WO2010054440A1 - Bmp-7 compounds for modulating the expression of telomerase reverse transcriptase - Google Patents

Abstract

The invention provides bone morphogenetic protein compounds, particularly BMP-7, and methods for their use in modulating the expression of telomerase reverse transcriptase (TERT) The subject compounds and methods find use in a variety of different applications, such as therapeutic applications, production of reagents for use in life science research, screening applications and the like. Said compounds and methods are particularly useful for the treatment of undesirable cell proliferation disorders such as cancer.

Description

BMP-7 COMPOUNDS FOR MODULATING THE EXPRESSION OF TELOMERASE REVERSE TRANSCRIPTASE

The present invention relates generally to compounds and methods for their use in modulating cellular proliferation. Specifically, compounds and methods are provided for modulating the expression of telomerase reverse transcriptase (TERT). The subject compounds and methods find use in a variety of different applications, such therapeutic applications, production of reagents for use in life science research, screening applications, and the like.

BACKGROUND

Cancer cells hold unlimited proliferative potential, attributed in part to the maintenance of telomeres during mitotic cell division.

Telomeres, which define the ends of chromosomes, consist of short DNA tandem repeats loosely conserved in eukaryotes. For example, human telomeres consist of many kilobases of (TTAGGG)_n, together with various associated proteins. Small amounts of these terminal sequences or telomeric DNA are lost from the tips of the chromosomes during S phase of mitotic cell division because of incomplete DNA replication. Thus, many human cells progressively lose terminal sequence with cell division, a loss that correlates with the apparent absence of telomerase in these cells. The resulting telomeric shortening has been demonstrated to limit cellular lifespan.

Telomerase is a ribonucleoprotein that synthesizes telomeric DNA. Telomerase is typically made up of an essential structural RNA (TER), where the human component is referred to in the art as hTER and a catalytic protein (telomerase reverse transcriptase or TERT), where the human component is referred to in the art as hTERT. Telomerase recognizes the 3' end of DNA {e.g., telomeres) and adds multiple telomeric repeats to its 3' end with the catalytic protein component (e.g., hTERT), which has polymerase activity, and hTER which serves as the template for nucleotide incorporation. Of these two components of the telomerase enzyme, both the catalytic protein component and the RNA template component are activity-limiting components.

Because of its role in cellular senescence and immortalization, there is much interest in the development of protocols and compositions for regulating telomerase activity. For instance, a usual DNA polymerase is responsible for the replication of DNA upon cell division, but does not replicate completely to the extreme end of DNA, thereby to generate a shortened telomere. A normal somatic cell repeats the cell divisions at predetermined times and stops the proliferation to fall into senescence or cell death.

Telomerase has been shown to be crucial to cancer cell proliferation and immortalization because it imparts on a cell an unlimited lifespan by maintaining telomere length. Ectopic expression of hTERT lengthens telomeric DNA and has been shown to stabilize telomeres and mediate cell immortalization. Conversely, inhibition of hTERT by gene silencing, dominant negative gene expression or substrate competitive inhibitors has been shown to accelerate telomere shortening and thereby trigger cancer cell senescence and apoptosis in vitro and in vivo.

Evidence suggests that when normal cells differentiate in most tissues and organs, hTERT gene expression becomes repressed, conferring a limited length of telomeres and therefore proliferative potential on cells. Repression of the hTERT gene appears to occur at the gene transcription level under a concerted regulation by a number of transcription factors and repressors.

However, little is known about the extracellular cues that regulate TERT expression. Thus, further studies are required to elucidate the mechanisms that regulate TERT expression, telomerase activity and telomere maintenance in the hope of developing improved treatment strategies to combat proliferative cell disorders, such as cancer.

The present invention overcomes, or at least alleviates, some of the aforementioned limitations of the prior art and, in doing so, provides compounds for modulating TERT gene expression and methods for their use in modulating cellular proliferation.

The discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date.

Throughout the description and claims of this specification the word "comprise", and variations of the word such as "comprising" and "comprises", are not intended to exclude other additives or components or integers or steps. SUMMARY OF INVENTION

In one aspect of the present invention, there is provided a method of repressing expression of telomerase reverse transcriptase (TERT) in a cell, the method including contacting the cell with a bone morphogenetic protein (BMP), or a biologically active fragment or variant thereof.

In some embodiments, the cell is a cancer cell.

In some embodiments, the cell is a cervical cancer cell.

In some embodiments, the cell is contacted with the BMP in vitro.

In some embodiments, the BMP is BMP7.

The present invention also provides a method of enhancing expression of telomerase reverse transcriptase (TERT) in a cell, the method including contacting the cell with an antagonist of BMP, or a biologically-active fragment or variant thereof.

In some embodiments, the antagonist of BMP is an antagonist of BMP7.

In another aspect of the present invention, there is provided a composition for repressing expression of TERT in a cell, the composition including a BMP, or a biologically active fragment or variant thereof.

In some embodiments, the cell is a cancer cell.

In some embodiments, the cell is a cervical cancer cell.

In some embodiments, the cell is cultured in vitro.

In some embodiments, the BMP is BMP7.

In another aspect of the present invention, there is provided a composition for enhancing expression of TERT in a cell, the composition including an antagonist of BMP, or a biologically active fragment or variant thereof. In some embodiments, the antagonist of BMP is an antagonist of BMP7.

In another aspect of the present invention, there is provided a pharmaceutical composition for repressing expression of TERT in a cell, the composition including a BMP, or a biologically-active fragment or variant thereof, and a pharmaceutically acceptable carrier, excipient, diluent and/or adjuvant.

In some embodiments, the cell is a cancer cell.

In some embodiments, the cell is a cervical cancer cell.

In some embodiments, the cell is cultured in vitro.

In some embodiments, the BMP is BMP7.

In another aspect of the present invention, there is provided a pharmaceutical composition for enhancing expression of TERT in a cell, the composition including an antagonist of BMP, or a biologically-active fragment or variant thereof, and a pharmaceutically acceptable carrier, excipient, diluent and/or adjuvant. In some embodiments, the antagonist of BMP is an antagonist of BMP7.

In another aspect of the present invention, there is provided a method of screening a test compound for its ability to modulate {e.g., increase or decrease) TERT expression, the method including the steps of: exposing a cell capable of expressing TERT to the test compound and a BMP, or a biologically-active fragment or variant thereof, under conditions that will allow the BMP, or a biologically-active fragment or variant thereof, to repress TERT expression; and determining whether the test compound modulates BMP-mediated repression of TERT expression.

In some embodiments, the cell is a cancer cell, a stem cell or a vascular smooth muscle cell.

In some embodiments, the cell is a cervical cancer cell. In some embodiments, the cell is a pancreatic progenitor cell. In some embodiments, the cell is a vascular smooth muscle cell. In some embodiments, the cell is exposed to the test compound and the BMP in vitro.

In some embodiments, the BMP is BMP7.

In some embodiments, the determining whether the test compound modulates BMP- mediated repression of TERT expression involves determining whether the test compound enhances BMP-mediated repression of TERT expression.

In some embodiments, the determining whether the test compound modulates BMP- mediated repression of TERT expression involves determining whether the test compound inhibits BMP-mediated repression of TERT expression.

In another aspect of the present invention, there is provided a test compound determined by the screening method as herein described as being capable of modulating BMP-mediated repression of TERT expression.

In another aspect of the present invention, there is provided a prophylactic or therapeutic method of treating a subject at risk of or susceptible to a disorder or having a disorder associated with undesirable cell proliferation, the method including administering to the subject a BMP, or a biologically active fragment or variant thereof.

In some embodiments, the disorder associated with undesirable cell proliferation is cervical cancer.

In some embodiments, the BMP is BMP7.

In another aspect of the present invention, there is provided a prophylactic or therapeutic method of treating a subject at risk of or susceptible to a disorder or having a disorder associated with TERT expression and/or activity, the method including administering to the subject an antagonist of BMP, or a biologically active fragment or variant thereof. In some embodiments, the antagonist of BMP is an antagonist of BMP7.

In another aspect of the present invention, there is provided use of a BMP in the manufacture of a medicament for use in prophylaxis or treatment of a subject at risk of or susceptible to a disorder or having a disorder associated with undesirable cell proliferation, the method including administering to the subject a BMP, or a biologically active fragment or variant thereof.

In some embodiments, the disorder associated with undesirable cell proliferation is cervical cancer.

In some embodiments, the BMP is BMP7.

In another aspect of the present invention, there is provided use of a BMP in the manufacture of a medicament for use in prophylaxis or treatment of a subject at risk of or susceptible to a disorder or having a disorder associated with TERT expression and/or activity, the method including administering to the subject an antagonist of BMP, or a biologically active fragment or variant thereof. In some embodiments, the disorder associated with TERT expression and/or activity is selected from the group consisting of cardiovascular diseases, osteoarthritis, osteoporosis, Alzheimer's disease, macular degeneration, liver cirrhosis, rheumatoid arthritis, AIDS or HIV infection, autoimmune disease, muscular dystrophy, wound healing, hair loss and photo-damaged skin. In some embodiments, the antagonist of BMP is an antagonist of BMP7.

FIGURES

Figure 1 : Figure 1A illustrates the concentration-dependent inhibition of telomerase activity by BMP7. HeLa cells were incubated with different concentrations of BMP7 as herein described for 24 hours in cell cultures and then subjected to telomerase activity analysis. Telomerase activity was determined by measuring newly synthesized telomeric DNA as herein described (see Materials and Methods). Telomeric DNA ladders and an internal loading control are indicated. Lanes 1 and 2 are labeled P and N for inter-experimental positive and negative controls, respectively. Figure 1 B illustrates the BMP7 concentration- and time-dependent inhibition of telomerase activity in HeLa cells. Cells were treated for 24 hours in the concentration-dependent experiments, or treated with BMP7 at 30 ng/ml for various time periods as indicated in the time-course studies. Telomeric DNAs resolved gel electrophoresis and autoradiography were scanned and presented as percentages of the values in non- treated controls. Results are mean ± SD from three determinations. Figure 1 C illustrated the effects of BMP7 on telomerase activity in PMC42 cells. PMC42 cells were incubated with BMP7 for 24 hours at the indicated concentrations followed by telomerase activity analysis. Telomere DNA produced and internal control are indicated. Figure 1 D illustrates the semi-quantitative RT-PCR analysis of hTERT and c-myc gene expressions. HeLa and PMC42 cells treated with BMP7 (30 ng/ml, 24 hours) were extracted for mRNA and semi-quantitative RT-PCR as described herein (see, e.g., Materials and Methods section of the Examples). The levels of hTERT and c-myc as indicated in the top panels were quantified as ratios to actin, and presented as mean ± SD from three similar experiments. Asterisk denotes a significant difference compared to non-treated control (p<0.01 ).

Figure 2 illustrates BMP7-induced telomere shortening in cervical cancer cells. Figure 2A shows that effect of BMP7 on telomere length in HeLa cells. Cells were treated with or without BMP7 (30 ng/ml) for 15 hours followed by replacement with fresh medium on every second day for two weeks. Telomeres were determined by Q-FISH and the distributions of telomere lengthare presented by fluorescence intensity versus frequencies. Figure 2B shows histograms of mean telomere fluorescence intensities (± S. E. M.) in control and BMP7-treated cells. Figure 2C shows illustrative micrographs of fluorescence-labeled telomeres in metaphase spreads.

Figure 3 illustrates that BMP7-induced cancer cell apoptosis is dependent on hTERT gene repression. Figure 3A shows inhibition of cancer cell proliferation by BMP7. HeLa cells were incubated with or without 30 ng/ml of BMP7, BMP6, BMP5, BMP4 or BMP2 for different periods of time as indicated. Cell numbers were counted in 20 μl at each time when cells were subcultured or terminated in Coulter counter (Beckman Coulter, Z Series, Australia). Asterisk indicates a significant difference from the non-treated control (p<0.05). Figure 3B shows the effect of BMP7 on apoptosis. HeLa cells transfected with empty plasmid, hTERT shRNA or hTERT wild type gene expression plasmid for 24 hours and then incubated with or without BMP7 (10 ng/ml) for further 24 hours, as indicated. Cells were stained with Annexin V and propidium iodide (Pl), and analyzed by FACS. Figure 3C shows the effect of gene expression of hTERT or hTERT shRNA on BMP7-induced HeLa cell death. Cells transfected with pEGFP, pEGFP-hTERT or pEGFP-hTERT shRNA for 24 hours were isolated by FACS sorting and incubated with BMP7 (10 ng/ml) or diluent as indicated for 24 hours. Apoptosis was analyzed by Annexin V and Pi staining in FACS. The data were from one of three similar experiments. Figure 3D shows the effect of BMP7 in telomerase-negative cell lines. GM847, Saos2 and HeLa cells were incubated in duplicate with different concentrations of BMP7 for 48 hours. Figure 4 illustrates BMP7 inhibition of tumor growth. In Figure 4A, the micrograph shows BMP7 suppression of tumor growth in soft agars. HeLa cells (3 x 106) in 0.35% soft agar suspension were incubated with or without BMP7 at 10 ng/ml (left panel) or different concentrations (right panel) for 7 days. Tumor colonies were observed after staining with Methylthiazolyldiphenyl-tetrazolium (MTT). Data are mean ± SD from four different determinations in the bar graph. Figure 4B shows the effect of different BMPs on xenograft tumor growth in mice. HeLa cells (3 x 106) were inoculated in nude mice subcutaneously. Different BMPs (10 ng/ml in 50 μl PBS) were injected in each xenograft 24 hours after inoculation and then on every second day for two weeks. Tumor growth was measured prior to each injection. Data are mean ± SD from multiple experiments (22 animals in PBS groups, 24 animals in BMP7-treated groups, and 4-8 animals in groups receiving other BMPs). Asterisk designates a significant difference from PBS control with p<0.01. Figure 4C shows a dose-dependent effect of BMP7 on xenograft tumor growth in mice. BMP7 of different doses was administered as indicated on every second day for two weeks. Data of tumor size are mean ± SD from four animals in each group. Figure 4D shows the expression of hTERT reverses BMP7- induced tumor growth inhibition. Empty plasmid, hTERT shRNA expression plasmid or hTERT wild type gene expression plasmid was intra-tumor injected one day after tumor inoculation and continued on every second day for two weeks. One day after injections of empty plasmid and hTERT wild type gene expression plasmid and two days after HeLa cell inoculation, BMP7 (10 ng/ml) was administered which was continued on every second day for two weeks. Data of tumor sizes are as mean ± SD from four animals in each treatment group. Asterisks indicate significant differences from that in PBS control.

Figure 5 illustrates BMP7-induced telomerase inhibition, hTERT gene repression, and p53 and p16 gene activation in mouse xenograft tumors. Figure 5A shows the effect of BMPs on telomerase activity in tumors. Tumors were treated with or without different BMPs (10 ng/ml) on every 2nd day for two weeks. Telomerase activity in the tumors was measured by TRAP. Figure 5B shows telomerase activity quantified by densitometry. Data are mean ± SD (N=3). Telomere DNA and internal control are indicated. C, Altered gene expressions of hTERT, c-myc, and p53 and p16 in the xenograft tumors treated with BMP7. Quantitative data of gene expressions of c-myc, hTERT, p53, p16 and actin in tumors treated with and without BMP7 as indicated. Data were obtained by densitometry, and are expressed as mean ± SD, from three determinations. Figure 5D shows semi-quantitative RT-PCR determination of hTERT and c-myc, and Western blotting for p53 and p16. The results are representatives of multiple experiments.

Figure 6 illustrates BMP7-induced telomere shortening and tumor cell growth arrest in mouse xenograft tumors. Figure 6A shows that BMP7 induces telomere shortening in tumors. Xenograft tumors in mice were treated on every second day for two weeks. The tumors were sectioned and examined for telomeres by Q-FISH (Materials and Methods). Illustrative micrographs of Q-FISH with merged images showing telomeres in red dots and DNA in blue. Figure 6B shows a quantitative histogram of the mean telomere fluorescence intensity. Data are mean ± S. E. M from at least fifty cells chosen randomly from each of the four conditions indicated. P-values indicate the levels of significant differences between the means of treated groups and control. Figure 6C shows decreased Ki67 as cell proliferation marker in xenograft tumors treated with BMP7. Sections from control and BMP7-treated tumors were fixed and incubated with Ki67 antibodies (red), and were stained for nuclei with Hoechst 33258 (blue). Figure 6D shows quantitative analysis of cell proliferation by counting Ki67-positive cells from 15 views of 3 sections in each group. Data are mean ± SE of percentage in total cells.

