JP2012509074A - Myometrial stem cells derived from myometrium - Google Patents

Abstract

The present invention relates to an adult stem cell isolation method, isolated cells and uses thereof. More particularly, the present invention is capable of differentiating into a number of different mesodermal tissue types including smooth muscle, adipocytes, osteoblasts, skeletal muscle and neural tissue, and is therefore suitable for regenerative medicine. The present invention relates to an isolated adult stem cell derived from a muscle layer.

Description

  The present invention relates to a method for isolating adult stem cells, cells isolated thereby, and uses thereof. More particularly, the present invention relates to isolated adult stem cells that are derived from the myometrium and differentiate to produce a series of cell lineages and present specific markers such as cell surface antigens. The cells provided by the present invention can be used, for example, in cell therapy and research and development of new drugs.

  Currently, technological developments in the field of stem cell research have made stem cells considered a promising organ and tissue source for the types of lesions that require organ or tissue transplantation. Indeed, stem cell therapy is very promising for the repair and / or regeneration of aging and damaged tissues.

  Theoretically, stem cells divide for self-maintenance during an unlimited period, resulting in phenotypically and genotypically identical cells. Furthermore, stem cells have the ability to differentiate into one or several cell types in the presence of certain signals or stimuli.

  Generating organs and cells from a patient's stem cells or immunocompatible heterologous cells so that the recipient's immune system does not recognize it as a foreign body solves the problem caused by lack of donors and the risk of rejection. Related benefits are obtained. The use of stem cells for organ and tissue regeneration is a promising alternative therapy for various human lesions, including cartilage, bone and muscle lesions, neurodegenerative diseases, immunological rejection, heart diseases and skin diseases. Become.

  In addition to cell therapy applications, stem cells have a number of other potential applications related to biomedical technology to facilitate biopharmaceutical research and development activities. One of these uses is the development of cellular models of human and animal diseases that help to substantially improve the speed and efficacy of new drug research and development. At present, the most commonly used methods for measuring the biological activity of new compounds before entering clinical trials are incomplete biochemical techniques or costly and inadequate animal models It is composed of Stem cells are a substantially unlimited amount of cells (both undifferentiated and differentiated cells) for research and development of new therapeutic compounds and for in vivo testing to measure their activity, metabolism and toxicity. Would be a potential source of The development of such tests, particularly high-throughput screening (HTS), reduces the time and cost required to develop compounds with therapeutic activity and greatly reduces the need to use animals for experiments. Also, patients will be less exposed to the adverse effects of the compound during clinical trials. In addition, the availability of different types of cells from different individuals provides a better understanding of the effects of therapeutic compounds on a particular individual, and the pharmacology where the activity of the compound is related to the individual's genetic structure. It will lead to full development in the field of genome. Stem cells and their differentiated progeny are also very useful in the process of research and characterization of new genes involved in a wide variety of biological processes including development, cell differentiation and tumor processes.

  Depending on the origin of the stem cells, we distinguish between embryonic stem cells (ES cells) and adult stem cells. ES cells are derived from the inner cell mass of undifferentiated germ cells, their most suitable feature being pluripotency. This means that adult tissue derived from the three germ layers can be generated. Adult stem cells are partially damaged cells present in adult tissue that can decrease in time but remain in the human body for decades.

  Despite the high pluripotency of ES stem cells, therapies based on the use of adult stem cells offer a range of advantages over the therapies based on ES cells. First, it is complicated to control the culture conditions of ES cells without inducing differentiation, and the use of this type of cells requires economic costs and workload. In addition, ES cells need to go through several intermediate steps, a process controlled by chemically complex compounds, before becoming the specific cell type needed to treat a particular lesion. is there. In addition, undifferentiated stem cells from embryonic tissue have a high probability of producing a type of tumor known as teratocarcinoma, and there are also safety issues when using ES cells for therapy. Finally, ES cell-derived cells are usually rejected by the immunology system because the immunological profile of such cells is different from the recipient. This problem is addressed by using a process known as “therapeutic cloning” in which autologous ES cells can be obtained by moving somatic cell nuclei from patients to female donor oocytes. However, this technique has not yet been developed in humans and causes significant ethical and legal problems. Another solution is the generation of “universal” cell lines with systemic immunocompatibility, but at this point there is no technology that can obtain such cells.

  In contrast, adult stem cells are not rejected by the immune system when obtained by autotransplantation. Furthermore, the fact that they are partially damaged reduces the number of differentiation stages required to produce specialized cells. Furthermore, the use of this type of cell is not related to any type of legal or ethical argument. Furthermore, although these types of cells are less likely to differentiate than ES cells, most of these are actually pluripotent, meaning that they can differentiate into multiple tissues. This suggests that a variety of cell types that can cover multiple therapeutic applications can be provided if a suitable source of adult stem cells is obtained.

  A new type of mammalian stem cell called “pluripotent adult progenitor cell” (MAPC) has recently been isolated from bone marrow and other tissues. This type of stem cell appears to be a precursor of so-called mesenchymal stem cells and exhibits great pluripotency. However, the process of isolating and culturing them is long, costly and uses large amounts of various growth factors. In the last few years, many different types of mesoderm stem cells have been isolated from both mouse and human tissues and characterized to different degrees. These include endothelial progenitor cells (EPC), pluripotent adult progenitor cells (MAPC), side population cells (SP), mesodermal hemangioblasts, stem / progenitor cells from myoendothelium, sinova , Dermis and adipose tissue. Even with various experimental procedures, various sources and partial characterization, the heterogeneity of these cells still cannot be fully understood, and their origin and possible lineage relationships are further known. Absent. In any case, many of these cells, such as MDSC or MAPC, were found to differentiate into skeletal muscle in vivo. Some of these cells grow widely in vivo, while others such as EPC and SP do not grow in vivo. On the one hand, EPC and SP can circulate, but systemic delivery has not been tested for most other cell types. For example, it has recently been shown that cells isolated from adipose tissue grow extensively in vivo and differentiate into several tissues, including skeletal muscle, resulting in human dystrophin-expressing fibers. However, these cells can be differentiated efficiently into other cell types or can hardly be obtained or grown.

  Therefore, it is necessary to obtain a readily available source of pluripotent stem cells. In particular, there is no significant risk or pain, isolation and culture costs are not high, contamination from other cell types is minimal, and there is no fear of karyotypic abnormalities and the possibility of tumor formation in culture There is a need for cells that can be easily isolated from living subjects.

  The document EP 1876233 describes the isolation of cell populations derived from endometrial tissue or from endometrial tissue isolated from menstrual blood, umbilical cord blood or fetal appendages. These cells can differentiate into cardiac muscle cells. Masanori O. Et al. (PNAS, 2007. vol. 104, 47: 18700-18705) described the isolation of side populations in human myometrium with phenotypic and functional properties of stem cells. The cells are positive for the surface markers CD90, CD73, CD105, CD34 and STRO-1, and negative for CD44. The cells were able to differentiate into adipocytes, bone cells and smooth muscle cells. The isolation of said cell population is performed by hysterectomy, ie by surgical removal of the uterus.

  We have isolated a new population of cells from the uterine wall of adult mice, particularly from myometrial tissue, using a simple and non-invasive technique. These cells can differentiate into a number of different mesodermal tissue types including smooth muscle, adipocytes, osteoblasts, skeletal muscle and neural tissue and are therefore suitable for regenerative medicine.

