KR101121987B1 - Anti-osteoclast mediated bone resorption siRNA vector for gene therapy - Google Patents

Abstract

The present invention inserts a nucleotide sequence encoding a siRNA that inhibits the expression of the CK-B gene in the RNA expression vector, wherein the vector inhibits the bone resorption of osteoclasts by inhibiting the expression of CK-B by the transcribed siRNA; It relates to the application method thereof. More specifically, the present invention relates to a CK-B inhibitory siRNA expression vector, a CK-B inhibitory siRNA, and a composition comprising the same as an active ingredient, which includes actin ring structure formation, RhoA protein formation, vATPase activity, and osteoclast bone It can be used to prevent and treat bone metabolic diseases by inhibiting absorption.

Osteoclasts, shRNA (short hairpin RNA), siRNA (short interfering RNA), CK-B (brain-type creatine kinase)

Description

Anti-osteoclast mediated bone resorption siRNA vector for gene therapy

The present invention inserts a nucleotide sequence encoding a siRNA that inhibits the expression of the CK-B gene in the RNA expression vector, wherein the vector inhibits the bone resorption of osteoclasts by inhibiting the expression of CK-B by the transcribed siRNA; It relates to the application method thereof. More specifically, the present invention relates to a CK-B inhibitory siRNA expression vector, CK-B inhibitory siRNA and a composition comprising the same as an active ingredient.

Bones support the soft tissues and weight of the body and surround internal organs to protect internal organs from external shocks. It is also one of the important parts of the human body that not only structurally supports muscles or organs, but also stores calcium and other essential minerals in the body, such as phosphorus and magnesium. Thus, the bones of grown adults do not stop, and until the day they die, the old bones are removed and the bones of the new bones are replaced with new bones. This is called bone remodeling (Yamaguchi A. et al., Tanpakushitsu Kakusan Koso., 50 (6Suppl): 664-669 (2005) .Bones maintain homeostasis through remodeling. The remodeling process involves two interactive processes: bone formation and bone resorption: the bone turnover, which removes old bone and replaces it with new bone, restores bone damage caused by growth and stress, Essential to maintain function (Cohen-Solal M. et al., Therapie., 58 (5): 391-393 (2003)) This process is progressed by the proper activity of osteoclasts, osteoblasts.

It is known that two types of cells are involved in aggregate formation. One of the two cells is an osteoblast that produces bone, and the other is an osteoblast that destroys bone. Osteoblasts produce RANKL (receptor activator of nuclear factor-κB ligand) and osteoprotegerin (OPG), its decoy receptor. When RANKL binds to the receptor activator of nuclear factor (RANK), a receptor on the surface of osteoclast progenitor cells, osteoclast progenitors mature into osteoclasts and cause bone resorption. However, when OPG binds to RANKL, the binding between RANKL and RANK is blocked, which inhibits the formation of osteoclasts and prevents more bone resorption than necessary (Theill LE. Et al., Annu Rev Immunol., 20: 795-823 (2002). Wagner EF. Et al., Curr Opin Genet Dev., 11: 527-532 (2001)). Absorption or destruction of old bone is caused by osteoclasts from blood cells (hematopoietic stem cells), which puncture the bone and release a small amount of calcium into the bloodstream to maintain body function (William J. et al. , Nature., 423: 337-342 (2003).

An imbalance between bone formation and bone resorption during bone remodeling can lead to metabolic bone disease. Osteoporosis (osteoporo sis) is a representative bone metabolic disease. Osteoporosis refers to a symptom of decreasing total bone mass due to an increase in osteoclast activity compared to osteoblasts. When osteoporosis occurs, the width of the cortical bone is reduced, the cavity of the bone marrow is enlarged, the reticulum is lowered, and the bone continues to be porous. As osteoporosis progresses, the bone's physical strength decreases, causing low back pain and joint pain, and the bone easily breaks down even with a slight impact. In addition to metabolic diseases of the bone, breast metastases such as breast and prostate cancer, bone metastasis lesions that have metastasized to bone, tumors formed in the bone such as multiple myeloma primary, rheumatoid or degenerative arthritis, periodontal disease Periodontal disease caused by bacteria causing the destruction of alveolar bone, inflammatory alveolar bone resorption disease after implantation of dental implants, inflammatory bone resorption disease caused by implants placed to fix bone in the orthopedic area And Paget's disease caused by various genetic predispositions.

Recently, differentiation and bone resorption of osteoclasts, which are directly responsible for bone metabolism, have been identified at the cellular and molecular levels. Development of therapeutic agents for osteoporosis through osteoclast function is expected. The development of osteoporosis treatment by inhibiting osteoclast function is progressing in two directions.

The first is the study on the development of inhibitors of osteoporosis by identifying the differentiation mechanism of osteoclasts. Osteoclasts are differentiated from hematopoietic stem cells in the bone marrow in the same way as the differentiation of immune cells. In particular, the early osteoclast differentiation process was differentiated into monocytes by a macrophage-colony stimulating factor (M-CSF), which is a differentiation factor of macrophage in the immune system, and a cytokine called rankl. After that, it finally matures into osteoclasts by rankl (FIG. 2) (8,9,10). Therefore, it is possible to develop a therapeutic agent for osteoporosis by searching for a substance that can inhibit the signaling mechanism during osteoclast differentiation.

Second is the study on the development of inhibitors of bone resorption mechanism of osteoclasts. Resorption of osteoclasts is achieved by the formation of specialized structures, such as the formation of intracellular actin rings, by secreting excess acid and proteolytic enzymes at the site of bone absorption. Therefore, a substance that inhibits the resorption mechanism of differentiated osteoclasts can be used directly as a therapeutic agent for osteoporosis.

Estrogens, calcitonins, vitamin D and its analogues (Vitamin analogues), bisphosphonates, and the like are known as inhibitors of bone resorption mechanisms of osteoclasts (Jardine et al., Annual Reports in Medicinal Chemistry, 31, p211, 1996). ).

In addition, many substances have been developed to treat bone metabolic diseases so far, and estrogen, which is most used as a treatment for osteoporosis, has not been proven its actual efficacy and has to be taken continuously throughout life, and also long-term administration If you have side effects that increase breast cancer or uterine cancer. Alendronate also has a problem that the effect is not clear, slow absorption in the digestive tract and inflammation of the stomach and esophagus mucosa. Calcium preparations are known to have fewer side effects and excellent effects, but there is a limit corresponding to preventive agents rather than therapeutic agents. Other vitamin D preparations, such as calcitonin, are known but have not been fully studied for their efficacy and side effects.

In 2002, Science Magazine selected small RNA as the 'molecule of the year', and in December 2003, published 10 major scientific achievements in all fields of science, among them inducing RNAi (RNA interference) phenomenon. SiRNA (small interfering RNA) technology has been selected. This fact shows the importance of the small RNA research field and RNAi technology using it and the interest among researchers. The technology is still in its infancy, but it is expected to revolutionize cytogenetic research, and some scientists believe it may be comparable to polymerase chain reaction (PCR). Until now, it took six months to a year to produce a cell that stopped expression of a gene, but siRNA RNAi technology can control dozens of genes a week. Over the last decade or so, many researchers and pharmaceutical researchers have been struggling to identify genes and develop new drugs by expressing anti-sense oligonucleotides or antisense RNAs. In the experiments using the sense strand, the inhibition of expression of the target gene was observed, and interest in identifying the cause was continued. The Fire group synthesized antisense RNA and sense RNA in vitro using RNA polymerase, and observed that very small but nonspecifically reversed RNAs were synthesized to produce dsRNAs. While antisense RNAs and sense RNAs do not efficiently inhibit gene expression, it has been found that interestingly dsRNAs generated from non-isolated test material inhibit gene expression very efficiently (Fire et al., 1998). In this report, When the Fire group puts double stranded RNA (dsRNA) corresponding to the nucleotide sequence of a specific gene into the body of the nematode Caenorhabditis elegans, the corresponding mRNA is specifically degraded and thus loses the function of the gene. Compared to the result of experiments (RNA interference, RNAi), it was observed that even a small amount is possible, and it was spread rapidly due to the sequence specificity of such RNAi phenomenon and simple and rapid gene expression inhibition induction function than the existing gene knock-out method. Nematodes have been actively used in the study of reverse genetics, and it has been reported that RNAi can be applied not only to nematodes but to whole organisms. In other words, RNAi is a phenomenon in which mRNA having complementary sequencing is selectively degraded or translation is inhibited by small-size RNA of 21-25 nt, so that mRNA degradation by siRNA and translation inhibition by miRNA are substantially the same. It can be said to belong to the control path.

Therefore, by using the RNAi technology, by inhibiting CK-B is expected to be able to prevent and treat bone metabolic diseases by inhibiting the bone resorption of osteoclasts.

An object of the present invention is to insert a nucleotide sequence encoding a siRNA that inhibits the expression of the CK-B gene in the siRNA expression vector, whereby inhibiting the bone resorption of osteoclasts by inhibiting the expression of CK-B by the transcribed siRNA To provide a vector.

It is an object of the present invention to provide a host cell transformed with a CK-B inhibitory siRNA expression vector.

An object of the present invention is a hairpin structure comprising a CK-B inhibitory siRNA comprising the nucleotide sequence of SEQ ID NO: 2 and an RNA nucleotide sequence complementary to SEQ ID NO: 2 linked to a loop region with the nucleotide sequence of SEQ ID NO: 2 To provide a CK-B inhibitory siRNA.

An object of the present invention provides a composition for inhibiting bone resorption of osteoclasts comprising the expression of a CK-B (brain-type creatine kinase) gene encoding the amino acid sequence of SEQ ID NO: 1 or an inhibitor of the action of the expressed protein thereof as an active ingredient. To provide.

