation on a solid surface, usually made of gelatin in the presence of a suitable cell culture medium [e g , DMEM, typically supplemented with 5-15% (e g , 10%) of a suitable serum, such as fetal bovine serum or human serum], and incubated under conditions which allow cells to adhere to the solid surface and proliferate.

The cells are maintained in culture in the same medium and under the same conditions until they reach the adequate confluence, typically, about 80% cell confluence, with replacement of the cell culture medium when necessary. After reaching the desired cell confluence, the cells can be expanded by means of consecutive passages using a detachment agent such as trypsin and seeding onto a bigger cell culture surface at the appropriate cell density (usually 2,000- 10,000 cells/cm²) Thus, cells are then passaged at least twice in such medium without differentiating, while still retaining their developmental phenotype, and more preferably, the cells can be passaged at least 10 times (e g , at least 15 times or even at least 20 times) without losing developmental phenotype Typically, the cells are plated at a desired density such as between about 100 cells/cm2 to about 100,000 cells/cm2 (such as about 500 cells/cm2 to about 50,000 cells/cm2, or, more particularly, between about 1,000 cells/cm2 to about 20,000 cells/cm ) If plated at lower densities (e g , about 300 cells/cm ), the cells can be more easily clonally isolated. For example, after a few days, cells plated at such densities will proliferate into an homogeneous population In a particular embodiment, the cell density is between 2,000-10,000 cells/cm2. As a result of the above method, a homogeneous cell population having the phenotype of interest is obtained. Example 1 describes in a detailed manner the isolation of the cells of the invention from mouse myometrial tissue.

Confirmation of the phenotype of interest can be carried out by using conventional means. Cell-surface markers can be identified by any suitable conventional technique, usually based on a positive/negative selection, for example, monoclonal antibodies against cell-surface markers, whose presence/absence in the cells has to be confirmed, can be used, although other techniques can also be used. Thus, in a particular embodiment, monoclonal antibodies against one, two, three, four, five, six, seven of or preferably all of CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl -81 surface markers are used in order to confirm the absence of said markers in the selected cells, and monoclonal antibodies against one, two, three, four, of or preferably all of CD31, CD34, CD44, CDl 17, SSEA-4, HLA-DR and WGA-lectin are used in order to confirm the presence thereof or detectable expression levels of, at least one of and preferably all of, said markers. Said monoclonal antibodies are known, commercially available or can be obtained by a skilled person in the art by conventional methods.

The cells and cell populations provided by the instant invention can be clonally expanded, if desired, using a suitable method for cloning cell populations. For example, a proliferated population of cells can be physically picked and seeded into a separate plate (or the well of a multi-well plate). Alternatively, the cells can be subcloned onto a multi- well plate at a statistical ratio for facilitating placing a single cell into each well (e.g., from about 0,1 to about 1 cell/well or even about 0,25 to about 0,5 cells/well, such as 0,5 cells/well). Of course, the cells can be cloned by plating them at low density (e.g., in a Petri dish or other suitable substrate) and isolating them from other cells using devices such as a cloning rings. The production of a clonal population can be expanded in any suitable culture medium. In any event, the isolated cells can be cultured to a suitable point when their developmental phenotype can be assessed.

Any of the steps and procedures for isolating the cells of the cell population of the invention can be performed manually, if desired. Alternatively, the process of isolating such cells can be facilitated and/or automated through one or more suitable devices, examples of which are known in the art.

In another aspect, the invention refers to a kit comprising a cell population containing the cells of the invention. In other aspect, the present invention refers to the use of a cell population containing cells of the invention for preventing, treating, or ameliorating one or more symptoms associated with a tissue degenerative condition in a subject suffering from said disorders or diseases.

