WO2010043114A1

WO2010043114A1 - Use of serum/plasma microrna in early diagnosis of hbv infection and liver cancer

Info

Publication number: WO2010043114A1
Application number: PCT/CN2009/001138
Authority: WO
Inventors: 曾科; 张辰宇; 张峻峰; 李丽民
Original assignee: 北京命码生科科技有限公司
Priority date: 2008-10-13
Filing date: 2009-10-13
Publication date: 2010-04-22
Also published as: CN101368213A; CN102016037A; CN102016037B

Abstract

A microRNA combination used for distinguishing HCV-infected persons, HBV-infected persons and HBV-related liver cancer patients from normal persons as well as the use thereof in early diagnosis of HBV infection and HBV-related liver cancer are provided. The combination contains all the serum/plasma microRNAs which have different expression profiles between HCV-infected persons, HBV-infected persons, HBV-related liver cancer patients and normal persons. A kit containing the microRNAs of the combination used for early diagnosis of HBV infection and HBV-positive liver cancer as well as the preparation method thereof are further provided. The main advantages of the kit include high specificity and high sensitivity.

Description

Application of serum/plasma miRNA in HBV infection and early diagnosis of liver cancer

The invention relates to the application research of serum/plasma microRNA (miRNA) in early diagnosis and dynamic monitoring of HBV-positive liver cancer, and specifically relates to early diagnosis, therapeutic evaluation, drug screening and drug efficacy evaluation of HBV-related diseases, especially liver cancer. Aspect of the application. Background technique

Hepatocellular Carcinoma (HCC) is one of the most common malignant tumors in the world. The International Agency for Research on Cancer (IARC) estimates that there were 564,000 cases of liver cancer in the world in 2000, with a death rate of 549,000. The incidence of liver cancer in China was 306,000 and the death rate was 300,000. More than half of the global morbidity and mortality of liver cancer is one of the major cancers that seriously endanger the health of our people. The occurrence of liver cancer is a multi-factor, multi-stage process. Globally, chronic HBV and HCV infection are major risk factors for primary hepatocellular carcinoma (HCC), especially in areas with chronic HBV infection and HCC. Consistency, related to 75% of global liver cancer, even reaching 85% in developing countries. In China, HBV infection is also the primary risk factor. It is estimated that the number of HBV carriers in China has reached 120 million, 20% of which will develop into chronic hepatitis B (CHB), and there is a significant progress in the activity of chronic hepatitis B. The tendency is that 15%-40% will progress to cirrhosis, and more than 90% of liver cancer patients in China have cirrhosis. Therefore, HBV infection, chronic hepatitis B, and cirrhosis to liver cancer are the main patterns of liver cancer in China. In recent years, through the vaccination of neonatal hepatitis B vaccine and the prevention and treatment of hepatitis B, liver cancer has shown a downward trend in the first generation, but the true manifestation of the effects of vaccines and other measures may take 10-20 years.

The treatment after HBV infection is a long and long process. In this process, the disease is prone to repeated activities, and the lesions often progress in stages. The later the worse, the later the more difficult to treat, after the cirrhosis, antiviral treatment It is difficult to completely prevent its further development, and HCC is one of the most malignant tumors. It has a short course, rapid progress, and poor prognosis. The 5-year survival rate is less than 10%. Therefore, the condition of HBV-infected patients needs long-term dynamic detection, grasp the patient's disease state and severity of the disease, and should make early diagnosis to determine the targeted prevention and treatment plan to maximize the long-term inhibition or elimination of HBV. Hepatocyte inflammation and necrosis and liver fibrosis delay and prevent disease progression, reduce and prevent liver decompensation, cirrhosis, primary hepatocellular carcinoma and its complications, thereby improving quality of life and prolonging survival.