It is an object of the present invention (1) treating any agent to animal cells expressing CK-B protein; (2) to provide a method for screening bone resorption inhibitors of osteoclasts, including determining whether the expression or activity of CK-B protein is reduced in comparison with the control group not treated with the drug in the animal cells.

According to one aspect of the invention, the present invention is inserted into the siRNA expression vector nucleotide sequence encoding the siRNA that inhibits the expression of the CK-B gene, wherein the osteoclast by inhibiting the expression of the CK-B gene by the transcribed siRNA Provided are vectors that inhibit bone resorption of cells.

The present inventors found that CK-B is specifically increased during osteoclast differentiation and involved in bone resorption mechanisms, and that CK-B may be a target for osteoclast regulation of osteoclasts. Therefore, as a result of research into suppressing the bone resorption of osteoclasts of the vector with a strategy of inserting a foreign sequence into the vector, when the nucleotide sequence encoding the siRNA targeting the mRNA of CK-B is inserted into the vector and expressed in the osteoclasts It has been found that bone resorption is suppressed.

As used herein, the term "osteoblast" is a multinuclear cell derived from hematopoietic stem cells, the absorption or destruction of old bone is made by the osteoclasts generated from blood cells (hematopoietic stem cells), which punctures bone Calcium is released into the bloodstream and used to maintain body function (William J. et al., Nature., 423: 337-342 (2003)). Bone resorption moves to the absorption part of osteoclasts, adhesion of osteoclasts to bone, polarization and formation of new membrane domains, degradation of hydroxyapatite, degradation and absorption of organic tissues The transfer of degradation products from voids and finally the process of apoptosis of osteoclasts.

Creatine kinase (CK) is an enzyme that catalyzes the transfer of high-energy phosphate groups from creatine phosphate to ADP. The isoenzyme of CK is CK-BB (moves from EP to albumin and is present in the brain) It moves to the globulin region and is mainly in skeletal muscle) and CK-MB (hybrid hybrid type is moved from EP to 2-globulin position and is mainly in the myocardium). The term "CK-B" in the present invention means CK-BB. Hereinafter, as shown in Figure 1a, the amount of expression increases during the differentiation and activation of osteoclasts. In addition, CK-B is involved in RhoA and V-ATPase activity and actin ring regulation that forms the intracellular framework.

The present invention is directed to a promoter capable of initiating the expression of siRNA (short interfering RNA) and a siRNA complementary to a portion of the CK-B (brain-type creatine kinase) mRNA of SEQ ID NO: 1 and inhibiting the expression of the CK-B gene. It provides a CK-B inhibitory siRNA expression vector comprising the nucleotide sequence encoding in the transcription direction.

As used herein, the term "siRNA" refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing to specifically inhibit the expression of a target gene (see WO00 / 44895, WO 01/36646). , WO 99/32619, WO 01/29058, WO 99/07409 and WO 00/44914.

As used herein, the term "specific" means the ability to inhibit only the target gene without affecting other genes in the cell, and is specific for the CK-B gene in the present invention.

The siRNA used in the present invention includes a sequence complementary to the CK-B mRNA, the term "complementary" is not only 100% complementary, but also inhibit the expression of the CK-B gene through the interference RNA (iRNA) mechanism It is meant to encompass some corresponding base deficiency and incomplete complementarity to the extent possible, preferably 90% complementarity, more preferably 98% complementarity, and most preferably 100% complementarity. When expressing 100% complementarity herein, it is specifically described as "completely complementary".

We used siRNA synthesis software on the Internet, such as www.invivogen.com, www.oligoengine.com, www.genescript.com, www.wistar.com, www.ambion.com, to find the optimal siRNA target site. Analyzed. The selection criteria should be those suggested by Tuschl et al., Ie have low GCcontents, at least 50-100 nt below the first codon to avoid binding to control proteins, at least secondary bases, at least 3 bases No repetition, no exon-intron boundary, no similarity to other sites (Elbashir et al., 2002). According to these criteria, 512-532 nt of CK-B mRNA was selected as the most suitable site for siRNA.

Thus, some of the preferred CK-B (brain-type creatine kinase) mRNA of the present invention is preferably 512 ~ 532 nt in the CK-B mRNA sequence of SEQ ID NO: 1.

According to a preferred embodiment of the present invention, the nucleotide sequence encoding the siRNA of the present invention has a sequence comprising the sequence of SEQ ID NO: 2 corresponding to (512 ~ 532 nt) of the CK-B mRNA sequence of SEQ ID NO: 1 It is characterized by. The nucleotide sequence encoding the siRNA requires that sequence as the minimum sequence.

The nucleotide sequence encoding the siRNA is a minimum length of 19 nucleotides (nt), more preferably at least 20 nt, effective for mediating CK-B gene silencing.

The nucleotide sequence encoding the siRNA molecule of the present invention comprises the minimum sequence described above, most preferably 19-25 nt.

The nucleotide sequence encoding the siRNA molecule of the present invention is preferably a DNA molecule because the carrier is a vector having a ds DNA genome.

The antisense RNA and the sense RNA may be expressed in the same vector or may be in the form of being expressed in different vectors, respectively.

Expression cassettes in which the sense RNA is expressed at the promoter and separate expression cassettes in which the antisense RNA is expressed at the promoter may be constructed, and these cassettes may be inserted into the vector in the same direction or in the reverse direction.

The nucleotide sequence encoding the siRNA molecule of the present invention, like the general sequence encoding the siRNA, is complementary to the sense strand (corresponding sequence corresponding to the CK-B mRNA sequence) and the antisense strand (CK-B mRNA sequence) complementary) may be positioned opposite to each other to form a double chain.

Further, according to another preferred embodiment of the present invention, the nucleotide sequence encoding the siRNA molecule of the present invention may have a single chain structure having a sense strand and a self-complementary antisense strand.

The term "self-complementary antisense strand" in the present invention refers to an antisense strand of a sequence that is complementary to the sense strand.

According to a preferred embodiment of the present invention, the nucleotide sequence encoding the siRNA molecule of the present invention is a sequence of SEQ ID NO: 2 corresponding to 512-532 nt of the CK-B mRNA sequence of SEQ ID NO: 1 and SEQ ID NO: 2 It is characterized by the fact that both reverse complementary sequences are present on the same strand.

In addition, a system capable of expressing a stem-and-loop structure siRNA is a unit in which an antisense RNA and a nucleotide sequence encoding a sense RNA are reversely arranged on the same DNA strand, and a loop is inserted between these DNAs to connect one unit. It can be placed downstream of the promoter of. At this time, the order of expression is not limited. That is, it may be a DNA form encoding a DNA-loop-sense RNA encoding an antisense RNA and a DNA form encoding a DNA-loop-antisense RNA encoding a sense RNA. As a result, the resulting siRNA has a stem loop structure in which sense RNA and antisense RNA on both sides of the loop are paired.

The nucleotide sequence encoding the siRNA of the present invention has a form in which a short nucleotide sequence (eg, about 5-15 nt) is inserted between a sense strand and a self complementary antisense strand, in which case the nucleotide sequence of SiRNA molecules formed by expression will form a hairpin structure by intramolecular hybridization, and form a stem-and-loop structure as a whole. This stem-and-loop structure is processed in vitro or in vivo to produce an active siRNA molecule capable of mediating RNAi.

According to a preferred embodiment of the present invention, the nucleotide sequence encoding the siRNA molecule of the present invention is a sequence of SEQ ID NO: 2 and SEQ ID NO: 2 corresponding to 512-532 nt of the CK-B mRNA sequence of SEQ ID NO: 1 A sequence (5-15 nt, preferably 8-12 nt) having a reverse complementary sequence and allowing a hairpin structure to be formed between the sequence of SEQ ID NO: 2 and the sequence complementary to SEQ ID NO: 2 It is characterized by being inserted.

The short nucleotide sequence inserted between the sense and self-complementary antisense strands can be any base capable of forming a loop (hairpin) structure, and this loop region has no special meaning to the sequence. Only 5-15 nt of base is needed to connect the sense and antisense sequences at appropriate intervals. Examples that have been widely used as loop regions of siRNAs are as follows: AUG (Sui et al., (2002) A DNA vector-based RNAi technology to suppress gene expression in mammalian cells.Proc. Natl. Acad. Sci. US A 99 (8): 5515-5520), CCC (Paul et al., (2002) Effective expression of small interfering RNA in human cells.Nature Biotechnology 20: 505-508), UUCG (Lee et al., (2002) Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells.Nature Biotechnology 20: 500-505), CCACC (Paul et al., (2002) Effective expression of small interfering RNA in human cells.Nature Biotechnology 20: 505 -508), CTCGAG, AAGCUU (Editors of Nature Cell Biology (2003) Whither RNAi, Nat Cell Biol. 5: 489-490), CCACACC (Paul et al., (2002) Effective expression of small interfering RNA in human cells. Nature Biotechnology 20: 505-508), UUCAAGAGA (Yu et al., (2002) RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells.Proc.Nat Acad. Sci. USA 99 (9): 6047-6052), and TTGATATCCG (default spacer at www.genscript.com). According to a specific example of the present invention, it is preferable to use TTGATATCCG as a loop region.

According to a preferred embodiment of the present invention, the nucleotide sequence encoding the siRNA is characterized in that it comprises the sequence of SEQ ID NO: 3.

The CK-B inhibitory expression vector of the present invention also includes vectors expressing only RNAs having sequences complementary to CK-B mRNA.