  Therefore, according to a first aspect, the present invention provides an isolated mesenchymal stem cell population derived from myometrium, wherein the cells of said cell population are CD31, CD34, CD44, CD117, SSEA- 4, relates to a stem cell population characterized by being positive for HLA-DR and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81 surface markers.

  According to another aspect, it relates to said isolated stem cell population of the present invention for use as a medicament.

  According to a further aspect, the present invention relates to an isolated stem cell population of the present invention for the treatment of a tissue degenerative condition.

  According to another aspect, the present invention relates to a pharmaceutical composition comprising an isolated stem cell population according to the present invention and an acceptable pharmaceutical vehicle.

According to a further aspect, the present invention is a method for isolating a stem cell population from myometrial tissue, wherein cells of said cell population are CD31, CD34, CD44, CD117, SSEA-4 and WGA-lectin surfaces. Positive for markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81 surface markers, the method comprising:
i) incubating a myometrial tissue sample in a suitable cell culture medium on a solid surface under conditions such that the cells of the sample adhere to the solid surface;
ii) recovering cells that do not adhere to the solid surface or have low adhesion ability from the cell culture medium;
and iii) confirming that the selected cell population exhibits the intended phenotype.

FIG. 2 is a diagram of surface marker expression analyzed by flow cytometry. FACS analysis using antibody panel: CD13, CD31, CD34, CD44, CD45, CD80, CD90, CD117, CD133, CD146, PAL, HLA-DR, TRA1-60, TRA1-81, SSEA-4, WGA and TMRM. It is a continuation of FIG. 1A. It is a continuation of FIG. 1B. It is a continuation of FIG. 1C. FIG. 1D is a continuation of FIG. 1D. It is a continuation of FIG. 1E. FIG. 1F is a continuation of FIG. 1F. It is a continuation of FIG. 1G. FIG. 6 is a diagram of MAMps marker expression analyzed by PCR. RNA extracted from various clonal cells was analyzed by PCR for the presence of marker genes such as Sox2, hTERT, MEF2a / 2c and Tbx2 / 5. FIG. 5 is a staining diagram for alkaline phosphatase showing expression at different levels in 100% of the cell population. It is a figure which shows the EMSC immunostaining about the nestin after one week of culture | cultivation in a neural stem cell proliferation medium. Phase contrast (left panel), nestin (middle panel), nucleus (right panel). (This is a micrograph taken with a Nikon camera in a Nikon fluorescence inverted microscope with an objective lens of 20 ×.)

  The present invention relates to a novel mesenchymal stem cell population isolated from myometrial tissue that exhibits the ability to differentiate into multiple cell types in vivo.

  Therefore, according to the first aspect, an isolated myometrial stem cell population (hereinafter referred to as “cell population of the present invention”), wherein the cells of the cell population are CD31, CD34 CD44, CD117, SSEA-4 (time-specific embryonic antigen-4), HLA-DR and WGA-lectin (wheat germ agglutinin-lectin) surface markers, CD13, CD45, CD80, CD133, CD146, It is characterized by being negative for TRA1-60 and TRA1-81 (Tumor Rejection Antigen 1) surface markers.

  As used herein, the term “MHC” (major histocompatibility gene complex) refers to the portion of a gene that encodes a cell surface antigen presenting protein. In humans, these genes are referred to as human leukocyte antigen (HLA) genes. In this specification, the abbreviations MHC or HLA are used interchangeably.

  As used herein, the term “isolated” as used for a cell population refers to a cell population isolated from the human or animal body and related to the cell population in vivo or in vitro. Means substantially free of one or more cell populations.

  The cells of the cell population of the present invention, hereinafter referred to as “cells of the present invention”, are derived from myometrial tissue. The term “myometrial tissue” refers to tissue from the middle layer of the uterine wall. As used herein, the term “uterus” includes the cervical canal and the uterine cavity. Thus, throughout the specification and claims, the term “uterine tissue” refers to any substance in the cervix and uterine cavity.

  The cells of the present invention can be obtained from any suitable source of myometrial tissue from any suitable animal, including humans. Generally, the cells are obtained from non-pathological postpartum mammalian myometrial tissue. According to a particular embodiment, the cells of the cell population of the invention are derived from a mammal, such as a rodent, a primate, etc., preferably from a human.

  As described above, the cells of the present invention are positive for CD31, CD34, CD44, CD117, SSEA-4, HLA-DR and WGA-lectin surface markers and are CD13, CD45, CD80, CD133, CD146, TRA1-60. And negative for the TRA1-81 surface marker.

  As used herein, “negative” with respect to a cell surface marker is used in a cell population comprising cells of the invention with conventional methods and equipment (eg, with commercially available antibodies and standard protocols known in the art). Less than 10% of cells, preferably less than 9%, showing signals for specific cell surface markers in flow cytometry above the background signal when using the Calibur (Becton Dickinson) FACS system) , Less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or none of the cells.

  According to a particular embodiment, the cells of the invention express the following cell surface markers CD31, CD34, CD44, CD117, SSEA-4, HLA-DR and WGA-lectin, ie the cells of the invention Characterized by being positive for cell surface markers. Preferably, the cell of the present invention is characterized by exhibiting a remarkable expression level of the cell surface marker. As used herein, the expression “significant expression” is used in a cell population comprising cells of the invention with conventional methods and equipment (eg, with commercially available antibodies and standard protocols known in the art). When using the Calibur (Becton Dickinson) FACS system), a signal for a specific cell surface marker in flow cytometry above the background signal is greater than 10%, preferably greater than 20% of the cells, It means greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80%, greater than 90%, or all of the cells. Background signal is defined as the signal intensity exhibited by a non-specific antibody of the same isotype as the specific antibody used to detect each surface marker in normal FACS analysis. Thus, for markers considered positive, the specific signal observed is determined by conventional methods and equipment (eg, Calibur (Becton Dickinson) FACS used with commercially available antibodies and standard protocols known in the art). System) over 10% of background signal strength, preferably over 20%, over 30%, over 40%, over 50%, over 60%, over 70%, over 80%, over 90%, More than 500%, more than 1000%, more than 5000%, more than 10,000% or more.

  Commercially known monoclonal antibodies against the cell-surface markers (eg, cell receptors and transmembrane proteins) can be used to identify cells of the invention.

According to a particular embodiment of the invention, the cells of the cell population according to the invention are characterized in that they express at least one of the following genes: Mef2c (muscle cell enhancer factor 2C), Sox2 (SRY (sex Determination region Y) -box2), Tbx5 (T-box5)
And hTERT (telomerase reverse transcriptase catalytic subunit). According to a more specific embodiment, said cells do not express the Mef2a (myocyte enhancer factor 2A) and Tbx2 (T-box5) genes.

  As used herein, the term “gene” refers to a gene comprising transcriptional and / or translational regulatory sequences and / or coding regions and / or untranslated sequences (eg, introns, 5′- and 3′-untranslated sequences). Can be. The coding region of a gene can be a nucleotide sequence encoding an amino acid sequence or a functional RNA such as tRNA, rRNA, catalytic RNA, siRNA, miRNA or antisense RNA. The gene may also be mRNA or cDNA corresponding to a coding region (for example, exon and miRNA) comprising 5'- or 3'-untranslated sequences optionally linked. The gene may also be an amplified nucleic acid molecule produced in vivo, comprising the coding region and / or all or part of the 5'- or 3'-untranslated sequence linked.

