WO2010049103A1 - Protéines apom tronquées solubles et leurs utilisations médicales - Google Patents

Protéines apom tronquées solubles et leurs utilisations médicales Download PDF

Info

Publication number
WO2010049103A1
WO2010049103A1 PCT/EP2009/007629 EP2009007629W WO2010049103A1 WO 2010049103 A1 WO2010049103 A1 WO 2010049103A1 EP 2009007629 W EP2009007629 W EP 2009007629W WO 2010049103 A1 WO2010049103 A1 WO 2010049103A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
polypeptide
apom
vector
seq
Prior art date
Application number
PCT/EP2009/007629
Other languages
English (en)
Inventor
Markus Stoffel
Christian Wolfrum
Original Assignee
Eth Zurich
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Eth Zurich filed Critical Eth Zurich
Publication of WO2010049103A1 publication Critical patent/WO2010049103A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/775—Apolipopeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to soluble truncated apoM proteins and derivatives thereof, capable of raising the apoA1 and HDL concentration in a mammal upon administration into the blood circulation of said mammal, corresponding nucleic acids as well as vectors and host cells containing these.
  • the present invention is directed to the use of said soluble truncated apoM proteins and derivatives thereof for manufacturing medicaments, in particular medicaments for raising the HDL concentration, for the prophylaxis and/or treatment of atherosclerosis, and also for increasing alveolar surfactants, in particular for the prophylaxis and/or treatment of Respiratory Distress
  • RDS RDS
  • ARDS Acute Respiratory Distress Syndrome
  • HDL high-density lipoproteins
  • RCT reverse cholesterol transport
  • HDL has also been shown to have antioxidant, anti-inflammatory and anti-thrombotic properties. These properties contribute to HDL anti-atherogenicity and HDL concentrations are inversely correlated to cardiovascular disease.
  • HDL is heterogeneous in density, size, lipid composition and apolipoprotein (apo) content, which might explain the diverse functions of the particle.
  • the small discoidal nascent HDL particles have a pre- ⁇ migrating property on an agarose gel while the larger spherical mature HDL migrates as ⁇ -particles.
  • the liver is the primary origin of plasma HDL and the liver specific deficiency of the ATP binding cassette A1 (AbcA1), that controls the rate-limiting step in HDL particle assembly, leads to an 80% reduction of plasma HDL.
  • Nascent immature pre- ⁇ migrating particles can also be formed in extra hepatic tissue during the initial steps of RCT.
  • pre- ⁇ migrating particles can be generated when larger HDL particles are metabolized.
  • Catabolism of HDL particles includes remodelling, selective cholesterol uptake and whole particle uptake by the liver or kidney. It has been demonstrated in vivo that the size of the particle determines the fate of HDL, mature HDL particles being catabolized mainly by the liver, whereas pre-/2 migrating particles are catabolized in the kidney.
  • the apolipoprotein content modulates the particle ' s function and catabolism.
  • apolipoproteins that are capable of associating with HDL are, for example, apoAI, apoAII, apoE, apoAIV, apoCs and apoM.
  • the most abundant HDL apolipoprotein is apoAI and it is important in RCT, since lipid free apoAI has been shown both in vivo and in vitro to associate with lipids forming nascent pre- ⁇ migrating particles.
  • apoAI plays a role in the maturation of the nascent particles since it is required for the normal function of lecithin cholesterol ester transferase (LCAT), an enzyme that converts free cholesterol to cholesterol esters. Therefore, apoAI also plays a central role in determining the lipid composition of the HDL particles.
  • LCAT lecithin cholesterol ester transferase
  • HDL high-density lipoprotein
  • apolipoprotein function and RCT the main goal being to increase plasma HDL levels.
  • the function of HDL in addition to plasma HDL concentrations, determines the particle ' s anti-atherogenic properties.
  • overexpressing either apoAI or apoAII increases HDL cholesterol.
  • apoAI is atheroprotective, while HDL from apoAII overexpressing transgenic mice is pro-inflammatory.
  • apoM apolipoprotein that recently had been shown to modulate HDL function in a beneficial manner
  • apoM A novel human apolipoprotein (apoM). J. Biol. Chem. 274, 31286-31290) by cloning an unrecognized 26 kDa protein in triglyceride-rich lipoproteins. Even though it has been shown that apoM can be associated with other lipoprotein particles, it is primarily present on HDL. Hence, the plasma concentration of apoM highly correlates with HDL in healthy humans (Axler, O., Ahnstrom, J., and Dahlback, B. (2007).
  • mice lacking apoM expression due to genetic deletion of the transcription factor Hnf-1 ⁇ 7cfr A or gene silencing of apoM by RNAi have an atypical lipoprotein profile with abnormally large HDL. In addition, these mice lack pre- ⁇ migrating particles. Conversely, over-expression of apoM by recombinant adenovirus in mice increases the amount of pre- ⁇ migrating particles and total HDL levels in plasma (Wolfrum, C, Poy, M. N., and Stoffel, M. (2005).
  • Apolipoprotein M is required for prebeta- HDL formation and cholesterol efflux to HDL and protects against atherosclerosis. Nat. Med. 11 , 418-422.). Furthermore, isolating apoM-containing HDL particles from human plasma by immunoaffinity chromatography leads to an additional peak in the lipoprotein profile that corresponds to the size of pre- ⁇ migrating particles (Christoffersen, C, Nielsen, L.B., Axler, O., Andersson, A., Johnsen, A.H., and Dahlback, B. (2006). Isolation and characterization of human apolipoprotein M-containing lipoproteins. J Lipid Res 47, 1833-1843.).
  • the apoM gene is only expressed in the liver and kidney and encodes 188 amino acids. Due to a glycosylation site in humans the protein is 26 kDa compared to 22 kDa in mouse. Structural computer modelling of apoM suggests that the protein belongs to the lipocalin family and in vitro findings indicate that apoM has the capability of binding to retinols, all-trans retinoic acid and 9-cis retinoic acid with its lipid binding pocket. However, the in vivo ligand of apoM remains to be determined. ApoM retains its 20 amino acids long signal peptide, like the HDL associated protein paraoxonase-1.
  • Atherosclerosis (“hardening of the artery) is associated with the deposition of cholesterol, cholesterol-esters, lipoproteins, collagen, calcification and sometimes even ossification of arteries leading to an increase in wall thickness, a corresponding decrease in the elasticity of the arterial wall and often partial or complete occlusion of the artery, all of which can eventually result in coronary thrombosis or infarction.
  • Respiratory Distress Syndrome is a breathing disorder of premature newborns in which the air sacs (alveoli) in a newborn ' s lung do not remain open because the production of surfactant is absent or insufficient.
  • the lungs produce a mixture of lipids (fats) and proteins called surfactant, which acts as a wetting agent and lines the surface of the air sacs, where it lowers the surface tension and allows the air sac to remain open throughout the respiratory cycle.
  • surfactant acts as a wetting agent and lines the surface of the air sacs, where it lowers the surface tension and allows the air sac to remain open throughout the respiratory cycle.
  • production of surfactant begins after about 34 weeks of pregnancy. The more premature the newborn, the greater the likelihood that RDS will develop after birth.
  • a corticosteroid drug typically betamethasone or dexamethason
  • a corticosteroid drug typically betamethasone or dexamethason
  • ARDS The Acute Respiratory Distress Syndrome
  • ARDS refractory hypoxemia
  • Alveolar-capillary damage in ARDS can be initiated by physical or chemical injury or by extensive activation of innate inflammatory responses. Such damage causes the lung ' s edema safety factor to decrease by about half and edema develops at low capillary pressures.
  • Widespread alveolar flooding in ARDS impairs alveolar ventilation, excludes oxygen and inactivates surfactant; this in turn decreases lung compliance, increases dispersion of ventilation and perfusion and produces intrapulmonary shunt.
  • the surfactant concentration in the alveoli plays a critical role not only in the normal breathing mechanism but is also an important factor involved in ARDS and RDS pathology, its absence or reduction (e.g. by inactivation in ARDS) contributing to alveolar dysfunction and edema formation.
  • the present invention relates to a soluble derivative of the apoM protein.
  • this aspect of the present invention relates a polypeptide having 80 or less than 80 amino acids and having at least 50 %, preferably at least 60 %, more preferably at least 80 %, most preferably at least 90 % amino acid sequence identity to 20 consecutive amino acids of the polypeptide of SEQ ID NO: 1 , wherein the polypeptide, a fragment and/or a functional derivative thereof i) is soluble under physiological conditions, ii) reduces the renal excretion of ApoA1 in a mammal, preferably human, iii) raises the ApoA1 and HDL concentration in a mammal, preferably human, upon intravenous administration of a pharmacologically effective amount thereof.