In the expression vector of the present invention, as a means for introducing a nucleic acid sequence encoding a gene of interest into a host cell, any conventionally known siRNA expression vector capable of expressing the target sequence of the present invention as siRNA can be used. For example, Promega products include the GeneClip ™ U1 Hairpin Cloning System (Cat. # 'S C8750, C8760, C8770, C8780, C8790), siLentGene ™ U6 Cassette RNA Interference System (Cat. # C7800), and the T7 RiboMAX ™ Express RNAi System (Cat . # P1700), siSTRIKE ™ U6 Hairpin Cloning Systems (Cat. # 'S C7890, C7900, C7910, C7920) and siLentGene ™ -2 U6 Hairpin Cloning Systems (Cat. #' S C7860, C8060, C8070, C8080) GenRNA products available include pRNA-U6.1 (Cat. # 'S SD1201, SD1202, SD1207), pRNATin-H1.2 (Cat. #' S SD1223, 1224), and pRNA-H1.1 / Adeno (Cat . # SD1209), pSUPER-retro-GFP / Neo (Cat. # 'S VEC-IND-0013 / 0014), etc. can be used as Oligoengine product, and pAdeno-X expression system (Cat) as Clontech product. . # 's PT3414-1) may be used.

The nucleotide sequence encoding the siRNA molecule targeting CK-B mRNA is loaded into the vector genome. The nucleotide sequence encoding the siRNA molecule is preferably present in a suitable expression construct. In the expression construct, the siRNA-coding nucleotide sequence is preferably operatively linked to the promoter. As used herein, the term “operably linked” refers to a functional binding between a nucleic acid expression control sequence (eg, an array of promoters, signal sequences, or transcriptional regulator binding sites) and other nucleic acid sequences, thereby The regulatory sequence will control the transcription and / or translation of said other nucleic acid sequence.

In the present invention, the promoter linked to the nucleotide sequence encoding the siRNA may be any promoter capable of initiating the expression of the siRNA, but is preferably operated in an animal cell, more preferably a mammalian cell, thereby siRNA-coding nucleotides. In order to control the transcription of the sequence, it is preferable to select one of the RNA polymerase III (pol III) promoters that transcript transcript, and since the 5 'end of the sense strand of most siRNAs ends with G or C, G or It is preferable to select a promoter capable of efficiently initiating C transcription. Promoters derived from mammalian viruses and promoters derived from genomes of mammalian cells, such as, for example, the U6 promoter, the T7 promoter, the H1 promoter, the cytomegalo virus (CMV) promoter, the adenovirus late promoter, the vaccinia virus 7.5K promoter , SV40 promoter, HSV tk promoter, RSV promoter, EF1 alpha promoter, metallothionine promoter, beta-actin promoter, promoter of human IL-2 gene, promoter of human IFN gene, promoter of human IL-4 gene, human Promoters of the lymphotoxin gene, promoters of the human GM-CSF gene, inducible promoters, cancer cell specific promoters (e.g., TERT promoters, PSA promoters, PSMA promoters, CEA promoters, E2F promoters and AFP promoters) and tissue specific Promoters (eg, albumin promoters), including but not limited to.

The present invention provides an expression vector capable of producing an siRNA targeting CK-B mRNA by inserting an expression cassette comprising DNA encoding an siRNA targeting CK-B mRNA into a vector to prepare a CK-B gene suppression recombinant vector. To prepare.

In order to design a vector for this, a CK-B mRNA sequence to be targeted for CK-B gene inhibition is obtained. Choose an appropriate promoter from the RNA polymerase III (pol III) promoters that transcribe short RNA transcripts. The sense strand and the antisense strand of the nucleotide sequence encoding siRNA from the promoter are positioned with the loop region interposed therebetween to synthesize the hairpin structure (shRNA). Thus synthesized shRNA is converted into siRNA having the correct structure by siRNA processing enzyme (Dicer or Rnase III) present in the cell to induce silencing of the target gene.

According to a preferred embodiment of the present invention, the present invention provides that the nucleotide having the nucleotide sequence of SEQ ID NO: 3 encoding the siRNA targeting the CK-B mRNA of SEQ ID NO: 1 is inserted into the transcription direction after the U6 promoter Characterized by CK-B inhibitory recombinant vector pRNA-U6.1 / Neo with the cleavage map of FIG. 17A is provided.

More specifically, the present invention is an siRNA expression vector comprising an expression cassette consisting of a U6 promoter, a nucleotide having a nucleotide sequence of SEQ ID NO: 3. SiRNA target was selected as a sequence capable of inducing RNA interference to suppress CK-B gene expression, and a nucleotide sequence having BamHI and HindIII restriction enzyme cleavage sites was prepared to make a double-stranded DNA fragment, followed by pRNA. Cloning into a -U6.1 / Neo vector yields a CK-B inhibitory recombinant vector.

In addition, according to a preferred embodiment of the present invention, the present invention is prepared by inserting a nucleotide having a nucleotide sequence of SEQ ID NO: 3 encoding the siRNA targeting the CK-B mRNA of SEQ ID NO: 1 in the transcription direction after the T7 promoter PSUPER-retro-GFP / Neo having a cleavage map of Fig. 17B is provided.

More specifically, a shRNA plasmid is prepared by cloning a nucleotide encoding a siRNA targeting CK-B mRNA to a pSUPER-retro-GFP / Neo vector (product of Oligoengine) for retrovirus expression. After transfection into a Plat-E cell line capable of replicating a retrovirus, extracellular suspension can be collected and used as an iRNA.

In addition, according to a preferred embodiment of the present invention, the nucleotide having the nucleotide sequence of SEQ ID NO: 3 encoding the siRNA molecule targeting the CK-B mRNA of SEQ ID NO: 1 is inserted in the transcription direction after the U6 promoter It provides a pAdeno-CK-B-sh DNA having a cleavage map of Figure 17c characterized in that the gene fragment obtained by cleaving with a restriction enzyme in the prepared RNAi-Ready-pSIREN-shuttle vector. The restriction enzyme is preferably I-CeuI and PI-SceI.

More specifically, adenovirus expressing CK-B shRNA is cloned into the RNAi-Ready-pSIREN-shuttle vector (Clontec) having a U6 promoter for RNA expression, followed by cloning of CK-B shRNA (I-CeuI / PI-SceI restriction enzyme). Was cut and cloned back into pAdeno-X vector (Clontech). The pAdeno-CK-B-sh DNA for expressing adenoviruses is transfected into HEK 293 cell line using Fugene 6 (Roche) to lyse the cells to obtain adenoviruses by CsCl density gradient centrifugation, and then use them after quantification. .

According to another aspect of the present invention, the present invention provides a host cell transformed with the CK-B inhibitory siRNA expression vector. The host cell of the present invention may be any host cell which can be expressed by injecting the CK-B inhibitory siRNA expression vector of the present invention by a conventionally known transformation method such as, for example, CaCl2 or electroporation, but preferably the siRNA of the present invention. E. coli strains transformed with the expression vector.

According to another aspect of the present invention, a CK-B inhibitory siRNA comprising the nucleotide sequence of SEQ ID NO: 2 is provided.

According to another aspect of the present invention, there is provided a CK-B inhibitory shRNA having a hairpin structure comprising an nucleotide sequence of SEQ ID NO: 2 and an RNA base sequence complementary to SEQ ID NO: 2 linked to a loop region thereof.

The siRNA-coding nucleotide sequences of the present invention targeting CK-B mRNA are described in more detail by quoting the above description.

The siRNA terminal structure can be either blunt or cohesive, as long as the expression of the target gene can be suppressed by the RNAi effect. The cohesive end structure is possible in both a three-terminal protruding structure and a five-terminal protruding structure. The number of protruding bases is not limited. For example, the number of bases may be 1 to 8 bases, preferably 2 to 6 bases. In addition, siRNA is a low-molecular RNA (e.g., a natural RNA molecule such as tRNA, rRNA, viral RNA or artificial RNA) in the protruding portion of one end to the extent that can maintain the expression inhibitory effect of the target gene Molecules). The siRNA terminal structure does not need to have a cleavage structure at both sides, and may be a stem loop type structure in which one terminal portion of the double chain RNA is connected by a loop RNA.

According to another embodiment of the present invention, the bone of osteoclasts comprising the expression of a CK-B (brain-type creatine kinase) gene transcribed in SEQ ID NO: 1 or an activity inhibitor of the expressed protein as an active ingredient Provided is a composition for inhibiting absorption.

In the present invention, inhibiting the expression of the CK-B gene or the activity of the CK-B protein includes down-regulating the transcription or translation of the CK-B gene or inhibiting the activity of the CK-B protein.

More specifically, the expression inhibitor of the CK-B (brain-type creatine kinase) gene includes the CK-B inhibitory siRNA expression vector of the present invention or the CK-B inhibitory siRNA of the present invention or the CK-B inhibitory shRNA of the present invention. do.

More specifically, the activity inhibitor of the CK-B (brain-type creatine kinase) protein includes Ccr (cyclocreatine).

The compositions of the present invention may include additional substances that inhibit osteoclasts of osteoclasts, and may also include agents that promote intracellular influx of shRNAs, siRNAs and vectors. Formulations that promote the intracellular influx of siRNA include liposomes (US Pat. Nos. 4,897,355, 4,394,448, 4,235,871, 4,231,877, 4,224,179, 4,753,788, 4,673,567, 4,247,411, 4,814,270). It can also be combined with one of the lipophilic carriers of many sterols, including cholesterol, cholate and deoxycholic acid. Poly-L-lysine, spermine, polysilazane, polyethylenimine, polydihydroimidazolenium, polyallylamine Cationic polymers, such as chitosan), succinylated PLL, succinylated PEI, polyglutamic acid, and polyaspartic acid. anionic polymers such as polyaspartic acid, polyacrylic acid, polymethacylic acid, dextran sulfate, heparin, hyaluronic acid, etc. It can also be used. In vivo administration of siRNAs in the form of complexes has been shown to significantly increase the retention time and duration of expression of genes compared to naked nucleic acids.