  The term “gene expression” refers to a process that involves transcription of a DNA code into mRNA, translocation of mRNA into a ribosome, and translation of an RNA message into a protein. The expression level of the gene can be measured by a standard method known in the art. As an illustrative, non-limiting example, the method includes measuring the expression level of mRNA encoded by the genes described above. For this purpose, a biological sample comprising the cells of the invention is processed to physically or mechanically disrupt cellular structures, release intracellular components into aqueous or organic solutions to prepare nucleic acids for further analysis. It is attached to. The nucleic acid is extracted from the sample by procedures known to those skilled in the art and commercially available. It is then extracted by any of the methods typical in the art, for example, Sambrook, Fischer and Maniatis, Molecular Cloning, Practical Manual, (2nd edition), Cold Spring Harbor Laboratory Press, New York (1989). Preferably, care is taken to avoid degradation of the RNA during the extraction process.

  Although all techniques of gene expression profiling are preferably used to practice the following aspects of the invention, gene mRNA expression levels are often measured by reverse transcription polymerase chain reaction (RT-PCR).

  In order to normalize the value of mRNA expression between different samples, the intended mRNA expression level in the test sample can be compared to the expression of the control RNA. Preferably, the control RNA is mRNA that is derived from a housekeeping gene and encodes a protein that is constitutively expressed and performs an essential cellular function. Preferred housekeeping genes used in the present invention include β-2-microglobulin, ubiquitin, 18-S ribosomal protein, cyclophilin, GAPDH and actin.

  Preferably, according to various embodiments of the invention, the detection method provides an output (ie, readout or signal) along with information regarding the presence or absence of the marker (s) in the sample. According to the present invention, this output is qualitative (eg, “positive” or “negative”). In this sense, “positive gene expression” is considered when an amplification product of the gene using any standard amplification reaction is obtained. Means for evaluating or detecting the amplification product are well known in the art. Illustratively, examples of the method include visualization of bands in the agarose gel shown in Example 1 of the present invention. In order to perform the amplification reaction, a specific amplification oligonucleotide for the gene is used.

  The terms “oligonucleotide primer” or “amplification oligonucleotide” are used interchangeably herein, including those with a lower limit of about 2 to 5 residues and an upper limit of about 500 to 900 residues in size range. Refers to a high molecular nucleic acid having less than 1,000 residues. According to a preferred embodiment, the oligonucleotide primer has a size range with a lower limit of about 5 to about 15 residues and an upper limit of about 100 to 200 residues. More preferably, the oligonucleotide primers of the present invention are in a size range with a lower limit of about 10 to about 15 residues and an upper limit of about 17 to 100 residues. Although oligonucleotide primers can be purified from natural nucleic acids, they are generally synthesized using any of a variety of well-known enzymatic or chemical methods. The term “amplification oligonucleotide” refers to an oligonucleotide that hybridizes to a target nucleic acid or its complement and participates in a nucleic acid amplification reaction. Amplification oligonucleotides include a primer and a promoter primer in which the 3 'end of the oligonucleotide is enzymatically extended using another nucleic acid strand as a template. In certain embodiments, the amplification oligonucleotide comprises at least about 10 consecutive bases, more preferably about 12 consecutive bases, that are complementary to a region of the target sequence (or its complementary strand). The target binding base is at least about 80%, more preferably about 90% to 100% complementary to the binding sequence. Amplification oligonucleotides are preferably about 10 bases to about 60 bases in length and may include modified nucleotides or base analogs. Illustrative non-limiting examples of amplification oligonucleotides used in the present invention include those disclosed in Example 1 of the present invention.

  According to another particular embodiment of the invention, the cells of the invention express alkaline phosphatase protein.

  Alkaline phosphatase (ALP) is a hydrolase involved in the removal of phosphate groups from many types of molecules such as nucleotides, proteins and alkaloids. Alkaline phosphatase is a stem cell membrane marker and high expression of this enzyme is associated with undifferentiated pluripotent stem cells. All primate pluripotent stem cells, such as embryonic stem (ES), embryonic reproductive (EG) and embryonic cancer (EC) cells, show alkaline phosphatase activity.

  There are various known methods in the art for the detection of ALP, such as those based on enzymatic reactions followed by colorimetric or fast red violet dyes, fluorescence detection, and immunostaining.

  According to the present invention, any standard technique of protein expression profiling is suitable for use in the practice of the above-described aspects of the present invention. In particular, alkaline phosphatase protein expression can be detected by flow cytometry using conventional methods and equipment (eg, Calibur (Becton Dickinson) FACS system used with commercially available antibodies and standard protocols known in the art). . Alternatively, alkaline phosphatase protein expression can be measured by standard protein expression assays using specific antibodies against the protein. Such assays include radioimmunoassays, enzyme immunoassays (eg, ELISA), immunofluorescence, immunoprecipitation, latex agglutination, hemagglutination, and histochemical examination. As an illustrative non-limiting example, alkaline phosphatase protein expression is measured as described in Example 1 of the present invention.

  Mitochondrial membrane potential (ΔΨm) is a key indicator of mitochondrial function, and characterization of ΔΨm in situ enables accurate measurement of mitochondrial bioenergetics and cellular metabolism. The method of measuring ΔΨm involves using a monovalent cationic fluorescent dye such as tetramethylrhodamine methyl ester (TMRM) for non-invasive reasons. The fluorescent membrane permeable cation probe TMRM is one of the probes that are more easily used in the analysis of ΔΨm in intact cells. The ability to measure ΔΨm corresponding to cell and mitochondrial physiology, protein localization and real-time enzyme kinetics allows for the progression of necrosis and apoptotic cell death, as well as cell survival characteristics after addition of stimuli and drugs Can be attached.

  According to a particular embodiment, the cells of said cell population exhibit a low mitochondrial membrane potential. According to the present invention, the term “low mitochondrial membrane potential” is defined as background when using conventional methods and apparatus (eg, Calibur (Becton Dickinson) FACS system) in a cell population comprising cells of the present invention. Signals for specific mitochondrial membrane markers in flow cytometry above the signal show less than 10% of the cells, preferably less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, 4 Means less than 3%, less than 3%, less than 2%, less than 1% or no cells.

  Advantageously, the cells of the invention do not exhibit in vivo tumorigenic activity. Thus, according to another particular embodiment of the invention, the cell population of the invention does not show tumor activity. The expression “tumor activity” herein refers to a transformation behavior or growth phenotype that results in tumor cells.

  The tumor activity of the cells of the present invention can be verified by conducting animal experiments using immunodeficient mouse strains. In these experiments, millions of cells are implanted subcutaneously into recipient animals, maintained for several weeks, and analyzed for tumor formation. One particular assay is disclosed in Example 1 of the present invention.

  The cells of the invention show the ability to proliferate and differentiate into several cell lineages. According to a preferred embodiment, the cells of the invention exhibit the ability to differentiate into at least 2, more preferably 3, 4, 5, 6, 7 or more cell lineages. In this sense, the cells of the present invention can be proliferated and differentiated into cells of other lineages by a normal method.

  According to a particular embodiment of the invention, the cells of the cell population of the invention exhibit the ability to differentiate into smooth muscle cells. According to another particular embodiment, the cells of said population exhibit the ability to differentiate into adipocytes. According to a further embodiment, the cells of the population exhibit the ability to differentiate into osteoblasts. According to another particular embodiment, the cells of the population exhibit the ability to differentiate into neurons.

  A method of identifying a differentiated cell from an undifferentiated counterpart and then isolating it can also be performed by a method well known in the art.