  • a preferred embodiment of the invention relates to a polypeptide of the invention having at least 5 %, preferably at least 9 %, more preferably at least 10 %, most preferably at least 12 % amino acid sequence identity to the polypeptide of SEQ ID NO: 1.
  • a polypeptide of the invention is one having at least 50 %, preferably at least 60 %, more preferably at least 70 or 80 %, most preferably at least 90 or 95 % amino acid sequence identity to or (ii) being identical to a polypeptide of any one of SEQ ID NO: 2, 3, or 4.
  • SEQ ID NO: 1 represents the amino acid sequence of human apoM lacking the N- terminal 27 amino acids.
  • amino acid sequence identity is meant to indicate the percentage of identical amino acids in said amino acid sequence of the polypeptide of the invention relative to the referenced amino acid sequence, e.g. 20 consecutive amino acids of SEQ ID NO: 1 thereof or SEQ ID NO: 2, 3, or 4.
  • the skilled person can revert to a number of standard algorithms known to those of skill in the art.
  • the polypeptide of the present invention may consist of only 50 up to 100 % of the amino acids set forth in 20 consecutive amino acids of SEQ ID NO: 1 or SEQ ID NO: 2, 3 or 4 as long as the required functional properties for practicing the present invention are given.
  • the polypeptide of the present invention may also comprise more than 50 to 100 % of the amino acids set forth in 20 consecutive amino acids of SEQ ID NO: 1 or SEQ ID NO: 2, 3 or 4, for example, additional signal peptides, purification tags (e.g. poly-his- tags), etc.
  • polypeptide components that are enzymatically cleavable by naturally occurring enzymes, more preferably enzymes present in recombinant cells for producing polypeptides according to the invention, most preferably enzymes that are present in liver, kidney and/or blood.
  • polypeptide according to the present invention also encompasses functional derivatives of the polypeptide of the invention having the properties (functions) identified above.
  • polypeptides according to the invention are defined by a structural requirement in combination with a functional limitation.
  • Requirement i) i.e. that the polypeptide, fragment and/or functional derivative thereof having at least 50 to 100 % amino acid sequence identity to 20 consecutive amino acids of SEQ ID NO: 1 or SEQ ID NO: 2, 3 or 4, is soluble under physiological conditions, means that said polypeptide, fragment and/or functional derivative does not precipitate substantially, preferably less than 10 %, more preferably less than 5 %, most preferably less than 1 %, within 1 h, preferably 12 h, more preferably 24 h, most preferably 48 h, at room temperature, i.e. approximately 20 0 C, in physiological saline, preferably in blood serum.
  • Requirement ii) i.e. that the polypeptide, fragment and/or functional derivative thereof having at least 50 to 100 % amino acid sequence identity to 20 consecutive amino acids of SEQ ID NO: 1 or SEQ ID NO: 2, 3 or 4, reduces the renal excretion of ApoA1 in a mammal, preferably human, means that that upon preferably intravenous administration of said polypeptide in a pharmacologically effective amount, renal excretion of ApoA1 into the urine of a mammal, preferably selected from rodents, preferably rat or mouse, and humans, is reduced by at least 10 %, preferably at least 20 %, more preferably at least 50 %, most preferably at least 80 % and very most preferred at least 95 %.
  • Requirement iii), i.e. that the polypeptide, fragment and/or functional derivative thereof having at least 50 to 100 % amino acid sequence identity to 20 consecutive amino acids of SEQ ID NO: 1 or SEQ ID NO: 2, 3 or 4, raises the ApoA1 and HDL concentration in a mammal, preferably human, upon intravenous administration of a pharmacologically effective amount thereof, means that the intravenous administration of a pharmacologically effective amount of the polypeptide must result in an increase in ApoA1 and HDL, preferably plasma HDL, by at least 1 %, preferably at least 5 %, more preferably at least 10 %, most preferably at least 20 % relative to the injection of saline vehicle alone (statistical significance provided), preferably plasma ApoA1 , by at least 10 %, preferably at least 20 %, more preferably at least 50 %, most preferably at least 80 %, and very most preferred at least 95 % relative to the injection of saline vehicle
  • apoAI concentrations in the urine will decrease by at least 10 %, preferably at least 20 %, more preferably at least 40 %, most preferably at least 80 % relative to the injection of saline vehicle alone.
  • ApoAI levels in the serum will increase at least 10 %, preferably at least 20 %, more preferably at least 50 %, most preferably at least 80 % relative to the injection of saline vehicle alone.
  • the present invention experimentally demonstrates that small soluble truncated apoM polypeptides selected from various regions throughout SEQ ID NO: 1 are capable of inhibiting renal clearance of apoAI and increasing plasma apoAI and HDL levels.
  • Preferred small soluble truncated apoM polypeptides for practicing the invention are selected from the group consisting of SEQ ID NO: 2, 3 and 4.
  • SEQ ID NO: 2 CPEHSQLTTLGVDGKEFPEV
  • SEQ ID NO: 2 corresponds to human amino acid residues 23 to 42 (NM_019101) and mouse amino acid residues 23 to 42 (NM_018816).
  • SEQ ID NO: 3 LHLRATIRMKDGLCVPRKWI
  • SEQ ID NO: 3 corresponds to human amino acid residues 82 to 101 (NM_019101) and mouse amino acid residues 82 to 101 (NM_018816).
  • SEQ ID NO: 4 LNETGQGYQRFLL YNRSPHP
  • SEQ ID NO: 4 corresponds to human amino acid residues 134 to 153 (NM_019101) and mouse amino acid residues 136 to 155 (NM 018816).
  • Polypeptides of the present invention located in the blood circulation of mammals being soluble themselves or comprising soluble fragments thereof will prevent loss of apoAI in the kidney.
  • apoAI concentrations in the blood increase, and, apoAI being a major determinant of HDL concentration, this consequently leads to increased HDL formation.
  • soluble polypeptides of the present invention in the blood of mammals will raise HDL concentration by inhibiting renal clearance of apoAI without affecting HDL formation in the liver.
  • polypeptides of the present invention will significantly raise HDL concentration, preferably by at least 1 %, more preferably by at least 5 %, even more preferably by at least 10 %, most preferably by at least 20 %, by significantly inhibiting, preferably by at least 10 %, more preferably at least 15 %, even more preferably by at least 20 %, most preferably by at least 50 %, the renal clearance of apoAI without substantially affecting HDL formation in the liver when introduced into the blood of a mammal, preferably human, in a pharmacologically effective amount.
  • the term "significant" as used herein in the context of raising the HDL concentration and inhibiting renal clearance of apoAI is understood from a statistical standpoint, a significant change being statistically relevant when compared to a reference point, e.g. vehicle administration.
  • the present invention relates to a chimeric polypeptide, comprising a polypeptide according to the invention fused to a heterologous polypeptide or amino acid sequence.
  • a "chimeric polypeptide” as used herein is a fusion of a first amino acid sequence encoding one of the polypeptides of the present invention with a second amino acid sequence foreign to and not substantially homologuous to any domain of one of the inventive polypeptides.
  • such a chimeric molecule comprises a fusion of a peptide of the present invention with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind.
  • the epitope tag is generally placed at the amino- or carboxyl-terminus of the inventive peptide. The presence of such epitope-tagged forms of the inventive peptides can be detected using an antibody against the tag polypeptide.
  • Various tag polypeptides and their respective antibodies are well known in the art.
  • poly-histidine poly-his
  • poly-histidine-glycine poly-his-glycine tags
  • flu HA tag polypeptide and its antibody 12CA5 [Field et al., MoI. Cell. Biol., 8:2159-2165 (1988)]
  • c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al. , Molecular and Cellular Biology, 5:3610-3616 (1985)]
  • Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein Engineering, 3(6):547-553 (1990)].
  • tag polypeptides include the Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al., Science 255:192-194 (1992)]; an ⁇ -tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266:15163-15166 (1991)]; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sd. USA, 87:6393-6397 (1990)].
  • the chimeric molecule may comprise a fusion of an inventive polypeptide with an immunoglobulin or a particular region of an immunoglobulin.
  • an immunoglobulin also referred to as an "immunoadhesin”
  • such a fusion could be to the Fc region of an IgG molecule.
  • the present invention relates to an isolated and purified nucleic acid, comprising a nucleic acid selected from the group consisting of: (i) at least 30 to 60, preferably at least 36 or 42, more preferably at least 48 or
  • nucleic acid 54 most preferably at least 57 or 60 of the nucleic acids of SEQ ID NO: 5, 6, 7 or 8; (ii) a nucleic acid having a sequence with at least 50 or 60 % identity, preferably at least 70 or 80 % identity, more preferred at least 90 % identity, most preferred at least 95 % identity to the nucleic acid sequence of SEQ ID NO: 5,