Figure 7 illustrates BMP7-induced pancreatic progenitor and vascular smooth muscle cell death. Cells were treated with BMP7 (10 ng/ml) or diluent as indicated for 24 hours. Cells were then stained with Annexin V and propidium iodide (Pl), and analyzed by FACS.

Figure 8 illustrates BMP7-induced inhibition of telomerase activity and shortening of telomeres in cultured breast cancer cells, (a). BMP7 induces a concentration- and time- dependent inhibition of telomerase activity in cultured human breast cancer MCF-7 cells. Cells were incubated with different concentrations of BMPs as indicated for 48 hours (solid lines), or with BMP7 (10 ng/ml) for different periods of time as indicated (dot line). Telomerase activity was determined by measuring newly synthesized telomeric DNA and quantitated by densitometry. The results are presented in mean ± SD from three determinations, (b). Effects of BMP7 antibodies or heating denatured BMP7 on telomerase activity. BMP7 with or without heating at 80oC for 2 minutes was incubated in the presence or absence of BMP7 antibodies (1 :100 dilution) in cultured cells. Telomere DNA produced and internal control are indicated, (c). Effect of BMP7 on telomere length in MCF-7 cells. Cells were treated with or without BMP7 (30 ng/ml) for 15 hours followed by replacement with fresh medium on every second day for two weeks. Telomeres were determined by Q-FISH and the distributions of telomere length are presented by fluorescence intensity versus frequencies, (d). Illustrative micrographs of fluorescence-labeled telomeres in metaphase spreads, (e). Histograms of mean telomere fluorescence intensities (± S. E. M.) in control and BMP7-treated cells.

Figure 9 illustrates BMP7-induced cancer cell senescence, (a). BMP7 induces an increase in cancer cell senescence. MCF-7 cells were incubated with or without BMP7 (30 ng/ml) for 15 hours three times a week for two weeks. Senescence-like cells were counted in multiple micrographs and presented as means with comparison between the control and BMP7-treated groups. The results are in mean ± SD from five determinations, (b). Representative micrographs of cultured MCF-7 cells photographed under phase contrast microscope at 10X magnification. Senescence-like cells are indicated by arrows, (c). Inhibition of telomerase activity in MCF-7 cell cultures treated with BMP7 for 15 hours three times a week for two weeks. The result was from one of two assays, (d). Increases in p16, p53 and p21 in the MCF-7 cells treated with BMP7 (10 ng/ml) for different periods of time, determined by Western blotting. The data presented in top panel were from one of two similar experiments, and the data in bottom panel are means of two determinations, (e). β-galactosidase activity determined by β-Gal staining in cultured MCF-7 cells treated with BMP7 (10 ng/ml) for different periods of time. Results were from phase contrast microscopy at 2OX magnification. Arrowed are enlarged β-galactosidase positive senescent cells.

Figure 10 illustrates BMP7-induced breast cancer cell apoptosis is dependent on hTERT gene repression, (a). BMP7 induces breast cancer cell apoptosis. MCF-7 cells were treated with BMP7 (10 ng/ml), or transfected with Smad3 or hTERT shRNA expression plasmids for 48 hours. Cells were stained with Annexin V and propidium iodide (Pl), and analyzed by FACS. (b). Effects of over- and underexpression of hTERT on BMP7-induced breast cancer MCF-7 cell death. Cells were transfected with pEGFP, pEGFP-hTERT or pEGFP-hTERT shRNA for 24 hours, followed by FACS sorting. GFP-positive cells were cultured for 15 hours before being treated with BMP7 (10 ng/ml, 24 hours) and analysed by apoptotic cell staining in FACS. (c). Comparison and statistical analysis of the mean inhibitory effect of recombinant hTERT on BMP7- induced cell death. The data are mean ± SD from eight similar experiments. P values were from student t-tests.

Figure 1 1 illustrates BMP7-induced Smad3 phosphorylation, nuclear translocation and gene transcriptional activity, (a). Smad1/5/8 phosphorylation and nuclear accumulation stimulated by BMP7, BMP2, BMP4 and BMP5. MCF-7 cells were incubated with the cytokines at 30 ng/ml for different time periods as indicated. Cells were fractionated by differential centrifugation for the cytoplasmic and nuclear fractions. Phosphorylation of Smad1/5/8 complex in response to the different cytokines as indicated was examined by Western blotting using specific anti-phosphorylated Smad1/5/8 antibodies, (b). Smad3 phosphorylation and nuclear accumulation stimulated by BMP7 and TGF-β. MCF-7 cells were incubated with BMP7 or TGF-β (10 ng/ml) for 10, 30, 60 and 120 minutes. Cells were fractionated and Smad3 phosphorylation was determined Western blotting using specific antiphosphorylated Smad3 antibody. Protein loading controls in each fraction were monitored by Western blotting using anti-actin antibodies. Data were representatives of at least three similar experiments, (c). BMP7 activation of Smad3 inducible (CAGA)12 Luc promoter. Cells transfected with pCAGA12 Luc were treated with different cytokines as indicated at the concentrations of 10 ng/ml for 24 hours. Luciferase activity was determined as described in Materials and Methods. Data are mean ± SD from four determinations.

Figure 12 illustrates that BMP7-induced inhibition of the hTERT gene expression and telomerase activity are dependent on Smad3 in cultured breast cancer MCF-7 cells, (a). Effects of silencing Smad3 and c-myc on BMP7-induced repression of hTERT BMP7 induces telomere shortening via Smad3 mRNA. MCF-7 cells were transfected with (lanes 2-6) or without (lane 1 ) different customer synthesized small interference RNA (siRNA) as indicated for 48 hours. Cells were then treated with (lanes 4-6) or without (lanes 1-3) BMP7 (10 ng/ml) for 24 hours. Gene expressions of hTERT, Smad3, c-myc and actin were determined by measuring their respective mRNA by RT- PCR using specific primers, (b). Effects of silencing Smad3 and c-myc on BMP7- induced inhibition of telomerase activity. MCF-7 cells were transfected with siRNA specific to Smad3 (lanes 7-10) or c-myc mRNA (lanes 11-14) for 48 hours. Cells were then treated with BMP7 (10 ng/ml) (lanes 5-8, 11-12) or diluent (lanes 1-4, 9-10, 13-14) for 24 hours. Lanes 1 and 2 were controls: lane 1 was a positive control of telomerase extracts and lane 2 was a negative control treated with RNase A. These data presented were representative of one of at least three similar experiments.

DETAILED DESCRIPTION OF THE INVENTION

In one aspect of the present invention, there is provided a method of repressing expression of telomerase reverse transcriptase (TERT) in a cell, the method including contacting the cell with a bone morphogenetic protein (BMP), or a biologically active fragment or variant thereof. The applicant has found for the first time that BMP family members regulate telomerase activity and telomere maintenance in a cell. They have shown, for example, that BMP7 induces sustained telomerase inhibition and telomere shortening in vitro and in vivo, resulting in cell apoptosis by a mechanism involving the repression of the hTERT gene and telomerase activity.

The terms "telomerase reverse transcriptase" and "TERT" are used interchangeably herein and typically denote the catalytic subunit of the enzyme telomerase. As stated earlier, telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme typically consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat (see, e.g., Ureta et al., 2003 "Telomerase: an enzyme with multiple applications in cancer research". Rev. Invest. Clin. 54(4):342-8).

Bone morphogenetic proteins (BMPs) typically operate through autocrine and paracrine mechanisms to regulate cell proliferation, differentiation and apoptosis during development. Similar to other transforming growth factor-β (TGF-β) family members, BMPs are believed to bind cell membrane type I and Il receptors of serine/threonine kinases eliciting intracellular signaling via Smadi , Smadδ, Smadδ and Smad9 proteins, the Lim kinase, and MAP kinase pathways.

In some embodiments of the invention, the BMP is bone morphogenetic protein-7 (BMP7; osteogenic protein-1 ).

In some embodiments of the invention, the BMP is an isolated or purified BMP polypeptide molecule that is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived. The term "substantially free" preferably refers to a preparation of BMP polypeptide molecule having less than about 30%, 20%, 10% and typically less than about 5% (by dry weight) of a non-BMP molecule (also referred to herein as a "contaminating molecule"). In some embodiments, the BMP polypeptide molecule is also substantially free of culture medium, i.e., culture medium represents less than about 20%, more less than about 10%, or less than about 5% of the volume of the polypeptide preparation. In some embodiments, the term "BMP" is also a reference to a nucleic acid molecule that encodes a BMP, or a biologically-active fragment or variant thereof. Typically, the nucleic acid molecule is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid. For example, with regard to genomic DNA, the BMP nucleic acid molecule is separated from the chromosome with which the genomic DNA is naturally associated. Typically, an "isolated" BMP nucleic acid is free of sequences that naturally flank the nucleic acid (i.e., sequences located at the 5' and/or 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in some embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of 5' and/or 3' nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Moreover, an isolated BMP nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

As used herein, the term "native" preferably refers to a BMP polypeptide molecule having an amino acid sequence that occurs in nature (e.g., a natural protein). Native BMP, or naturally occurring BMP, may be identified by any means known to those skilled in the art (e.g., by sequence and/or by function).

Biologically-active variants of BMP may exhibit amino acid sequences that are at least 80% identical to a native BMP polypeptide or a biologically-active fragment thereof. Also contemplated are embodiments in which a variant comprises an amino acid sequence that is at least 90% identical, at least 95% identical, at least 98% identical, at least 99% identical, or at least 99.9% identical to native BMP polypeptide or a biologically-active fragment thereof. Percent identity may be determined by visual inspection and mathematical calculation. The BMP variants or fragments thereof typically retain all of the biological activity of native BMP or at least a portion thereof.

Biologically-active variants of BMP may include polypeptides that are substantially homologous to the native form of BMP, but which have an amino acid sequence different from that of the native form because of one or more deletions, insertions or substitutions. In some embodiments, biologically-active variants of BMP include polypeptides that comprise from one to ten deletions, insertions or substitutions of amino acid residues when compared to a native BMP sequence. A given sequence may be replaced, for example, by a residue having similar physiochemical characteristics. Examples of such conservative substitution of one aliphatic residue for another, such as lie, VaI, Leu or Ala for one another; substitution of one polar residue for another, such as between Lys and Arg, GIu and Asp, or GIn and Asn; or substitutions of one aromatic residue for another, such as Phe, Trp or Tyr for one another. Other conservative substitutions, e.g., involving substitutions of entire regions having similar hydrophobicity characteristics, are well known in the art. Biologically- active variants of BMP may also be generated by the truncation of a native BMP polypeptide. Further variants encompassed by the present invention include, but are not limited to, deglycosylated BMP polypeptides, or fragments thereof, or those polypeptides demonstrating increased glycosylation when compared to native BMP. Also encompassed are BMP polypeptide variants with increased hydration. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, an amino acid residue of a BMP polypeptide may be replaced with another amino acid residue from the same side chain family. In some embodiments, mutations can be introduced randomly along all or part of a BMP coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for BMP activity to identify variants that demonstrate the same, reduced or increased BMP activity in comparison to native BMP. Following mutagenesis, the encoded protein can be expressed recombinantly and the activity of the protein can be determined by the methods described herein.

In some embodiments, a variant of a BMP polypeptide may function as either an agonist (mimetic) or as an antagonist. An agonist of BMP can augment the activity of BMP or retain substantially the same, or a subset, of the biological activities of the naturally occurring form of BMP. An antagonist of BMP will typically inhibit one or more of the activities of the naturally occurring form of the BMP polypeptide by, for example, competitively modulating BMP-mediated repression of TERT expression. Thus, specific biological effects can be elicited by treatment with a variant of limited function. Preferably, treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of BMP has fewer side effects in a subject relative to treatment with the naturally occurring form of the polypeptide.

In some embodiments, the BMP variant is a fusion protein comprising a native BMP polypeptide, or a biologically-active fragment thereof, and an additional domain attached thereto, wherein the additional domain can be either naturally occurring or synthetic. In some embodiments, the fusion protein includes a number of amino acids added to a BMP polypeptide, or a biologically-active fragment or variant thereof, usually to the amino terminus of the recombinant BMP polypeptide molecule. Such fusion proteins can serve a purpose selected from the group including, but not limited to: 1 ) increasing expression of a recombinant BMP polypeptide; 2) increasing solubility of a recombinant BMP polypeptide; and 3) aiding in the purification of a recombinant BMP polypeptide by acting as a ligand in affinity purification. Often, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant BMP polypeptide to enable separation of the recombinant BMP polypeptide from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion proteins may be produced by using fusion expression vectors known to those skilled in the art, such as pGEX, pMAL and pRIT5 which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant polypeptide.

As used herein, the term "fragment" typically refers to a portion of a BMP polypeptide, or a variant thereof that retains at least some of the biological activity of native BMP, as herein described. Such fragments may include at least 5 amino acid residues, at least 10 amino acid residues or at least 20 amino acid residues of a native BMP (or a variant thereof, as herein described).

In some embodiments, a fragment of a BMP polypeptide includes an immunogenic or antigenic region. A fragment may therefore comprise a portion of a BMP polypeptide, or a variant thereof that is recognized (i.e., specifically bound) by an immunoglobulin.

Fragments of BMP may also be identified by screening such fragments for their ability to react with BMP-specific antibodies and/or antisera. Antisera and antibodies are

"BMP-specific" if they specifically bind to a BMP polypeptide or a variant or fragment thereof (i.e., they react with a BMP in an enzyme-linked immunosorbent assay [ELISA] or other immunoassay, and do not react detectably with unrelated polypeptides). Such antisera and antibodies may be prepared as described herein, and using well- known techniques (see, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988).

A BMP molecule may also encompass naturally occurring or synthetic nucleic acid molecules whose nucleotide sequence encodes a BMP polypeptide, or a biologically- active fragment or variant thereof, as hereinbefore described. The term "nucleic acid molecule" includes DNA molecules (e.g., a cDNA or genomic DNA) and RNA molecules {e.g., an mRNA) and analogs of the DNA or RNA generated {e.g., by the use of nucleotide analogues). The BMP nucleic acid molecule can be a single-stranded or double-stranded DNA molecule.

As used herein, a "naturally-occurring" nucleic acid molecule typically refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature {e.g., encodes a natural protein).

As used herein, the terms "gene" and "recombinant gene" typically refer to nucleic acid molecules which include an open reading frame encoding a BMP polypeptide, and can further include non-coding regulatory sequences, and introns.

For example, a BMP nucleic acid molecule may include a nucleotide sequence which is at least about 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more homologous to the nucleotide sequence of a native BMP nucleic acid molecule. In the case of a nucleic acid molecule that is longer than or equivalent in length to the reference sequence, the comparison is made with the full length of the reference sequence. Where the isolated nucleic acid molecule is shorter than the reference sequence, the comparison is made to a segment of the reference sequence of the same length (typically excluding any loop required by the homology calculation). The BMP nucleic acid molecule may be derived from any species, including, but not limited to, human, rat, mouse, bird and horse.

As used herein, the terms "BMP activity", "biological activity of BMP" and the like typically refer to the activity of a BMP polypeptide molecule to repress TERT expression in a cell. The activity also includes the capacity to synergise with other agents to repress TERT expression in a cell. The target cell can be any cell whose replication capacity is attributed, at least in part, to TERT expression and activity.

In some embodiments, the nucleic acid sequence encoding a BMP polypeptide molecule, or a biologically-active fragment or variant thereof, is placed under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs ; the P-actin promoter; and human growth hormone promoters. The promoter also may be a native promoter that controls the genes encoding BMP, or a biologically-active fragment or variant thereof.

In some embodiments, there is provided a host cell or cell line transfected with a vector capable of driving the recombinant expression of BMP, or a biologically-active fragment or variant thereof, in the host cell. The host cell or cell line may be a eukaryotic cell or cell line of any species selected from the group including embryonic stem cells, embryonic carcinoma cells, hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, bronchial epithelial cells and immune cells. The host cell may also be of a lower organism such as bacteria.