  The cells of the present invention can also be expanded ex vivo. That is, after isolation, the cells of the present invention can be maintained and propagated in vitro in a culture medium. Such media contains, for example, antibiotics (eg, 100 units / ml penicillin and 100 μg / ml streptomycin), 5 mM glutamine, and 2-20% fetal bovine serum (FBS). It consists of Dulbecco's modified Eagle medium (DMEM). It is known to those skilled in the art to change or adjust the concentration of media and / or media supplements as needed for the cells used. Serum often contains cellular and non-cellular factors and components that are necessary for viability and growth. Examples of the serum include FBS, bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum (HS), pig serum, Examples include sheep serum, rabbit serum, and rat serum (RS). In addition, when the cells of the present invention are derived from human, it is also intended to add human serum (preferably autologous) to the cell culture medium. If it appears necessary to inactivate components of the complement cascade, the serum can be heat inactivated at 55-65 ° C. Regulation of serum concentration, recovery of serum from the culture medium can also be used to promote the survival of one or more desired cell types. Preferably, cells of the invention will be effective at FBS concentrations of about 2% to about 25%. According to another embodiment, the cells of the invention can be grown in a culture medium of a defined composition, in which case the serum is treated with serum albumin, serum transferrin, selenium and recombinant proteins known in the art. For example, insulin, platelet derived growth factor (PDGF) and basic fibroblast growth factor (bFGF), but not limited to.

  Many cell culture media already contain amino acids, but some require supplementation prior to cell culture. Examples of such amino acids include L-alanine, L-arginine, L-aspartic acid, L-asparagine, L-cysteine, L-cystine, L-glutamic acid, L-glutamine, and L-glycine. It is not limited.

  Antimicrobial substances are also typically used in cell culture to reduce bacterial, mycoplasma and fungal contamination. Typically, the antibiotic or antifungal compound used is a penicillin / streptomycin mixture and also includes amphotericin (Fungisone®), ampicillin, gentamicin, bleomycin, hygromasin, kanamycin, mitomycin, etc. However, it is not limited to these.

  Hormones can also be used advantageously in cell culture, such as D-aldosterone, diethylstilbestrol (DES), dexamethasone, b-estradiol, hydrocortisone, insulin, prolactin, progesterone, somatostatin / human growth hormone (HGH), etc. However, it is not limited to these.

  The cell maintenance conditions of the present invention can also contain cellular factors that allow the cells to remain in an undifferentiated form. It will be apparent to those skilled in the art that supplements that inhibit cell differentiation must be removed from the culture medium prior to differentiation. It is also clear that not all cells require these factors. In fact, these factors induce undesirable effects in some cell types.

  According to another particular embodiment of the invention, said cells exhibit a limited growth rate. Indeed, the data presented here demonstrates that the cells of the invention can be grown extensively in vivo, but not indefinitely. These cells age after approximately 30 passages in vivo.

  The cells of the invention can be transfected or genetically engineered to express at least one intended polypeptide. Thus, according to another specific embodiment, the cells of the invention are genetically modified.

  A cell is “genetically modified” when it is transferred to the cell by any suitable means of artificial manipulation, or when the cell is a progeny of the first altered cell that inherited the polynucleotide. Or “transfected” or “gene transformed”. Polynucleotides often include a transcribable sequence that encodes the intended protein, thereby allowing the cell to express the protein at high levels. A genetic change is said to be “hereditary” if the progeny of the altered cell has the same change. “Transformed cell” means a cell into which a nucleic acid molecule encoding the polynucleotide of the present invention has been introduced, for example, by recombinant DNA methods or viruses (or one that has been introduced into its progeny or ancestor). “Nucleic acid” or “nucleic acid molecule” refers to a deoxyribonucleotide or ribonucleotide polymer in single- or double-stranded form, and unless otherwise specified, known natural nucleotides that can function similarly as natural nucleotides. Analogs can be included. “Polypeptide”, “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogues of the corresponding natural amino acids, as well as natural and non-natural amino acid polymers. Amino acid analogs refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.

  In recent years, MSCs have an increasing role in tissue repair and regeneration. In various models of tissue damage, MSC improves the recovery of damaged tissue.

  The cells of the present invention express some of the proteins used by leukocytes to attach to and traverse the endothelium (CD44), and thus when delivered transarterially, in osteogenic tissues and adipocytes Can diffuse into the interstitium of skeletal muscles. On the other hand, it is clear from the data presented herein that the cells of the invention can grow extensively but not permanently in vivo. This is very important given the further concern of cell therapy protocols, that extensive proliferation in vivo can impair differentiation and / or self-renewal capacity or even cause malignant transformation. is there. In fact, as described above, the cells age after about 30 passages in vivo. Furthermore, these cells maintain a diploid karyotype and do not form tumors in immunodeficient mice.

  As used herein, the term “karyotype” refers to the chromosomal characteristics of an individual cell or cell line of a species, defined by both the number and morphology of the chromosomes. Typically, karyotypes are presented as a systematic array of early or intermediate (or condensed) chromosomes from micrographs or computer generated images. Alternatively, interphase chromosomes can be analyzed as histone-depleted DNA fibers released from interphase cell nuclei. A normal karyotype is considered when the number of chromosomes does not change compared to the number of chromosomes in the species.

  Thus, according to a further aspect, the invention relates to an isolated stem cell population of the invention for use as a medicament. According to a particular embodiment, the cell population of the invention is used as an agent for treating a tissue degenerative condition. As used herein, the term “tissue degenerative condition” refers to a tissue that exhibits a pathological condition. Therefore, according to the present invention, the cell population or composition of the present invention can be used as a tissue repair and / or regeneration agent. In this sense, the cell population of the present invention can be used to enhance stem cell proliferation, regeneration and / or engraftment in the tissue, i.e. to repair and / or regenerate aged and / or damaged tissue.

  According to a more specific embodiment, the tissue degeneration state is skeletal muscle degeneration, heart tissue degeneration, bone tissue degeneration, nerve tissue degeneration, lung degeneration, liver degeneration, kidney degeneration, or a plurality of the tissue degeneration states at the same time. It is in the state.

  As used herein, the terms “treat”, “treatment” and “treating” result from administration of a cell population of the invention or a pharmaceutical composition comprising said cell population to a subject in need of said treatment. Refers to the alleviation of one or more symptoms associated with a disease. Accordingly, "treatment" as used herein encompasses any treatment of a disorder, disease or condition in mammals, particularly humans, and includes the following: (a) susceptible to a disease or condition Preventing a subject not yet diagnosed as having the condition from developing the disease or condition; (b) inhibiting the disease or condition, ie, preventing its progression; or ( c) alleviating a disease or condition, ie improving the regression of the disease or condition or the symptoms of one or more diseases or conditions. The population of subjects to be treated by this method includes subjects suffering from an undesirable condition or disease, as well as subjects at risk of progression of the condition or disease. As used herein, the terms “disorder” and “disease” are used interchangeably and refer to an abnormal or pathological condition in a subject that can impair physical function and lead to death.

  The term “subject” refers to animals, preferably mammals, such as non-primates (eg, cows, pigs, horses, cats, dogs, rats or mice) and primates (eg, monkeys or humans). According to a preferred embodiment, the subject is a human.