In other aspect, the present invention provides methods of preventing, treating, or ameliorating one or more symptoms associated with a tissue degenerative condition, in a subject suffering from said disorders or diseases, which comprises administering to said subject in need of such treatment of a prophylactically or therapeutically effective amount of a cell population containing cells of the invention. In a particular embodiment, said tissue degenerative condition is skeletal muscle degeneration, cardiac tissue degeneration, bone tissue degeneration, neural tissue degeneration, lung degeneration, liver degeneration, kidney degeneration or more than one of said tissue degenerative conditions simultaneously.

The invention will now be described in more detail, by way of examples which in no way are meant to limit the scope of the invention, but, rather, these examples will serve to illustrate the invention with reference to the accompanying figures.

EXAMPLE

Isolation, in vitro expansion and differentiation of mouse adult myometrial precursors (MAMps) from the uterine tissue

I. Materials and Methods

Uterine and myometrial explants

Myometrial explants were taken from the lower uterine segment of the corpus uteri by uterine exfolation. Sampling involves collecting exfoliated cells from the endocervical uterine canal with an appropiate tool. All explants were trimmed of endometrial, serosal, fat and fibrous tissue prior to use. Technique would be similar to a cervical cytology.

Myometrial tissue can be maintained for up to 24 hours post-obtention in oxygenated (95% O₂, 5% CO₂) physiological salt solution (PBS) at room temperature. Samples were transferred to a Petri dish coated with gelatin 1% in presence of 10% FBS-DMEM plus 5 mM glutamine and antibiotics. These samples were cultured for 15 days and after the initial outgrowth of fϊbroblast-like cells, small round and refractile cells appeared. This cell population was easily collected by gently pipeting of the original culture, counted and cloned by limited dilution on gelatin 1% coated p96-well dishes. Myometrial precursors were also obtained from uterine explants. Myometrial tissue pieces (10-30mg) obtained from 4 months C57 mice were kept in DMEM w/o FCS (fetal calf serum), with antibiotics. Each piece was then rinsed in PBS with Ca/Mg and sharply dissected into 1-2 mm diameter pieces with a scalpel. Fragments containing small vessels were transferred to a Petri dish coated with gelatin 1% in presence of 10% FBS-DMEM plus 5 mM glutamine and antibiotics. These fragments were cultured for 15 days and after the initial outgrowth of fϊbroblast-like cells, small round and refractile cells appeared. This cell population was easily collected by gently pipeting of the original culture, counted and cloned by limited dilution on gelatin 1% coated p96well dishes.

Different valid clones were selected by phase contrast morphology and then characterized by surface markers expression.

Differentiation assays

Differentiation into different cell types was induced following already well-known published protocols.

Cultures were shifted to differentiation medium (DMEM supplemented with 2% horse serum). Differentiation into smooth muscle cells and osteoblasts was induced by treatment with TGFβl and BMP2 respectively, as previously described (Minasi, M. G., et al. 2002. Development 129, 2773-2783). Differentiation into skeletal muscle cells was induced by co-culturing MAMps with C2C12 mouse myoblasts. Differentiation into cardiac cells was analyzed after treatment with 10 microM 5-azacytidine for 48 hours. After 5 days cultures were fixed and stained with colour solutions or with antibodies against striated myosin (MF20).