The composition for inhibiting bone resorption of osteoclasts of the present invention can be used for the prevention and treatment of bone metabolic diseases. Osteoporosis (osteoporo sis) is a representative bone metabolic disease. Osteoporosis refers to a symptom of decreasing total bone mass due to an increase in osteoclast activity compared to osteoblasts. When osteoporosis occurs, the width of the cortical bone is reduced, the cavity of the bone marrow is enlarged, the reticulum is lowered, and the bone continues to be porous. As osteoporosis progresses, the bone's physical strength decreases, causing low back pain and joint pain, and the bone easily breaks down even with a slight impact. In addition to metabolic diseases of the bone, breast metastases such as breast and prostate cancer, bone metastasis lesions that have metastasized to bone, tumors formed in the bone such as multiple myeloma primary, rheumatoid or degenerative arthritis, periodontal disease Periodontal disease caused by bacteria causing the destruction of alveolar bone, inflammatory alveolar bone resorption disease after implantation of dental implants, inflammatory bone resorption disease caused by implants placed to fix bone in the orthopedic area And Paget's disease caused by various genetic predispositions.

The composition of the present invention may be administered with a pharmaceutically acceptable carrier, and when used orally, a binder, a suspending agent, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a perfume, and the like may be used. In the case of injections, buffers, preservatives, analgesic agents, solubilizers, isotonic agents, stabilizers and the like can be mixed and used. For topical administration, bases, excipients, lubricants, preservatives and the like can be used. The formulation of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it may be prepared in the form of tablets, troches, capsules, elesir, suspensions, syrups, wafers, etc., and in the case of injections, may be prepared in unit dosage ampoules or multiple dosage forms.

The composition of the present invention can suppress bone resorption of osteoclasts by administering to a patient having the above-mentioned diseases, and can effectively prevent or treat the disease.

As used herein, the term "prevention" refers to any action of inhibiting or delaying the induction of bone resorption in osteoclasts by administering the composition of the present invention, and "treatment" refers to the improvement of neuronal cell death by administering the composition of the present invention. Means any action that could be or beneficially altered.

The compositions of the present invention can be administered via a general route to reach the desired tissue in a therapeutically or prophylactically effective amount.

The composition of the present invention may be administered in a therapeutically or prophylactically effective amount. Dosage may vary depending on a variety of factors, including the type and severity of the patient, age, sex, weight, sensitivity to the drug, type of current treatment, method of administration, target cells, and can be readily determined by those skilled in the art. Can be. Preferably, it is preferable to administer 2-5 mg / kg for siRNA, and 0.1-1 g / kg for cK-B activity inhibitors. The composition of the present invention may be administered in combination with a conventional therapeutic agent and may be administered sequentially or simultaneously with the conventional therapeutic agent. It may also be single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.

As used herein, the term "administration" means introducing a predetermined substance into a patient by any suitable method, and the route of administration of the composition for inhibiting apoptosis comprising siRNA may be any general route as long as it can reach the target tissue. It can be administered through. Intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, nasal administration, pulmonary administration, rectal administration, but is not limited thereto. In addition, the pharmaceutical composition may be administered by any device in which the active agent may migrate to the target cell.

According to another aspect of the present invention, the present invention comprises the steps of (1) treating any agent to animal cells expressing CK-B protein; (2) comparing the animal cells with a control group not treated with the medicament provides a method for screening bone resorption inhibitors of osteoclasts comprising determining whether the expression or activity of CK-B protein is reduced.

As used herein, the term "animal cell" refers to a human or cow, goat, pig that expresses the CK-B protein. Includes all cells of animal origin, such as mice, rabbits, rats,

As used herein, the term "any agent" refers to a substance that is supposed to induce bone repression inhibition of osteoclasts. Any such medicament may include a single compound such as an organic or inorganic compound, a complex of a plurality of compounds, a polymer compound such as a protein, a carbohydrate, a nucleic acid molecule and a lipid, and the like. Including but not limited to a composition for inhibiting bone resorption of osteoclasts according to the present invention. More specifically, it may be a CK-B inhibitory siRNA expression vector of the present invention or a CK-B inhibitory siRNA of the present invention.

As used herein, the term "treatment" means that any agent affects osteoclasts, and is not limited to being absorbed directly into cells. In addition, the mechanism by which any drug inhibits the bone resorption of osteoclasts is not particularly limited.

Expression or activity of the CK-B protein can be measured by various methods known in the art. Preferably, it can be measured by the amount of mRNA or protein of the CK-B gene. In addition, CK-B, which increases the amount of expression during osteoclast differentiation, is involved in RhoA and V-ATPase activity and actin regulation, which forms the intracellular framework. -ATPase activity can also be determined by measuring the formation of the actin ring structure.

As used herein, the term "actin ring" is a structure formed in the process of activating osteoclasts to absorb bone. Sealing off is performed on the surface of the substrate under the activated osteoclast. This refers to the accumulation of podosom and the formation of f-actin-rich sealing zones. The sealing zone is reported to play a role of firmly attaching the plasma membrane of the bone matrix and osteoclasts.

As used herein, the term "RhoA" refers to a protein that plays an important role in the differentiation, migration, and resorption of osteoclasts as one of the Ras family. The inventors found that this is involved in the formation of the sealing zone, and that V-ATPase activity is likely to be indirectly regulated by RhoA.

As used herein, the term "V-ATPase" is a gene expressed during differentiation of osteoclasts, and is involved in the migration of H + in secreting strong acids and bone matrix degrading enzymes to break down bone during bone resorption of osteoclasts. By lowering the pH so that the osteoclasts have the best activity. It has been found by the inventors that V-ATPase is activated to promote acidification in the lacuna structure in which bone resorption occurs, and that V-ATPase activity is likely to be indirectly regulated by RhoA and actin.

Assays for measuring mRNA levels include RT-PCR, Competitive RT-PCR, Realtime RT-PCR, RNase protection assay (RPA), Northern blotting (Northern blotting), DNA chips, etc., but are not limited thereto.

The amount of protein can be confirmed by using an antibody that specifically binds to the CK-B protein, and analytical methods for this may include Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), Radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, protein chip (protein chip), but is not limited thereto.

Analytical methods for determining the activity of V-ATPase include Fernandez, R. & Malnic, G. H ⁺ ATPase and Cl ^- interaction in regulation of MDCK cell pH. J. Membr. Biol. 163, 137-145 (1998) and the like, but is not limited thereto.

The substance obtained by the above method can be used to suppress bone resorption in osteoclasts.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

A vector for inhibiting osteoclasts of osteoclasts by inserting a nucleotide sequence encoding an siRNA that inhibits the expression of the CK-B gene into an RNA expression vector and inhibiting the expression of CK-B by the transcribed siRNA and its application method The present invention relates to the formation of actin ring structure, the formation of the protein of RhoA, the activity of vATPase and osteoclast can be used to prevent and treat bone metabolic diseases by inhibiting bone resorption. The siRNA expression vector of the present invention is less toxic or side effects than conventional antisense oligomers or viral vectors, but it is thought to have a superior effect compared to the existing antisense oligomers and is very excellent when used for anticancer gene therapy or stem cell differentiation control. It is safe and effective.

Example  1. Confirmation of culture conditions and differentiation for osteoclast formation

Mouse bone marrow cells were isolated from the tibia of ICR mice and treated with M-CSF at a concentration of 30 ng / ml for 3 days. The bone marrow-derived macrophages thus formed were treated in a-MEM culture medium containing 30 ng / ml M-CSF and 100 ng / ml RANKL (hereinafter, referred to as osteoclast differentiation culture) for 3 days to obtain osteoclast precursor cells. Mature osteoclasts were obtained by further incubation for 2 days. Osteoclast differentiation was determined by measuring tartrate-resistant acid phosphatase (TRAP) activity using Acid-Phosphatase Kit (Sigma). Mature osteoclast bone resorption activity using dentin was measured after incubating bone marrow-derived macrophages on dentin fragments and incubating osteoclasts in the same way for one day.

In addition, expression of intracellular CK-B protein using retrovirus was induced by introducing retrovirus into osteoclast precursor cells under the same culture conditions.

Example 2. Discovery and Identification of CK-B Proteins by Two-Dimensional Electrophoresis (2D PAGE)

Lysates containing intracellular proteins obtained by lysing cells before osteoclast differentiation and mature osteoclasts were adsorbed onto Immobiline DryStrips (pH 3-10 linear, Amersharm Pharmacia) and then 72,000 Vh in Multiphor II electrophoresis unit (Amersham Pharmacia). One-dimensional isoelectric point electrophoresis was performed for 20 hours at a maximum voltage of 4000V, and protein fractions were identified after silver staining by separation through two-dimensional electrophoresis. After differentiation, isolated protein fractions on SDS-PAGE gels with increased expression difference in osteoclasts were cut and lysed using trypsin, followed by Nano-LC electrospray ionization (ESI) quadrupole time-of-flight (Q / TOF) mass spectrometer (Micromass QTOF II, Micromass) was analyzed, and peptide sequence was confirmed using MASCOT program (Matrix Science), and then the CK-B protein was verified using a rodent database provided by NCBI.

Example 3. Confirmation of CK-B Protein Expression Using Western Blotting

Bone marrow-derived macrophages and RAW264.7 macrophage lines were used to lyse the cells according to osteoclast differentiation time to obtain intracellular proteins. The lysate was electrophoresed using an SDS-PAGE gel, followed by anti-CK-B antibody (Fitzgeral), anti-V-ATPase E subunit antibody (Santa Cruz Biotechnology), and anti-RhoA monoclonal antibody (Upstate, Temecula, CA) as primary antibodies. ) And anti-actin monoclonal antibody (Sigma) were used for western blotting.