  • nucleic acid that hybridizes to a nucleic acid of (i) or (ii); (iv) a nucleic acid, wherein said nucleic acid is derivable by substitution, addition and/or deletion of one of the nucleic acids of (i), (ii) or (iii); (v) a fragment of any one of the nucleic acids of (i) to (iv), that hybridizes to a nucleic acid of (i), wherein the nucleic acids of (i) to (v) code for a polypeptide according to the invention.
  • SEQ ID NO: 5 is the nucleic acid sequence coding for SEQ ID NO: 1
  • nucleic acid sequence of the present invention comprises SEQ ID NO: 6, 7 or 8, which code for the amino acid sequences set forth in SEQ ID NO: 2, 3 and 4, respectively.
  • SEQ ID NO. 8 ctgaatgagacaggccagggttaccagcgctttctcctctacaatcgctcaccacatcct
  • % (percent) identity indicates the degree of related ness among 2 or more nucleic acid molecules that is determined by agreement among the sequences.
  • the percentage of "identity” is the result of the percentage of identical regions in 2 or more sequences while taking into consideration the gaps and other sequence peculiarities.
  • the identity of related nucleic acid molecules can be determined with the assistance of known methods.
  • special computer programs are employed that use algorithms adapted to accommodate the specific needs of this task.
  • Preferred methods for determining identity begin with the generation of the largest degree of identity among the sequences to be compared.
  • Computer programs for determining the identity among two sequences comprise, but are not limited to, the GCG-program package, including GAP (Devereux et al., Nucleic Acids Research 12 (12):387 (1984); Genetics Computer Group University of Wisconsin, Madison, (Wl)); BLASTP, BLASTN, and FASTA (Altschul et al., J. Molec. Biol 215:403/410 (1990)).
  • the BLAST X program can be obtained from the National Center for Biotechnology Information (NCBI) and from other sources (BLAST handbook, Altschul et al., NCB NLM NIH Bethesda, MD 20894). Also, the well- known Smith-Waterman algorithm can be used for determining identity.
  • Preferred parameters for sequence comparison comprise the following:
  • the gap program is also suited to be used with the above-mentioned parameters.
  • the above-mentioned parameters are standard parameters (default) for nucleic acid comparisons.
  • gap opening penalties, gap extension penalties, comparison matrix including those in the program handbook, Wisconsin-package, version 9, September 1997.
  • the selection depends on the comparison to be done and further, whether a comparison among sequence pairs, for which GAP or Best Fit is preferred, or whether a comparison among a sequence and a large sequence databank, for which FASTA or BLAST is preferred, is desired.
  • nucleic acid molecules according to the invention may be prepared synthetically by methods well-known to the skilled person, but also may be isolated from suitable DNA libraries and other publicly-available sources of nucleic acids and subsequently may optionally be mutated. The preparation of such libraries or mutations is well-known to the person skilled in the art.
  • the nucleic acid molecules of the invention are cDNA, genomic DNA, synthetic DNA, RNA or PNA, either double-stranded or single-stranded (i.e. either a sense or an antisense strand). Fragments of these molecules, which are encompassed within the scope of the invention, may be produced by, for example, the polymerase chain reaction (PCR) or generated synthetically using DNA synthesis or by reverse transcription using mRNA from liver or kidney.
  • PCR polymerase chain reaction
  • the present invention also provides novel polynucleotides encoding the polypeptides of the present invention characterized in that they have the ability to hybridize to a specifically referenced nucleic acid sequence, preferably under stringent conditions.
  • a specifically referenced nucleic acid sequence preferably under stringent conditions.
  • the nucleic acid of the present invention is preferably operably linked to a promoter that governs expression in suitable vectors and/or host cells producing the polypeptides of the present invention in vitro or in vivo.
  • the nucleic acid of the present invention is one that is operably linked to a promoter selected from the group consisting of the MCK promoter, the RSV promoter, the CMV promoter, a tetracycline-regulatable promoter, a doxycycline-regulatable promoter, and a promoter capable of being recognized by RNA- dependent RNA polymerase.
  • a promoter selected from the group consisting of the MCK promoter, the RSV promoter, the CMV promoter, a tetracycline-regulatable promoter, a doxycycline-regulatable promoter, and a promoter capable of being recognized by RNA- dependent RNA polymerase.
  • the isolated and purified nucleic acid is in the form of a recombinant vector, such as a viral vector.
  • a viral vector is selected from the group consisting of an adenovirus, an adeno-associated viral vector, a retroviral vector, a Herpes simplex viral vector, a lentiviral vector, a Sindbis viral vector, or a Semliki forest viral vector.
  • the isolated and purified nucleic acid encoding and expressing the protein or polypeptide is operably linked to a promoter selected from the group consisting of the MCK promoter, the CMV promoter, a tetracycline-regulatable promoter, and a doxycycline-regulatable promoter.
  • a promoter selected from the group consisting of the MCK promoter, the CMV promoter, a tetracycline-regulatable promoter, and a doxycycline-regulatable promoter.
  • Suitable vectors are reviewed in Kay et al., Nature Medicine 7: 33-40 (2001); Somia et al., Nature Reviews 1 : 91-99 (2000); and van Deutekom et al., Neuromuscular Disorders 8: 135-148 (1998).
  • the viral vector is an adenovirus (preferred examples are described in Acsadi et al., Hum. Gene Ther.
  • a Herpes simplex viral vector see, e.g., Latchman, Gene 264(1): 1-9 (2001)
  • a lentiviral vector a Sindbis viral vector
  • a Semliki forest viral vector a Herpes simplex viral vector
  • a lentiviral vector a Sindbis viral vector
  • a Semliki forest viral vector a Herpes simplex viral vector
  • a lentiviral vector a Sindbis viral vector
  • Sindbis viral vector e.g., Sindbis viral vector
  • Semliki forest viral vector e.g., Sindbis viral vector, or a Semliki forest viral vector.
  • Suitable promoters for operable linkage to the isolated and purified nucleic acid are known in the art.
  • the isolated and purified nucleic acid encoding the protein is operably linked to a promoter selected from the group consisting of the muscle creatine kinase (MCK) promoter (Jaynes et al., MoI. Cell Biol
  • CMV cytomegalovirus
  • a tetracycline- regulatable promoter Gossen et al., PNAS USA 89: 5547-5551 (1992)
  • a doxycycline-regulatable promoter Gossen et al. (1992), supra.
  • Vector construction including the operable linkage of a coding sequence with a promoter and other expression control sequences, is within the ordinary skill in the art.
  • the present invention relates to a recombinant vector, comprising a nucleic acid according to the invention, preferably said recombinant vector being capable of producing a polypeptide according to the invention.
  • the recombinant vector according to the invention is one, wherein the vector is a viral vector selected from the group consisting of an adenoviral vector, an adeno- associated viral vector, a retroviral vector, a Herpes simplex viral vector, a lentiviral vector, a Sindbis viral vector, and a Semliki forest viral vector.
  • a viral vector selected from the group consisting of an adenoviral vector, an adeno- associated viral vector, a retroviral vector, a Herpes simplex viral vector, a lentiviral vector, a Sindbis viral vector, and a Semliki forest viral vector.
  • a further aspect of the present invention is directed to a host cell comprising a nucleic acid according to the invention and/or a vector according to the invention, preferably being capable of producing polypeptides according to the present invention.
  • the present invention encompasses an antibody that specifically binds a polypeptide according to the invention but not to natural mammalian apoM.
  • the antibodies may be polyclonal or monoclonal antibodies.
  • the term "antibody” refers not only to whole antibody molecules, but also to antigen-binding fragments, e.g., Fab, F(ab') 2 , Fv, and single chain Fv fragments. Also included are chimeric antibodies, preferably humanized antibodies. Such antibodies are useful as research tools for distinguishing between natural apoM and polypeptides according to the invention.
  • a further aspect relates to a hybridoma cell line, expressing a monoclonal antibody according to the invention.
  • the present invention provides for a pharmaceutical composition compromising a polypeptide, a nucleic acid and/or a recombinant vector according to the invention as well as a pharmaceutically acceptable carrier (or excipient).
  • Suitable carriers or excipients are well-known in the art.
  • a carrier or excipient may be a solid, semi-solid or liquid material which may serve as a vehicle or medium for the active ingredient.