The biological activity of BMP can be assessed by the skilled addressee by any number of means known in the art including, but not limited to, the measurement of

BMP-mediated repression of TERT expression and/or activity. In some embodiments of the invention, the cell can be any cell in which its replicative capacity can be regulated by regulating the expression and/or activity of TERT. These cells include, but are not limited to, cells skin cells, {e.g., keratinocytes, melanocytes, hair follicle), fibroblasts, endothelial cells {e.g., vascular endothelial cells), epithelial cells {e.g., bronchial epithelial cells and retinal pigment epithelial cells), cells associated with joints

{e.g., chondrocytes), immune cells {e.g., B cells, T cells, and macrophages), hepatocytes, hematopoietic cells, hematopoietic stem cells, neurons, astrocytes, gastrointestinal cells, renal cells {e.g., renal tubular cells), cells associated with bone formation and structure {e.g. osteoblasts, osteocytes, and osteoclasts), germ cells, muscle cells {e.g., skeletal muscle cells, smooth muscle cells, cardiac myocytes) and neoplastic cells {e.g., cancer and tumor cells). In some embodiments of the invention, the cell is a cancer cell. In some embodiments, the cancer cell is a cervical cancer cell. The target cell may be a cancer cell, such as a cervical cancer cell. In some embodiments, the cell is the human cervical cancer HeLa cell.

The skilled addressee can determine the replicative capacity of a cell by any means known in the art. For example, the skilled addressee can determine the replicative capacity of a cell by culturing the cell under conditions that allow for mitotic cell division. Usually the number of times a cell population can be divided before it reaches senescence after a division (e.g., when it takes at least 10 times longer than usual for the cell culture to reach confluency) represents the replicative capacity of the cell. For instance, the following steps can be used to determine the replicative capacity of a cell population: 1 ) collect half of the cell population in a confluent culture flask, 2) inoculating another culture flask of the same size as in step 1 ) with the collected cell population and allowing the cell culture to reach confluency, 3) repeat the steps of 1 ) and 2), until it takes at least 10 times longer than usual for the cell culture to reach confluency {e.g., when it takes two weeks for the cell culture to reach confluency), and 4) counting the number of times the process has been repeated, wherein such number represents the replicative capacity of the cell population.

In some embodiments of the invention, the cell is contacted with the BMP in vitro. In other embodiments, the cell is contacted with the BMP in vivo. Thus, in some embodiments, the method of the invention finds use in a variety of therapeutic applications in which it is desired to modulate {e.g., increase or decrease) TERT expression in a target cell or collection of cells, where the collection of cells may be a whole animal or portion thereof {e.g., tissue, organ, etc). As such, the target cell(s) may be a host animal or portion thereof, or may be a therapeutic cell (or cells), which is to be introduced into a multicellular organism {e.g., a cell employed in gene therapy).

As such, embodiments of the invention provide methods for treating various conditions associated with the activity of TERT by administering to a subject {e.g., mammal such as human) in need of such treatment, a BMP capable of modulating {e.g., increasing or decreasing) TERT expression.

Conditions or disorders associated with the activity of TERT include any condition or disorder associated with the expression, activation, quantitative and qualitative level of

TERT and any condition associated with telomeres {e.g., telomere length). Typically, such condition or disorder is associated with aging, neoplastic growth, or related to cell replication or turn over {e.g., conditions associated with high cell replication event or turn over). For example, conditions or disorders associated with TERT activity include progeria, atherosclerosis, cardiovascular diseases, osteoarthritis, osteoporosis,

Alzheimer's disease, macular degeneration, liver cirrhosis, rheumatoid arthritis, AIDS or HIV infection, autoimmune disease, muscular dystrophy, wound healing, hair loss, photo-damaged skin, transplantation, cancer, and tumour growth. Some conditions or disorders are associated with decreased level or absence of TERT activity or expression, whereas other conditions or disorders {e.g., neoplastic growth) are associated with the presence or increased level of TERT activity or expression.

In another aspect of the present invention, there is provided a composition for repressing expression of TERT in a cell, the composition including a BMP, or a biologically active fragment or variant thereof.

In another aspect of the present invention, there is provided a pharmaceutical composition for repressing expression of TERT in a cell, the composition including a BMP, or a biologically-active fragment or variant thereof, and a pharmaceutically acceptable carrier, excipient, diluent and/or adjuvant.

Pharmaceutical compositions of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.

Such compositions may include a BMP polypeptide, or a biologically-active fragment or variant thereof, cells or biological tissue transfected with expression vectors capable of driving the expression of recombinant BMP, or a biologically-active fragment or variant thereof, a nucleic acid molecule encoding said BMP, or a biologically-active fragment or variant thereof, or an antagonist of BMP {e.g., a BMP-specific antibody), together with a pharmaceutically acceptable carrier, excipient, diluent and/or adjuvant.

As used herein, the language "pharmaceutically acceptable carrier" typically includes solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.

A pharmaceutical composition is typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral {e.g., intravenous, intradermal, subcutaneous), oral {e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Examples of solutions or suspensions used for parenteral, intradermal, or subcutaneous application include, but are not limited to, a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include, but are not limited to, sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers may include physiological saline, bacteriostatic water, Cremophor EL. TM. (BASF, Parsippany, NJ.) or phosphate buffered saline (PBS). In some embodiments, the compositions are sterile and should be fluid to the extent that easy syringability exists. For instance, it should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, or liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion or by the use of surfactants. Prevention of the action of microorganisms may be achieved by incorporation of various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In some embodiments, it may be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, or sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.

Sterile injectable solutions may be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of their preparation may include vacuum drying and freeze-drying which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of tablets, troches, or capsules {e.g., gelatin capsules). Oral compositions may also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like may include any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavouring agent such as peppermint, methyl salicylate, or orange flavouring.

For administration by inhalation, the compounds may be delivered in the form of an aerosol spray from a pressurised container or dispenser that contains a suitable propellant {e.g., a gas such as carbon dioxide), or a nebulizer.

Systemic administration may also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated may be used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished with nasal sprays or suppositories. The compounds may also be prepared in the form of suppositories {e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

For transdermal administration, the active compounds may be formulated into ointments, salves, gels, or creams as generally known in the art. In some embodiments of the invention, the compositions are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials may also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. patent no. 4,522,81 1.

Where the agent is a polypeptide, polynucleotide, analog or mimetic thereof {e.g. oligonucleotide decoy, it may be introduced into tissues or host cells by any number of routes, including viral infection, microinjection, or fusion of vesicles. Jet injection may also be used for intramuscular administration (as described, for example, by Furth et al. (1992), Anal Biochem 205:365-368). The DNA may be coated onto gold microparticles, and delivered intradermal^ by a particle bombardment device, or "gene gun" as described in the literature (see, for example, Tang et al. (1992), Nature 356:152-154), where gold microprojectiles are coated with the DNA, then bombarded into skin cells. For nucleic acid therapeutic agents, a number of different delivery vehicles find use, including viral and non-viral vector systems, as are known in the art.

In some embodiments of the invention, the active compound is prepared with carriers that will protect the agent against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid.

It may be advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. "Dosage unit form" as used herein typically refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD₅₀ (the dose lethal to 50% of the population) and the ED₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio

LD50/ED50. In some embodiments of the invention, the composition will exhibit a high therapeutic index. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosages for use in humans. The dosage may lie within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any composition used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC₅₀ (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

Another example of determination of effective dose for an individual is the ability to directly assay levels of "free" and "bound" compound in the serum of the test subject.

Such assays may utilize antibody mimics and/or "biosensors" that have been created through molecular imprinting techniques. The compound which is able to modulate

BMP activity is used as a template, or "imprinting molecule", to spatially organize polymerizable monomers prior to their polymerization with catalytic reagents. The subsequent removal of the imprinted molecule leaves a polymer matrix that contains a repeated "negative image" of the compound and is able to selectively rebind the molecule under biological assay conditions. A detailed review of this technique can be seen in Ansell, R. J. et al. (1996) Current Opinion in Biotechnology 7:89-94 and in

Shea, K. J. (1994) Trends in Polymer Science 2:166-173. Such "imprinted" affinity matrices are amenable to ligand-binding assays, whereby the immobilized monoclonal antibody component is replaced by an appropriately imprinted matrix. An example of the use of such matrices in this way can be seen in Vlatakis, G. et al. (1993) Nature 361 :645-647. Through the use of isotope-labeling, the "free" concentration of compound which modulates the expression or activity of BMP can be readily monitored and used in calculations of IC₅₀. Such "imprinted" affinity matrices can also be designed to include fluorescent groups whose photon-emitting properties measurably change upon local and selective binding of target compound. These changes can be readily assayed in real time using appropriate fibre-optic devices, in turn allowing the dose in a test subject to be quickly optimized based on its individual IC₅O- A rudimentary example of such a "biosensor" is discussed in Kriz, D. et al. (1995) Analytical Chemistry 67:2142-2144.

As defined herein, a therapeutically effective amount of a BMP (i.e., an effective dosage) preferably ranges from about 0.001 to 30 mg/kg body weight, more preferably about 0.01 to 25 mg/kg body weight, even more preferably about 0.1 to 20 mg/kg body weight, and still more preferably about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight. The composition can be administered one time per week for between about 1 to 10 weeks, preferably between 2 to 8 weeks, more preferably between about 3 to 7 weeks, and even more preferably for about 4, 5, or 6 weeks. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including the activity of the specific compound employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, the degree of TERT expression or activity to be modulated, the severity of the disease or disorder, previous treatments and other diseases present.

In some embodiments of the invention, the antagonist of BMP is an antibody to BMP. In some embodiments, the dosage of an anti-BMP antibody is 0.1 mg/kg of body weight (generally 10 mg/kg to 20 mg/kg). If the antibody is to act in the brain, a dosage of 50 mg/kg to 100 mg/kg may be appropriate. Typically, partially humanised antibodies and fully humanised antibodies have a longer half-life within the human body than other antibodies. Accordingly, lower dosages and less frequent administration may be possible. Modifications such as lipidation can be used to stabilize antibodies and to enhance uptake and tissue penetration (e.g., into the brain). A method for lipidation of antibodies is described, for example, by Cruikshank et al. ((1997) J. Acquired Immune Deficiency Syndromes and Human Retrovirology 14:193).

The nucleic acid molecules of the invention as herein described can be inserted into vectors and used as gene therapy vectors. For example, the nucleic acid molecules may be inserted into retroviral vectors {e.g., retroviral vectors such as pLXSN). Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see, e.g.,

Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91 :3054-3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is embedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells {e.g., retroviral vectors), the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

The pharmaceutical compositions of the invention may be included in a container, pack, or dispenser together with instructions for administration.

In another aspect of the present invention, there is provided a method of screening a test compound for its ability to modulate TERT expression, the method including the steps of: exposing a cell capable of expressing TERT to the test compound and a

BMP, or a biologically-active fragment or variant thereof, under conditions that will allow the BMP, or a biologically-active fragment or variant thereof, to repress TERT expression; and determining whether the test compound modulates BMP-mediated repression of TERT expression.

In some embodiments, the determining whether the test compound modulates BMP- mediated repression of TERT expression and/or activity involves determining whether the test compound enhances BMP-mediated repression of TERT expression.

In some embodiments, the determining whether the test compound modulates BMP- mediated repression of TERT expression involves determining whether the test compound inhibits BMP-mediated repression of TERT expression.

The screening methods may include assays that provide for qualitative/quantitative measurements of TERT expression {e.g., of a coding sequence for a marker or reporter gene) in the presence of a particular test compound. Assays of interest include, but are not limited to, assays that measures TERT expression of a reporter gene (i.e. coding sequence, e.g., luciferase, SEAP, etc.) in the presence and absence of a test compound, e.g., the expression of the reporter gene in the presence or absence of a test compound. The screening method may be an in vitro or in vivo method, where both methods are readily developed by those skilled in the art. Whether the method is performed in vivo or in vitro (or any combination thereof), an expression system (e.g., a plasmid) that includes a TERT promoter and a reporter coding sequence all operably linked is combined with the test compound in an environment in which, in the absence of the test compound, the TERT promoter is repressed. The conditions may be set up in vitro by combining the various required components in an aqueous medium, or the assay may be carried out in vivo {e.g., in a cell that normally lacks-telomerase activity, e.g., an MRC5 cell).

The present invention also provides, in some embodiments, methods for screening potential therapeutic agents useful for modulating the expression and/or activity of TERT, the replicative capacity of cells, and for treating conditions associated with the expression and/or activity of TERT.

In some embodiments of the invention, any test compound that specifically increases or decreases the expression and/or activity of TERT with respect to 1 ) its interaction with one or more repressor sites in TERT promoter or 2) its impact on the activity of

TERT is a potential therapeutic agent capable of regulating the expression and/or activity of TERT. Such screening can be carried out either in vitro {e.g., via high throughput screening) or in vivo {e.g., in an animal model). In some embodiments, test compounds are tested for their ability to specifically bind to or interact with TERT and any specific binding between the test compound and TERT is indicative of the test compound's ability to modulate the expression and/or activity of TERT.

A variety of different in vivo models for screening test compounds that modulate TERT expression are also provided by the invention. In vivo models of interest include engineered cells whose replicative capacity is regulated, in part, by TERT expression and/or activity, and a BMP (or a biologically-active fragment or analogue thereof), which components are present in a host cell. Also of interest in the subject screening assays are multicellular in vivo models, e.g., transgenic animal models described below.

Whether the screening method is an in vivo or an in vitro format, the model being employed is typically combined with a test compound and the effect of the test compound on the model is observed and related to the TERT expression modulatory activity of the test compound. For example, for screening inhibitory compounds, the model is typically combined with the test compound and a BMP in an environment in which, in the absence of the candidate agent, TERT expression is repressed by the BMP. The conditions may be set up in vitro by combining the various required components in an aqueous medium, or the assay may be carried out in vivo, etc.

As used herein, the terms "TERT activity", "activity of TERT" and the like typically refer to the ability of TERT to synthesise telomeric DNA. The target cell can be any cell whose replicative capacity is regulated, at least in part, to TERT expression and/or activity.

As used herein, the terms "expression of TERT", "TERT expression" and the like typically refer to the concentration of a polynucleotide that encodes TERT, or a biologically-active fragment or variant thereof, or may refer to a concentration of the TERT polypeptide, or a biologically-active fragment or variant thereof.

The activity of TERT may be determined by persons skilled in the art, as herein described.

The expression of TERT may be assessed by the skilled addressee by any number of means known in the art including, but not limited to, the measurement of messenger RNA (mRNA) encoding TERT, typically expressed by the host cell, such as by Northern blot analysis or quantitative reverse transcription-polymerase chain reaction (RT-PCR), as well as by the measurement of the TERT polypeptide in the host cell, such as by enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or by an indirect determination of TERT activity as hereinbefore described, such that the concentration of TERT in a biological sample is directly (but not necessarily linearly) proportional to the level of TERT activity.

In another aspect there is provided a compound identified by a screening assay that modulates TERT expression and/or activity. These compounds encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 Daltons. Such compounds may include functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The compounds may also include cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. The compounds may also include biomolecules including, but not limited to, peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof. However, this invention is not limited to these compounds.

The compounds may include, but are not limited to 1 ) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e.g., Lam et al., 1991 , Nature 354:82-84; Houghten et al., 1991 , Nature 354: 84- 86) and combinatorial chemistry-derived molecular libraries made of D- and/or L- configuration amino acids; 2) phosphopeptides (e.g., members of random and partially degenerate, directed phosphopeptide libraries, see, e.g., Songyang et al., 1993, Cell 72:767-778); 3) antibodies (e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies, as well as Fab, F(ab')₂, Fab expression library fragments, and epitope-binding fragments of antibodies); and 4) small organic and inorganic molecules.

The compounds can be obtained from a wide variety of sources such as, but not limited to libraries of synthetic or natural compounds. Synthetic compound libraries may be commercially available from, for example, Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, N. J.), Brandon Associates (Merrimack, N. H.), and Microsource (New Milford, Conn.), Aldrich Chemical Company, Inc. (Milwaukee, Wis.). Natural compound libraries comprising bacterial, fungal, plant or animal extracts are available from, for example, Pan Laboratories (Bothell, Wash.). In addition, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides.

Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts may be produced. Methods for the synthesis of molecular libraries are readily available (see, e.g., DeWitt et al., 1993, Proc. Natl. Acad. Sci. USA 90:6909; Erb et al., 1994, Proc. Natl. Acad. Sci. USA 91 :1 1422; Zuckermann et al., 1994, J. Med. Chem. 37:2678; Cho et al., 1993, Science 261 :1303; Carell et al., 1994, Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al., 1994, Angew. Chem. Int. Ed. Engl. 33:2061 ; and Gallop et al., 1994, J. Med. Chem. 37:1233). In addition, natural or synthetic compound libraries and compounds can be readily modified through conventional chemical, physical and biochemical means (see, e.g., Blondelle et al., 1996, Trends in Biotech. 14:60), and may be used to produce combinatorial libraries. In another approach, previously identified pharmacological agents can be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, and the analogs can be screened for TERT-modulating activity. Numerous methods for producing combinatorial libraries are known in the art, including those involving biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the ^"one-bead one- compound^" library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide or peptide libraries, while the other four approaches are applicable to polypeptide, peptide, non-peptide oligomer, or small molecule libraries of compounds (K. S. Lam, 1997, Anticancer Drug Des. 12:145).

A variety of other reagents may be included in the screening assay. These include reagents like salts, neutral proteins (e.g., albumin, detergents, etc.), which are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may be used. The components are added in any order that produces the requisite binding. Incubations are performed at any temperature that facilitates optimal activity, typically between 4⁰C and 4O⁰C. Incubation periods are typically selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Normally, between 0.1 and 1 hours will be sufficient. Typically, a plurality of assay mixtures is run in parallel with different test agent concentrations to obtain a differential response to these concentrations. Typically, one of these concentrations serves as a negative control (i.e., at zero concentration or below the level of detection).

The designing of mimetics to a known pharmaceutically active compound is also a known approach to the development of pharmaceuticals based on a "lead" compound. This might be desirable where the active compound is difficult or expensive to synthesize or where it is unsuitable for a particular method of administration (e.g., peptides are generally unsuitable active agents for oral compositions as they tend to be quickly degraded by proteases in the alimentary canal). Mimetic design, synthesis, and testing are generally used to avoid large-scale screening of molecules for a target property.

When designing a mimetic, it is desirable to firstly determine the particular regions of the compound that are critical and/or important in determining the target property. In the case of a peptide, this can be done by systematically varying the amino acid residues in the peptide (e.g., by substituting each residue in turn). These parts or residues constituting the active region of the compound are known as its "pharmacophore". Once the pharmacophore has been found, its structure is modelled according to its physical properties (e.g., stereochemistry, bonding, size, and/or charge), using data from a range of sources (e.g., spectroscopic techniques, X-ray diffraction data, and NMR). Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms), and other techniques can be used in this modelling process. In a variant of this approach, the three dimensional structure of the compound and its binding partner are modelled. This can be especially useful where the compound and/or binding partner change conformation on binding, allowing the model to take account of this in the design of the mimetic. A template molecule is then selected, and chemical groups that mimic the pharmacophore can be grafted onto the template. The template molecule and the chemical groups grafted on to it can conveniently be selected so that the mimetic is easy to synthesize, is likely to be pharmacologically acceptable, does not degrade in vivo, and retains the biological activity of the lead compound. The mimetics found are then screened to ascertain the extent they exhibit the target property, or to what extent they inhibit it. Further optimization or modification can then be carried out to arrive at one or more final mimetics for in vivo or clinical testing.

In another aspect of the present invention, there is provided a test compound determined by the screening method as herein described as being capable of modulating BMP-mediated repression of TERT expression.

In another aspect of the present invention, there is provided a prophylactic or therapeutic method of treating a subject at risk of or susceptible to a disorder or having a disorder associated with undesirable cell proliferation, the method including administering to the subject a BMP, or a biologically active fragment or variant thereof.

In some embodiments, the prophylactic or therapeutic method comprises the steps of administering a BMP, or a biologically-active fragment or variant thereof (as herein described), to a subject who has a disease, a symptom of disease or predisposition toward a disease associated with undesired cell proliferation, as hereinbefore described, for the purpose to cure, heal alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, the symptoms of the disease, or the predisposition towards the disease. In some embodiments, the prophylactic or therapeutic method comprises the steps of administering a BMP, or a biologically-active fragment or variant thereof (as herein described), to an isolated tissue or cell obtained from a subject who has a disease, a symptom of disease or predisposition toward a disease associated with undesired cell proliferation and/or activity, as hereinbefore described, and reintroducing said tissue or cell into the subject for the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, the symptoms of the disease, or the predisposition towards the disease.

The subject methods may find use in the treatment of a variety of different conditions in which modulation of TERT expression in a host cell (e.g., enhancing or decreasing TERT expression) is desired. By treatment is meant that at least an amelioration of the symptoms associated with the condition afflicting the host is achieved, where amelioration is used in a broad sense to refer to at least a reduction in the magnitude of a parameter, e.g. symptom (such as inflammation), associated with the condition being treated. As such, treatment also includes situations where the pathological condition, or at least symptoms associated therewith, are completely inhibited, e.g. prevented from happening, or stopped [e.g. terminated), such that the host no longer suffers from the condition, or at least the symptoms that characterize the condition.

A variety of hosts are treatable according to the subject methods. Generally such hosts are "mammals" or "mammalian," where these terms are used broadly to describe organisms which are within the class mammalia, including the orders carnivore {e.g., dogs and cats), rodentia {e.g., mice, guinea pigs, and rats), and primates {e.g., humans, chimpanzees, and monkeys). In some embodiments, the hosts will be humans.

In some embodiments, the invention provides methods of treating conditions or disorders resulting undesirable {e.g., unwanted) TERT expression and/or activity. Representative conditions or disorders for each category are herein described.

In some embodiments, the condition or disorder that may be treated according to the invention is Progeria, or Hutchinson-Gilford syndrome. This condition is a disease of shortened telomeres for which no known cure exists. It afflicts children, who seldom live past their early twenties. In many ways progeria parallels aging itself. However, these children are born with short telomeres. Their telomeres do not shorten at a faster rate - they are short to begin with. The methods of the invention can therefore be used in such conditions to further delay natural telomeric shortening and/or increase telomeric length, thereby treating this condition.

Another specific disease condition in which the subject methods find use is in immune senescence. The effectiveness of the immune system decreases with age. Part of this decline is due to fewer T-lymphocytes in the system, a result of lost replicative capacity. Many of the remaining T-lymphocytes experience loss of function as their telomeres shorten and they approach senescence. The methods of the invention may therefore be employed to inhibit immune senescence due to telomere loss. Because hosts with aging immune systems are at greater risk of developing pneumonia, cellulitis, influenza, and many other infections, the subject methods reduce morbidity and mortality due to infections.

In some embodiments, the condition or disorder that may be treated according to the invention is AIDS. HIV, the virus that causes AIDS, invades white blood cells, particularly CD4 lymphocyte cells, and causes them to reproduce high numbers of the

HIV virus, ultimately killing cells. In response to the loss of immune cells (typically about a billion per day), the body produces more CD8 cells to be able to suppress infection. This rapid cell division accelerates telomere shortening, ultimately hastening immune senescence of the CD8 cells. Anti-retroviral therapies have successfully restored the immune systems of AIDS patients, but survival depends upon the remaining fraction of the patient's aged T-cells. Once shortened, telomere length has not been naturally restored within cells. The subject methods may therefore be employed to restore this length and/or prevent further shortening. As such the subject methods can spare telomeres and is useful in conjunction with the anti-retroviral treatments currently available for HIV.

In some embodiments, the condition or disorder that may be treated according to the invention is cardiovascular disease. The methods can be employed to extend telomere length and replicative capacity of endothelial cells lining blood vessel walls. Endothelial cells form the inner lining of blood vessels and divide and replace themselves in response to stress. Stresses include high blood pressure, excess cholesterol, inflammation, and flow stresses at forks in vessels. As endothelial cells age and can no longer divide sufficiently to replace lost cells, areas under the endothelial layer become exposed. Exposure of the underlying vessel wall increases inflammation, the growth of smooth muscle cells, and the deposition of cholesterol. As a result, the vessel narrows and becomes scarred and irregular, which contributes to even more stress on the vessel. Aging endothelial cells also produce altered amounts of trophic factors (hormones that affect the activity of neighboring cells). These too contribute to increased clotting, proliferation of smooth muscle cells, invasion by white blood cells, accumulation of cholesterol, and other changes, many of which lead to plaque formation and clinical cardiovascular disease. By extending endothelial cell telomeres, the methods of the present invention can be employed to combat the stresses contributing to vessel disease. Many heart attacks may also be prevented if endothelial cells were enabled to continue to divide normally and better maintain cardiac vessels. The occurrence of strokes caused by the aging of brain blood vessels may also be significantly reduced by employing the methods of the present invention to help endothelial cells in the brain blood vessels to continue to divide and perform their intended function.

In some embodiments, the methods of the present invention may be used in skin rejuvenation. The skin is the first line of defence of the immune system and shows the most visible signs of aging. As it ages, the skin typically thins, develops wrinkles, discolours, and heals poorly. Skin cells divide quickly in response to stress and trauma; but, over time, there are fewer and fewer actively dividing skin cells. Compounding the loss of replicative capacity in aging skin is a corresponding loss of support tissues. The number of blood vessels in the skin decreases with age, reducing the nutrients that reach the skin. Also, aged immune cells less effectively fight infection. Nerve cells have fewer branches, slowing the response to pain and increasing the chance of trauma. In aged skin, there are also fewer fat cells, increasing susceptibility to cold and temperature changes. Old skin cells respond more slowly and less accurately to external signals. They produce less vitamin D, collagen, and elastin, allowing the extracellular matrix to deteriorate. As skin thins and loses pigment with age, more ultraviolet light penetrates and damages skin. To repair the increasing ultraviolet damage, skin cells need to divide to replace damaged cells, but aged skin cells have shorter telomeres and are less capable of dividing. Thus, by practicing the methods of the present invention (e.g., via administration of a BMP antagonist topically, one can extend telomere length, and slow the downward spiral that skin experiences with age. Such a product not only helps protect a person against the impairments of aging skin; it also permits rejuvenated skin cells to restore youthful immune resistance and appearance. The methods of the present invention may therefore be used for both medical and cosmetic skin rejuvenation applications.

In some embodiments, the condition or disorder in which the present invention finds use is in the treatment or prevention of osteoporosis. Two types of cells interplay in osteoporosis: osteoblasts make bone and osteoclasts destroy it. Normally, the two are in balance and maintain a constant turnover of highly structured bone. In youth, bones are resilient, harder to break, and heal quickly. In old age, bones are brittle, break easily, and heal slowly and often improperly. Bone loss has been postulated to occur because aged osteoblasts, having lost much of their replicative capacity, cannot continue to divide at the rate necessary to maintain balance (Hazzard et al. PRINCIPLES OF GERIATRIC MEDICINE AND GERONTOLOGY, 2d ed. McGraw-Hill, New York City, 1994). The present invention can be employed to lengthen telomeres of osteoblast and osteoclast stem cells, thereby encouraging bone replacement and proper remodeling and reinforcement. The resultant stronger bone improves the quality of life for the many sufferers of osteoporosis and provides savings from fewer fracture treatments. The present invention may be part of a comprehensive treatment regime that also includes calcium, estrogen, and exercise.

Additional disease conditions in which the subject methods find use are described in WO 99/35243, the disclosures of which are herein incorporated by reference.

In addition to the above-described methods, the present invention can also be used to extend the lifetime of a mammal. By extend the lifetime is meant to increase the time during which the animal is alive, where the increase is generally at least 1%, usually at least 5% and more usually at least about 10%, as compared to a control. As indicated herein, instead of a multicellular animal, the target may be a cell or population of cells which are treated according to the subject methods and then introduced into a multicellular organism for therapeutic effect. For example, the subject methods may be employed in bone marrow transplants for the treatment of cancer and skin grafts for burn victims. In these cases, cells are isolated from a human donor and then cultured for transplantation back into human recipients. During the cell culturing, the cells normally age and senesce, decreasing their useful lifespans. Bone marrow cells, for instance, lose approximately 40% of their replicative capacity during culturing. This problem is aggravated when the cells are first genetically engineered. In such cases, the therapeutic cells must be expanded from a single engineered cell. By the time there are sufficient cells for transplantation, the cells may have undergone the equivalent of 50 years of aging. Use of the methods of the present invention may spare the replicative capacity of bone marrow cells and skin cells during culturing and expansion and thus significantly improves the survival and effectiveness of bone marrow and skin cell transplants. Any transplantation technology requiring cell culturing can benefit from the subject methods, including ex vivo gene therapy applications in which cells are cultured outside of the animal and then administered to the animal, as described, for example, in U.S. patent nos. 6,068,837; 6,027,488; 5,824,655; 5,821 ,235; 5,770,580; 5,756,283; 5,665,350; the disclosures of which are herein incorporated by reference.

In some embodiments, the methods of the present invention may be used to repress TERT expression. In some embodiments, repression of TERT expression is meant a decrease in TERT expression by a factor of at least about 2-fold, typically at least about 5-fold and more usually at least about 10-fold, as compared to a control. Methods for repressing TERT expression find use in, among other applications, the treatment of cellular proliferative disease conditions, particularly abnormal cellular proliferative disease conditions, including, but not limited to, neoplastic disease conditions (e.g., cancer). In such applications, an effective amount of BMP, or a biologically-active fragment or variant thereof (as herein described), a vector encoding a BMP, an agent that enhances BMP-mediated repression of TERT expression, etc., is administered to the subject in need thereof. Treatment is used broadly as defined above, e.g., to include at least an amelioration in one or more of the symptoms of the disease, as well as a complete cessation thereof, as well as a reversal and/or complete removal of the disease condition {e.g., cure).

With regards to both prophylactic and therapeutic methods of treatment, such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics. "Pharmacogenomics", as used herein, preferably refers to the application of genomics technologies such as gene sequencing, statistical genetics, and gene expression analysis to drugs in clinical development and on the market. More preferably, the term refers to the study of how a patient's genes determine his or her response to a drug (e.g., a patient's "drug response phenotype", or "drug response genotype"). Thus, another aspect of the present invention provides methods for tailoring an individual's prophylactic or therapeutic treatment with either the BMP of the present invention or agents that modulate BMP-mediated repression of TERT expression and/or activity (such as those identified by screening assays as herein described), according to that individual's drug response genotype. Pharmacogenomics allows a clinician or physician to target prophylactic or therapeutic treatments to patients who will most benefit from the treatment and to avoid treatment of patients who will experience toxic drug-related side effects. If the expression and/or activity of TERT in a cell is reduced compared to a normal cell, several therapeutic approaches are available. In one preferred approach, the therapeutic agent administered to a subject is a BMP inhibitor compound (antagonist, as hereinbefore described), along with a pharmaceutically acceptable carrier, in an amount effective to inhibit BMP-mediated repression of TERT expression and/or activity, and thereby cure, heal alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, the symptoms of the disease, or the predisposition towards the disease. A BMP antagonist may also include antibodies or antigen-binding fragments thereof (including, for example, polyclonal, monoclonal, humanized, anti-idiotypic, chimeric or single chain antibodies, and FAb, F(ab')₂ and FAb expression library fragments, scFV molecules, and epitope-binding fragments thereof), oligonucleotides or BMP fragments (that compete with BMP but have no or a lower biological activity as compared to native BMP) or other small molecules that bind to a native BMP and inhibit its biological activity.

The antagonist may also take the form of a compound that affects the target cell such that the target cell is modified and is no longer responsive to BMP or is less responsive to BMP. Here, the treatment is not directed to BMP per se, but on the target cell.

Conditions in which BMP-mediated repression of TERT expression is in excess, and where it is therefore desirable to enhance TERT expression and/or activity, may be identified by those skilled in the art by any or a combination of diagnostic or prognostic assays known in the art. For example, a biological sample obtained from a subject {e.g. blood, serum, plasma, urine, saliva, and/or cells derived therefrom) may be analysed for TERT expression and/or activity, as hereinbefore described. Such conditions include, but are not limited to, progeria, atherosclerosis, cardiovascular diseases, osteoarthritis, osteoporosis, Alzheimer's disease, macular degeneration, liver cirrhosis, rheumatoid arthritis, AIDS or HIV infection, autoimmune disease, muscular dystrophy, wound healing, hair loss, photo-damaged skin and transplantation. Thus, in some embodiments, the prophylactic and therapeutic methods of treatment of such conditions or disorders.