Example 4 Gene Expression Confirmation Using DNA Amplification by Reverse Transcription Polymerase Chain Reaction (RT-PCR Analysis)

CDNA was synthesized after extracting RNA from whole cells using Trizol (Invitrogen), and polymerase chain reaction was performed in a thermal cycler (Perkin Elmer) to observe the expression level of CK-B gene. The denaturation step at 94 ° C. for 30 seconds, the annealing at 58 ° C. for 1 minute, and the extension reaction at 72 ° C. for 1 minute were repeated 30-35 times, and the base of the CK-B primer used was The sequences were 5'-ATGCCCTTCTCCAACAGCCA-3 '(forward) and 5'-CGTGCCGCTCCTCAATAATG-3' (reverse).

Example 5-1. CK-B inhibition base sequence

Target sequencer of accession number BC_015271 (Mus musculus creatine kinase, brain, mRNA (cDNA clone MGC: 18576 IMAGE: 4225384), complete cds) was obtained using a target finder program of GenScript, USA. . Using TTGATATCCG as the loop sequence, the sense sequence was inserted after the restriction enzyme cleavage site, and the loop sequence, the anti-sense sequence and the terminal were designed to include TTTTTTCCAA.

Example 5-2. Sequence and Expression Vector Construction for shRNA

To induce RNA interference to suppress CK-B expression, a vector was constructed to mount a nucleotide sequence encoding a DNA target portion and a small hairpin (sh) loop RNA portion. That is, 5'-CCATCGAGAAGCTGGCAGTAG-3 (SEQ ID NO: 2), which is the base sequence of GC% 57.14%, is selected as the sense siRNA sequence, and the loop sequence is 5`- TTGATATCCG -3`, and the shRNA sequence is 5`- CCATCGAGAAGCTCTCCCAGTAGTTGATATCCGCTACTGCCAGCTTCTCGATG 3 '(SEQ ID NO: 3).

More specifically, for the expression of eukaryotic cells and retroviruses, BamHI and HindIII restriction enzymes were prepared to have a cleavage site, and the pRNA-U6.1 / Neo ( The recombinant vector was obtained by cloning into a vector of GenScipt, USA.

That is, 5'-GGATCCCGCCATCGAGAAGCTGGCAGTAGTTGATATCCGCTACTGCCAGCTTCTCGATGGTTTTTTCCAAAAGCTT-3` (Forward; SEQ ID NO: 4) for eukaryotic cell production and retrovirus production.

3'-CCTAGGGCGGTAGCTCTTCGACCGTCATCAACTATAGGCGATGACGGTCGAAGAGCTACCAAAAAAGGTTTTCGAA-5 '(Reverse; SEQ ID NO: 5) was used.

The nucleotide sequence was cloned into pSUPER-retro-GFP / Neo vector (Oligoengine) for retrovirus expression to prepare shRNA plasmids. After transfection into the Plat-E cell line capable of replicating retroviruses, extracellular suspension was collected and used.

Adenoviruses expressing CK-B shRNAs were expressed in RNAi-Ready-pSIREN-shuttle vector (Clontec) with a U6 promoter for RNA expression.

5'-CGCCATCGAGAAGCTGGCAGTAGTTGATATCCGCTACTGCCAGCTTCTCGATGGTTTTTTCCAA-3` (Forward; SEQ ID NO: 6) and

3′-GCGGTAGCTCTTCGACCGTCATCAACTATAGGCGATGACGGTCGAAGAGCTACCAAAAAAGGTT-5 ′ (Reverse; SEQ ID NO: 7) was cloned and digested with I-CeuI / PI-SceI restriction enzymes to produce a cloned back pAdeno-X vector (Clontech). PAdeno-CK-B-sh DNA and control shRNA for expressing adenoviruses were transfected into HEK 293 cell line using Fugene 6 (Roche) to lyse the cells to obtain adenovirus by CsCl density gradient centrifugation. It was used after.

Example 6 Osteoclasts in vitro bone resorption Activity analysis

In order to analyze the degree of bone resorption activity of osteoclasts, the following procedure was carried out.

Bone marrow-derived macrophages were treated with osteoclast differentiation cultures on dentin sections for 5 days, and the resulting osteoclasts were treated with CK-B shRNA retrovirus and control Luc shRNA retrovirus. After 24 hours, the osteoclast differentiation culture was again treated and cultured for 24 hours. Creatine Kinase (CK) inhibitor cyclocreatine (Ccr, Sigma) was used as a positive control. The osteoclasts differentiated from dentin sections were treated with cyclocreatine at a concentration of 0.5-1.5 mM for 24 hours. In addition, bone marrow-derived cells of CK-B-deficient mice were used as other positive controls, and bone marrow-derived cells of CK-B-deficient mice were observed by differentiation for 6 days. Bone resorption was observed under an optical microscope by removing the cells on the dentin surface by sonication and staining with 1% toluidine blue solution, and quantified using an image analysis system (Image Pro-Plus, Media Cybernetics).

Example 7 Observation of Actin Ring Structure of Osteoclasts Using Confocal Microscopy

Bone marrow-derived macrophages were differentiated into osteoclasts in osteoclast differentiation cultures for 3 days, and then treated with CK-B shRNA retrovirus and cultured in osteoclast differentiation cultures for 40 hours. Thereafter, the cells were fixed in 3.7% formaldehyde / PBS solution for 5 minutes and then treated with 0.5% saponin solution for 20 minutes to facilitate invasion of the antibody. In order to prevent nonspecific antibody binding reaction, 2% BSA / PBS solution was treated, followed by FITC-labeled phalloidin (manufactured by Sigma) which binds to actin. Fluorescence images were observed under confocal microscopy (LSM 5 PASCAL, Carl Zeiss). The total number of multinucleated cells and the number of multinucleated cells with actin ring structure were measured, and then the percentage of actin ring positive cells was measured. .

Example 8. Rho Protein Activity Assay

 Rho protein activity was used for products and methods of Pierce (Rockford, IL). Cells were lysed (25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM MgCl 2, 1% NP-40, 1 mM DTT, 5% glycerol, 1 g / ml leupeptin, 1 g / ml aprotinin, and 1 GST-rhotekin-RBD binding to activated RhoA protein in cell suspension after lysis with mM PMSF) was treated with Immobilized Glutathione Disc for 2 hours at 4 ° C, washed with only bead and heated for 5 minutes to induce protein denaturation. . The extracted protein was electrophoresed under an SDS-PAGE gel and then transferred to a nitrocellulose membrane, followed by Western blotting using an anti-Rho (Upstate) antibody.

Example 9. V-ATPase Activity Assay

V-ATPase activity of osteoclasts was measured by BCECF (2 ', 7'-bis), a pH-sensitive probe in the presence of Na ⁺ / H ⁺ -exchanger inhibitor EIPA [5- (N-ethyl-N-isopropyl) amiloride. (carboxyethyl) -5 (6) -carboxyfluorescein) was treated by measuring the intracellular pH (pHi) change. Bone marrow-derived macrophages were placed on 30-mm cover glass and cultured in osteoclast differentiation medium for 5 days to obtain mature osteoclasts, and were used for V-ATPase activity analysis according to inhibition of CK-B activity. After pretreatment of 1 mM Ccr for 30 minutes to mature osteoclasts, BCECF acetoxymethyl ester (BCECF-AM) at 1 M concentration was treated at 37 ° C. for 30 minutes, and then introduced into cells, followed by acid loading buffer (145 mM NaCl, 5 mM). KCl, 1 mM NaH ₂ PO ₄ , 1 mM Na ₂ SO ₄ , 1.8 mM CaCl ₂ , 30 mM HEPES, 1 mM MgCl ₂ , 10 mM glucose, 40 mM NH ₄ Cl, pH 7.4) solution for 15 minutes. Again, the solution was replaced with non-acid buffer (acid loading buffer missing NH ₄ Cl), and pHi change according to the presence or absence of 5 M EIPA was measured using the Intracellular Ion Image System (Olympus, IX71). Fluorescence measured at intervals of 0.5 seconds at 495 nm and 440 nm was analyzed using Metafluor Universal Imaging software. To measure V-ATPase activity following RhoA expression inhibition, bone marrow-derived macrophages were differentiated into multinucleated osteoclasts, followed by RhoA siRNA oligonucleotide duplex (5'-CAUGUAGAGUUGGCUUUAUGGGACA-3 ') using Lipofectamine 2000 (Invitrogen) or Negative control duplex (Invitrogen) was transfected and V-ATPase activity was measured after incubation in osteoclast differentiation culture for 1 day.

Example  10. Intracellular ATP  Concentration measurement

Total ATP concentration in the cells was measured using a ^ENLITEN? ATP Bioluminescence Assay Detection System Kit (Promega Ltd.). To measure the ATP concentration of CK-B deficient mouse cells, bone marrow-derived macrophages were isolated and cultured in osteoclast differentiation medium for 48 hours, and then cells were lysed using Glo-lysis buffer (promega). The same amount of luciferinluciferase reaction buffer was added and treated at 20 ° C. for 10 minutes, and luminescence was measured on an LB 9501 Lumat luminometer (Berthold GmbH).

Example 11. CK-B Defective Mice

All animal experiments were performed according to international guidelines with the approval of the Animal Experimental Ethics Committee of Seoul National University and Radboud University (Nijmegen). Normal and CK-B deficient mice used in the experiments obtained F2 CK-B +/- heterozygotes obtained by crossbring between 25% 129 / Ola and 75% C57Bl / 6 background through 10-12 generation crosses.