  • One of ordinary skill in the art in the field of preparing compositions can readily select the proper form and mode of administration depending upon the particular characteristics of the product selected, the disease or condition to be treated, the stage of the disease or condition, and other relevant circumstances (Remington's Pharmaceutical Sciences, Mack Publishing Co. (1990)).
  • the proportion and nature of the pharmaceutically acceptable carrier or excipient are determined by the solubility and chemical properties of the pharmaceutically active compound selected, the chosen route of administration, and standard pharmaceutical practice.
  • the pharmaceutical preparation may be adapted for oral, parenteral intravenous, subcutaneous, intramuscular or inhalative administration and may be administered to the patient in the form of tablets, capsules, suppositories, solution, suspensions or the like.
  • the pharmaceutically active compounds of the present invention while effective themselves, can be formulated and administered in the form of their pharmaceutically acceptable salts, such as acid addition salts or base addition salts, for purposes of stability, convenience of crystallization, increased solubility, and the like.
  • the polypeptide or polypeptides can be formulated and administered in the form of their pharmaceutically acceptable salts, such as acid addition salts or base addition salts, for purposes of stability, solubility and activity.
  • Nucleotides and/or vectors in form or adeno- adeno associated, Sindbis or Semlili Forest virus vectors may be administered intravenously.
  • the polypeptide, nucleic acid and/or vector is formulated in such a manner that they provide for a pharmaceutically effective amount of the soluble and active polypeptide and/or a soluble and active fragment (after enzymatic and/or hydrolytic cleavage) of the polypeptide of the invention in the blood circulation, and in particular in the kidney, of the treated mammal, preferably human, to prevent loss of apoAI in the kidney without affecting pre- ⁇ -HDL formation in the liver.
  • Another aspect of the present invention is directed to the use of at least one of the following, a polypeptide, a nucleic acid and/or a recombinant vector according to the present invention, for preparing a medicament.
  • the vectors of the present invention With respect to the vectors of the present invention and to ensure effective transfer of the vectors of the present invention, it is preferred that about 1 to about 5,000 copies of the vector according to the invention be employed per cell to be contacted, based on an approximate number of cells to be contacted in view of the given route of administration, and it is even more preferred that at least about 3 to about 300 pfu enter each cell.
  • the present invention relates to the use of a polypeptide, a nucleic acid and/or a recombinant vector according to the invention for the preparation of a medicament for raising the HDL concentration.
  • the present invention relates to the use of a polypeptide, a nucleic acid and/or a recombinant vector according to the invention for the preparation of a medicament for the prophylaxis and/or therapy of artherosclerosis.
  • the present invention relates to the use of a polypeptide, a nucleic acid and/or a recombinant vector according to the invention for the preparation of a medicament for increasing the content of alveolar surfactants.
  • an increase of alveolar surfactants is an important measure for preventing and/or treating Respiratory Distress Syndrome (RDS) in newborns and also for preventing and/or treating Acute Respiratory Distress Syndrome by preventing and/or treating edema formation.
  • RDS Respiratory Distress Syndrome
  • the present invention relates to the use of a polypeptide, a nucleic acid and/or a recombinant vector according to the invention for the preparation of a medicament for the prophylaxis and/or therapy of Respiratory Distress Syndrome.
  • another aspect of the present invention concerns a method of treatment, wherein a pharmacologically effective amount of the above pharmaceutical composition is administered to a patient in need thereof, preferably a patient suffering from atherosclerosis, ARDS or RDS.
  • At least one compound of the present invention can be administered in any form or mode which makes the therapeutic polypeptide or therapeutic fragment thereof bioavailable in an effective amount, including oral or parenteral routes.
  • compositions of the present invention can be administered subcutaneously, intramuscularly, intravenously, by inhalation and the like.
  • One skilled in the art in the field of preparing formulations can readily select the proper form and mode of administration depending upon the particular characteristics of the product selected, the disease or condition to be treated, the stage of the disease or condition and other relevant circumstances (see. e.g. Remington ' s Pharmaceutical Sciences, Mack Publishing Co. (1990)).
  • Another aspect of the present invention is directed to a method of raising the HDL concentration in a mammal, which method comprises administering to the mammal a therapeutically effective amount of a polypeptide, a nucleic acid and/or a recombinant vector according to the invention.
  • the present invention relates to a method of treating and/or preventing atherosclerosis in a mammal, which method comprises administering to the mammal a therapeutically effective amount of a polypeptide, a nucleic acid and/or a recombinant vector according to the invention.
  • the present invention relates to a method of treating and/or preventing Respiratory Distress Syndrome and/or Acute Respiratory Distress Syndrome in a mammal, which method comprises administering to the mammal a therapeutically effective amount of a polypeptide, a nucleic acid and/or a recombinant vector according to the invention.
  • the vector is preferably a recombinant viral vector selected from the group consisting of an adenovirus, an adeno-associated viral vector, or a lentiviral vector.
  • the polypeptide, nucleic acid and/or recombinant vector is/are preferably administered by intravenous or local application, preferably into the kidney.
  • the present invention encompasses a) methods of producing a polypeptide, wherein a host cell according to the invention is cultured and said polypeptide is purified; b) methods of producing a nucleic acid according to the invention, wherein a host cell according to the invention is cultured and said nucleic acid is purified; c) methods of producing a vector according to the invention, wherein a host cell according to the invention is cultured and said vector is purified; d) methods of producing an antibody according to the invention, wherein a hybridoma cell according to the invention is cultured and said antibody is purified.
  • Fig. 1A is a schematic drawing of the surface probability plot of apoM calculated according to a formula of Emini et al. (J. Virol., 55:836-839 (1985). The 8 amino acid flag epitope was inserted at indicated amino acids. The total length of apoM with flag epitope is 196 amino acids.
  • Fig. 1 B shows the over-expression of flag constructs, apoM and GFP in HepG2 cells.
  • Cell lysates and medium were analyzed by SDS-PAGE and immunoblotted using anti-apoM antibodies and anti-flag antibodies.
  • Fig. 1C One-dimensional native agarose gel electrophoresis and immunoblotting of medium from HepG2 cells transfected with apoM117, apoM or GFP expression vectors. The blotted 1 D native agarose gel was probed with either anti-apoM antibodies or anti-flag antibodies.
  • Fig. 1 D FPLC analysis of plasma from TcfT' ⁇ mice infected with either Ad-apoM117 or
  • Ad-GFP Cholesterol was measured by a colorimetric assay and presented as absorbance at 505 nm.
  • Fig. 2 C leavage of the signal peptide of apoM inhibits pre- ⁇ migrating particle formation and affects full-length apoM in a dominant negative fashion
  • Fig. 2 A HepG2 cells were transfected with expression vectors for apoM, hybrids Al/M, alb/M and GFP and cell extracts were analyzed by PAGE and immunoblotting. Media were analyzed by SDS-PAGE and immunoblotted with anti-apoM antibodies.
  • Fig. 2 B 1 D native agarose gel of medium from HepG2 cells transfected with apoM, hybrid Al/M, hybrid alb/M or GFP. The blotted agarose gel was probed with anti- apoAI antibodies.
  • Fig. 2 C Effects of truncated apoM on expression of wildtype apoM in co-transfected
  • HEK293 cells were transfected with 10 ⁇ g GFP or co-transfected with constant amount (4 ⁇ g) of apoM117 flag and increasing amount (1-6 ⁇ g) of alb/M117 HA.
  • Cell lysates and medium were subjected to SDS-PAGE and immunoblotted using either anti-HA antibodies or anti-flag antibodies.
  • anti-TATA binding protein (Tbp) antibodies were used for cell lysate loading control.
  • Fig. 3 A) HepG2 cell lysates, transfected with apoM or alb/M expression vectors, were incubated with either PBS, or cross-linking reagents dimethyl 3, 3'- dithiobispropionimate (DTBP) and bismaleimidohexane (BMH). SDS-PAGE under non-reducing conditions and immunoblotting using anti-apoM antibodies showed a band twice the molecular weight of apoM. Under reducing conditions only the monomer was detected in PBS and DTBP-treated cell lysate. In contrast, the dimer persisted in BMH-treated samples as BMH cross-linking could not be reversed.