For treating conditions in which it is desirable to decrease TERT expression and/or activity, several approaches are also available. In some embodiments, the therapeutic agent administered to a subject is a recombinant BMP polypeptide or compounds identified by the aforementioned screening assays that are capable of activating endogenous BMP expression and/or activity (i.e., an agonist, as herein described), in combination with a pharmaceutically acceptable carrier, to thereby cure, heal alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, the symptoms of the disease, or the predisposition towards the disease. In some embodiments, such agonists include BMP polypeptides (and biologically-active fragments and variants thereof) and agents that are capable of binding native BMP to increase its biological activity. A BMP agonist may also include antibodies or antigen- binding fragments thereof (including, for example, polyclonal, monoclonal, humanized, anti-idiotypic, chimeric or single chain antibodies, and FAb, F(ab')₂ and FAb expression library fragments, scFV molecules, and epitope-binding fragments thereof) or other small molecules that bind to a native BMP and increase its biological activity.

An agonist is preferably employed for therapeutic and prophylactic purposes for conditions in which enhanced BMP-mediated repression of TERT expression is desirable, including, but not limited to, those associated with unwanted (i.e., undesirable) cell proliferation (such as cancer and tumour growth). In some embodiments, the agonist is employed for the treatment of cervical cancer.

Alternatively, gene therapy may be employed to effect the endogenous expression of BMP by a cell in a subject in need of such therapy, including, but not limited to, rats, mice, dogs, cats, cows, horses, rabbits, monkeys, and humans. For example, cells comprising a retroviral vector driving the expression of BMP, or a biologically-active fragment or variant thereof (as herein described), may be administered to a subject for engineering cells in vivo to express the recombinant BMP polypeptide in vivo. For overview of gene therapy, see, for example, Chapter 20, Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, (and references cited therein) in Human Molecular Genetics, Strachan T. and Read A. P., BIOS Scientific Publishers Ltd (1996).

Further, antisense and ribozyme molecules that inhibit expression of the target gene can also be used in accordance with the present invention to reduce the level of BMP gene expression. Still further, triple helix molecules can be utilized in reducing the level of BMP gene expression.

As used herein, the term "antisense" typically refers to a nucleotide sequence that is complementary to a nucleic acid encoding BMP, or a fragment or variant thereof, as hereinbefore described (e.g., complementary to the coding strand of the double- stranded cDNA molecule or complementary to the mRNA sequence encoding BMP, or a fragment or variant thereof). The antisense nucleic acid is typically complementary to an entire BMP coding strand, or to only a portion thereof. In some embodiments, the antisense nucleic acid molecule is antisense to a "non-coding region" of the coding strand of a nucleotide sequence encoding BMP, or a fragment or variant thereof (e.g., the 5' and 3' untranslated regions).

An antisense nucleic acid can be designed such that it is complementary to the entire coding region of BMP, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or non-coding region of BMP mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of BMP mRNA. An antisense oligonucleotide can be, for example, about 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more nucleotides in length.

An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids {e.g., phosphorothioate derivatives and acridine substituted nucleotides) can be used. The antisense nucleic acid also can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).

In some embodiments of the present invention, BMP short interfering nucleic acid molecules (siRNA) that inhibit expression of BMP can also be used in accordance with the invention to reduce the level of BMP-mediated repression of TERT expression.

The term "BMP short interfering nucleic acid", "BMP siNA", "BMP short interfering RNA", "BMP siRNA", "BMP short interfering nucleic acid molecule", "BMP short interfering oligonucleotide molecule", or "chemically-modified BMP short interfering nucleic acid molecule", as used herein, typically refer to any nucleic acid molecule capable of inhibiting or down-regulating BMP gene expression, for example, by mediating RNA interference ("RNAi") or gene silencing in a sequence-specific manner. Chemical modifications can also be applied to any siNA sequence of the present invention. For example, the siNA can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to a nucleotide sequence encoding BMP or a portion thereof and the sense region having a nucleotide sequence corresponding to a nucleotide sequence encoding BMP or a portion thereof. The siNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e. each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure, for example, wherein the double stranded region is about 19 base pairs); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence encoding BMP or a portion thereof and the sense strand comprises nucleotide sequence corresponding a nucleotide sequence encoding BMP or a portion thereof. Alternatively, the siNA is assembled from a single oligonucleotide, where the self- complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s). The siNA can be a polynucleotide with a hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to a nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having a nucleotide sequence corresponding to a nucleotide sequence encoding BMP or a portion thereof. The siNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to a nucleotide sequence encoding BMP or a portion thereof and the sense region having a nucleotide sequence corresponding to a nucleotide sequence encoding BMP or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi. The siNA can also comprise a single stranded polynucleotide having a nucleotide sequence complementary to a nucleotide sequence encoding BMP or a portion thereof (for example, where such siNA molecule does not require the presence within the siNA molecule of a nucleotide sequence corresponding to a nucleotide sequence encoding BMP or a portion thereof), wherein the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5'-phosphate or a 5',3'-diphosphate. In some embodiments, the siNA molecule of the present invention comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der Waals interactions, hydrophobic interactions, and/or stacking interactions. In a further embodiment, the siNA molecule of the present invention comprises a nucleotide sequence that is complementary to a nucleotide sequence encoding BMP or a portion thereof. In another embodiment, the siNA molecule of the present invention interacts with a nucleotide sequence encoding BMP in a manner that causes inhibition of expression of the BMP gene. As used herein, siNA molecules need not be limited to those molecules containing only RNA, but further encompasses molecules comprising chemically-modified nucleotides or those in combination with non-nucleotides. In some embodiments, the siNA molecule of the present invention lacks 2'-hydroxy (2'-OH) containing nucleotides. Such siNA molecules that do not require the presence of ribonucleotides within the siNA molecule to support RNAi can, however, have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups. Optionally, siNA molecules of the present invention can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. The modified siNA molecules of the invention can also be referred to as short interfering modified oligonucleotides "siMON." As used herein, the term siNA is typically meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post- transcriptional gene silencing RNA (ptgsRNA), translational silencing, and others. In addition, as used herein, the term RNAi is preferably meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, or epigenetics. For example, siNA molecules of the invention can be used to epigenetically silence genes at both the post-transcriptional level or the pre-transcriptional level. In a non-limiting example, epigenetic regulation of BMP gene expression by siNA molecules of the present invention can result from siNA- mediated modification of the chromatin structure to alter BMP gene expression.

The antisense and short interfering RNA molecules of the present invention are typically administered to a subject {e.g., by direct injection at a tissue site), or generated in situ such that they hybridise with or bind to cellular mRNA and/or genomic DNA encoding BMP to thereby inhibit expression of said BMP (e.g., by inhibiting transcription and/or translation). Alternatively, the molecules can be modified to target selected cells and then administered systemically. For systemic administration, antisense or siRNA molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface {e.g., by linking the molecules to peptides or antibodies that bind to cell surface receptors or antigens). The molecules can also be delivered to cells using vectors, or by viral mechanisms (such as retroviral or adenoviral infection delivery). To achieve sufficient intracellular concentrations of the molecules, vector constructs in which the molecule is placed under the control of an appropriate promoter.

In some embodiments, the antisense nucleic acid molecule of the present invention is an α-anomeric nucleic acid molecule. An α-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual α-units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15:6625-6641 ). The antisense nucleic acid molecule can also comprise a 2'-o-methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215:327-330).

In some embodiments, an antisense nucleic acid of the invention is a ribozyme. A ribozyme having specificity for BMP-encoding nucleic acid molecules can include one or more sequences complementary to the nucleotide sequence of BMP cDNA disclosed herein, and a sequence having known catalytic sequence responsible for mRNA cleavage (see U.S. Pat. No. 5,093,246 or Haselhoff and Gerlach (1988) Nature 334:585-591 ). For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a BMP-encoding mRNA (see, e.g., Cech et al. U.S. Pat. No. 4,987,071 ; and Cech et al. U.S. Pat. No. 5,1 16,742). Alternatively, BMP mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules (see, e.g., Bartel, D. and Szostak, J. W. (1993) Science 261 :1411-1418).

In some embodiments, BMP-mediated repression of TERT expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the BMP {e.g., a BMP promoter and/or enhancers) to form triple helical structures that prevent transcription of the BMP gene in target cells (see generally, Helene, C. (1991 ) Anticancer Drug Des. 6(6):569-84; Helene, C. et al. (1992) Ann. N. Y. Acad. Sci. 660:27-36; and Maher, L. J. (1992) Bioassays 14(12):807-15). The potential sequences that can be targeted for triple helix formation can be increased by creating a so-called "switchback" nucleic acid molecule. Switchback molecules are synthesized in an alternating 5'-3\ 3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizeable stretch of either purines or pyrimidines to be present on one strand of a duplex.

The antisense molecules may also be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acid molecule can be modified to generate peptide nucleic acids (see Hyrup B. et al. (1996) Bioorganic & Medicinal Chemistry 4 (1 ): 5-23). As used herein, the terms "peptide nucleic acid" or "PNA" refers to a nucleic acid mimic (e.g., a DNA mimic), in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of a PNA can allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup B. et al. (1996) supra; Perry-O'Keefe et al. Proc. Natl. Acad. ScL 93:14670-675.

PNAs of BMP nucleic acid molecules can be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, for example, inducing transcription or translation arrest or inhibiting replication. PNAs of BMP nucleic acid molecules can also be used in the analysis of single base pair mutations in a gene

(e.g., by PNA-directed PCR clamping); as ^"artificial restriction enzymes^" when used in combination with other enzymes, (e.g., S1 nucleases (Hyrup B. (1996) supra)); or as probes or primers for DNA sequencing or hybridization (Hyrup B. et al. (1996) supra;

Perry-O'Keefe supra).

In some embodiments, the antisense molecules may comprise other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl. Acad.

ScL USA 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. ScL USA 84:648-652;

PCT Publication No. WO88/09810) or the blood-brain barrier (see, e.g., PCT

Publication No. WO89/10134). In addition, antisense molecules can be modified with hybridization-triggered cleavage agents (See, e.g., Krol et al. (1988) BioTechniques

6:958-976) or intercalating agents. (See, e.g., Zon (1988) Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule, (e.g., a peptide, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent).

It is possible that the use of antisense, siRNA, ribozyme, and/or triple helix molecules to reduce or inhibit mutant gene expression can also reduce or inhibit the transcription

(triple helix) and/or translation (antisense, ribozyme) of BMP mRNA produced by normal target gene alleles, such that the concentration of normal target gene product present can be lower than is necessary for a normal phenotype. In such cases, nucleic acid molecules that encode and express target gene polypeptides exhibiting normal target gene activity can be introduced into cells via gene therapy methods.

Another method by which nucleic acid molecules may be utilized in treating or preventing a disease characterized by undesired TERT expression and/or activity is through the use of aptamer molecules specific for BMP. Aptamers are nucleic acid molecules having a tertiary structure which permits them to specifically bind to protein ligands (see, e.g., Osborne, et al. (1997) Curr. Opin. Chem. Biol. 1 (1 ):5-9; and Patel, D. J. (June 1997) Curr. Opin. Chem. Biol. 1 (1 ):32-46). Since nucleic acid molecules may in many cases be more conveniently introduced into target cells than therapeutic protein molecules may be, aptamers offer a method by which BMP-mediated repression of TERT expression may be specifically increased without the introduction of drugs or other molecules which may have pluripotent effects.

In conjunction with the treatment of diseases or conditions associated with undesired TERT expression and/or activity, pharmacogenomics (i.e., the study of the relationship between an individual's genotype and that individual's response to a foreign compound or drug) may also be considered. Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drug. Thus, a physician or clinician may consider applying knowledge obtained in relevant pharmacogenomics studies in determining whether to administer a therapeutic agent to modulate BMP-mediated repression of TERT expression, as well as tailoring the dosage and/or therapeutic regimen of such treatment.

Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons. See, for example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol. Physiol.

23(10-11 ):983-985 and Under, M. W. et al. (1997) Clin. Chem. 43(2):254-266. In general, two types of pharmacogenetic conditions can be differentiated. Genetic conditions transmitted as a single factor altering the way drugs act on the body (altered drug action) or genetic conditions transmitted as single factors altering the way the body acts on drugs (altered drug metabolism). These pharmacogenetic conditions can occur either as rare genetic defects or as naturally-occurring polymorphisms.

One pharmacogenomic approach to identifying genes that predict drug response, known as "a genome-wide association", relies primarily on a high-resolution map of the human genome consisting of already known gene-related markers (e.g., a "bi-allelic" gene marker map which consists of 60,000-100,000 polymorphic or variable sites on the human genome, each of which has two variants). Such a high-resolution genetic map can be compared to a map of the genome of each of a statistically significant number of patients taking part in a Phase I I/I 11 drug trial to identify markers associated with a particular observed drug response or side effect. Alternatively, such a high- resolution map can be generated from a combination of some ten million known single nucleotide polymorphisms (SNPs) in the human genome. As used herein, a "SNP" is a common alteration that occurs in a single nucleotide base in a stretch of DNA. For example, a SNP may occur once per every 1000 bases of DNA. A SNP may be involved in a disease process, however, the vast majority may not be disease- associated. Given a genetic map based on the occurrence of such SNPs, individuals can be grouped into genetic categories depending on a particular pattern of SNPs in their individual genome. In such a manner, treatment regimens can be tailored to groups of genetically similar individuals, taking into account traits that may be common among such genetically similar individuals.

Alternatively, a method termed the "candidate gene approach" can be utilized to identify genes that predict drug response. According to this method, if a gene that encodes a drug's target is known (e.g., BMP), all common variants of that gene can be fairly easily identified in the population and it can be determined if having one version of the gene versus another is associated with a particular drug response.

Alternatively, a method termed the "gene expression profiling" can be utilized to identify genes that predict drug response. For example, the gene expression of an animal dosed with a drug (e.g., a BMP molecule or a modulator of BMP-mediated repression of TERT expression according to the present invention) can give an indication whether gene pathways related to toxicity have been turned on. Information generated from more than one of the above pharmacogenomic approaches can be used to determine appropriate dosage and treatment regimens for prophylactic or therapeutic treatment of an individual. This knowledge, when applied to dosing or drug selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic or prophylactic efficiency when treating a subject with a therapeutic agent as hereinbefore described.

Monitoring the influence of agents {e.g., drugs) on the expression and/or activity of BMP or on the activity of BMP-mediated repression of TERT expression can be applied in clinical trials. For example, the effectiveness of a compound, identified by a screening assay as described herein, to increase BMP expression and/or activity or on the activity of BMP-mediated repression of TERT expression can be monitored in clinical trials of subjects exhibiting decreased BMP-mediated repression of TERT expression. Alternatively, the effectiveness of an agent determined by a screening assay to decrease BMP expression and/or activity can be monitored in clinical trials of subjects exhibiting increased BMP-mediated repression of TERT expression. In such clinical trials, the expression and/or activity of BMP or TERT can be used as a "read out" or markers of the phenotype of a particular cell.

It would also be well appreciated by one skilled in the art that the methods of treatment hereinbefore described could be used in any number of combinations with each other, or with other treatment regimes currently employed in the art.

In some embodiments, the disorder associated with undesirable cell proliferation is cervical cancer.

In some embodiments, the BMP is BMP7.

In another aspect of the present invention, there is provided use of a BMP in the manufacture of a medicament for use in prophylaxis or treatment of a subject at risk of or susceptible to a disorder or having a disorder associated with undesirable cell proliferation, the method including administering to the subject a BMP, or a biologically active fragment or variant thereof.

EXAMPLES

Example 1 : Materials and Methods A. Cytokines, gene expression plasmids and antibodies.

Human recombinant Bone Morphogenetic Protein (BMP) 2, 4, 5, 6, and 7 were from R & D systems (Minneapolis, MN, USA). Smad3 siRNA and control siRNA were from Ambion (Austin, TX, USA), c-myc and relevant control siRNAs were from Cellogenetic. Plasmid pEGFP-C1 , pEGFP-C1-hTERT, and pEGFPC1-hTERT shRNA were produced in this laboratory. For hTERT shRNA, the oligonucleotide (5'- AATTCAAAAAGGGTCTTTCTACCAGAGGTGCTTCTCTTGAAATCATCTCTGGTAGC AAGACC-3) was annealed and cloned to the EcoR1 site downstream of the U6 promoter. All plasmids were verified by DNA sequencing. The primary antibodies of mouse anti-c-myc, mouse anti-p53 and mouse anti-p21 were from Santa Cruz Biotechnology, CA, USA, rabbit anti-p16 from Cell Signaling Technology, MA, USA, mouse anti-actin from Chemicon, and horseradish peroxidase-coupled second antibodies from Dako.