  While the active ingredient, i.e. the cell population of the invention, can be administered alone, it is provided as part of a pharmaceutical formulation or composition comprising as an active ingredient an effective amount of the cell population according to the invention. Is preferred. A pharmaceutical formulation or composition in connection with the present invention means a combination of the active ingredient (s) with a pharmaceutically acceptable carrier and other additives (together or separately). Thus, according to another aspect, the present invention refers to a pharmaceutical composition comprising an isolated stem cell population of the present invention and an acceptable pharmaceutical vehicle or carrier.

  According to certain embodiments, the term “pharmaceutically acceptable” refers to a US or European pharmacopoeia, or other commonly recognized pharmacy approved by a federal or state regulatory authority. On the other hand, it means that the use for animals, more specifically for humans, is described.

  In the context of the present invention, the term “carrier” does not react with the cell population of the present invention and is added to the formulation as a diluent, adjuvant, excipient or vehicle, or to give the formulation form or consistency It means any one of inert non-toxic substances that can be added. The carrier may have the effect of improving the delivery or penetration of the active ingredient into the target tissue, reducing undesirable side effects and the like. The carrier can also be a substance that stabilizes the formulation (eg, preservatives) so that the formulation contains an edible flavoring agent. For examples of carriers, stabilizers and adjuvants, see E.C. W. See Martin, REMINGTON'S PHARMACEUTICAL SCIENCES, MacK Pub Co (June 1990). If desired, the composition can also contain a small amount of a pH buffer.

  Such compositions are suitable for administration to a subject, containing a prophylactic or therapeutically effective amount of a prophylactic or therapeutic agent, preferably in purified form, together with a suitable amount of earner. Form. The formulation must be compatible with the method of administration. According to a preferred embodiment, the pharmaceutical composition is sterile and is in a form suitable for administration to a subject, preferably an animal subject, more preferably a mammalian subject, most preferably a human subject.

  The pharmaceutical composition of the present invention can be in various forms. These include solid, semi-solid and liquid dosage forms such as lyophilized formulations, solutions or suspensions, injections and insoluble solutions. The preferred form depends on the intended method of administration and therapeutic use.

  The cell population of the present invention or a pharmaceutical composition comprising the cell population can be administered to a subject in need thereof by a usual means. In certain embodiments, the cell population is administered to a subject by a method comprising transferring the cell population in vitro (eg, as a graft prior to transplantation or engraftment) or directly into animal tissue in vivo. Cells are generally transferred to the desired tissue by an appropriate method that varies with the type of tissue. For example, cells can be transferred to the graft by immersing the graft in a culture medium containing the cells (or pouring the culture medium into the graft). Alternatively, cells can be seeded at a desired site in the tissue to establish a population. Cells can be transferred to sites in the body using devices such as catheters, trocars, cannulas, and stents (which can be seeded with cells).

  Furthermore, the active substance can also be mixed with other active substances that do not interfere with the desired action, or with substances that supplement the desired action or have another action. The compounds of the invention, i.e. the cell population, may be formulated as a single pharmaceutically active composition in the composition or other active ingredients, e.g. other agents useful for the treatment of tissue degenerative conditions. Can also be combined. Accordingly, the cell populations and compositions of the present invention may be administered in combination therapy. The term “combination therapy” refers to the use of a cell population of the invention in conjunction with other active agents or methods of treatment in a method of the invention for amelioration of one or more symptoms associated with a disorder. These other agents or treatments can include known drugs and therapies for the treatment of such disorders. The combined use of the agents of the present invention with other therapies or treatment methods may be simultaneous or sequential. That is, in the two treatments, the cell population of the present invention or a pharmaceutical composition comprising the cell population may be administered before or after other therapies or treatment therapies. The attending physician can decide on the appropriate order of administering the cell population or pharmaceutical composition comprising said cell population in combination with other drugs, therapies or treatment methods.

  According to another aspect, the present invention provides a skeletal muscle degeneration, heart tissue degeneration, bone tissue degeneration, nerve tissue degeneration, lung degeneration, liver degeneration, kidney degeneration, or a state in which a plurality of the tissue degeneration states are simultaneously present. It relates to the use of the cells of the invention for the preparation of a medicament for preventing, treating or ameliorating one or more symptoms related to, but not limited to, tissue degenerative conditions.

According to another aspect, the present invention provides a method for isolating a stem cell population from myometrial tissue, wherein cells of said cell population are CD31, CD34, CD44, CD117, SSEA-4 and WGA-lectin. Positive for surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81 surface markers, the method comprising:
i) incubating a myometrial tissue sample in a suitable cell culture medium on a solid surface under conditions such that the cells of the sample adhere to the solid surface;
ii) recovering cells that do not adhere to the solid surface or have low adhesion ability from the cell culture medium;
iii) confirming that the selected cell population exhibits the intended phenotype, and a method (hereinafter referred to as “the method of the present invention”).

  As used herein, the term “solid surface” refers to any substance to which cells can adhere. According to a particular embodiment, the substance is gelatin. As shown in Example 1 according to the present invention, myometrial tissue samples were transferred to Petri dishes coated with 1% gelatin as described above for other cell types (Minasi, MG, etc .; Samolesi M). 2003. Science. 301: 487-492). These samples were cultured for 15 days, and after initial growth of fibroblast-like cells, small round and refractive cells appeared. Those cells that did not adhere to the substrate and emerged were easily collected by pipette gently from the original culture. The floating cells grew as a polyclonal population or were cloned by limited dilution. Thus, according to step ii) of the method of the invention, the expression “low attachment ability” as used herein is a standard condition under which cells (eg fibroblasts) can adhere to the solid surface. Below, it refers to cells that do not adhere to the solid surface and therefore can float on the culture medium or be easily collected from the culture medium, for example, gently by pipette.

  The cells of the invention can be obtained by conventional means from any suitable myometrial tissue source from any suitable animal, including humans. In certain cases, a myometrial tissue sample is obtained from the lower uterine segment of the uterine body by uterine detachment. For sampling, exfoliated cells are collected from the intracervical uterine canal with the appropriate tool described in Example 1 of the present invention. Generally, the cells are obtained from non-pathological postpartum mammalian myometrial tissue. According to a particular embodiment, the cells of the cell population of the invention are derived from mammals such as rodents, primates, preferably humans. As long as the myometrial tissue cells in the animal can grow, they may be alive or dead. Typically, human uterine myocytes are obtained from living donors using well-known protocols as described above.

  A sample of myometrial tissue is preferably washed prior to processing to separate the cells of the invention from the remainder of the material. The remaining cells are generally present in various sized clumps and can proceed using a protocol that allows the entire structure to be degraded while minimizing damage to the cells themselves. Cell clumps can be broken down using processes such as mechanical agitation, sonic energy, and thermal energy.

  After final isolation, the cells can be cultured and, if desired, assayed for number and viability to assess yield. Desirably, the cells are cultured on a solid surface without differentiation at a suitable cell density and culture conditions using a suitable cell culture medium. Thus, according to a particular embodiment, the cells are cultured in a suitable cell culture medium [eg DMEM, typically 5-15% (eg 10%) suitable serum, eg fetal calf serum or human serum. Is cultured without differentiation on a solid surface, usually made of gelatin, and incubated under conditions where the cells attach to and grow on the solid surface.