Differentiation into neural cells consist on changing the culture medium to a neural stem cell proliferation medium: DMEM:F12 medium (Sigma) supplemented with D-Glucose (Sigma) to a final concentration of 4.5 mg/ml, N2 Supplement (Gibco- Invitrogen), B27 Supplement (Gibco-Invitrogen), 20μg/ml insulin (Sigma), 2 μg/ml heparin (Sigma), 20 ng/ml βFGF (Sigma), 10 ng/ml EGF (Sigma). The neural stem cell proliferation medium was changed twice and after one week in culture, the cells were processed for immuno cytochemistry. Further, cells were grown for another week in neural stem cell differentiation medium (DMEM :F 12 (Sigma), supplemented with D- Glucose (Sigma) to a final concentration of 4,5 mg/ml, N2 Supplement (Gibco- Invitrogen), B27 Supplement (Gibco-Invitrogen), 2 μg/ml heparin (Sigma) and 1% FBS (Sigma)) and for another week in specific medium for neuronal culture (Neurobasal-A (Gibco-Invitrogen), B27 (Gibco-Invitrogen), Glutamax-I (Gibco-Invitrogen), P/S (Sigma)) and oligodendrocyte differentiation (DMEM (Sigma), 4.5 mg/mL D-glucose, 100 μg/mL BSA (Sigma), 100 U/mL penicillin, 100 μg/mL streptomycin (Sigma), 2 mM L-glutamine (Sigma), 60 μg/mL N-acetyl-L-cysteine (Sigma), N2 Supplement (Gibco-Invitrogen), 20 ng/mL bFGF (PeproTech) and 10 ng/mL PDGF-AA (PeproTech). After this time, the cells were processed for inmunocytochemistry. Identification of human nuclei was confirmed by Hoechst. Percentage of differentiation was calculated by counting the number of differentiated MAMps.

Analysis of cell proliferaήon

Cells were plated at a density of 3 x 10³ cells/cm² in different media and passed on average every three days. At each passage, the number of cells was counted in triplicate in a hemocytometer. For the growing curve of the clones, cells were plated initially at 1 x 10⁴ cells/cm² in complete DMEM or embryonic media and passed every five days. At each passage, the number of cells was counted in triplicate in the hemocytometer.

Karyotype analysis

Cells, plated at 1/3 confluence 72 hours before analysis, were processed with the Karyomax kit (Invitrogen) according to the manufacturer's instructions. For each of the karyotypes analyzed, 5 different metaphase spreads were examined.

Tumorigenicity

To test for possible tumor formation, 5 nude mice were injected subcutaneously with 10⁷ MAMps. After 4 months, the mice were sacrificed and analyzed for the presence of macro scopically detectable tumors.

Immunofluorescence

Cells were grown on gelatin coated glass coverslips, washed with PBS and fixed with 4% paraformaldehyde for 10 minutes. Samples were frozen in liquid nitrogen cooled isopentane and serial 8 μm thick sections were cut with a Leyca cryostat. Cells were permeabilized with 0.2% Triton X-100, 1% BSA in PBS for 30 minutes at RT, while tissue sections were incubated without detergent. Cells and tissue sections were incubated with 10% donkey serum for 30 minutes a RT, and incubated overnight at 4°C with primary antibodies at the appropriate dilution. After incubation, samples were washed twice with the permeabilization buffer and then incubated with the appropriate FITC or TRiTC conjugated anti-mouse or anti-rabbit IgG and Hoechst for 45 minutes at RT. After three final washes, the cover slips were mounted on glass slides using mowiol in PBS and analyzed under a fluorescent microscope (Nikon). Other tissue sections or cells were stained with X-GaI as described (Sampaolesi M, et al. 2003. Science. 301 :487-492).

Antibodies

The following antibodies were used: anti-laminin monoclonal or polyclonal antibodies (Sigma) at 1 :100 dilution; MF20 antibody at 1 : 5 dilution, anti Smooth Alpha actin 1 :300 dilution from Sigma, polyclonal anti-nestin antibody (Abeam), beta-III- tubulin (anti- TUJl antibody, Abeam), doublecortin (anti- Dcx antibody, Abeam), and MAP2 (Sigma) as neuronal marker, GFAP (Sigma) as astrocyte marker and RIP (Developmental Studies Hybridoma Bank) as oligodendrocyte marker. Nuclei were stained with bisbenzimide (Sigma).

For FACS analysis (FACS Calibur (Becton Dickinson)) the following antibodies were used CD44, CD34, CD45, CDl 17, CD133 from BD Biosciences, CD31, CD13, from ID labs Inc, CD146 from Biocytes, CD80, CD90, SSEA-4, WGA from Abeam, TRA1-60 and TRAl -81 from Biotech, TMRM from Molecular Probes.