Currently, serum HBV markers and adenines (AFP) are the most widely used HBV infections and HCC biomarkers (Biomarker) in the world, and transaminase reflects liver damage. Common indicators of degree, but they are difficult to reflect the dynamic progress of HBV infection-related diseases, and the early diagnosis of the corresponding diseases is increasingly unable to meet the needs. For example, with the development of imaging, AFP-negative cases are diagnosed as liver cancer. The sensitivity of diagnosing liver cancer is only 40%-60%, and the specificity is 70%-90%. The diagnosis of liver cirrhosis and the judgment of lesion degree still lack suitable biomarkers. Although researchers at home and abroad are exploring new biomarkers to effectively supplement AFP, it is difficult to break through the bottleneck in the development and application of traditional biomarkers, that is, it is difficult to prepare and quantitatively detect antibodies.

In summary, HCC is relatively insidious and has a poor prognosis. To strengthen the monitoring of HBV-infected patients and to identify early indicators of disease changes, it is necessary to obtain sensitive, specific, and easily detectable markers for different stages of HBV infection. In addition, HBV infection and HCC treatment have limited effect. To judge the early effect of treatment, and find more effective therapeutic targets, targeted therapy requires dynamic monitoring of the effects of HBV infection and HCC treatment, and understand the natural history of HBV infection, HCC. The molecular mechanisms of occurrence and development gain access to easily modulating therapeutic targets. Therefore, finding a new class of specific biomarkers is a top priority for liver cancer prevention and treatment.

MicroRNA (miRNA) is a research hotspot in recent years. It is a single-stranded RNA molecule of about 19-23 nucleotides in length. It is located in the non-coding region of the genome and is highly evolutionarily conserved. It can regulate gene expression at the translational level. And closely related to many normal physiological activities of animals, such as biological individual development, tissue differentiation, apoptosis and energy metabolism, and also closely related to the occurrence and development of many diseases. Since the discovery of lin-4 and let-7, which have been involved in the regulation of nematode timing, microRNAs have gradually become a research hotspot for regulating mRNA stability and protein translation. They were selected into Science Magazine's top ten technological breakthroughs in 2002 and 2003 respectively. . It is now predicted that microRNAs can regulate at least 5,300 human genes, or 30% of all genes. With the deepening of research, more and more miRNAs have been discovered. Among them, the relationship between miRNAs and tumors has become the focus of research. Several miRNAs have been found to express negatively regulated genes with chronic lymphocytic leukemia, lung cancer, and breast. Cancer and colon cancer are highly correlated. The positive regulation of miRNAs The phenomenon of target genes is a recent discovery, and the specific mechanism is still unclear. Some scholars have proposed the "cancer microRNA" (OncomiRs) view that the abnormal expression of certain miRNAs plays a similar oncogene role in the development of tumors.

Liver cancer, especially hepatitis B-related liver cancer, has a high incidence rate and high mortality in China, which seriously endangers people's health. However, there is no satisfactory treatment for hepatitis B-related liver cancer. Domestic and foreign scholars have carried out extensive and in-depth research on liver cancer, but the relationship between hepatitis B virus and the development of liver cancer has not been fully elucidated. Recent studies have shown that miRNA may play an important role in the development and progression of liver cancer, but there is no report on the use of serum/plasma microribonucleic acid for the diagnosis and treatment of liver cancer. Road.

In previous studies, we found that there are hundreds of microRNAs in serum/plasma, which are stable, abundant, and easy to quantify, and have significant disease specificity. Serum microRNA expression has been confirmed in lung cancer and colon cancer. It can be used as a potential biomarker for early diagnosis, and the microRNA in serum is first proposed as a new indicator for disease detection (the invention has been patented). This finding is inspiring. Serological microRNAs, as a class of non-coding regulatory small RNAs, have the potential to replace traditional biomarkers represented by specific proteins, opening up a new realm of biomarkers. The research quickly attracted widespread attention from the international media. Reuters, Hezhong, Scientific American, and the US Technical Review all reported on the research results. Nature is also on its website. The latest research progress from China is shown in the "Latest Research Progress" column of the homepage. Therefore, if we can screen out HCC-specific serum microRNAs caused by HBV infection as biomarkers and develop corresponding disease progression monitoring chips, it is not only an international leader in this field, but also the prevention and treatment of HBV infection-related diseases and HCC in China. It is a powerful push.