  • DTBP dimethyl 3, 3'- dithiobispropionimate
  • BMH bismaleimidohexane
  • HEK293 cells were co-transfected with the following combinations of expression vectors: apoM117 HA and alb/M117 flag, apoM117 flag and alb/M117 HA, ApoM117 flag and ApoM117 HA or Alb/M117 flag and Alb/M117 HA.
  • the cell lysates were immunoprecipitated with anti-M2 flag agarose.
  • the immunoprecipitates were subjected to SDS-PAGE and immunoblotted using anti-
  • Truncated apoM affects formation of pre-/? migrating particles in vivo.
  • Fig. 3. Liver homogenates from C57BL/6 mice injected with 1 x 10 9 pfu adenovirus expressing GFP, apoM117 or alb/M117, were incubated with either PBS, or cross-linking reagent bismaleimidohexane (BMH). SDS-PAGE under non- reducing conditions and immunoblotting using anti-apoM antibodies showed a band twice the molecular weight of apoM. Under reducing conditions only the monomer was detected in PBS liver homogenates. In contrast, the dimer persisted in BMH-treated samples as BMH cross-linking could not be reversed.
  • BMH cross-linking reagent bismaleimidohexane
  • Fig. 4A Effect of hepatic expression of truncated apoM on lipoprotein metabolism
  • Fig. 4A FPLC analysis of plasma from Ad-GFP, Ad-apoM, Ad-AI/M and Ad-AI/M infected mice. Cholesterol was measured by colorimetric assay and presented as absorbance at 505 - 650 nm.
  • Fig. 4B Expression of plasma apolipoprotein in Ad-GFP, Ad-apoM, Ad-AI/M and Ad- AI/M infected mice. Plasma was analyzed 7 days postinjection by SDS-PAGE and immunoblotting.
  • Fig. 5C shows 125 l-apoAI accumulation in different liver, intestine, kidney and heart 24 hrs after injection of mice that were treated with Ad-GFP, Ad-ApoM, Ad-AI/M and
  • Fig. 5D shows ApoAI expression in liver and urine.
  • Mice were injected with Ad-GFP, Ad- apoM, Ad-AI/M and Ad-AI/M and specimens were taken after 6 days.
  • Urine samples were collected during a 24 h interval.
  • Liver cell lysates (20 ⁇ g protein) and urine (15 ⁇ l_) were analyzed by SDS-PAGE and immunoblotting.
  • Fig. 6 HDL and apoAI metabolism in TTR-alb/M transgenic mice
  • Fig. 6A is a Western blot analysis of urine from TTR-AI/M transgenic mice and wildtype littermates using specific anti-apoAI antibodies.
  • Fig. 6B is an FPLC analysis of plasma from TTR-AI/M transgenic mice and wildtype littermates. Cholesterol was measured by colorimetric assay and presented as absorbance at 505 - 650 nm.
  • Fig. 6C shows a 1-D native agarose gel electrophoresis and immunoblotting of plasma from TTR-AI/M transgenic mice and wildtype littermates using anti-apoA1 and apoM antibodies.
  • Fig. 6D is a Western blot analysis of urine from TTR-AI/M transgenic mice and wildtype littermates using specific anti-apoAI antibodies.
  • Fig. 7 Truncated apoM exacerbates the formation of atherosclerotic lesions
  • Figs. 7A-C relate to C57BI/6 mice fed 0.02% cholesterol diet for 11 weeks, followed by injection of Ad-GFP, Ad-apoM and Ad-AI/M. Plasma cholesterol and lesion areas were studied 3 weeks post-infection.
  • Figs. 7D-E relate to LdIr-/- mice fed 0.02% cholesterol diet for 16 weeks, followed by injection of Ad-GFP, Ad-apoM and Ad-AI/M. Plasma cholesterol and lesion areas were studied 3 weeks post-infection.
  • Figs. 7C & F are representative pictures of oil red o stainings of aortic roots.
  • FIG. 8A shows a western blot of apoAI in mouse urine samples collected for 12 hours after the 1 st and 3 rd injection (12 and 48 h) of 6 soluble short polypeptides derived from apoM (peptides no. 1 to 6, 300 ⁇ g in 0,2 ml PBS each, 3 x at 12 h intervals).
  • Fig. 8B shows a western blot of apoA1 in mouse urine samples collected for 12 hours after the 1 st and 3 rd injection (12 and 48 h) of 2 soluble short polypeptides derived from apoM (peptides no. 3 and 5 (left and middle lane, respectively), 300 ⁇ g in 0,2 ml PBS each, 3 x at 12 h intervals).
  • a peptide containing sequences of ovalbumin was used as a control (right line).
  • Fig. 8C shows measurements of urinary 125 l-apoAI in urine samples collected over 24 h after injection of human 125 l-apoAI.
  • Bars labelled Ad-GFP and Ad-Alb/M117 indicate mice that were injected with respective recombinant adenoviruses 6 days prior to 125 l-apoAI injection.
  • Fig. 8D shows plasma apoAI levels of mice that were injected intraperitoneally with PBS, Peptide 3 (Pep.3) or Peptide 5 (Pep.5) for 2 weeks with 300 ⁇ g in 0,2 ml PBS once daily.
  • Plasma apoAI levels were measured in duplicates by immunoblotting and quantification using densitometry scanning.
  • Plasma from an untreated wildtype animal (apoAI +/+ , serum control) and apoAI null (apoAl ⁇ ) mouse were analyzed as a control.
  • N 5.
  • Fig. 8E Shows an FPLC analysis of plasma from mice that were injected intraperitoneally with PBS, Peptide 3 (Pep.3) or Peptide 5 (Pep.5) for 2 weeks with 300 ⁇ g in 0,2 ml PBS once daily. The fractions containing HDL are indicated. Each line represents a plasma pool of 5 mice.
  • Fig. 8E shows an analysis of ⁇ - and pre/3-migrating HDL particles of mice that were treated with 0,2 ml PBS or a single intraperitoneal injection of Peptide 3 (300 ⁇ g in 0,2 ml PBS) for 7 days by a 1-D agarose gel electrophoresis. The gel was blotted and HDL particles were visualized with anti-apoAI antibodies. Each lane represents a different animal.
  • Adenoviruses The cDNAs of Flag-tagged apoM and hybrid apoM were cloned into plasmid Ad5CMV K- NpA (Viraquest) and recombinant adenoviruses were generated using standard procedures. For in vivo experiments, mice were injected through the tail vein with 1x10 9 pfu of adenovirus. Empty virus expressing only GFP served as control (Ad-GFP).
  • the apoM flag-constructs were generated by inserting Flag sequences into the respective positions in the apoM cDNA using PCR.
  • the hybrids Al/M and Alb/M were generated by PCR by replacing the sequence of amino acids 1-27 of the murine apoM cDNA with the N-terminal 18 amino acid residue sequence of apoAI and the N-terminal 24 amino acid sequence of albumin, to generate hybrids Al/M and alb/M, respectively. All sequences were confirmed by dideoxynucleotide sequencing.
  • HEK293 and HepG2 cells were cultured with DMEM medium containing 25 mM glucose 10% FCS. Transfections were performed using Fugene reagent (Roche Diagnostics, Switzerland) according to the manufacture's instructions.
  • HepG2 cells were split into 10 cm Petri dishes and grown to 80% confluency before infection with 1 x 10 7 pfu adenovirus. Two days after the cells were harvest and resuspended in reaction buffer. Cross linking experiments were performed as previously described (Akpinar et al, Cell Metabolism 2: 385-397, 2005). Cross linking reagents and buffers: bismaleimidohexane (BMH) (Sigma Aldrich) was dissolved in DMSO and incubated in PBS, and dimethyl-3,3'-dithiobispropionimidate (DTBP) (Sigma Aldrich) was dissolved in water and incubated in 0.2M tris-ethanolamine (pH 8.0). lmmunoprecipitation of Flag epitope
  • Transfected HEK293 cells were washed twice with PBS and the cells were lysed in RIPA buffer in the presence of protease inhibitors for 20 min at 4°C.
  • Cell lysates were centrifuged for 5 min at 10,000 x g at 4 0 C and the supernatant were incubated with M2 flag agarose (Sigma Aldrich) at 4°C for 16 h.
  • M2 flag agarose Sigma Aldrich
  • Plasma or whole cell extracts were separated by SDS-PAGE and transferred onto a nitrocellulose membrane (Schleicher & Schuell, Germany) by electroblotting.
  • ApoM was detected with anti-apoM antiserum (ref) (1 :1000), anti-flag antibodies (Sigma Aldrich) or anti-HA antibodies (Convance, USA).
  • Other apolipoproteins were detected using affinity purified antibodies (BioDesign, USA) (1 :1000). Primary antibodies were incubated at 4°C over night.
  • Lipoproteins were separated by native agarose gel electrophoresis (0.8% agarose in 10 mM Tris, pH 8.6). The agarose gel was blotted by capillary transfer onto a nitrocellulose membrane in ddH 2 0 and apolipoproteins were detected using specific antibodies.
  • Plasma samples were taken from mice using heparinized capillary tubes. An aliquot of each sample was treated with 1.5 mM DTNB (5,5-Dithiobis-2-nitro-benzoic acid) to inhibit LCAT activity. Plasma cholesterol, triglycerides and phospholipids levels were determined using a colorimetric assay system (Roche, Wako, USA).
  • DTNB 5,5-Dithiobis-2-nitro-benzoic acid
  • Radiolabeling of apoAI Human apoAI was labelled according to McFarlan et al., using freshly prepared [ 125 I]CI solution. Unbound free iodine or iodine labelled tracer was separated from HDL by PD- 10 columns (Pharmacia). The integrity of apoAI was checked by FPLC separation. Mice were injected with 100 nCi of radiolabeled HDL. Blood was taken at different times after injection and counted using a gamma-counter.
  • mice C57BI/6 mice were fed a diet containing 0.02% cholesterol for 8 weeks, after this period the animals were injected with either Ad-GFP, Ad-ApoM or Ad-AI/M.
  • LdIr 7" mice were fed the same diet for 16 weeks and then were injected with either Ad-GFP, Ad-ApoAI, Ad- ApoM or Ad-AI/M. Mice were sacrificed 3 weeks post injection and atherosclerosis was quantified as reported previously (Wolfrum et al, Nature Medicine 11418-422, 2005).
  • Results are given as mean ⁇ SD. Statistical analyses were performed by using a Student's f-test, and the null hypothesis was rejected at the 0.05 level.