Gene expression analysis

RNA was extracted from the different MAMps clones cells while growing. RT-

PCR was performed for analyzing the expression of different genes involved in development or differentiation previously described by other groups (MefZc, Sox2,

Tbx5, hTERT, Mef2a and Tbx2). The conditions for the PCR were general for all primers: 94 ⁰C for 4 minutes. 30 cycles of 94 ⁰C, 45 s; 55 ⁰C, 45 s; 72 ⁰C, 45 s. And a final step of 72 ⁰C for 10 minutes.

List of used primers: Mef2a primer forward: TTGAGGCTCTGAACAAGAAGG Mef2a primer reverse: GCATTGCCAGTACTTGGTGG MefZc primer forward: AACACGGGGACTATGGGGAGAAA MefZc primer reverse: TATGGCTGGACACTGGGATGGTA Tbx2 primer forward: GGTGCAGACAGACAGTGCGT Tbx2 primer reverse: AGGCCAGTAGGTGACCCATG Tbx5 primer forward: CCAGCTCGGCGAAGGGATGTTT Tbx5 primer reverse: CCGACGCCGTGTACCGAGTGAT Sox2 primer forward: GGCAGCTACAGCATGATGCAGGAGC Sox2 primer reverse: CTGGTCATGGAGTTGTACTGCAGG mTERT: human/mouse TERT primer pair (R&D systems)

Alkaline Phospatase (AP) reaction

MAMps were cultured for five days on plates prior to analyzing AP activity, at high density.

On the fifth day, media was aspirated and cells fixed with 4% paraformaldehyde in PBS for 3 min. Then, fixative was aspirated and rinsed with PBS Ix.

Stain solution was added (mix fast red violet with naphthol, phosphatase solution and water in a 2:1 :1 ratio. Detection kit, (Millipore) covering each well and incubated for 15 min at room temperature in dark. Aspirate solution, rinse plates with PBS Ix and count and analyze under microscope the number of violet cells.

Results

Isolation and in vitro expansion of cells from primary mouse uterine biopsies

As mentioned above, uterus biopsies were dissected under the microscope; fragments of vessels and surrounding mesenchymal tissue were dissected and plated on gelatin coated dish as previously described for other cell types (Minasi, M. G., et al cited supra; Sampaolesi M, et al. 2003. cited supra). After the initial outgrowth of fϊbroblast- like cells, small round and refractile cells appeared. Those cells adhered poorly to the substratum and were thus collected by gently pipetting. Floating cells were either grown as a polyclonal population or, in some cases, cloned by limited dilution. The large majority of the cells in the population acquired a triangular, retractile morphology and maintained a high proliferation rate for approximately 30 passages with a doubling time of approximately 36 hours. Proliferation rate was largely independent from the age of the mice (ranging from 4 to 8 months). This proliferation rate leads to a final number of approximately 3 xlO⁹ cells, starting from 10.000 cells outgrown. This number of cells would be suitable for injections. After 30 passages (approximately 60 PD), large flat cells appeared at increasing frequency that did not divide any more and after few more passages the whole population underwent senescence. At both early and late passages, cells were maintained a normal diploid karyotype. To test for tumorigenicity, 10⁷ MAMps were injected subcutaneously SCID/beige mice. 10 injected mice were maintained up to 6 months after the injection and none of them developed any visible tumor that could be detected macro scopically at autopsy (data not shown).

Phenotvpe of mouse mvometrial precursors MAMps were further characterized by flow cytometry and PCR gene expression and their ability to differentiate to different cell types was analyzed. Characterization of surface markers and gene expression

MAMps clones were analyzed by flow cytometry for the expression at the cell surface of the following stem cells markers: CD31, CD34, CD44, CDl 17, alkaline phosphatase (PAL), HLA-DR, SSEA-I, HLA-DR, WGA, CD13, CD45, CD80, CD90, CD133, CD146, TRA1-60/81 and Tetramethyl Rhodamine Methyl Ester (TMRM). All clones were positive for CD31, CD34, CD44, CDl 17, SSEA-4, HLA-DR and WGA- lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRAl -81 surface markers. See Table 1 below for percentage and Figure 1 for FACS profiles.