At present, the diagnosis of HCC caused by HBV infection is limited to various biochemical indicators in serum/plasma, as well as traditional medical and imaging methods, and there is no report on the use of serum/plasma microRNA for diagnosis and treatment of liver cancer. . Based on this finding of microribonucleic acid, the present inventors will study the important application prospects of blood/plasma microribonucleic acid in the diagnosis and treatment of liver cancer caused by hepatitis B. Therefore, it is hoped that the HCC-specific serum microRNA expression database and liver cancer-specific markers caused by HBV infection can be obtained through the successful implementation of this subject, and a diagnostic kit for HCC caused by HBV infection can be developed to provide data support for the study of the occurrence and progression mechanism of HBV-related diseases. Through the development and application of serum microRNA biomarkers and diagnostic kits, the early diagnosis and dynamic monitoring of HCC caused by HBV infection is convenient and convenient, allowing clinicians to quickly and accurately grasp the patient's condition and timely obtain more individualized prevention and treatment. The program provides support and lays the foundation for the evaluation of clinical application effects in the later period. Summary of the invention

The present inventors search for a class of liver cancer caused by HBV infection-related diseases, especially HBV infection, by isolating and studying microRNAs in the serum of normal humans, HBV carriers, chronic hepatitis B patients, hepatitis C patients, and HBV-infected liver cancer patients. Early diagnosis of high-efficiency, high-specificity and high-sensitivity microRNAs, and the development of a diagnostic kit for the early diagnosis of liver cancer caused by HBV infection-related diseases, especially HBV infection. In order to achieve this, the problems to be solved by the present invention include: (1) Establishing a unified standard specimen library and data Library: A standard-compliant blood sample is collected using standard operating procedures (SOPs) and the system collects complete demographic data and clinical data. (2) Analysis of serum miRNA differential expression: Select healthy individuals, hepatitis B surface antigen carriers, chronic hepatitis B patients, chronic hepatitis C patients and HBV-related liver cancer patients to detect serum miRNA expression profiles and levels, and analyze the commonality of serum miRNAs in different populations. Characteristics, screening differentially expressed miRNAs for further large sample independent validation. (3) Screening for disease-specific serum miRNAs: Quantitative analysis of screened differentially expressed miRNAs in large sample populations to determine specific serum miRNAs in hepatitis B surface antigen carriers, chronic hepatitis B patients, chronic hepatitis C patients, and liver cancer patients. Specificity indicates the various stages of liver cancer development, reflecting the dynamic changes in liver cancer. (4) Development of serum miRNA diagnostic kit: According to HBV infection to specific stage of liver cancer, specific serum miRNA development miRNA diagnostic kit, the chip can identify the stage of the HBV infection patients and the severity of the disease, to achieve early diagnosis of liver cancer purpose.

In order to solve the above problems, the inventors collected standard blood samples by standard operating procedures (SOPs), systematically collected complete demographic data and clinical data, and employed RT-PCR methods, Real-time PCR methods, and Solexa sequencing. One or more of technology and biochip methods.

Specifically, the experimental methods of research mainly include the following parts:

1. Sample sorting and classification method

Group A: healthy control group (n=80)

(1) Hepatitis B surface antibody, hepatitis B surface antigen and hepatitis B core antibody negative

(2) Hepatitis C antibody and / or hepatitis C RNA negative

(3) ALT<40IU/L, AST<45IU/L

(4) No other systemic diseases

(5) Age ≥ 20

Group B: Virus Cleaner (n=80)

(1) Hepatitis B surface antigen negative and / or HBV-DNA negative, hepatitis B surface antibody and hepatitis B core antibody positive and no vaccine injection history