Example 12. In vivo bone resorption analysis using mouse and rat ovariectomy model animals

In 8-week-old normal and CK-B-deficient mice (n = 9 per experimental group) or 12-week-old Sprague-Dawley rats (n = 5 per experimental group), ovarian resection was performed and the operation was performed without ovarian resection. In case of sham operated, it was used as a control. Four weeks after surgery, the femurs and tibias were removed and the degree of bone resorption was observed by μ-CT and morphometric analysis. In order to observe the bone resorption effect of CK-B inhibition in rats, 3 weeks after surgery, Ccr (0.5 g / kg) or vehicle (0.005 N HCl) solution was used for 1 week using gastric Zonde needle (Natsume). Was administered twice for 4 weeks. To measure the biochemical bone resorption index, urine DPD concentration was measured by ELISA (enzyme-linked immunosorbent assay) kit (Pyrilinks, Metra Biosystems, Inc.) method and creatinine using QuantiChromTM Creatinine Assay Kit (BioAssay System). The concentration is measured and shown quantitatively.

Example 13. Bone Absorption Model Animal Analysis by LPS Administration

Four-week-old normal and CK-B-deficient mice (n = 8 per experimental group) were intraperitoneally injected with PBS or LPS (5 mg / kg) twice at four-day intervals. CT absorption was measured and bone mineral density (BMD) was measured.

Example 14 Bone Absorption Model Animal Analysis by PTH Administration

PTH injection with Alzet osmotic minipumps was performed to induce bone resorption following continuous PTH exposure. Alget osmotic minipumps released at 0.5 μl per hour in human PTH (peptides consisting of amino acids 1-84) or vehicle (PBS) in 8-week-old normal ICR mice (n = 5) were injected subcutaneously between the scapula for 4.3 pmol / h for 5 days. Induced PTH to be released. To observe the effects of CK inhibitors, Ccr (0.5 g / kg) or vehicle (0.005 N HCl) was administered on the 1st and 3rd day of surgery using a gastric Zonde needle (Natsume). Tibia was extracted and observed for the degree of bone resorption using μ-CT and histological analysis.

Example 15 Skull Bone Resorption Model Animals

In the skull in vivo bone resorption model, CK-B shRNA or control shRNA adenovirus (1 × 10 ¹⁰ MOI / mouse) was injected subcutaneously into the skull and pretreated with bone resorption. After 2 days, collagen sheets (width, 100 mm ² ) treated with PBS, IL-1α (2.5 μg) alone or IL-1 (2.5 μg) and 30 μl of shRNA adenovirus were planted in the center of the subcutaneous skull (n = 5), 4 days later, the skull was removed and the bone resorption level of the skull was observed by μ-CT analysis.

Example 16. Radiologic Analysis, BMD (Bone Mineral Density) Measurement and Histological Analysis Using Micro-CT

In order to observe the degree of bone resorption in vivo, the leg, foot, or skull including femur and tibia were extracted and obtained a total of 320 ~ 350 tomographic slices using a 1072 Microtomograph (SkyScan) system. Product) to reconstruct the three-dimensional image. BMD of the leg bone was measured using Lunar PIXImus Densitometer (GE Medical Systems), which is a dual-energy x-ray absorptiometry (DEXA) densitometry. Bone was fixed in 4% formaldehyde / PBS solution for histological analysis and embedded in paraffin after demineralization and dehydration. 4 mm thick sections were obtained from paraffin removal and dehydration, and stained with hematoxylin and eosin (H & E stain) solutions. TRAP staining was performed to observe osteoclasts. All the results were analyzed by the Bioquant Bone Morphometry System (R & M Biometrics Corp., Nashville, TN) through the various indicator measurements.

Example 17 Statistical Process and Verification

All the quantitative experiments were repeated at least three times and the results were expressed as mean standard error. The statistical significance of the results was analyzed by two-tailed Student t-test method.

A vector containing a nucleotide sequence encoding an siRNA that inhibits the expression of the CK-B gene in an RNA expression vector, wherein the vector inhibits osteoclasts of osteoclasts by inhibiting the expression of CK-B by the transcribed siRNA and its The present invention on the application method can be used to prevent and treat bone metabolic diseases by inhibiting the formation of actin ring structure, the formation of RhoA protein, the activity of vATPase and osteoclasts of osteoclasts. The siRNA expression vector of the present invention is less toxic or side effects than conventional antisense oligomers or viral vectors, but it is thought to have a superior effect compared to the existing antisense oligomers and is very excellent when used for anticancer gene therapy or stem cell differentiation control. It is safe and effective.

Figure 1 shows the degree of CK-B expression during osteoclast differentiation by RANKL.

( a ) MS / MS profile results including CK-B protein images on silver stained 2D gels for intracellular proteins before and after differentiation and DLFDPIIEER peptide sequences of CK-B protein.

( b, c ) Western blotting results of CK-B protein expression during osteoclast differentiation from bone marrow-derived macrophages or RAW264.7 cells.

( D ) CK-M mRNA expression of 1-4 days by treating M-CSF and RANKL in bone marrow-derived macrophages. Comparison of results using RNA extracted from muscle cells using positive control.

( e ) UbCKmit mRNA expression in osteoclast differentiation using bone marrow-derived macrophages. Comparison with CK-B expression level on day 4 of differentiation.

Figure 2 shows the effect of inhibiting osteoclast activity according to the inhibition of CK-B expression and pharmacological activity using CK-B shRNA.

( a ) Confirmation of inhibition of CK-B expression by differentiating myeloid macrophages into pre osteoclasts followed by shRNA retrovirus treatment for 24 hours. Luciferase shRNA (Luc-sh) adenovirus was used as a control.

( b, c ) Confirmation of inhibition of osteoclast activity by CK-B shRNA retrovirus in dentin fragments. Use luc shRNA retrovirus as a control. *** Significance of inhibitory effect of CK-B-sh treatment group on P <0.001 Luc-sh control group.

( d ) The effect of decreasing bone resorption activity by cyclocreatine (Ccr), a CK inhibitor with no cytotoxic concentration.

( e ) The effect of actin ring formation on osteoclasts by CK-B shRNA retrovirus treatment was observed under confocal microscopy after FITC-phalloidin staining. Expressed as the ratio of multinucleated cells with an actin ring to the total number of multinuclear cells. ** Significance of CK-B-sh treated group compared to P <0.01 Luc-sh treated group.

( f ) Ccr inhibitory effect on RhoA activity of osteoclasts. Rho activity analysis after Ccr treatment for 1 hour in osteoclasts differentiated into osteoclast differentiation medium containing bone marrow-derived macrophages containing 30 ng / ml M-CSF and 100 ng / ml RANKL (left figure). Alternatively, the osteoclasts were treated with Ccr for the last 45 minutes during 3 hours without serum and treated with 100 ng / ml of M-CSF and 500 ng / ml of RANKL for 15 minutes, followed by Rho activity assay (right picture). To observe RhoA in GTP-coupled activated form.

( g ) Inhibition of V-ATPase activity of osteoclasts by Ccr. Treatment of osteoclasts differentiated from bone marrow-derived macrophages for 30 minutes after treatment with Ccr and EIPA (Na ⁺ / H ⁺ exchanger inhibitor) under the conditions treated with pHi control V-ATPase activity by measuring the pHi response. Arrows indicate when to replace non-acid buffer solutions.

( h, i ) Inhibition of V-ATPase activity of osteoclasts by inhibition of RhoA expression by siRNA.

In Figure 3 is due to the CK-B deficient in vitro and in In vivo bone resorption activity was analyzed.

( a ) Western blotting results of CK-B expression in osteoclasts of normal and CK-B deficient mice.

( b, c ) Observed in vitro bone resorption activity of osteoclasts differentiated from bone marrow-derived macrophages in normal and CK-B deficient mice in dentin sections. Dentin sections were stained with toluidine blue solution and the area absorbed was measured. *** P <0.001 Significance for activity of CK-B deficient osteoclasts compared to normal osteoclasts.

( d ) Measurement of RhoA protein activity in osteoclasts differentiated using normal and CK-B deficient mice. CK-B deficient osteoclasts with reduced RhoA activity.

( e ) CK-B deficient osteoclasts with reduced V-ATPase activity compared to normal osteoclasts. ( f ) Normal and CK-B deficient osteoclasts showing the same V-ATPase protein expression.

( g ) Determination of intracellular ATP concentrations in normal and CK-B deficient mice by treatment with 30 ng / ml M-CSF alone or with 30 ng / ml M-CSF and 100 ng / ml RANKL simultaneously result.

( hq ) Effect of CK-B on osteoporosis in ovarian ablation model animals. Normal and CK-B deficient mice were treated with ovarian resection and compared with mice treated with surgery without ovarian resection 4 weeks later. Results of m-CT analysis using the femur ( hl ) and indicators indicating the degree of bone resorption ( mp ). Results of histological analysis by staining HE ( m , pictured above) and TRAP ( m , pictured below) in the tibia. Ovariectomized CK-B deficient mice ( q ), which showed reduced bone resorption activity as compared to normal ovarian resected mice as measured by urine DPD. BV / TV, volume of bone per tissue volume; Tb.Th, cavernous bone thickness; Tb.Sp, inter-cavernosal distance; Th.N, spongy bone marrow; Oc.N / B.Pm, osteoclasts per bone circumference; ES / BS, absorbed surface per bone surface. * P <0.05, ** P <0.01, *** P <0.001 Significance between the experimental groups indicated. NS, no significance.

( rt ) The role of CK-B on bone resorption by LPS. Two injections of PBS or LPS (5 mg / kg) in normal and CK-B deficient mice. Cross-section ( r , above) and three-dimensional images ( r , below) of m-CT analysis of the femur showing reduced bone loss in CK-B-deficient mice. BV / TV ( s ) and BMD ( t ) in CK-B deficient mice, which were reduced compared to normal mice showing significant bone loss induction by LPS. * P <0.05, ** P <0.01 Significance between experimental groups. NS, no significance.