B. Cell culture and treatment.

Human cervical cancer HeLa cells were grown in 5% CO2 atmosphere at 37°C in Dulbecco's modified Eagle's medium (Invitrogen) containing 10% fetal bovine serum in 6-well plastic plates or 10-cm dishes (Nunc, Naperville, CT, USA). Recombinant BMP proteins at concentrations of 0.1 , 0.3, 3, 10 and 30 ng/ml were added to cell cultures for various periods of time as indicated in individual experiments, in which the serum concentration was 0.5% in the cell culture medium. Cells were lysed in ice cold CAHPS lysis buffer (0.5% (3-[(Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) 10 mM Tris, pH 7.5, 1 mM MgCI2, 1 mM EGTA, 0.1 mM benzamidine, 5 mM β-mercaptoethanol, 10% glycerol), in the presence of complete mini protease inhibitors (Roche Diagnostic, Australia). Clarified cell lysates were normalized for total protein concentrations by the Bradford protein assay (Bio-Rad). To reverse BMP7 inhibition of telomerase, the GFPhTERT was expressed by transfection with pEGFP-C2-hTERT plasmid, with pEGPF-C2 plasmid as control. Cell transfection was conducted using Lipofectamine-2000 (Invitrogen) according to the manufacturer's instruction. After 24 hours of transfection, cells positive for GFP were isolated by FACS, cultured and incubated with BMP2, 4, 5, 6 or 7 for different periods of time and analysed in Western blotting, semi-quantitative RTPCR for gene expressions, telomerase activity assay and cell death analysis, as indicated in individual experiments.

Human breast cancer MCF-7 cell line was grown in 5% CO₂ atmosphere at 37°C in Dulbecco's modified Eagle's medium (Invitrogen) containing 0.5% fetal bovine serum in 6-well plastic plates or 10-cm dishes. Cells were treated with purified recombinant cytokines at different concentrations added into culture medium in a one tenth volume for 1-4 days. Pulsatile chronic treatment was carried out by incubating cultured cells with BMP7 for 15 hours followed by replacing with fresh medium and further cultures of two days. The treatment was repeated in two days continuously for two weeks. Cell transfection was conduced using Lipofectamine-2000 (Invitrogen) according to the manufacturer's instruction. After a 24-hr transfection, GFP transfected cells were sorted using FACSAria flow cytometer (BD Biosciences, San Jose, CA). The GFP positive cells were re-seeded into 6-well plates at a density of 0.2 X 106 cells/ml in DMEM plus 10% FBS including Gentamicin antibiotics (Pfizer, Australia). Cells were treated with cytokines for different periods and analysed in Western blotting and semi-quantitative RT-PCR analysis to detect gene expressions as indicated in individual experiments. For subcellular distribution between cytoplasm and nucleus, cell fractionation was performed by differential centrifugation.

C. Fluorescence-activated cell sorting (FACS)

GFP transfected cells were sorted using FACSAria flow cytometer (BD Biosciences, San Jose, CA). The GFP positive cells were re-seeded into 6-well plates at a density of 0.2 X 106 cells/ml in DMEM plus 10% FBS including Gentamicin antibiotics (Pfizer, Australia). For apoptosis analysis, following treatment of cells as indicated in individual experiments, cells were dislodged from tissue culture plates using 0.5M EDTA for 5 minutes at 37°C and incubated with annexin-V-FLUOS conjugate (Roche Diagnostic, Australia) and propidium iodide (Sigma) for 15 min at room temperature in an incubation buffer that facilitates binding per the manufacturers' instructions. The cells were then analyzed using FL-2 and FL-3 channel, respectively. Percentages of stained apoptotic cells were determined using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA). An acquisition gate was set to include -20,000 of the centrally located cells for each sample acquisition using linear forward scatter versus linear side scatter. This acquisition strategy resulted in -40,000 ungated events being included for each sample analysis. Dotplot integration was determinate from the background fluorescence using unstained HeLa cells. This integration cursor placement remained unchanged when stained HeLa cells were analyzed.

D. Preparation of protein extracts and Western blotting

These procedures were described previously (30). Briefly, tumor cells were treated by CHAP lysis buffer including protein inhibitors (Roche Diagnostic, Australia), at 4°C and homogenized immediately. The lysates were incubated for 10 min on ice and then centrifuged for 45 minutes at 5,000 x RPM, then centrifuged again for 30 minutes at 13,000 RPM. The supernatants were collected and stored at -80oC. Extracted proteins (-25 μg) in SDS sample buffer were boiled and electrophoresed on a 10% SDS- polyacrylamide gel, and electroblotted onto a pre-wet nitrocellulose membrane (BioRad Laboratories, Australia). The blotted nitrocellulose membrane was blocked in PBS containing 5% skim milk and 0.02% Tween-20, and probed with antibodies as indicated in individual experiments at 4°C overnight. The blots were developed using ECL Western blotting detection system (Amersham Biosciences, England).

E. RNA isolation and gene expression analysis As previously described (Li et al., 2006, J Biol Chem 281 :25588-600), total RNA was extracted by TRIzol reagent (Invitrogen, Australia) according to the manufacturer's instructions. The RNA (1 μg) was transcribed by oligo(dT) and ThermoScript™ Reverse Transcriptase (Invitrogen) in a volume of total 21 μl. Contaminants were removed from the samples by Rnase H treatment, according to manufacturer's instruction (Invitrogen). Linear amplification for semi-quantitative PCR was performed using ThermoScript RT-PCR kit following the manufacturer's instruction (Invitrogen), for 25-35 cycles of 30 second at 72°C as the optimized annealing temperature and 64°C extension. Primers specific for different genes were: hTERT (5'- CCACCTTGACAAAGTACAG-3') and (δ'-CGTCCAGACTCCGCTTCAT-S'), Smad3 (δ'CCGAATCCGATGTCCCCS') and (5'CCCCTCCGATGTAGTAGAGCC3'), and Actin (5'-GCTCGTCGTCGACAACG GCTC-3') and (5'-

CAAACATGATCTGGGTCSTCTTCTC-3'). Actin was used as control. PCR produces were mixed with 6X loading dye (30% glycerol, 0.5 M EDTA, Bromophenol Blue) and run on 1.5% Agarose gel, visualized in the presence of ethidium bromide, photographed in a gel 1000 ultraviolet documentation system (Bio-Rad), and analyzed by densitometry.

F. Cell senescence and apoptosis analysis β-Galactosidase staining was performed for cell senescence by incubation cells with 2 ml of staining solution (1 mg/ml X-gal, 40 mM citric acid/Na phosphate buffer, pH 6.0, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCI, and 150 mM

MgCI). The stained plates were wrapped with parafilm to protect against pH changes and incubated overnight at 37°C. The cells were rinsed and stored in PBS, and analyzed by microscopy (Nikon). Apoptotic cells were analyzed a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA), by incubating with annexin-V-FLUOS conjugate (Roche Diagnostic, Australia) and propidium iodide (Pl) (Sigma) for 15 min at room temperature. Samples were then analyzed using FL-2 and FL-3 channel respectively. An acquisition gate was set to include -20,000 of the centrally located cells for each sample acquisition using linear forward scatter versus linear side scatter. This acquisition strategy resulted in -40,000 ungated events being included for each sample analysis.

G. Luciferase gene reporter assay

The p(CAGA)13 Luc TGF-β-inducible luciferase reporter construct (0.5 μg) was transfected into cultured breast cancer cells to determine Smad3 signaling as described previously (Li et al., 2006, J Biol Chem 281 :25588-600). Briefly, cells were co-transfected with Renilla luciferase and control reporter (pRL-TK) for 48 hour. During the last 24 hours of 48 hour transfection, cells were treated with different cytokines indicated in individual experiments. The dual-luciferase assay was analysed using Wallac Victor Light plate reader (Perkin-Elmer, United States of America).

H. Telomerase activity assay

Telomerase activity was determined by TRAP as described previously (Li et al., 1997, J Biol Chem 272:16729-32). Briefly, cells treated with different reagents were washed and lysed by detaching and passing the cells though a 261 /2G needle attached to a 1 ml syringe in pre-chilled TRAP lysis buffer. Equal amounts of telomerase protein extract (0.4 μg) were incubated with telomeric DNA substrate and dNTP, and newly synthesized telomeric DNAs were observed following PCR using specific telomeric DNA primers and [0³²P]ATP (Amersham Biosciences), polyacrylamide slab gel electrophoresis and autoradiography. As an internal control of the PCR and loading, the primers NT(ATCGCTTCTCGGCCTTTT) and TSNT(AATCCGTCGAG CAGAGTTAAAAGGCCGAGAAGCGAT) were included in the reaction.

I. Telomere length analysis

For telomeres in cultured cells, metaphase spreads from cycling HeLa cells that were treated with or without BMP7 (30 ng/ml, 15 hours) three times per week for two weeks were generated using standard laboratory protocols. The slides of metaphase cells or tumor sections were fixed in 4% formaldehyde before treatment with acidified 1% pepsin solution, and hybridized with the probe solution (0.3μg/ml Cy3-conjugated [CCCTAA]3 PNA probe (Panagene, Daejeon, South Korea), 70% formamide, 2OmM Tris-HCI, pH 7.0, 1 % BSA). Washing was conducted in PBS/tween-20 with one high stringent wash at 57⁰C. DNA was counterstained with DAPI, visualized and captured using Nikon Eclipse TE2000 microscope, Plan Fluor 40^χ objective, DS-5MC CCD camera and NIS-Elements F 2.20 software (Nikon). Telomere images were captured with a Plan Fluor 100^χ oil-emersion objective, and individual telomere fluorescence was integrated using spot IOD analysis in the TFL-TeIo 2.2 program (gift from Dr. Peter Lansdorp, Vancouver) (Rufer et al., 1998, Nature Biotechnology 16:743-747). Images from at least 13 metaphase spreads from each data point were quantified before assembly of data in a standard spreadsheet program. At least 50 cell nuclei from each condition were analyzed.

J. Tumor cell growth analysis in soft agar

Tumor cell colonies were grown in soft agar to assess the effects of BMP7 on tumor growth in vitro. Two milliliters of mixture of 2X Dulbecco's Modified Eagle Medium (DMEM) containing 20% FBS were used to make 0.5% agar (base layer) with or without BMP7 in a 35 mm culture dish or 6-well plate. On top of the base layer was added a mixture of serum supplemented media and 0.35 % agar (2 ml) containing 2500 HeLa cells in the presence or absence of BMP7 (100 ng/ml or as indicated) (top layer). The dishes were kept in tissue culture incubator at 37°C and 5 % CO2 for 14 days to allow for colony formation and growth. All assays were performed in triplicates. The colony assay results were photographed or scanned after the plates were stained with Methylthiazolyldiphenyl-tetrazolium (MTT).

K. Tumor xenografting and treatment procedure

HeLa cells were xenografted in female nude mice (Balb/c Nude) (Animal Resources Centre ARC, Western Australia). Cultured monolayer cells were detached by trypsinization, washed in PBS, and counted. Approximately 10 x 106 cells were resuspended in 0.1 ml PBS and inoculated subcutaneously in the flank of the mice. Twenty-four hours after inoculation, BMPs and other reagents prescribed as indicated in individual experiments were administered into the xenografts on every second day. The development of xenograft tumors was measured with Vernier callipers before each treatment. The animals were sacrificed by carbon dioxide asphyxiation when tumor growth in the controls reached 20 mm in diameter. Immediately after culling, the tumors were removed, measured, snapfrozen in liquid nitrogen, and stored at -80oC for further analyses. The mice were maintained under specific pathogen-free conditions at constant temperature (-22⁰C) and humidity (-40%). Sterilized food and water were given ad libitum.

L. Tumor tissue sectioning and staining

Freshly dissected tumor samples were embedded in O. C. T. compound and frozen using isopentane cooled with liquid nitrogen. Five μm fresh-frozen sections were prepared and used to stain for the Ki67 antigen, a marker of cell proliferation.

Sections were fixed in 4% paraformaldehyde/10% sucrose, washed once in PBS and blocked with 5% bovine serum albumin (Sigma, Fraction V) for 30 min. Sections were incubated with polyclonal rabbit anti-Ki67 antibodies (Abeam, ab15580) at 4°C overnight at a 1 :400 dilution. Primary antibody was detected with Cy3-conjugated goat anti-rabbit antibodies (Chemicon) for 90 min at a 1 :200 dilution. Nuclei were stained with 0.5 μg/μl Hoechst 33258 (Sigma). The staining was visualised by fluorescence microscopy. Five random images within the tumor area were analysed in three sections, approximately 50 μm apart, for each treatment group.

M. Statistical analysis

Data were analyzed using student t-tests and a probability (P) value of less than 0.05 was considered statistically significant.

Example 2: BMP7 induces telomerase inhibition and telomere shortening in cultured cancer cells.

To investigate a potential role of the BMP family in telomerase activity, we examined effects of BMP2, BMP4, BMP5, BMP6 and BMP7 by spiking the medium of cancer cell cultures with purified recombinant human cytokines. Incubation of human cervical cancer HeLa cells with different concentrations of BMP7 for 48 hours resulted in significant inhibition of telomerase activity (Fig. ~\A). The maximal inhibition was approximately 85% inhibition of telomerase activity, achieved with the median inhibitory concentration (IC50) of BMP7 of 8 ± 0.6 ng/ml and the maximal inhibition at 35 ± 1.4 ng/ml (n=3) (Fig. 1 S). Incubations of the cells with BMP2, BMP4, BMP5 or BMP6 showed no significant inhibitory effect on telomerase activity (not shown). In the time course studies, BMP7 (10 ng/ml) induced telomerase inhibition in 24 hours of the treatment for about 3 days (Fig. 1 S). To determine the inhibitory effect on telomerase in other cancer cell type, we tested human breast cancer PMC42 cells with different concentrations of BMP7. As shown in Fig. 1 C, BMP7 induced significant inhibition of telomerase activity in a dose-dependent manner in PMC42 cells. To verify that the inhibition of telomerase activity in HeLa and breast cancer cells was at the levels of gene expression of human telomerase reverse transcriptase (hTERT), we measured hTERT mRNA by semi-quantitative RT-PCR. As shown in Fig. 1 D, BMP7 induced a significant down-regulation of hTERT gene expression in both HeLa and PMC42 cells. In addition, we noted that BMP7 also induced a significant down-regulation of the c- myc gene expression (Fig. 1 D). The inhibition of the c-myc gene expression was approximately 80% of control, and the inhibition of the hTERT gene expression was about 70% of the control (Fig. 1 D). To determine the effect of BMP7 on telomeres, we treated HeLa cells with 30 ng/ml of BMP7 for 15 hours each time on every second day for two weeks. The pulsatile treatments of cultured HeLa cells with BMP7 resulted in a sustained telomerase inhibition and significant shortening of telomeres as measured by quantitative fluorescence in situ hybridization (Q-FISH), using a specific telomeric DNA probe in cell metaphase spreads. As shown in Fig. 2A, BMP7 treatments of cultured HeLa cells caused a marked shift of the telomere fluorescence peak compared to the control. The size of telomeres in the control cells was ranged with a major peaks of greater than 100 frequencies between -300 and -1200 fluorescence unit. In contrast, the telomeres in the BMP7-treated cells were shown as a major peak with a relatively narrow range exhibiting between 100 and 1100 fluorescence unit. The highest frequency of telomere fluorescence in control cells occurred at 800-900 fluorescence unit, whereas the highest frequency of telomere fluorescence in BMP7-treated cells occurred at 500-600 fluorescence unit showing significantly shortened telomeres compared to the control (Fig. 2A). Analysing the mean telomere length in control and BMP7 treated cells showed that the mean telomere length in the BMP7-treated group was about 25% shorter than that in the controls (Fig. 2S). The fluorescence micrographs in Fig. 2C showed typical images of telomere fluorescence (yellow dots) in different sizes at the ends of chromosomes (blue) between control (left panel ) and BMP7-treated (right panel) HeLa cells.

Example 3: BMP7 induces cancer cell death by a mechanism largely dependent on hTERT gene repression.