  • Flag epitopes were inserted in regions of the apoM protein where the surface probability is the highest (amino acid 57, 117, 152 and 180) (Fig. 1A). All constructs were expressed in HepG2 cells and expression was assessed by immunoblotting. ApoM 152 could not be detected by the apoM antibody used (raised against a peptide containing the amino acids 140 to 159 of apoM) (Richter et al, Diabetes 52:2989-2995, 2003), since the insertion of the flag is interrupting the apoM antibody epitope, but could be visualized using anti-flag antibodies.
  • apoM117 was secreted from cells, showing that insertion of the Flag epitope at positions 57, 152 and 180 affects apoM secretion (Fig. 1 B).
  • Fig. 1 B Previous studies have shown that apoM is involved in the formation of pre- ⁇ migrating particles (Wolfrum et al, Nature Medicine 11418-422, 2005).
  • apoM117 was functional, formation of pre- ⁇ migrating particles in HepG2 cells was examined. Similar to wild type apoM, apoM117 induced formation of pre- ⁇ migrating particles that could be detected by anti-Flag antibodies (Fig. 1C).
  • apoM117 was functional in vivo by injecting apoM117 adenovirus into Tcf1 ⁇ ⁇ ⁇ mice. These mice have an abnormal lipoprotein profile that can be rescued by overexpressing wildtype apoM (Wolfrum et al, Nature Medicine 11418-422, 2005). ApoM117 was indeed able to restore the lipoprotein profile of Tcfi ⁇ (Fig. 1 D). Together, these results demonstrate that an insertion of a Flag epitope at amino acid 117 in apoM is compatible with normal apoM function.
  • apoM hybrids were generated, in which amino acid residues 1-27 of apoM were replaced either by the N-terminal 18 amino acid residues of apoAI (to generate hybrid Al/M), or amino acids 1- 24 of albumin (to generate hybrid alb/M), thereby fusing the signal peptides of apoAI and albumin, including their signal cleavage recognition sequences, with apoM lacking its hydrophobic N-terminus.
  • apoAI amino acid residues 1-27 of apoM were replaced either by the N-terminal 18 amino acid residues of apoAI (to generate hybrid Al/M), or amino acids 1- 24 of albumin (to generate hybrid alb/M)
  • apoAI and albumin to generate hybrid alb/M
  • truncated apoM acts as a dominant negative regulator of apoM expression/secretion.
  • HEK293 cells were co-transfected with either apoM11-HA and alb/M117-flag, apoM117-flag and alb/M117-HA, apoM117-flag and apoM117-HA or alb/M117-flag and alb/M117-HA. lmmunoprecipitations were performed from cell lysates using anti-flag antibodies, followed by a SDS-PAGE and immuno-blotting with anti-HA antibodies.
  • Figure 3B shows that full length (lane 3) and truncated (lane 4) apoM can interact to form homodimers. Interestingly, the truncated apoM also interacted with the full-length apoM to form heterodimers (lane 1 and 2), a finding that offers a mechanistic explanation for the dominant-negative activity of truncated apoM.
  • Truncated apoM inhibits formation of pre- ⁇ migrating particles in vivo
  • truncated apoM Over-expression of truncated apoM in vivo has minor effects on plasma lipoprotein metabolism
  • Pre- ⁇ migrating particles are precursors for mature HDL in the circulation. It was therefore of interest to examine whether the truncated apoM had any effect on plasma lipoprotein metabolism.
  • Mice were injected with recombinant adenoviruses Ad-GFP, Ad- ApoM, Ad-Alb/M117 and Ad-AI/M and total plasma cholesterol and triglycerides were measured after 7 days.
  • apoM levels were increased in Ad-ApoM compared to Ad-GFP and, consistent with the in vitro data, apoM was lower in plasma from mice injected with either Ad-Alb/M117 or Ad-AI/M, confirming that truncated apoM inhibits endogenous apoM secretion.
  • Plasma apoAI was slightly increased in mice expressing apoM, alb/M117 and Al/M. ApoE was also affected, where Ad-ApoM and Ad-AI/M increased the expression compared to Ad-GFP. However, injection of Ad-Alb/M117 did not seem to alter apoE levels.
  • Ad-ApoM Ad-Alb/M117
  • Ad-AI/M Ad-AI/M
  • apoC apoC levels in plasma
  • the levels of apoB48, a very low density and low density lipoprotein associated protein were also determined. All three apoM adenoviruses increased apoB48 in plasma, indicating that apoM affects the other lipoprotein classes.
  • the flag epitope of Ad-Alb/M117 was detected in plasma, demonstrating that the truncated apoM is secreted from the liver into the circulation (Fig. 4B).
  • the altered apolipoprotein content in plasma most likely reflects changed apolipoprotein content on the particle, which might affect the function of the lipoproteins and or compensate for decreased apoM expression, even if the total plasma cholesterol and triglyceride levels are not altered.
  • ApoAI is the primary apolipoprotein attached to HDL (approximately 70% of all apolipoprotein) and it is thought to play an important role for pre- ⁇ migrating particle formation, either by acquired lipids from cells or during lipoprotein remodeling (Assmann G et al. Annu. Rev. Med. 54, 321-341 , 2003). Since truncated apoM decreases apoAI containing pre- ⁇ migrating particles, studies were performed to elucidate whether other components of apoAI metabolism were affected.
  • mice treated with Ad-GFP, Ad-ApoM, Ad-Alb/M117 or Ad-AI/M were injected after 6 days with radio-labelled 125 l-ApoAI. Blood was collected over a 24 h period to measure the clearance of 125 I-ApOAI from the circulation. As seen in figure 5A 1 125 l-apoAI rapidly cleared from the blood in all four groups. Interestingly, the clearance of apoAI after 30 min was much greater in Ad-GFP and Ad-ApoM mice compared to Ad-Alb/M117 and Ad-AI/M treated animals (56.6 ⁇ 0.82% and 50.1 ⁇ 2.09% vs. 29.2 ⁇ 2.55% and 42.2 ⁇ 1.11%, respectively).
  • mice over-expressing alb/M117 or Al/M had 2-fold more radiolabeled apoAI in plasma when compared to Ad-GFP and Ad-ApoM treated mice (Fig. 5C). It was then investigated whether there was an altered catabolism of apoAI in the kidney, since it is well known that lipid-free apoAI is rapidly catabolized through the kidney (Assmann G et al. Annu. Rev. Med. 54, 321-341 , 2003). Therefore, an increase in ApoAI plasma clearance should also be reflected in increased excretion of 125 I-ApOAI in the urine.
  • truncated apoM also affected apoAI expression in the liver
  • homogenates from the adenovirus-injected mice were analyzed on SDS-PAGE and by immunoblotting.
  • the expression of apoAI varied within the groups, however, no marked effect on hepatic expression of ApoAI could be detected (Fig. 5E).
  • TTR-Alb/M117 #1 and #2 were generated.
  • Western blot analysis of liver cell lysates revealed that Alb/M117 was expressed in both lines (data not shown).
  • Truncated apoM exacerbated atherosclerotic lesion formation
  • truncated apoM is pro-atherogenic, since it decreases plasma pre- ⁇ migrating particles, which are know to be anti-atherogenic due to the involvement in RCT.
  • Mice C57BI/6 were fed an atherogenic diet, containing 0.02% cholesterol, for eight weeks followed by injection of either Ad-GFP, Ad-ApoM or Ad-AI/M. Three weeks post-injection plasma cholesterol levels were increased in mice expressing apoM compared to GFP (242 ⁇ 13.2 mg/dL vs.
  • FIG. 7E shows the lesion area for the four different groups. Similar to the C57BI/6 atherosclerotic study, over-expression of apoAI or apoM in the liver led to a reduction of atherosclerosis compared to GFP (116,379 ⁇ 26,476 ⁇ m 2 , 77,884 ⁇ 14,274 ⁇ m 2 vs. 179,684 ⁇ 32,871 ⁇ m 2 , respectively).
  • Short truncated apoM polypeptides affect apoAI metabolism Six peptides with partial sequences of apoM, i.e. sequences consisting of 15 to 20 amino acids of SEQ ID NO: 1 , were injected (300 ⁇ g in 0,2 ml PBS per injection for each polypeptide) into the tail vein of C57/BI6 mice three times at 12 h intervals. The urine of the mice was collected in metabolic cages, immediately frozen and apoAI clearance in the kidney was measured by western blotting of apoAI in the urine samples. These peptides were:
  • Peptide 1 CPEHSQLTTLGVDGKEFPEV (SEQ ID NO: 2)
  • Peptide 2 AGAAPTKEELATFDPVDNIV (SEQ ID NO: 9)
  • Peptide 3 LHLRATIRMKDGLCVPRKWI (SEQ ID NO: 3)
  • Peptide 4 LTEGSTDLRTEGRPDMKTEL (SEQ ID NO: 10)
  • Peptide 5 LNETGQGYQRFLLYNRSPHP (SEQ ID NO: 4)
  • Peptide 6 LDSKAFLLTPRNQEACELSN (SEQ ID NO: 11)
  • the western blot of Fig. 8A demonstrates that the systemic administration of short truncated apoM derivatives, i.e. polypeptide 1 , 3 and 5, inhibits renal clearance of apoAI.
  • the animal experiment was repeated with polypeptides 3 and 5 as well as a peptide containing a sequence of ovalbumin (ISQAVHAAHAEINEAGR) as a control.
  • the western blot of Fig. 8B confirms the inhibitory in vivo action of short apoM-derivatives according to the invention.
  • Fig. 8C shows that Peptide 3 has similar inhibitory effects on urinary apoAI clearance than expression of Alb/M117 using recombinant adenovirus.
  • FIG. 8D demonstrates that mice treated intraperitoneally for 2 weeks with Peptide 3 have significantly increased plasma apoAI levels.
  • Figure 8D shows that the increase of plasma apoAI in these Peptide 3 treated mice results in a 2-fold increase in HDL levels compared to PBS treated mice.
  • the 1-D agarose gel electrophoresis of Fig. 8F shows that pre/?-migrating HDL particles are present in mice treated with the soluble apoM peptide 3.