4 is It shows the effect of inhibiting bone destruction of rats and mice by the CK inhibitor.

( ae ) Effect of CK inhibitor Ccr on bone loss following ovarian resection in rats. Vehicle or Ccr (0.5 g / kg) was administered for 4 weeks in operatively treated rats and ovarian resections. M-CT analysis of Ccr-administered ovarian resected rat femur with reduced bone loss ( a ). Bone resorption index analysis showing the degree of tibial bone destruction reduced by Ccr administration ( bd ). Reduction of DPD in Urine by Ccr Administration ( e ). * P <0.05, ** P <0.01, *** P <0.001 Significance between the experimental groups indicated.

(Fi) in accordance with the Ccr administration of bone loss in mice by administration of PTH vivo effect. CCR and vehicle were administered twice on Days 0 and 3, respectively, during 5 days of continuous PTH (1-84) administration to ICR mice. Bone resorption index analysis of histological specimens of tibia showing bone loss reduced by Ccr. * P <0.05, ** P <0.01, *** P <0.001 Significance between the experimental groups indicated.

( j and k ) in vivo Effect of CK-B shRNA on Bone Resorption. CK-B shRNA or control shRNA was combined with PSB or IL-1, soaked in collagen sheets and treated in the mouse skull. Three-dimensional image ( j ) and BV / TV ( k ) of skull according to μ-CT analysis after 5 days. * P <0.05, ** P <0.01 Significance between experimental groups.

( l ) Schematic diagram showing the importance of ATP supply by the CK-B protein involved in the bone resorption activity of osteoclasts. Increased CK-B upon osteoclast differentiation by RANKL is involved in RhoA and V-ATPase activity and actin regulation in the intracellular framework. Therefore, RhoA activity and actin structure in osteoclasts are important for the formation of sealing zone, and V-ATPase activity plays an important role in the degradation of bone matrix by promoting acidification in lacuna structure where bone resorption occurs. As a result, it is possible that V-ATPase activity is indirectly regulated by RhoA and actin, suggesting that this process is regulated by CK-B.

5 shows the analyzed peptide sequence of CK-B protein. Ten peptide sequences (shown in red) were identified using tandem mass spectrometry to confirm that they were CK-B proteins.

Figure 6 shows that Ccr does not affect the survival of osteoclasts.

Bone marrow-derived macrophages were treated with 30 ng / ml of M-CSF and 100 ng / ml of RANKL for 5 days on dentin sections to induce differentiation into osteoclasts, and Ccr was labeled on the osteoclasts or small multinuclear osteoclasts at this time. Treatment was done for 24 hours. Cell viability was measured using a Cell Counting Kit (manufactured by Dojindo, Japan), which is a modified method of MTT assay. The measured OD of the Y axis indicates the number of living cells.

7 shows the effect of Ccr on the actin structure.

 Bone marrow-derived macrophages were treated with 30 ng / ml of M-CSF and 100 ng / ml of RANKL for 3 days to induce differentiation into osteoclasts just before fusion.

( a, b ) CK-B anti-sense (5'-AGUCAGCCUAGUCCGAUAGCGCUAU-3 'or scrambled (5'-GUGUCUGCAACAGCUUAGCCAUCAG-3' oligonucleotide) using Lipofectamine 2000 (available from Invitrogen) to osteoclasts at 30 ng / ml -16 h transfection with CSF, 24 h after incubation for 24 h with 30 ng / ml M-CSF and 100 ng / ml RANKL followed by actin staining with FITC-conjugated phalloidin Actact ring structure in whole osteoclast Determination of the number of multinucleated osteoclasts with P. ** Significance of anti-sense oligonucleotide treated group compared to scramble treated group with P <0.01.

( c ) Actin staining with FITC-phalloidin after Ccr treatment at 0.1-1.5 mM concentration for 24 hours in 30 osteong cells treated with 30 ng / ml M-CSF and 100 ng / ml RANKL. ** P <0.01, *** P <0.001 Significance of Ccr treated group compared to control.

( d ) Actin staining with FITC-phalloidin after treatment with bone marrow-derived macrophages treated with 30 mM ng / ml M-CSF and 100 ng / ml RANKL for 5 days after treatment with 1 mM Ccr for 3 hours . Bar size, 200 mm.

Figure 8 confirms the V-ATPase specific activity in osteoclasts.

( a ) Intracellular pH (pHi) regulation activity in osteoblasts according to the treatment of 5- (N-ethyl-N-isopropyl) amiloride (EIPA) with Na ⁺ / H ⁺ -exchanger inhibitor (left and right picture). ( b ) Intracellular pH (pHi) regulatory activity in myeloid-derived macrophages, progenitor cells prior to differentiation. ( c ) pHi recovery activity was assessed in differentiated OCs in the presence of intracellular pH (pHi) regulating activity in osteoclasts with and without treatment with bafilomycin A, an EIPA and V-ATPase specific inhibitor. Inhibition of intracellular pH (pHi) regulation activity at 100 nm concentration of bafilomycin A. Arrows indicate when to replace non-acid buffer solutions.

Figure 9 shows that the absorption area of osteoclasts decreases due to CK-B deficiency.

Bone marrow-derived macrophages of normal and CK-B deficient mice were treated with 30 ng / ml M-CSF and 100 ng / ml RANKL for 6 days to differentiate, followed by TRAP staining to determine the number of multinuclear osteoclasts. The degree of absorption was measured by the area absorbed after toluidine blue staining and expressed as the absorption area per osteoclast. ** Significance of CK-B deficient osteoclasts compared to P <0.01 normal osteoclasts.

10 shows a comparison of actin ring formation in normal and CK-B deficient osteoclasts.

Bone marrow-derived macrophages of normal and CK-B deficient mice were treated with 30 ng / ml M-CSF and 100 ng / ml RANKL for 6 days to differentiate, followed by FITC-phalloidin staining to observe actin ring structures under confocal microscopy. . * P <0.05 Significance of CK-B deficient osteoclasts compared to normal osteoclasts.

Figure 11 shows the role of CK-B in bone loss by PTH. Eight weeks-old normal and CK-B deficient mice (n = 5) were induced with PTH exposure for 5 days using Alzet osmotic minipump.

CK-B-deficient mice showing reduced bone loss through ( a ) μ-CT analysis of the femur and ( b - g ) bone resorption index analysis on tibial tissue samples. BV / TV, volume of bone per tissue volume; Th.N, spongy bone marrow; Tb.Th, cavernous bone thickness; Tb.Sp, inter-cavernosal distance; ES / BS, surface absorbed per bone surface; Oc.N / B.Pm, osteoclasts per bone circumference. * P <0.05, ** P <0.01, *** P <0.001 Significance between the experimental groups indicated. NS, no significance.

12 shows the inhibitory effect of Ccr on bone destruction by ovarian ablation.

Vehicle or Ccr (0.5 g / kg) was orally administered for 4 weeks in the experimental group that underwent surgery and the ovarian resected rats. Tb.Th, cavernous bone thickness; Tb.Sp, inter-cavernosal distance; Th.N, spongy bone marrow. *** P <0.001 Significance between experimental groups indicated.

Figure 13 shows the inhibitory effect of Ccr on bone loss by PTH.

( a ) Oral administration of vehicle or Ccr (0.5 g / kg) on day 0 and day 3 with 8-day-old ICR mice (n = 5) inducing PTH exposure for 5 days with Alzet osmotic minipump.

( b, c ) Ccr administered mice showing reduced bone loss through μ-CT analysis of the femur and bone resorption index analysis in the tibial tissue specimens. Tb.Th, cavernous bone thickness; Tb.Sp, spongy bone distance. * P <0.05, ** P <0.01, *** P <0.001 Significance between the experimental groups indicated. NS, no significance.

Figure 14 shows the inhibitory effect of Ccr on LPS and CIA induced bone destruction.

( a , b ) Mice were intraperitoneally administered PBS or LPS (5 mg / kg) on days 0 and 4, and vehicle or Ccr (0.5 g / kg) was intraperitoneally administered on days 0, 2 and 5 7 days later, the femur was removed and analyzed by μ-CT. Femoral transverse (left) and longitudinal (right) images and BV / TV results of the Ccr-administered group showing inhibitory effects on bone destruction by LPS administration. * P <0.05, ** P <0.01 Significance between experimental groups.

(Ce) μ-CT analysis of the secondary result after induce CIA conditions according to the method to include the joint region of the vehicle or Ccr group (c). HE staining results of the femur ( d ) and BV / TV results ( e ). ** P <0.01 Significance between experimental groups.

Figure 15 shows the results of inhibition of CK-B expression by CK-B shRNA adenovirus.

Induced differentiation from bone marrow-derived macrophages to osteoclasts, and then introduced into cells using CK-B shRNA adenovirus and induced differentiation into osteoclasts after treatment with 30 ng / ml M-CSF and 100 ng / ml RANKL after 24 hours. . The resulting osteoclasts were fused and Western blotting was performed using an anti-CK-B antibody. GFP shRNA was used as a control.

Figure 16 is due to the IL-1α in The effect of CK-B on in vivo cranial bone resorption is shown. Bone resorption was induced by inserting collagen sheets treated with PBS or IL-1α into the skull (n = 5) of 4-week-old and CK-B deficient mice.

( a ) Three-dimensional images analyzed by μ-CT after 5 days and ( b ) BV / TV. *** P <0.001 Significance between experimental groups indicated.