Cells are maintained in the same medium under the same conditions until appropriate confluence, typically about 80% cell confluence, is reached, changing cell culture medium as needed. After reaching the desired cell confluence, the cells are serially passaged with a detachment agent such as trypsin to allow larger cells at an appropriate cell density (usually 2,000-10,000 cells / cm ² ). It can grow by seeding on the culture surface. Thus, the cells are then passaged at least twice in such media without differentiation while still retaining the developmental phenotype. More preferably, the cells can be passaged at least 10 times (eg, at least 15 times, or even at least 20 times) without losing the developmental phenotype. Typically, the cells are about 100 cells / cm ² to about 100,000 cells / cm ² (eg, about 500 cells / cm ² to about 50,000 cells / cm ² or more particularly about 1,000 cells. / Cm ² to about 20,000 cells / cm ² ). Cells can be more easily clonally isolated when plated at lower densities (eg, about 300 cells / cm ² ). For example, after a few days, cells plated at such a density will proliferate into a uniform population. According to a particular embodiment, the cell density is 2,000-10,000 cells / cm ² . As a result of the above method, a uniform cell population with the intended phenotype is obtained. Example 1 describes in detail the isolation of cells of the invention from mouse myometrial tissue.

  Confirmation of the intended phenotype can be performed using conventional means. Cell-surface markers can be identified by any suitable conventional means, usually based on positive / negative selection, eg, monoclonal antibodies to cell-surface markers that need to be confirmed for presence / absence in the cell. However, other methods can be used. Thus, according to a particular embodiment, one, two, three, four, five, six of CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81 surface markers, Confirming the absence of the marker in selected cells using monoclonal antibodies against seven, preferably all, among CD31, CD34, CD44, CD117, SSEA-4, HLA-DR and WGA-lectin Monoclonal antibodies against one, two, three, four, preferably all of these are checked for their presence or at least one, preferably all detectable expression levels of said markers. Said monoclonal antibodies are known and commercially available or can be obtained by a person skilled in the art by conventional methods.

  The cells and cell populations provided by the present invention can be clonally expanded, if desired, using methods suitable for cloning the cell population. For example, a proliferating population of cells can be physically harvested and seeded in separate plates (or wells of multi-well plates). Alternatively, cells can be subcloned onto multi-well plates at a statistical ratio to facilitate placement of single cells in each well (eg, from about 0.1 to about 1 cell / well or Further about 0.25 to about 0.5 cells / well, such as about 0.5 cells / well). Of course, cells can be cloned by plating at low density (eg, on a Petri dish or other suitable substrate) and isolating them from other cells using a device such as a cloning ring. Production of the clonal population can be grown in any suitable culture medium. In any case, isolated cells can be cultured to a suitable point where their developmental phenotype can be assessed.

  Any of the steps and procedures for isolating cells of the cell population of the present invention can be performed manually as needed. Alternatively, the process of isolating such cells can be facilitated and / or automated by one or more suitable devices, examples of which are known in the art.

  According to another aspect, the present invention relates to a kit comprising a cell population containing the cells of the present invention.

  According to another aspect, the present invention provides a cell population comprising a cell of the present invention for preventing, treating or ameliorating one or more symptoms associated with a tissue degenerative condition in a subject suffering from said disorder or disease. Regarding use.

  According to another aspect, the present invention is a method for preventing, treating or ameliorating one or more symptoms associated with a tissue degenerative condition in a subject suffering from said disorder or disease, and in need of such treatment Administering to the subject a prophylactically or therapeutically effective amount of a cell population containing the cells of the invention. According to a specific embodiment, the tissue degenerative state is a state in which a plurality of skeletal muscle degeneration, heart tissue degeneration, bone tissue degeneration, nerve tissue degeneration, lung degeneration, liver degeneration, kidney degeneration, or the tissue degeneration states occur simultaneously. It is.

  The present invention will be described in more detail by way of examples. However, these examples are for explaining the present invention with reference to the accompanying drawings, and the scope of the present invention is limited to these examples. Do not mean.

I. Isolation, in vivo growth and differentiation of adult mouse myometrial precursor (MAMp) from uterine tissue Materials and methods
Uterus and myometrial explants Myometrial explants were taken from the lower uterine segment of the uterus by uterine detachment. Sampling involves collecting exfoliated cells from the intracervical uterine canal with a suitable tool. All explants were trimmed of endometrium, serosa, fat and fibrous tissue prior to use. The procedure is similar to cervical cytology.

Myometrial tissue can be maintained at room temperature in oxygenated (O ₂ 95%, CO ₂ 5%) saline (PBS) for up to 24 hours after acquisition. Samples were transferred to Petri dishes coated with 1% gelatin in the presence of 10% FBS-DMEM + 5 mM glutamine and antibiotics. These samples were cultured for 15 days, and after the initial growth of fibroblast-like cells, small circular and refractive cells appeared. This cell population was easily pipetted from the initial culture slowly, counted, and cloned by limiting dilution on p96 well dishes coated with 1% gelatin.

  Myometrial precursors were also obtained from uterine explants. Myometrial tissue pieces (10-30 mg) obtained from 4-month C57 mice were retained in DMEM w / o FCS (fetal bovine serum) containing antibiotics. Each piece was then rinsed in PBS containing Ca / Mg and sharply subdivided into 1-2 mm diameter pieces with a scalpel. Fragments containing tubules were transferred to Petri dishes coated with 1% gelatin in the presence of 10% FBS-DMEM + 5 mM glutamine and antibiotics. These fragments were cultured for 15 days, and after the initial growth of fibroblast-like cells, small circular and refractive cells appeared. This cell population was easily collected by pipetting the initial culture slowly and counted, and cloned by limiting dilution on a gelatin 1% coated p96 well dish.

  Different effective clones were characterized by surface marker expression after selection by phase contrast morphology.

Differentiation assay Differentiation into different cell types was induced according to the well-known published protocols.

  The culture solution was transferred to differentiation medium (DMEM supplemented with 2% horse serum). Differentiation into smooth muscle cells and osteoblasts was induced by treatment with TGFβ1 and BMP2, respectively, as previously reported (Minasi, MG, et al. 2002. Development 129, 2773-2783). . Differentiation into skeletal muscle cells was induced by co-culturing MAMp with C2C12 mouse myoblasts. Differentiation into heart cells was analyzed after treatment with 10 μM 5-azacytidine for 48 hours. After 5 days, the culture was fixed and stained with a colored solution or stained with an antibody against striated myosin (MF20).

Neuronal differentiation consists of changing the culture medium to neural stem cell growth medium: final concentration 4.5 mg / ml, N ₂ added (Gibco-Invitrogen), B27 added (Gibco-Invitrogen), 20 μg / ml insulin. (Sigma) DMEM: F12 medium (Sigma) supplemented with D-glucose (Sigma) up to 2 μg / ml heparin (Sigma), 20 ng / ml βFGF (Sigma), 10 ng / ml EGF (Sigma). The neural stem cell growth medium was changed twice, and after 1 week of culture, the cells were processed and subjected to immunocytochemical analysis. Further, the cells were differentiated into neural stem cell differentiation medium (DMEM: F12 (Sigma) supplemented with D-glucose (Sigma) to a final concentration of 4.5 mg / ml, N ₂ added (Gibco-Invitrogen), B27 added (Gibco-Invitrogen). Grows for an additional week in 2 μg / ml heparin (Sigma) and 1% FBS (Sigma), specific media for neuronal culture (Neurobasal-A (Gibco-Invitrogen), B27 (Gibco-Invitrogen), Glutamax-I ( (Gibco-Invitrogen), P / S (Sigma)) for an additional week, and oligodendrocyte differentiation (DMEM (Sigma), 4.5 mg / mL D-glucose, 100 μg / mL BSA (S)) igma), 100 U / mL penicillin, 100 μg / mL streptomycin (Sigma), 2 mM L-glutamine (Sigma), 60 μg / mL N-acetyl-L-cysteine (Sigma), N ₂ added (Gibco-Invitrogen), 20 ng / mL bFGF (PeproTech) and 10 ng / mL PDGF-AA (PeproTech)). Following this, the cells were processed for immunocytochemical analysis. The identity of the human nucleus was confirmed by Hoechst. Differentiation rate (%) was calculated by counting the number of differentiated MAMp.