Table 1: Percentage of expression of markers at the surface of MAMps.

RNA was extracted from the different MAMps clones cells while growing. RT-

PCR was performed for analyzing the expression of different genes involved in development or differentiation previously described by other groups. MAMps were positive for MefZc, Sox2, Tbx5 and hTERT, while negative for MefZa and Tbx2 (see

Figure 2).

Differentiation potency of MAMps.

To complete the in vitro characterization of MAMps, their ability to undergo terminal differentiation into different mesoderm cell types was tested. MAMps readily differentiate into smooth muscle, adipocytes or osteoblasts, when treated with transforming growth factor beta (TGFβ), insulin-dexamethazone or bone morphogenetic protein 2 (BMP2). When cardiac muscle differentiation was induced by adding 5μM 5- azacytidine each 48 hours, less than 1% of the MAMps expressed sarcomeric myosin (data not shown), showing that these cells have a modest ability to undergo cardiomyogenesis. When skeletal muscle differentiation was induced by co-culturing MAMps with mouse myogenic cells, a very high percentage (more than 50%) fused into hybrid myotubes (Figure 6C). MAMps were also able to differentiate into neural tissue after changing to neural stem cells proliferation medium (see methods). After one day in the neural stem cell proliferation medium, and during one week, the cells slowed down the proliferation rate and started changing their shape. Some cells presented long and thin processes and others formed rosettes than resembled neuro spheres. Most cells were positive for Nestin (Figure 4). Further, the cells showed positive staining for the three neuronal markers (Tuj-1, Dcx and MAP2), for the astrocyte marker GFAP as well as for the oligodendrocyte marker, RIP. Furthermore, the morphology of the Tuj-1 positive cells was very similar to that of neuroblasts. Additionally, MAMps were naturally positive for the fostatase alkaline reaction (Figure 3).

DISCUSSION The present invention shows the isolation of myometrial precursors from mouse adult uterine tissue. Said precursors can grow until 30 passages and express stem cells surface markers and genes. Besides, these precursors are able to differentiate into different mesoderm tissues types which could make them suitable for regenerative medicine. Myometrial precursors can be easily isolated from the very biopsy that is used for diagnosis, with no need of additional surgical intervention. The source of cells is important not only for practical reasons. Multipotent mesoderm progenitors, receive some sort of local commitment that favours recruitment into the cell types of the tissue where they reside. So, it is interesting to have a source of mesoderm progenitors that still remain with the multipotency property.

A comparison with other stem cells of the mesoderm

In the last several years many different types of mesoderm stem cells have been isolated from both mouse and human tissues and characterized to different extent. These include endothelial progenitor cells (EPC), multipotent adult progenitor cells (MAPC), side population cells (SP), mesoangioblasts, stem/progenitor cells from muscle endothelium, sinovia, dermis, and adipose tissue. Different experimental procedures, different sources and partial characterization still prevent a complete understanding of the heterogeneity of these cells; even less is known on their origin and possible lineage relationships. Whatever the case, many of these cells, such as MDSC or MAPC have been shown to differentiate into skeletal muscle in vitro. Some of these cells grow extensively in vitro but others such as EPC and SP do not; on the other hand EPC and SP can circulate whereas systemic delivery has not been tested for most of the other cell types. For example, it was recently shown that cells isolated from adipose tissue can be grown in vitro extensively, differentiate into several tissues including skeletal muscle and give rise to human dystrophin expressing fibers. But few of these cells can differentiate efficiently to other cells types or be obtained and grow easily.

Perspectives for a clinical trial

In future clinical protocols, systemic delivery appears as an obligate choice. The myometrial precursors of the invention express some of the proteins that leukocytes use to adhere to and cross the endothelium and thus can diffuse into the interstitium of the skeletal muscle, inside the osteogenic tissue and between the adypocytes, when delivered intra-arterially.