Figure 17 shows a vector expressing shRNA. The green underlined portion represents the restriction enzyme cleavage site and the green arrow indicates the region where the nucleotide to encode the shRNA is inserted.

( a ) shows a vector for eukaryotic cell expression, ( b ) retrovirus expression vector, and ( c ) adenovirus expression vector.

<110> Seoul national university indusrtry foundation <120> Anti-osteoclast mediated bone resorption siRNA vector for gene          therapy <160> 9 <170> KopatentIn 1.71 <210> 1 <211> 1498 <212> RNA <213> Mus musculus creatine kinase, brain, mRNA <400> 1 gcacaggcau ccaucgcccc ugcuucgucc ggcaucccgc ccgcugccgc cgccaugccc 60 uucuccaaca gccauaauac gcagaagcug cgcuucccgg ccgaggauga guucccugau 120 cugagcagcc acaacaacca uauggccaag gugcugaccc cggagcugua cgccgagcuc 180 cgugccaagu gcacgccgag cggcuuuacu uuggacgacg ccauucagac uggcguagac 240 aauccgggcc acccguacau caugacugug ggugcagugg cgggcgacga ggagaguuac 300 gacguauuca aggaccucuu cgaccccauu auugaggagc ggcacggcgg cuaccagccc 360 agugaugagc acaagaccga ccucaaccca gacaaccugc aggguggcga ugaccuggac 420 cccaacuacg ugcugagcuc gcgagugcgc acaggccgca gcauccgcgg cuucugucuc 480 cccccgcacu gcagccgcgg ggagcgccgc gccaucgaga agcuggcagu agaagcucug 540 uccagccuag auggcgaccu gucuggcagg uacuacgcgc ucaagagcau gacugaggcg 600 gagcagcagc agcucauuga cgaccacuuc cucuucgaua agccuguguc gccucugcug 660 cuggccuccg gcauggcccg cgacuggccg gaugcucgug gcauauggca caaugacaau 720 aagacuuucc ugguguggau uaacgaggag gaccaccugc gagucaucuc caugcagaag 780 gggggcaaca ugaaggaagu guucacccga uucugcaccg gccucacuca gaucgaaacu 840 cucuucaagu ccaagaacua ugaguucaug uggaauccuc accugggcua cauccucaca 900 ugcccaucca accugggcac cggacugcgg gcaggugugc acaucaagcu gccccaccug 960 gggaagcacg agaaguucuc ggaggugcuc aagcggcugc ggcuucagaa gcgaggcaca 1020 gguggcgugg acaccgcugc ugucgguggg guguuugaug ucuccaacgc ugaccgccug 1080 ggcuucucgg agguggaacu ggugcagaug gugguggacg gagugaaacu acucauugag 1140 auggagcaac ggcucgagca gggucaggca aucgaugacc ucaugccggc ccagaaguga 1200 agccuggccc ucgccaccau caggcugccg cuuccuaacu uauuacccgg gcagugcccg 1260 ccaugcaucc uugauguuug ccgccuggcg gcugagcccu uagccucgcu guagagacuu 1320 cugucgcccu ggguagaguu uauuuuuuug auggcuaagc uguugcugac acugaaaaua 1380 aacuaggguu uggccugccc uaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1440 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaa 1498 <210> 2 <211> 21 <212> DNA <213> sense siRNA sequence interfering CK-B gene <400> 2 ccatcgagaa gctggcagta g 21 <210> 3 <211> 52 <212> DNA <213> shRNA sequence interfering CK-B gene <400> 3 ccatcgagaa gctggcagta gttgatatcc gctactgcca gcttctcgat gg 52 <210> 4 <211> 76 <212> DNA <213> forward shRNA (or shRNA retrovirus) sequence for CK-B gene <400> 4 ggatcccgcc atcgagaagc tggcagtagt tgatatccgc tactgccagc ttctcgatgg 60 ttttttccaa aagctt 76 <210> 5 <211> 76 <212> DNA (213) reverse shRNA (or shRNA retrovirus) sequence for CK-B gene <400> 5 cctagggcgg tagctcttcg accgtcatca actataggcg atgacggtcg aagagctacc 60 aaaaaaggtt ttcgaa 76 <210> 6 <211> 64 <212> DNA <213> forward shRNA adenovirus sequence for CK-B gene <400> 6 cgccatcgag aagctggcag tagttgatat ccgctactgc cagcttctcg atggtttttt 60 ccaa 64 <210> 7 <211> 64 <212> DNA <213> reverse shRNA adenovirus sequence for CK-B gene <400> 7 gcggtagctc ttcgaccgtc atcaactata ggcgatgacg gtcgaagagc taccaaaaaa 60 ggtt 64 <210> 8 <211> 527 <212> DNA <213> U6 promoter <400> 8 ccccagtgga aagacgcgca ggcaaaacgc accacgtgac ggagcgtgac cgcgcgccga 60 gcccaaggtc gggcaggaag agggcctatt tcccatgatt ccttcatatt tgcatatacg 120 atacaaggct gttagagaga taattagaat taatttgact gtaaacacaa agatattagt 180 acaaaatacg tgacgtagaa agtaataatt tcttgggtag tttgcagttt taaaattatg 240 ttttaaaatg gactatcata tgcttaccgt aacttgaaag tatttcgatt tcttggcttt 300 atatatcttg tggaaaggac gaaacaccgt gctcgcttcg gcagcacata tactaaaatt 360 ggaacgatac agagaagatt agcatggccc ctgcgcaagg atgacacgca aattcgtgaa 420 gcgttccata tttttacatc aggttgtttt tctgttttta catcaggttg tttttctgtt 480 tggttttttt tttacaccac gtttatacgc cggtgcacgg tttacca 527 <210> 9 <211> 20 <212> DNA <213> T7 promoter <400> 9 taatacgact cactataggg 20  

Claims (15)

CK-B comprising a promoter capable of initiating the expression of a short interfering RNA (siRNA) of SEQ ID NO: 8 or SEQ ID NO: 9 and a sequence complementary to a portion of the brain-type creatine kinase (CK-B) mRNA of SEQ ID NO: 1 A CK-B gene suppression siRNA expression vector comprising a nucleotide sequence encoding an siRNA that inhibits the expression of a gene in a transcriptional direction. According to claim 1, wherein part of the CK-B (brain-type creatine kinase) mRNA CK-B gene suppression siRNA, characterized in that the nucleotide corresponding to 512 ~ 532 nt of the CK-B mRNA sequence of SEQ ID NO: 1 Expression vector. The nucleotide sequence encoding the siRNA is reverse complementary to the sequence of SEQ ID NO: 2 corresponding to 512-532 nt of the CK-B mRNA sequence of SEQ ID NO: 1 and SEQ ID NO: 2 ) CK-B gene suppression siRNA expression vector, characterized in that the sequences are all present on the same strand. The nucleotide sequence encoding the siRNA is reverse complementary to the sequence of SEQ ID NO: 2 and SEQ ID NO: 2 corresponding to 512-532 nt of the CK-B mRNA sequence of SEQ ID NO. CK-B gene suppression siRNA expression vector, characterized in that a loop sequence is inserted between the sequences to form a hairpin structure. The CK-B gene suppression siRNA expression vector of claim 4, wherein the nucleotide sequence encoding the siRNA comprises the nucleotide sequence of SEQ ID NO: 3. 6. According to claim 5, The CK-B gene suppression siRNA expression vector is a nucleotide having a nucleotide sequence of SEQ ID NO: 3 is prepared by inserting in the transcription direction after the U6 promoter having a nucleotide sequence of SEQ ID NO: 8 PRNA-U6.1 / Neo with a cleavage map of 17a. According to claim 5, The CK-B gene suppression siRNA expression vector is a nucleotide having a nucleotide sequence of SEQ ID NO: 3 is prepared by inserting in the transcription direction after the T7 promoter having a nucleotide sequence of SEQ ID NO: 9 PSUPER-retro-GFP / Neo with a cleavage map of 17b. The RNAi-Ready-pSIREN of claim 5, wherein the CK-B gene suppression siRNA expression vector is prepared by inserting a nucleotide having a nucleotide sequence of SEQ ID NO: 3 into the transcription direction after a U6 promoter having a nucleotide sequence of SEQ ID NO: 8 pAdeno-CK-B-sh DNA having a cleavage map of FIG. 17C, which is prepared by inserting a gene fragment obtained by cleaving with a restriction enzyme from a shuttle vector. A host cell transformed with the CK-B inhibitory siRNA expression vector of any one of claims 1 to 8. CK-B gene suppression siRNA comprising the nucleotide sequence of SEQ ID NO: 2. CK-B gene suppression shRNA having a hairpin structure comprising a nucleotide sequence of SEQ ID NO: 2 and a nucleotide sequence reversely complementary to SEQ ID NO: 2 linked to a loop region thereof. A composition for inhibiting bone resorption of osteoclasts comprising the expression of a CK-B (brain-type creatine kinase) gene transcribed in SEQ ID NO: 1 or an activity inhibitor of the expressed protein thereof as an active ingredient. The method of claim 12, wherein the expression inhibitor of the CK-B gene is CK-B gene suppression siRNA expression vector of any one selected from claims 1 to 8 or CK-B gene suppression siRNA of claim 10 or CK of claim 11 -B gene inhibition shRNA composition for inhibiting bone resorption of osteoclasts. The composition for inhibiting bone resorption of osteoclasts according to claim 12, wherein the activity inhibitor of the CK-B protein is cyclocreatine (Ccr; cyclocreatine). A method for screening bone resorption inhibitors of osteoclasts, comprising the following steps: (1) treating any agent with an animal cell expressing CK-B protein; (2) comparing the animal cell with a control not treated with the medicament to determine whether the expression or activity of the CK-B protein is reduced.

Images