Analysis of Cell Proliferation Cells were plated at a density of 3 × 10 ³ cells / cm ² in different media and passaged on average every 3 days. At each passage, the number of cells was counted in triplicate with a hemocytometer. For clonal growth curves, cells were first plated at ¹ × 10 ⁴ cells / cm ² in complete DMEM or embryonic medium and passaged every 5 days. At each passage, the number of cells was counted in triplicate with a hemocytometer.

Cells plated at 1/3 confluence 72 hours prior to karyotyping analysis were treated with Karyomax kit (Invitrogen) according to manufacturer's instructions. Five different metaphase growths were examined for each karyotype analyzed.

To test the possibility of tumorigenic tumor formation, 5 nude mice were injected subcutaneously with 10 ⁷ MAMp. After 4 months, the mice were sacrificed and analyzed for the presence of visually detectable tumors.

Immunofluorescent cells were grown on gelatin-coated glass coverslips, washed with PBS and fixed with 4% paraformaldehyde for 10 minutes. Samples were frozen with chilled isopentane in liquid nitrogen and serial 8 μm (thick) sections were cut with a Leyca cryostat. Cells were permeabilized with 0.2% Triton X-100, 1% BSA in PBS for 30 minutes at room temperature while incubating tissue sections without detergent. Cells and tissue sections were incubated with 10% donkey serum for 30 minutes at room temperature and incubated with primary antibody at 4 ° C overnight at the appropriate dilution. Following incubation, samples were washed twice with permeabilization buffer and then incubated with appropriate FITC or TRiTC conjugated anti-mouse or anti-rabbit IgG and Hoechst for 45 minutes at room temperature. After three final washes, coverslips were mounted on glass slides using Mowiol in PBS and analyzed under a fluorescence microscope (Nikon). Other tissue sections or cells were stained with X-Gal as described (Sampolesi M et al. 2003. Science. 301: 487-492).

The following antibodies were used: anti-laminin monoclonal antibody or polyclonal antibody (Sigma) at 1: 100 dilution; MF20 antibody at 1: 5 dilution, anti-smooth α-actin 1: 300 dilution from Sigma, polyclonal anti-nestin antibody (Abcam), β-III-tubulin (anti-TUJ1 antibody, Abcam), doublecortin (anti-Dcx antibody, Abcam), and MAP2 (Sigma) (as a neuronal marker), GFAP (Sigma) (astrocyte marker) As) and RIP (Developmental Studies Hybridoma Bank) (as an oligodendrocyte marker). The nuclei were stained with bisbenzimide (Sigma).

  The following antibodies were used for FACS analysis (FACS Calibur (Becton Dickinson)): BD Biosciences CD44, CD34, CD45, CD117, CD133, ID Labs CD31, CD13, Biocytes CD146, Abcam CD80, CD90, SSEA-4, WGA manufactured by Biotech, TRA1-60 and TRA1-81 manufactured by Biotech, and TMRM manufactured by Molecular Probes.

Gene expression analysis RNA was extracted from different MAMp clonal cells while growing. RT-PCR was performed to analyze the expression of different genes involved in the development or differentiation described above by other groups (Mef2c, Sox2, Tbx5, hTERT, Mef2a and Tbx2).

PCR conditions were general for all primers: 4 min at 94 ° C. 94 ° C, 45 seconds 30 cycles; 55 ° C, 45 seconds; 72 ° C, 45 seconds. Final stroke for 10 minutes at 72 ° C.
List of primers used:
Mef2a primer forward: TTGAGGCTCTGAACAAGAAGG
Mef2a primer reverse: GCATTGCCAGACTACTTGGTGG
Mef2c primer forward: AACACGGGGACTATGGGGGAAA
Mef2c primer reverse: TATGGCTGGACACTGGGATGGGTA
Tbx2 primer forward: GGTGCAGACAGACAGTGGCGT
Tbx2 primer reverse: AGGCCAGTAGGTACCCATG
Tbx5 primer forward: CCAGCTCGGCGAAGGGATGTTT
Tbx5 primer reverse: CCGACGCCGTGTACCGAGTGAT
Sox2 primer forward: GGCAGCTACAGCATGATGGCAGGAGC
Sox2 primer reverse: CTGGTCATGAGGTTGTTACGCAGGG
mTERT: Human / mouse TERT primer pair (R & D systems)

Alkaline phosphatase (AP) -reacted MAMp was cultured at high density for 5 days on plates before analyzing AP activity.

  On day 5, the medium was aspirated and the cells were fixed with 4% paraformaldehyde in PBS for 3 minutes. Thereafter, the fixative was aspirated and rinsed with PBS 1 ×.

  Staining solution was added (first red violet mixed with naphthol, phosphatase solution and water in a 2: 1: 1 ratio). In a detection kit (Millipore), each well is covered and incubated for 15 minutes at room temperature in the dark. Aspirate the solution, rinse the plate with 1x PBS, count the number of violet cells with a microscope and analyze.

result
Isolation and in vivo growth of cells from primary mouse uterine biopsies As described above, uterine biopsies were dissected under the microscope: subdivision of tube fragments and surrounding mesenchymal tissue, for other cell types Plated on a gelatin-coated dish as described above (Minasi, MG, etc. described above; Sampalesi M, etc. 2003 described above). After initial growth of fibroblast-like cells, small round and refractive cells appeared. These cells did not adhere well to the substrate and were therefore slowly pipetted. Suspension cells were grown as a polyclonal population or optionally cloned by limiting dilution. The majority of cells in the population acquired a triangular and refractive morphology and maintained a high growth rate with a doubling time of about 36 hours during about 30 passages. Growth rate was almost independent of mouse age (range 4-8 months). This growth rate resulted in a final cell count of approximately 3 × 10 ⁹ from the initial 10.000 cells. This cell number would be suitable for injection. After 30 passages (about 60 PD), large flat cells that did not differentiate any more appeared at an increased frequency, and after several passages, the entire population aged. Cells maintained normal diploid karyotype at early and late passages. To test for tumorigenicity, 10 ⁷ MAMp was injected subcutaneously into SCID / beige mice. Ten injected mice were maintained for up to 6 months after injection and did not develop any visible tumor that could be detected with the naked eye during autopsy (data not shown).

The mouse myometrial precursor phenotype MAMp was further characterized by flow cytometry and PCR gene expression and analyzed for its ability to differentiate into different cell types.

Characterization of surface markers and gene expression MAMp clones were analyzed by flow cytometry for cell surface expression of the following stem cell markers: CD31, CD34, CD44, CD117, alkaline phosphatase (PAL), HLA-DR, SSEA -1, HLA-DR, WGA, CD13, CD45, CD80, CD90, CD133, CD146, TRA1-60 / 81 and tetramethylrhodamine methyl ester (TMRM). All clones are positive for CD31, CD34, CD44, CD117, SSEA-4, HLA-DR and WGA-lectin surface markers, CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81 surface markers Was negative. See Table 1 for percentages and FIG. 1 for FACS profiles.