Abstract

La présente invention porte sur des protéines apoM tronquées solubles et sur leurs dérivés, aptes à élever la concentration en apoAI et HDL chez un mammifère lors de l'administration dans la circulation sanguine dudit mammifère, sur des acides nucléiques correspondants ainsi que sur des vecteurs et des cellules hôtes les contenant. De plus, la présente invention porte sur l'utilisation desdites protéines apoM tronquées solubles et de leurs dérivés pour la fabrication de médicaments, en particulier de médicaments pour l'élévation de la concentration en HDL pour la prophylaxie et/ou le traitement de l'athérosclérose et également pour l'augmentation des tensioactifs alvéolaires, en particulier pour la prophylaxie et/ou le traitement du syndrome de détresse respiratoire (SDR) et du syndrome de détresse respiratoire aiguë (SDRA).
PCT/EP2009/007629 2008-10-31 2009-10-26 Protéines apom tronquées solubles et leurs utilisations médicales WO2010049103A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP08018299.1 2008-10-31
EP08018299 2008-10-31

Publications (1)

Publication Number Publication Date
WO2010049103A1 true WO2010049103A1 (fr) 2010-05-06

Family

ID=41466932

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2009/007629 WO2010049103A1 (fr) 2008-10-31 2009-10-26 Protéines apom tronquées solubles et leurs utilisations médicales

Country Status (1)