An additional concern for future cell therapy protocols is the risk that extensive expansion in vitro may compromise differentiation and/or self-renewal ability or even lead to malignant transformation. The data presented here demonstrate that the cells of the invention can be grown extensively but not indefinitely in vitro. These cells maintain a diploid karyotype, are not tumorigenic in immune deficient mice and undergo senescence after approximately 30 passages in vitro.

Finally, two protocols appear now as alternative choices for cell therapy: autologous cells after gene correction in vitro or normal donor cells in the presence of immune suppression or, hopefully induced adoptive tolerance. Donor cell transplantation would overcome these problems but faces the need for a life long immune suppression that would also start early in life.

Claims

1. An isolated, myometrial-derived mesenchymal stem cell population characterized in that the cells of said cell population are positive for CD31, CD34, CD44, CDl 17, SSEA-4, HLA-DR and WGA-lectin surface markers and negative for CD13, CD45,

CD80, CD133, CD146, TRAl-60 and TRAl -81 surface markers.

2. Isolated stem cell population according to claim 1, characterized in that the cells of said cell population express at least one of the following genes Mef2c, Sox2, Tbx5 and hTERT.

3. Isolated stem cell population according to any one of claims 1 to 2, characterized in that the cells of said cell population express alkaline phosphatase protein.

4. Isolated stem cell population according to anyone of claims 1 to 3, characterized in that the cells of said cell population present a low Mitochondrial Membrane Potential when compared with a reference value.

5. Isolated stem cell population according to any one of claims 1 to 4, characterized in that said population does not present tumorigenic activity.

6. Isolated stem cell population according to any one of claims 1 to 5, characterized in that the cells of said population present capacity to be differentiated into smooth muscle cells.

7. Isolated stem cell population according to any one of claims 1 to 6, characterized in that the cells of said population present capacity to be differentiated into adipocytes.

8. Isolated stem cell population according to any one of claims 1 to 7, characterized in that the cells of said population present capacity to be differentiated into osteoblasts.

9. Isolated stem cell population according to any one of claims 1 to 8, characterized in that the cells of said population present capacity to be differentiated into neural cells.

10. Isolated stem cell population according to any one of claims 1 to 9, characterized in that said cells present a limited proliferation rate.

11. Isolated stem cell population according to any one of claims 1 to 10, wherein said cells are genetically modified.

12. Isolated stem cell population according to any one of claims 1 to 11 for use as a medicament.

13. Isolated stem cell population according to any one of claims 1 to 12 for the treatment of a tissue degenerative condition.

14. Isolated stem cell population according to claim 13, wherein said tissue degenerative condition is skeletal muscle degeneration, cardiac tissue degeneration, bone tissue degeneration, neural tissue degeneration, lung degeneration, liver degeneration, kidney degeneration or more than one of said tissue degenerative conditions simultaneously.

15. A pharmaceutical composition comprising an isolated stem cell population according to any one of claims 1 to 11 and an acceptable pharmaceutical vehicle.

16. A method for isolating a stem cell population from myometrial tissue, wherein the cells of said cell population are characterized in that are positive for CD31, CD34, CD44, CDl 17, SSEA-4 and WGA-lectin surface markers and negative for CD 13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl -81 surface markers, said method comprising the steps of: i) incubating a myometrial tissue sample in a suitable cell culture medium on a solid surface under conditions allowing cells of said sample to adhere to said solid surface; ii) recovering the cells from said cell culture which do not adhere to said solid surface or which show low adherence capacity; and iii) confirm that the selected cell population presents the phenotype of interest.

17. Method according to claim 16, wherein said myometrial tissue sample is a biopsy sample.

18. Method according to claim 17, wherein said biopsy sample is an exfoliation sample.

19. Method according to any one of claims 16 to 18, wherein said method comprises removing serosal, fat and fibrous tissue from said myometrial tissue sample prior to incubation in culture medium according to step i).