(2) Hepatitis C antibody and / or hepatitis C RNA negative

(3) ALT<40IU/L, AST<45IU/L

(4) No other systemic diseases

(5) Age ≥ 20

Group N: Control group (n=60) Integration of Group A and Group B

Group C: persistent asymptomatic HBV infection (n=55) (1) Hepatitis B surface antigen and core antibody positive

(2) Hepatitis C antibody and / or hepatitis C RNA negative

(3) ALT<40IU/L, AST<45IU/L

(4) No clinical symptoms of hepatitis

(5) No clinical signs of cirrhosis

(6) No other systemic diseases

(7) Age ≥ 20

Group D: Chronic hepatitis B patients (n=80)

(1) Hepatitis B surface antigen and hepatitis B core antibody are positive for at least 6 months

(2) Hepatitis C antibody and / or hepatitis C RNA negative

(3) ALT and / or AST levels are more than twice the normal value

(4) No clinical signs of cirrhosis

(5) No other systemic diseases

(6) Age ≥ 20

Group HBV: HBV Group (n=135) Integration of Group C and Group D

Group HBV-HCC: HBV-associated hepatocellular carcinoma (n=65)

(1) Hepatitis B surface antigen and hepatitis B core antibody positive

(2) Hepatitis C antibody and / or hepatitis C RNA negative

(3) Histopathological examination confirmed hepatocellular carcinoma

(4) Age ≥ 40

Group HCV: Chronic hepatitis C patients (n=48)

(1) Hepatitis C antibody and / or hepatitis C RNA positive

(2) Hepatitis B surface antigen negative

(3) ALT and / or AST levels are more than twice the normal value

(4) No clinical signs of cirrhosis

(5) No other systemic diseases

(6) Age ≥ 20

2. Trizol Reagent (Invitrogen, Carlsbad, CA) extracts total serum RNA

(1) Take 80-100ml of serum and add an equal volume of Trizol Reagent

(2) Phase separation

Leave at room temperature for 15 min, then add chloroform according to the volume ratio of 0.2 ml chloroform / 1 ml Trizol Reagent. The education column is shaken for 15 s, room temperature for 15 min, 12,000 g, 4 ° C, centrifuge for 15 min. (3) Transfer the aqueous phase to a new 50 ml centrifuge tube, 3 steps of phenol/chloroform to remove the protein phase (4) RNA precipitation

Transfer the aqueous phase to a new centrifuge tube, add isopropanol in a volume of 0.5 ml isopropanol / 1 ml Trizol Reagent, store at -20 ° C for 60 min, 12,000 g, 4 ° C, centrifuge for 60 min ( 5 ) with 1 ml Trizol Suspend the pellet and transfer the suspension to a new 1.5 ml centrifuge tube.

(6) Repeat steps 2 and 4 (the fourth step is changed to 15 minutes)

(7) RNA washing

Remove the supernatant, add 75% ethanol, 12,000g, centrifuge at 5 ° C for 5min

(8) Measuring concentration

Usually get 5~10 μg RNA/ 50-100 ml serum

3. Solexa sequencing

(1) Total RNA was recovered by PAGE to recover 17-27nt RNA molecules.

(2) Enzyme adaptor prime to the 3' and 5' ends of small RNA molecules

(3) After RT-PCR reaction and sequencing

(4) Data analysis and processing

4. Real-time PCR method

(1) taking the serum/plasma total RNA of the subject, and obtaining a cDNA sample by reverse transcription reaction of RNA; or collecting serum/plasma samples of the subject, and performing reverse transcription reaction using serum/plasma as a buffer to prepare a cDNA sample. ;

(2) designing primers using microRNAs;

(3) adding a fluorescent probe for PCR reaction;

(4) Detect and compare changes in the amount of microRNA in serum/plasma samples of normal, hepatitis B carriers, and hepatitis B patients.