To determine the functional consequence of BMP7-induced telomerase inhibition and telomere shortening, we examined the changes in cell number and apoptotic death in the cell cultures treated with or without different cytokines over a time course of several days. As shown in Fig. 3/\, whereas the cells underwent population doubling in the control group, a single dose treatment of HeLa cells with BMP7 (10 ng/ml) resulted in a marked reduction of total cell number. The reduction of cell number in the cell cultures treated with BMP7 was about 50% on each day of the controls treated with diluent,

BMP2, BMP4, BMP5 or BMP6, showing a complete arrest of cell population doubling by the presence of BMP7 (Fig. 3A). Treatment of the cells with different concentrations of BMP7 for 24 hours showed a concentration-dependent reduction of cell numbers

(not shown). To determine if BMP7 induces cancer cell apoptosis, we examined HeLa and PMC42 cells treated with or without BMP7 for the apoptotic markers of Annexin V and propidium iodide (Pl) staining by FACS. As shown in Fig. 3S, a single dose of

BMP7 treatment resulted in a significantly increase in HeLa cell apoptosis compared to controls (7 versus 17%). BMP7 also induced increased apoptosis in PMC42 cells (not shown). To investigate if BMP7-induced cell death is a consequence of hTERT gene repression and telomerase inhibition, we analyzed the effect of hTERT gene expression on BMP7-induced cell death in HeLa cell cultures. Under-expression of hTERT with hTERT shRNA for 48 hours mimicked the cell killing effect of BMP7 (Fig. 3S), whereas overexpression of hTERT for 24 hours before BMP7 treatment inhibited subsequent BMP7-induced cell death (Fig. 3S), suggesting that the pro-apoptotic effect of BMP7 is mediated in a significant part by hTERT repression. To further attest the role of hTERT in the BMP7-induced cell death, we transfected HeLa cells with GFP- hTERT, GFPhTERT shRNA or GFP-only gene expression plasmids, then isolated the GFP-positive transformants by FACS and treated the cells with BMP7 (10 ng/ml) for 24 hours. In these homogenously transfected cell cultures, we found that the expression of GFP-hTERT significantly decreased the levels of cell death induced by BMP7 (Fig. 3C, from 10 to 22% versus from 10 to 17%), corroborating that hTERT repression is required to a significant degree in BMP7-induced cell death. Consistently, down- regulation of hTERT with GFP-hTERT shRNA increased cell death above basal levels (Fig. 3C). Consistent with a significant role of telomerase inhibiting in mediating BMP7- induced apoptosis, BMP7 did not induce significant cell death in the telomerase- negative GM847 and Saos2 cell cultures (Fig. 3D). Verification of BMP7 receptors by Western blotting with specific antibodies confirmed the presence of both BMPR1A and BMPR2 receptors in Soas2 and HeLa cell lines, although BMPR1A was not detectable in GM847 cells (not shown).

Example 4: BMP7 inhibits tumor growth with hTERT gene repression and telomere shortening in mouse xenograft tumors.

To investigate if BMP7 inhibits tumor growth, we examined the effect of BMP7 on tumor cell anchorage-independent growth in soft agar assays. As shown in Fig. AA (left panel), numerous tumor colonies grew from the HeLa cell suspension under basal conditions. In the presence of BMP7, however, there was a dramatic inhibition of tumor colony formation and growth, resulting in less than 15% colonies of the control (Fig. AA). The inhibition was concentration dependent, with the IC50 and maximal inhibition concentrations being 4 ng/ml and 20 ng/ml respectively (Fig. AA, right panel). To attest the effect of BMP7 on tumor growth in vivo, we exploited the xenograft tumor model in immune deficient nude mice and carried out intra-tumor injection of different concentrations of BMP7 on every second day for two weeks. BMP7 markedly inhibited tumor growth compared to the controls (Fig. 46). Significant tumor growth inhibition was observed following the first one or two injections of 10 ng/ml of BMP7, with maximal inhibition observed after three injections (Fig. 4S). Inhibition was concentration-dependent, with the IC50 being -10 ng/ml and maximal inhibitory concentration of 30 ng/ml of BMP7 (Fig. 4C). The effective concentrations were comparable to that inducing telomerase inhibition (Fig. ^/\A). In two weeks of the treatment, BMP7 induced a maximal tumor growth inhibition by about 75% of the controls (Fig. 4C), while no significant inhibitory effect was observed on the tumors receiving BMP2, BMP4, BMP5 or BMP6 under the same experimental conditions (Fig. 4S). To determine the intermediate role of hTERT gene repression in the BMP7- induced tumor growth inhibition, we carried out under- and over-expression of hTERT in the xenograft tumors and determined the effect of BMP7 in different backgrounds of hTERT gene expression on tumor growth. Significant inhibitory effect on tumor growth was observed in the animals treated by intra-tumor injection of the hTERT shRNA expression plasmid (Fig. AD). Overexpression of wild type hTERT has no significant effect on tumor growth in the cohort receiving intra-tumor injection of hTERT expression plasmid. However, overexpression of hTERT significantly compromised the BMP7-induced inhibition of tumor growth, reversing tumor growth inhibition from 25% back to 70-80% of the control after two weeks of treatments (Fig. AD). Examinations of telomerase activity in the tumors treated with or without BMP7 showed that telomerase activity was almost completely inhibited in the tumor tissues treated with BMP7 for two weeks, in contrast to the controls and other groups receiving treatments with BMP2, BMP4, BMP5 or BMP6 (Fig. 5/1 & 6). To determine altered gene expressions, we found that BMP7 treatment rendered a marked inhibition of the endogenous hTERT gene expression after two weeks of treatment (Fig. 5C & D). In addition, BMP7 treatment also induced a significant inhibition of the oncogene c-myc gene expression (Fig. 5C & D), suggesting that BMP7 induces the repression of the hTERT gene through a transcription-dependent mechanism involving c-myc gene repression (30, 33). Furthermore, corresponding with a BMP7-triggerd deregulation of telomeres and its associated DNA damage response, we observed significant increases in the levels of p53 and p16 tumor suppressors in the tumors treated with BMP7 (Fig. 5C & D). The increases of p53 and p16 were significant compared to the control, reflecting an activation of the cell cycle checkpoints and arrest of the cell cycle (Fig. 5D). Examination of telomeres in the tumor tissues showed that the average telomere length in the tumors treated with BMP7 for two weeks was significantly shorter than that in the controls (Fig. 6/1 & S). The shortening of telomeres induced by the pulsatile treatment with BMP7 for two weeks was 25-30% of the controls. On the contrary, overexpression of hTERT resulted in lengthened telomeres in about 130% of the control (Fig. 6/1 & 6) in association with a significant reversal of BMP7-induced tumor growth arrest (Fig. 4D). Consistently with a functional consequence of telomere shortening, we observed a significant decrease of cell proliferation as indicated by Ki67 staining in BMP7-treated tumors. As shown in Fig. 6C & D, BMP7 elicited an inhibition of cell proliferation by approximately 60% as estimated in Ki67 staining on tumor tissue sections. These in vivo findings from the xenograft tumors mirrored the findings from cell culture studies, demonstrating that BMP7 triggered an intracellular signaling pathway leading to repressed gene expressions of c-myc and hTERT, increased gene expressions of cell cycle checkpoints, inhibition of telomerase activity, shortening of telomeres and cancer cell apoptosis.

Example 5: BMP7 induces pancreatic progenitor and vascular smooth muscle cell death.

Rat pancreatic progenitor (RINA12), vascular smooth muscle cells (WKY), and hypertensive vascular smooth muscle cells (SHR) were treated with BMP7 (10 ng/ml) or diluent as indicated for 24 hours. Cells were then stained with Annexin V and propidium iodide (Pl), and analyzed by FACS.

Incubation of rat pancreatic progenitor (RINA12), vascular smooth muscle cells (WKY), or hypertensive vascular smooth muscle cells (SHR) with BMP7 at 10 ng/ml for 24 hours resulted in a significant increase in Pl and Annexin V double positive cells (Figure 7). The effect of BMP7 on apoptosis of pancreatic stem cell progenitors, normal and hypertensive vascular smooth muscle cells suggest that BMP7 has a utility in inhibiting cell proliferation under the conditions of stem cell development and hyper proliferation including in vessel walls of hypertension. The results are consistent with BMP7 inhibition of telomerase activity, shortening of telomeres and precipitation of cell aging and death in cancer cell cultures.

Discussion

Telomere maintenance is critical in tumor cell immortalization. Here, the applicant reports that a bone morphogenetic protein (BMP7) inhibits telomerase activity that is required for telomere maintenance in cancer cells, namely cervical cancer cells.

Without being bound by theory, application of human recombinant BMP7 triggers a repression of the human telomerase reverse transcriptase (hTERT) gene, shortening of telomeres, and hTERT repression-dependent cervical cancer cell death. Continuous treatment of mouse xenograft tumors with BMP7, or silencing the hTERT gene, resulted in sustained inhibition of telomerase activity, shortening of telomeres and tumor growth arrest. Overexpression of hTERT lengthens telomeres and blocks BMP7-induced tumor growth arrest. Thus, without being bound by theory, BMP7 appears to negatively regulate telomere maintenance inducing cervical tumor growth arrest by a mechanism of inducing hTERT gene repression.

The maintenance of telomeres is critical for cancer cell proliferation particularly as telomeres are already very short in cancer cells. Thus, inhibition of telomere maintenance offers an important mechanism to inhibit cancer cell proliferation. In these examples, the applicant demonstrates that the cytokine BMP7 triggers an inhibition of telomere maintenance and cervical cancer cell growth arrest in vitro and in tumor xenografts. A single application of recombinant BMP7 produces a significant inhibition of telomerase activity critical in telomere maintenance in cultured cervical cancer HeLa cells. Continuous applications of BMP7 on every second day for two weeks in HeLa cell cultures or xenograft tumors result in a sustained depression of telomerase activity and shortening of telomeres. Consistently, BMP7 induces a gene expression pattern of decreased hTERT and c-myc, and increased p16 and p53. Furthermore, BMP7 induces inhibitions of cancer cell anchorage-independent growth in soft agar and xenograft tumor growth. These findings, together with the telomerase inhibitory effect confirmed in breast cancer cells, suggest that telomere homeostasis is subject to regulation by extracellular cytokines in which BMP7 plays a significant role in eliciting a negative regulation of telomere maintenance and cell proliferative capacity in cancer. Further, the present data suggest that BMP7 has utility as an anti-cancer agent by targeting cancer cell telomere maintenance.

The specificity of BMP7-induced inhibition of telomerase activity, telomere maintenance and cancer cell proliferation is demonstrated by testing different BMPs. The dose- dependent effect of BMP7, with an effective concentration within a physiologically relevant range, supports a specific effect of BMP7 mediated by BMP7 receptors on tumor cell surface. Time course studies that BMP7 inhibition of telomerase activity occurs in 24 hours of treatment further suggest that BMP7 inhibits telomerase activity by modifying specific programs of gene expression in the tumor cells. The data suggest that the effect of BMP7 on cancer cell apoptosis is mediated by a mechanism involving repression of the hTERT gene and inhibition of telomerase activity. Under-expression of hTERT mimics the cell killing effect of BMP7, whereas over-expression of hTERT significantly inhibits the BMP7-induced cell death. While future studies are required to investigate the mechanisms underlying BMP7-induced hTERT gene repression and telomere shortening, the findings that c-myc is down-regulated in association with hTERT down-regulation suggest that repression of c-myc contributes to the repression of the hTERT gene induced by BMP7. The applicant has also shown that BMP7 induces cervical cancer cell apoptosis. In addition, they have shown for the first time that BMP7 inhibits cervical tumor growth in vivo. Furthermore, the applicant has found that BMP7 inhibits telomerase activity and induces telomere shortening as a fundamental mechanism in BMP7-induced cell death. These data suggest that BMP7 serves a function to inhibit cancer cell proliferation by inducing intracellular signaling to counteract mitogenic stimulation of telomerase activity by factors such as c-myc. Endogenous BMP7 produced in cancer cells may therefore be a protective mechanism against oncogenic development, and reinforcement with exogenous recombinant BMP7 produces an imbalance in favor of BMP7 predominance by counterbalancing the actions of oncogenic growth factors and cytokines in extracellular microenvironment of cancer. BMP7-induced inhibition of telomerase activity and shortening of telomeres may therefore represent a powerful mechanism to intercept the process of immortalization of neoplastic cells that use telomerase to maintain telomeres. The applicant's findings that constant presence of high levels of BMP7 results in sustained telomerase inhibition and telomere shortening illustrate a novel model in cytokine therapeutic intervention of cancer development through targeting telomerase maintenance of telomeres.

It is currently thought that deregulation of telomeres instigates rapid cell death via mechanisms including telomere decapping and DNA damage response. In support of telomeric DNA damage response, the applicant has shown show that BMP7 induces increased p16 and p53 cell cycle checkpoint activities. Critical in tumor cell aging and death, increased p16 and p53 activities have previously been demonstrated to be involved in coupling telomere deregulation with cell senescent and apoptotic response. Thus, BMP7-induced cancer cell death may be prompted by a series of interchanges including telomerase inhibition, telomere shortening, telomere-associated DNA damage responses, and subsequent cell senescence and apoptosis.

In summary, the applicant's data demonstrate a novel mechanism of BMP7 negative regulation of telomere maintenance and cell proliferation in cancer by a mechanism of hTERT gene repression and telomerase inhibition in vitro and in vivo. The data suggest that telomeres undergo continuous remodelling which can be reprogramming by defined combinations of extracellular factors, with BMP7 serving as a major negative regulator. Example 6: BMP7 induces telomerase inhibition and telomere shortening in cultured breast cancer cells

To investigate a potential involvement of the BMP family in telomerase activity, we examined the effects of BMP2, BMP4, BMP5, BMP6 and BMP7 on telomerase activity by spiking the medium of cultured human breast cancer MCF-7 cells with purified recombinant human cytokines. Incubation of MCF-7 cells with different concentrations of BMP7 for 48 hours resulted in more than 70% inhibition of telomerase activity

(Figure 8a). The median inhibitory concentration (IC50) of BMP7 was 4 ± 0.5 ng/ml and maximal inhibitory concentration was 20 ± 0.8 ng/ml (n=3) (Figure 8a), concentrations that are within the levels of BMPs administered and observed in vivo.

In contrast to BMP7, incubations of the cells with BMP2, BMP4, BMP5 or BMP6 showed no significant inhibitory effect on the telomerase activity (Figure 8a). Consistent with a specific effect, BMP7 antibodies abrogated the inhibition, and denatured BMP7 had no effect (Figure 8b). BMP7 also elicited telomerase inhibition in a time-dependent manner (Figure 8a), with the inhibition occurring in about 24 hours and lasted for 2-3 days. In addition to inhibiting telomerase activity, BMP7 consistently induced a significant reduction in the size of telomeres. Pulsatile treatments of cultured MCF-7 cells with BMP7 (30 ng/ml) for 15 hours three times a week over two weeks resulted in significantly shortened telomeres (Figures 8c and d), as revealed by quantitative fluorescence in situ hybridization (Q-FISH) using a specific telomeric DNA probe in the metaphase cell spread preparations. As shown in Figure 8c, BMP7 treatments induced a marked shift of the peak of the telomere fluorescence intensity signals between the control and BMP7-treated groups. While the majority of the telomere sizes were distributed with high frequency at the 6-26 fluorescence units (peaking at 1 1 ) in the control cells, the peak of telomere signals was at the 6th fluorescence unit in the BMP7-treated group exhibiting much shorter telomeres than that in the control group. On average, the telomeres in the BMP7-treated group were 25-30% shorter than the telomeres in the normal control cells (Figures 8d and e). Thus, the data together demonstrated clearly that BMP7 induced inhibition of telomerase activity and shortening of telomeres in cultured human breast cancer cells.