  RNA was extracted from different MAMp clonal cells while growing. RT-PCR was performed to analyze the expression of different genes involved in development or differentiation as described above in other groups. MAMp is positive for Mef2c, Sox2, Tbx5 and hTERT and negative for Mef2a and Tbx2 (see FIG. 2).

To complete the in vivo characterization of differentiation potential MAMP of MAMP, they were tested for their ability to undergo terminal differentiation into mesodermal cell types in which different. MAMp readily differentiates into smooth muscle, adipocytes or osteoblasts when treated with transforming growth factor β (TGFβ), insulin-dexamethasone or bone morphogenic protein 2 (BMP2). Less than MAMp 1% expressed sarcoma myosin when myocardial differentiation was induced by adding 5 μM 5-azacytidine every 48 hours (data not shown). This indicates that these cells have a moderate ability to undergo cardiomyogenesis. When skeletal muscle differentiation was induced by co-culturing MAMp with mouse myoblasts, a very high percentage (greater than 50%) fused to hybrid myotubes (FIG. 6C). MAMp could also differentiate into neural tissue after changing to neural stem cell growth medium (see method). After 1 day in neural stem cell growth medium and for 1 week, the cell growth rate decreased and the shape began to change. Some cells exhibited an elongated process, others formed rosettes than similar neurospheres. Most cells were positive for nestin (Figure 4). In addition, the cells showed positive staining for three neuronal markers (Tuj-1, Dcx and MAP2), astrocyte marker GFAP and oligodendrocyte marker, RIP. Furthermore, the morphology of Tuj-1 positive cells was very similar to that of neuroblasts. Furthermore, MAMp was positive for the native phosphatase alkaline reaction (FIG. 3).

Discussion The present invention demonstrates the isolation of myometrial precursors from adult mouse uterine tissue. The precursor can grow for up to 30 passages and express stem cell surface markers and genes. In addition, these precursors can differentiate into different mesodermal tissue types and are suitable for regenerative medicine.

  Myometrial precursors can be easily isolated from only the biopsy used for diagnosis without the need for further surgical intervention. Cell sources are important not only for practical reasons. Pluripotent mesoderm precursors are subject to certain local differentiation constraints found in the cell types of the tissues present. It is therefore interesting to have a source of mesoderm precursor that remains pluripotent.

Comparison of mesoderm with other stem cells In the last few years, many different types of mesoderm stem cells have been isolated from mouse and human tissues and characterized to different extents. These include endothelial progenitor cells (EPC), pluripotent adult progenitor cells (MAPC), side population cells (SP), mesodermal hemangioblasts, stem / progenitor cells from myoendothelium, sinobia , Dermis and adipose tissue. Different experimental procedures, different origins and partial characterizations do not fully understand the heterogeneity of these cells, and little is known about their origin and possible lineage relationships. In any case, many of these cells, such as MDSC or MAPC, have been found to differentiate into skeletal muscle in vivo. Some of these cells grow extensively in vitro, but others such as EPC and SP do not grow; whereas EPC and SP circulate, systemic delivery has been tested for most other cell types. Was not. For example, recently isolated cells from adipose tissue can proliferate extensively in vitro and differentiate into several tissues, including skeletal muscle, to produce human dystrophin-expressing fibers. However, most of these cells are effectively differentiated and obtained from other cell types and cannot be easily grown.

Perspectives for clinical trials In future clinical protocols, systemic delivery is an obligatory choice. The myometrial precursors of the present invention are used to attach and traverse leukocytes to the endothelium and thus can diffuse into the skeletal muscle stroma within bone forming tissue and between adipocytes when delivered to the carotid artery Species proteins can be expressed.

  A further concern for future cell therapy protocols is the fear that extensive in vitro proliferation may interfere with differentiation and / or self-renewal ability or even cause malignant transformation. From the data provided here, the cells of the present invention can be expanded extensively, but not in vitro. These cells maintain a diploid karyotype, do not form tumors in immunodeficient mice, and undergo senescence after about 30 passages in vitro.

Finally, two protocols can now be selected for cell therapy: autologous cells after gene modification in vitro, or normal donor cells in the presence of immunosuppression or possibly induced adoptive tolerance. Donor cell transplant overcomes these problems, but faces the need for lifelong immunosuppression that begins shortly after birth.

Claims (19)

  An isolated myometrial stem cell population derived from myometrium, wherein cells of said cell population are positive for CD31, CD34, CD44, CD117, SSEA-4, HLA-DR, and WGA-lectin surface markers A stem cell population characterized in that it is negative for CD13, CD45, CD80, CD133, CD146, TRA1-60, and TRA1-81 surface markers.   The isolated stem cell population according to claim 1, wherein the cells of the cell population express at least one of the genes Mef2c, Sox2, Tbx5, and hTERT.   The isolated stem cell population according to any one of claims 1 to 2, wherein the cells of the cell population express an alkaline phosphatase protein.   The isolated stem cell population according to any one of claims 1 to 3, wherein the cells of the cell population exhibit a mitochondrial membrane potential lower than a reference value.   The isolated stem cell population according to any one of claims 1 to 4, wherein the population does not exhibit tumorigenic activity.   The isolated stem cell population according to any one of claims 1 to 5, wherein the cells of the population exhibit an ability to differentiate into smooth muscle cells.   The isolated stem cell population according to any one of claims 1 to 6, wherein the cells of the population exhibit an ability to differentiate into adipocytes.   The isolated stem cell population according to any one of claims 1 to 7, wherein the cells of the population exhibit an ability to differentiate into osteoblasts.   The isolated stem cell population according to any one of claims 1 to 8, wherein the cells of the population exhibit an ability to differentiate into nerve cells.   The isolated stem cell population according to any one of claims 1 to 9, wherein the cells exhibit a limited proliferation rate.   The isolated stem cell population according to any one of claims 1 to 10, wherein the cells have been genetically modified.   The isolated stem cell population according to any one of claims 1 to 11, which is used as a medicine.   13. The isolated stem cell population according to any one of claims 1 to 12, for the treatment of a tissue degenerative condition.   The tissue degeneration state is a state in which skeletal muscle degeneration, heart tissue degeneration, bone tissue degeneration, nerve tissue degeneration, lung degeneration, liver degeneration, kidney degeneration or the tissue degeneration state, or a plurality of them simultaneously occur. 14. The isolated stem cell population according to 13.   A pharmaceutical composition comprising the isolated stem cell population according to any one of claims 1 to 11 and an acceptable pharmaceutical vehicle. A method for isolating a stem cell population from myometrial tissue, wherein cells of said cell population are positive for CD31, CD34, CD44, CD117, SSEA-4, and WGA-lectin surface markers, CD13, CD45 , CD80, CD133, CD146, TRA1-60, and TRA1-81 surface markers are negative and the method is:
i) incubating a myometrial tissue sample in a suitable cell culture medium on a solid surface under conditions such that the cells of the sample adhere to the solid surface;
ii) recovering cells that do not adhere to the solid surface or have low adhesion ability from the cell culture medium;
and iii) confirming that the selected cell population exhibits the intended phenotype.   The method of claim 16, wherein the myometrial tissue sample is a biopsy sample.   The method of claim 17, wherein the biopsy sample is an exfoliated sample.   19. The method of any one of claims 16-18, wherein the method comprises removing serosa, fat and fibrous tissue from the myometrial tissue sample prior to incubation in the culture medium in step i). The method according to item.