Country Link
WO (1) WO2010049103A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012162392A1 (fr) * 2011-05-23 2012-11-29 Timothy Hla Matériaux protecteurs de l'endothélium et procédés d'utilisation
WO2019035931A1 (fr) * 2017-08-15 2019-02-21 Children's Medical Center Corporation Protéines de fusion apom-fc et leurs utilisations
US10870689B2 (en) 2016-08-15 2020-12-22 The Children's Medical Center Corporation ApoM-Fc fusion proteins, complexes thereof with sphingosine 1-phosphate (S1P), and methods for treating vascular and non-vascular diseases

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006005583A2 (fr) * 2004-07-12 2006-01-19 Geneprot Inc. Especes de polypeptides secretes impliques dans la sclerose en plaques
WO2006032470A1 (fr) * 2004-09-21 2006-03-30 Smithkline Beecham Corporation Composes qui augmentent la production de l'apolipoproteine a-1 et leurs utilisations en medecine
WO2006118805A2 (fr) * 2005-04-29 2006-11-09 The Regents Of The University Of California Peptides et mimetiques de peptides destines a traiter les pathologies caracterisees par une reaction inflammatoire
WO2008063369A2 (fr) * 2006-11-01 2008-05-29 George Mason Intellectual Properties, Inc. Biomarqueurs pour états neurologiques
WO2009056330A1 (fr) * 2007-10-31 2009-05-07 Eth Zurich Protéines apom tronquées solubles et utilisations médicales de celles-ci
WO2009074350A2 (fr) * 2007-12-13 2009-06-18 Fraunhofer Gesellschaft zur Förderung der angewandten Forschung e.V. Sérum d'analyse protéomique pour la recherche de marqueurs diagnostiques et pour le suivi d'intervention thérapeutique dans le traitement du carcinome hépatocellulaire

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006005583A2 (fr) * 2004-07-12 2006-01-19 Geneprot Inc. Especes de polypeptides secretes impliques dans la sclerose en plaques
WO2006032470A1 (fr) * 2004-09-21 2006-03-30 Smithkline Beecham Corporation Composes qui augmentent la production de l'apolipoproteine a-1 et leurs utilisations en medecine
WO2006118805A2 (fr) * 2005-04-29 2006-11-09 The Regents Of The University Of California Peptides et mimetiques de peptides destines a traiter les pathologies caracterisees par une reaction inflammatoire
WO2008063369A2 (fr) * 2006-11-01 2008-05-29 George Mason Intellectual Properties, Inc. Biomarqueurs pour états neurologiques
WO2009056330A1 (fr) * 2007-10-31 2009-05-07 Eth Zurich Protéines apom tronquées solubles et utilisations médicales de celles-ci
WO2009074350A2 (fr) * 2007-12-13 2009-06-18 Fraunhofer Gesellschaft zur Förderung der angewandten Forschung e.V. Sérum d'analyse protéomique pour la recherche de marqueurs diagnostiques et pour le suivi d'intervention thérapeutique dans le traitement du carcinome hépatocellulaire

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHRISTOFFERSEN CHRISTINA ET AL: "The signal peptide anchors apolipoprotein m in plasma lipoproteins and prevents rapid clearance of apolipoprotein M from plasma", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM, US, vol. 283, no. 27, 1 July 2008 (2008-07-01), pages 18765 - 18772, XP002514109, ISSN: 0021-9258, [retrieved on 20080505] *
SHAKEEL SHABIH ET AL: "Peptide nucleic acid (PNA) - a review", JOURNAL OF CHEMICAL TECHNOLOGY AND BIOTECHNOLOGY, BLACKWELL SCIENTIFIC PUBLICATIONS. OXFORD, GB, vol. 81, no. 6, 1 June 2006 (2006-06-01), pages 892 - 899, XP002514110, ISSN: 0268-2575 *
WOLFRUM CHRISTIAN ET AL: "Apolipoprotein M is required for prebeta-HDL formation and cholesterol efflux to HDL and protects against atherosclerosis.", NATURE MEDICINE APR 2005, vol. 11, no. 4, April 2005 (2005-04-01), pages 418 - 422, XP002563189, ISSN: 1078-8956 *
WOLFRUM CHRISTIAN ET AL: "Foxa2 activity increases plasma high density lipoprotein levels by regulating apolipoprotein M", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 283, no. 24, June 2008 (2008-06-01), pages 16940 - 16949, XP002563188, ISSN: 0021-9258 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012162392A1 (fr) * 2011-05-23 2012-11-29 Timothy Hla Matériaux protecteurs de l'endothélium et procédés d'utilisation
US9592268B2 (en) 2011-05-23 2017-03-14 Cornell University Endothelium protective materials and methods of use
US10870689B2 (en) 2016-08-15 2020-12-22 The Children's Medical Center Corporation ApoM-Fc fusion proteins, complexes thereof with sphingosine 1-phosphate (S1P), and methods for treating vascular and non-vascular diseases
WO2019035931A1 (fr) * 2017-08-15 2019-02-21 Children's Medical Center Corporation Protéines de fusion apom-fc et leurs utilisations
CN111836646A (zh) * 2017-08-15 2020-10-27 儿童医学中心公司 Apom-fc融合蛋白及其用途

Similar Documents

Publication Publication Date Title
Liadaki et al. Binding of High Density Lipoprotein (HDL) and discoidal reconstituted HDL to the HDL receptor scavenger receptor Class B Type I*: effect of lipid association and apoa-I mutations on receptor binding
Yoshimoto et al. The discovery of LOX-1, its ligands and clinical significance
DK2155871T3 (en) ACE2 Polypeptide
Nomura et al. Low-density lipoprotein receptor gene therapy using helper-dependent adenovirus produces long-term protection against atherosclerosis in a mouse model of familial hypercholesterolemia
JP2003531811A (ja) 血管形成及び心臓血管新生の促進又は阻害
WO2010049103A1 (fr) Protéines apom tronquées solubles et leurs utilisations médicales
JP2009171980A (ja) 高トリグリセリド血症を誘発することなくコレステロールレベルを低下するための化合物と方法
WO2009056330A1 (fr) Protéines apom tronquées solubles et utilisations médicales de celles-ci
US7241861B2 (en) High density lipoprotein-reactive peptides
JP6033433B2 (ja) アポリポタンパク質ａｉｖを用いて高血糖障害を治療する方法
EP2367564A1 (fr) Utilisation de la protéine norrin dans le traitement de maladies associées à une augmentation de l'activité de tgf-bêta
US20150119333A1 (en) Methods of inhibiting adverse cardiac events and treating atherosclerosis and coronary artery disease using galectin-3 binding protein (gal-3bp, btbd17b, mac-2 binding protein)
US20060142200A1 (en) Compounds and methods for lowering cholesterol levels without inducing hypertrigylceridemia
EP1314779B1 (fr) Enzymes de type trypsine propres aux voies respiratoires et procede les utilisant
US20220125874A1 (en) Methods of use of soluble cd24 for treating systemic lupus erythematosus
US7309606B2 (en) Methods and compositions for treating hypercholesterolemia
US20130244954A1 (en) Use of reg4 and pharmaceutical composition thereof
EP3366770A1 (fr) Vaccin à adn contre l'amyloide-beta et tau
US9512196B2 (en) Short-form human MD-2 as a negative regulator of toll-like receptor 4 signaling
WO2022237548A1 (fr) Utilisation pharmaceutique de protéine associée aux gouttelettes lipidiques inductibles par l'hypoxie ou d'un fragment tronqué de celle-ci
JP2004518638A (ja) 癌を予防及び／又は治療するためのタンパク質ｅｓｍ−１のアンタゴニスト化合物の使用、及び癌を予防及び／又は治療するための薬剤の製造
JP2006528490A (ja) 抗凝固作用の惹起方法
Harada et al. Transgenic mouse and gene therapy
JP5884105B2 (ja) 酸化ｌｄｌ阻害剤
WO2002059369A2 (fr) Compositions et procedes de traitement des maladies liees a une mauvaise regulation du cholesterol

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09744961

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09744961

Country of ref document: EP

Kind code of ref document: A1