Example 7: BMP7 induces tumor cell senescence and death by a mechanism dependent on telomerase inhibition With the signaling mechanisms of BMP7 from the cell surface to the nucleus, we treated cultured breast cancer cells with BMP7 overnight with repeats in every two-day for two weeks for observation of tumor cell senescence. In the BMP7 treated cell cultures, we observed the cells' characteristics of enlarged and flattened cell morphology, greater cytoplasm/nuclear ratio, and expressions of cell senescence markers such as β-galactosidase and p16. As shown in Figure 9a, treatment of MCF-7 cells with BMP7 (30 ng/ml) for 15 hours in every two-day for two weeks resulted in a marked increase in the incidence of cell senescence (Figure 9a). The increase in cell senescence in the BMP7-treated cultures was associated with reduced cell numbers (Figure 9b) and protein concentrations (not shown), decreased telomerase activity (Figure 9c). The inhibition of telomerase activity in these cells was by 60-70%. Staining of the MCF-7 cells treated with a single dose of BMP7 (10 ng/ml) also showed cell senescent characteristics of the enlarged cell bodies and increased p16, p53 and p21 (Figure 9d). The gene expression levels of p16, p53 and p21 were 2-5 folds of controls (Figure 9d). The cells treated with BMP7 stained positive for the β-galactosidase activity in 72 and 96 hours of BMP7 treatment (Figure 9e). Thus, our data showed that prolonged exposure to BMP7 induced tumor cell growth arrest, senescence and death. To explore BMP7 instigation of breast cancer cell apoptotic cell death, we stained the BMP7 treated cells with annexin V and propidium iodide (Pl), and analyzed double positive cells in fluorescence activated cell sorter (FACS). Incubation of MCF-7 cells with BMP7 (30 ng/ml) for 24 hours resulted in a significant increase in the percentage of annexin V- and Pl-positive cells (Figure 10a). The number of apoptotic cells in 24 hours of BMP7-treated cell cultures was doubled when compared to the basal levels in control group. To examine the involvement of telomerase inhibition in breast cancer cell apoptosis, we observed an increased response of apoptosis to the transient overexpression of Smad3 that is an hTERT gene repressor or to the transient expression of the hTERT shRNA to silence the hTERT gene. The levels of induced apoptosis by BMP7 treatment, Smad3 overexpression or hTERT shRNA were within 10-20% of total cells (Figure 10a), consistent with a specifically increased incidence of apoptosis due to telomerase inhibition.

To further attest the role of hTERT in the BMP7-induced cell death, we transfected MCF-7 cells with recombinant GFP-hTERT, GFP-hTERT shRNA or GFP only gene expression plasmids, then isolated the GFP-positive transformants by FACS, and treated the cells with BMP7 (10 ng/ml) for 24 hours (Figures 10b and c). In these homogenously transfected cell cultures, we found that BMP7 treatment doubled the number of apoptotic cells of control, and hTERT shRNA induced a significant cell death in parallel (Figure 10b). More interestingly, hTERT shRNA did not potentiate the levels of cell death induced by BMP7 (Figure 10b), suggesting a possibly shared mechanism.

Furthermore, overexpression of hTERT wild type significantly reduced the levels of BMP7-induced cell death (Figure 10b). In average, the gene expression GFP-hTERT reduced the levels of cell death induced by BMP7 from 19% to 14% (p=0.007) (Figure 10c). These data together demonstrated that hTERT repression mediated the breast cancer cell apoptosis induced by BMP7 at least in part. In addition, we also noted that hTERT did not completely prevent BMP7-induced cells. As shown in Figure 10c, although hTERT overexpression reduced BMP7-induced cell death significantly, BMP7 treatment of GFP-hTERT transformants still showed more cell death than the GFP- hTERT transformants without BMP7 treatment (p=0.001 ) (Figure 10c). Consistently, while hTERT shRNA induced a significant increase in apoptosis (p=0.004), the cell death induced by the combination of hTERT shRNA and BMP7 was greater than hTERT shRNA alone (p=0.002) (Figure 10c). These data suggest that over and above hTERT repression, other mechanism(s) may also exist to participate in mediating BMP7-induced breast cancer cell apoptosis.

Example 8: BMP7 repression of the hTERT gene is mediated by Smad3 signaling

To investigate the mechanisms of the inhibitory effect of BMP7 on telomerase activity, we determined hTERT gene expression as a possible function of the activation of Smad proteins. BMP7 stimulated the phosphorylation and nuclear retention of Smad1/5/8 complex, similar to that by BMP2, BMP4 and BMP5 (Figure 1 1a). Surprisingly, we found that Smadi , Smadδ and Smadδ had no significant effect on mediating BMP7-induced telomerase inhibition (not shown), but that Smad3 responded to BMP7. As shown in Figure 1 1 b, incubation of cultured MCF-7 cells with BMP7 for different periods of time from 10 min to 2 hours resulted in Smad3 phosphorylation. The phosphorylation was gradually increased and maximal levels of phosphorylation were two-three folds of that under basal conditions in a time-dependent manner (Figure 11 b). In addition, the phosphorylation of Smad3 occurred in association with the phosphorylated protein nuclear accumulation from ten minutes of BMP7 treatment, which lasted for two hours of observation (Figure 1 1 b). As controls, Smad3 phosphorylation was also induced by TGF-β stimulation (Figure 11 b), but no Smad3 phosphorylation was observed in the cells treated with BMP2, BMP4 or BMP5 (not shown).

To further investigate the nuclear activity of BMP7-induced Smad3 signaling, we examined if BMP7 stimulates Smad3 gene transcriptional activity using a Smad3 responsive luciferase gene reporter assay. MCF-7 cells were transfected with Smad3- responsive gene promoter (pGL3-(CAGA)12-Luc luciferase reporter) for 24 hours, and the transfected cells were further treated with 30 ng/ml of BMP7, TGF-β, BMP2, BMP4, BMP5 or BMP6 for 48 hours. As shown in Figure 11 c, BMP7 or TGF-β induced marked increases in the luciferase reporter gene activity that is under the transcriptional control of the Smad3-specific promoter. The increased luciferase activity induced by BMP7 was four-five folds of control, which was comparable to that induced by TGF-β (Figure 11 c). In contrast, BMP2, BMP4, BMP5 or BMP6 did not elicit any significant increase in the luciferase activity driven by Smad3 responsive promoter (Figure 1 1c). These data confirmed that BMP7 triggered the nuclear signaling of Smad3 in cancer cells. With the correlative changes of Smad3 nuclear signaling (Figures 11 b and c) and telomerase inhibition induced by BMP7 (Figure 8a), next we investigated a causal role of the BMP7-induced Smad3 signaling in mediating the gene repression of hTERT by silencing the Smad3 gene and then determining if the inhibitory effect of BMP7 on the hTERT gene expression is mitigated (Figures 12a and b).

Significantly, silencing Smad3 gene expression resulted in increased gene expressions of c-myc and hTERT (Figure 12a, lane 2 or 4, versus lane 1 ), and increased telomerase activity (Figure 12b, lane 9-10 versus lane 3-4). In contrast, silencing c-myc gene expression resulted in inhibition of the hTERT gene expression (Figure 12a, lane 3 or 5, versus lane 1 ), or telomerase activity (Figure 12b, lane 1 1-14 versus lane 3-4), However, silencing Smad3 markedly relaxed the BMP7 inhibition of the hTERT gene expression and telomerase activity (lane 4 versus lane 6 of Figure 12a, and lanes 7-8 versus lanes 5-6 of Figure 12b). These findings that knocking down Smad3 gene expression disrupted BMP7-induced telomerase inhibition clearly demonstrated that Smad3 was required in BMP7-induced telomerase inhibition in human breast cancer cells. Thus, BMP7 employed Smad3 to repress the hTERT gene, inhibit telomerase activity and induce telomere shortening in cancer cells.

Discussion The inventors have demonstrated that recombinant human BMP7 triggers telomerase inhibition and telomere shortening in cultured human breast cancer cells, and induces cancer cell senescence and death. They show that BMP7 elicits telomere shortening by 25-30% and inhibition of telomerase activity by >60% in human breast cancer cells. The data suggest that telomerase maintenance of telomeres in tumor cells is subject to regulation by extracellular cytokine and that the BMP7 pathway plays a significant role in the negative regulation of telomerase activity and telomere maintenance in cancer. The maintenance of telomeres by telomerase in cancer is therefore likely to be reprogrammable by a defined combination of extracellular factors with BMP7 to be a major inhibitory cytokine of telomerase-mediated telomere homeostasis.

Consistent with induced inhibition of telomerase activity, BMP7 elicits significant breast cancer cell senescence and apoptosis. The occurrence of breast cancer cell senescence appears in 72-96 hours of BMP7 treatment, following the inhibition of telomerase activity. Pulsatile treatments of breast cancer cells with BMP7 for two weeks lead to a significant shortening of telomeres, marked increase in cell senescence and drastic loss of cultured cells. Consistent with the cells undergoing cell senescence and apoptotic cell death, the inventors demonstrated that BMP7 administration and telomerase inhibition are associated with precipitated increases in the cell cycle checkpoint protein p16 and tumor suppressor protein p53. Thus, BMP7 may induce cancer cell ageing and death by a series of interchanges of telomerase inhibition, telomere shortening, telomere-associated DNA damage response, premature cell senescence and apoptosis.

The inventors have further demonstrated a mechanism whereby BMP7 induces cancer cell death that involves the repression of the hTERT gene resulting in inhibition of telomerase activity and shortening of telomeres. They show that BMP7-induced cell death is significantly reduced after hTERT gene is constitutively overexpressed to prevent telomerase inhibition. Consistently, silencing the hTERT gene induces breast cancer cell death without potentiating the effect of BMP7 on cancer cell death. However, it is noteworthy that a significant additive (i.e., synergistic) effect between BMP7 and hTERT shRNA has been observed on apoptosis, and that establishing telomerase activity by constitutive overexpression of hTERT does not prevent BMP7- induced apoptosis completely. These data suggest that mechanism(s) other than hTERT gene repression may also be involved in BMP7-induced breast cancer cell apoptosis.

In addition to the novel findings of BMP7-induced telomerase inhibition and telomere shortening, in the present study, the inventors also show for the first time that BMP7 exerts its inhibitory effect by a mechanism involving Smad3 nuclear signaling. They show that BMP7 induces Smad3 phosphorylation, nuclear translocation and gene transcriptional activity. As a repressor the hTERT gene, Smad3 overexpression induces breast cancer cell death. Moreover, when Smad3 is silenced, the repression of the hTERT gene and inhibition of telomerase activity induced by BMP7 is abolished. The inventors' findings that BMP7 stimulates Smad3 phosphorylation and nuclear accumulation in addition to Smad1/5/8, and that Smad3 mediates BMP7-induced telomerase inhibition were unexpected.

In conclusion, this data demonstrate that BMP7 exerts an inhibitory effect on telomerase activity and telomere maintenance in cultured human breast cancer cells.

Mechanistic studies reveal the involvement of Smad3 signaling in mediating the BMP7- induced inhibition of the hTERT gene and telomerase activity. Continuous exposure to

BMP7 entrains telomere shortening and cancer cell senescence and apoptosis. Thus, the inventor's findings suggest that BMP7 has a utility as an anti-cancer therapeutic, and in reprogramming telomere homeostasis and cell proliferative capacity potentially in other cell types, including stem cells.

Finally it is to be understood that various other modifications and/or alterations may be made without departing from the spirit of the present invention as outlined herein.

Claims

Claims:

1 . A method of repressing expression of telomerase reverse transcriptase (TERT) in a cell, the method including contacting the cell with a bone morphogenetic protein (BMP), or a biologically active fragment or variant thereof.

2. The method of claim 1 , wherein the cell is a cancer cell, a stem cell or a vascular smooth muscle cell.

3. The method of claim 2, wherein the cell is a cervical cancer cell.

4. The method of any one of claims 1 to 3, wherein the cell is contacted with the BMP in vitro.

5. The method of any one of claims 1 to 4, wherein the BMP is BMP7.

6. A method of enhancing expression of telomerase reverse transcriptase (TERT) in a cell, the method including contacting the cell with an antagonist of BMP, or a biologically active fragment or variant thereof.

7. The method of claim 6, wherein the antagonist of BMP is an antagonist of BMP7.

8. A composition for repressing expression of TERT in a cell, the composition including a BMP, or a biologically active fragment or variant thereof.

9. The composition of claim 8, wherein the cell is a cancer cell, a stem cell or a vascular smooth muscle cell.

10. The composition of claim 9, wherein the cell is a cervical cancer cell.

1 1. The composition of any one of claims 8 to 10, wherein the cell is cultured in vitro.

12. The composition of any one of claims 8 to 1 1 , wherein the BMP is BMP7.

13. A composition for enhancing expression of TERT in a cell, the composition including an antagonist of BMP, or a biologically active fragment or variant thereof.

14. The composition of claim 13, wherein the antagonist of BMP is an antagonist of

BMP7.

15. A pharmaceutical composition for repressing expression of TERT in a cell, the composition including a BMP, or a biologically-active fragment or variant thereof, and a pharmaceutically acceptable carrier, excipient, diluent and/or adjuvant.

16. The composition of claim 15, wherein the cell is a cancer cell, a stem cell or a vascular smooth muscle cell.

17. The composition of claim 16, wherein the cell is a cervical cancer cell.

18. The composition of any one of claims 15 to 17, wherein the cell is cultured in vitro.

19. The composition of any one of claims 15 to 18, wherein the BMP is BMP7.

20. A pharmaceutical composition for enhancing expression of TERT in a cell, the composition including an antagonist of BMP, or a biologically-active fragment or variant thereof, and a pharmaceutically acceptable carrier, excipient, diluent and/or adjuvant.

21. The composition of claim 20, wherein the antagonist of BMP is an antagonist of BMP7.

22. A method of screening a test compound for its ability to modulate TERT expression, the method including the steps of: exposing a cell capable of expressing TERT to the test compound and a BMP, or a biologically-active fragment or variant thereof, under conditions that will allow the BMP, or a biologically-active fragment or variant thereof, to repress TERT expression; and determining whether the test compound modulates BMP-mediated repression of TERT expression.

23. The method of claim 22, wherein the cell is a cancer cell, a stem cell or a vascular smooth muscle cell.

24. The method of claim 23, wherein the cell is a cervical cancer cell.

25. The method of any one of claims 22 to 24, wherein the cell is exposed to the test compound and the BMP in vitro.

26. The method of any one of claims 22 to 25, wherein the BMP is BMP7.

27. The method of any one of claims 22 to 26, wherein determining whether the test compound modulates BMP-mediated repression of TERT expression involves determining whether the test compound enhances BMP-mediated repression of TERT expression.

28. The method of any one of claims 22 to 26, wherein determining whether the test compound modulates BMP-mediated repression of TERT expression involves determining whether the test compound inhibits BMP-mediated repression of TERT expression.

29. A test compound determined by the method of any one of claims 22 to 28 as being capable of modulating BMP-mediated repression of TERT expression.

30. A prophylactic or therapeutic method of treating a subject at risk of or susceptible to a disorder or having a disorder associated with undesirable cell proliferation, the method including administering to the subject a BMP, or a biologically active fragment or variant thereof.

31. The method of claim 30, wherein the disorder associated with undesirable cell proliferation is cervical cancer.

32. The method of claim 30 or 31 , wherein the BMP is BMP7.

33. A prophylactic or therapeutic method of treating a subject at risk of or susceptible to a disorder or having a disorder associated with TERT expression and/or activity, the method including administering to the subject an antagonist of BMP, or a biologically active fragment or variant thereof.

34. The method of claim 33, wherein the antagonist of BMP is an antagonist of BMP7.

35. Use of a BMP in the manufacture of a medicament for use in prophylaxis or treatment of a subject at risk of or susceptible to a disorder or having a disorder associated with undesirable cell proliferation, the method including administering to the subject a BMP, or a biologically active fragment or variant thereof.

36. The use of claim 35, wherein the disorder associated with undesirable cell proliferation is cervical cancer.

37. The use of claim 35 or 36, wherein the BMP is BMP7.

38. Use of a BMP in the manufacture of a medicament for use in prophylaxis or treatment of a subject at risk of or susceptible to a disorder or having a disorder associated with TERT expression and/or activity, the method including administering to the subject an antagonist of BMP, or a biologically active fragment or variant thereof.

39. The use of claim 38, wherein the disorder associated with TERT expression and/or activity is selected from the group consisting of cardiovascular diseases, osteoarthritis, osteoporosis, Alzheimer's disease, macular degeneration, liver cirrhosis, rheumatoid arthritis, AIDS or HIV infection, autoimmune disease, muscular dystrophy, wound healing, hair loss and photo-damaged skin.

40. The use of claim 38 or 39, wherein the antagonist of BMP is an antagonist of BMP7.