5. Diagnostic kit preparation method

The Solexa method determines more than 50 copies of microRNA in normal and patient sera. Then, by using quantitative PCR technology and biochip technology, a class of serum/plasma microRNAs with large expression and degree of difference under disease and normal physiological conditions is screened as an index for predicting whether liver cancer and other diseases associated with HBV occur and the degree of disease diagnosis. . The final screening of the number of serum ribonucleic acids corresponding to liver cancer and HBV-related diseases is controlled in the order of a few to a dozen, which is an optimized reduction based on the chip probe library. The diagnostic kit includes a batch of serum microRNA primers, Taq enzymes, dNTPs and other reagents.

According to the above Solexa sequencing method, the inventors detected differentially expressed normal persons and The ribonucleic acids in serum/plasma of patients with chronic hepatitis B include let-7c, miR-1, miR-10a, miR-122, miR-125b, miR-128a, miR-128b, miR-150, miR-197, miR- 221 , miR-222 , miR-223, miR-23a, miR-23b, miR-27a, miR-27b, miR-30a, miR-342-3p, miR-361-5p, miR-423-5p, miR- 532-5p, miR-574-3p, miR-629, miR-92a, miR-92b, miR-99a, miR-139-5p, miR-193a-5p, miR-193b, miR-365, miR-375, miR-455-3p, miR-483-3p, miR-483-5p, miR-486-3p, miR-885-5p, miR-99b, let-7f, let-7g, let-7i, miR-101, miR-103, miR-106a, miR-106b, miR-107, miR-126, miR-130a, miR-130b, miR-142-3p, miR-142-5p, miR-144, miR-146a, miR- 146b-5p, miR-148b, miR-151-5p, miR-15a, miR-16, miR-17, miR-182, miR-183, miR-185, miR-186, miR- 18a, miR-191, miR-19b, miR-20a, miR-20b, miR-21, miR-210, miR-26a, miR-26b, miR-29c, miR-30e, miR-340, miR-362-5p, miR-363, miR-374a, miR-378, miR-424, miR-451, miR-454, miR-532-5p, miR-652, miR-660, miR-7, miR-923, miR-93, miR-96, miR-98.

The present inventors demonstrated that there was no significant difference in the expression of serum microRNAs between normal controls and virus removers, between chronic hepatitis B patients and HBV carriers, and that normal controls and virus scavengers were integrated into a control group, chronic hepatitis B Patients and HBV carriers were integrated into the HBV group. The specific implementation method is:

According to the above Solexa results, microRNAs whose copy number in chronic hepatitis B patients is 20 times the copy number in healthy controls are selected as serum markers for preliminary screening in the present invention, and the copy number of these microRNAs in chronic hepatitis B patients is larger than 50 copies, due to technical operation problems, abandoned miR-221 and miR-629.

According to the above real-time PCR method, the inventors performed 30 normal controls (samples sequenced with Solexa), 30 virus scavengers, 30 chronic hepatitis B patients (samples sequenced with Solexa), and 30 asymptomatic HBV infected persons. The following 13 microRNAs were successfully detected in serum: miR-122a, miR-423, miR-92a, let-7c, miR-23a, miR-23b, miR-223, miR-342-3p, miR-375, miR- 99a, miR- 150, miR- 125b, miR-10a

As a result of the analysis, the present inventors found that there was no significant difference in the expression of the 13 microRNAs between the normal control and the virus remover, between the chronic hepatitis B patients and the HBV carriers, and therefore, the normal controls and the virus scavengers were integrated into the control. Group, chronic hepatitis B patients and HBV carriers were integrated into the HBV group.

The inventors have also demonstrated that the selected 13 microRNAs can open the control group, the chronic hepatitis C infected person and the HBV component, and the specific implementation method is: Further detection of the specific expression of HBV, the above-mentioned real-time PCR method was used to detect the expression of these 13 microRNAs in the serum of 30 patients with chronic hepatitis C, and found that chronic hepatitis C infection can be combined with HBV components.

It was further confirmed that these 13 microRNAs could be used to detect chronic hepatitis C infection and HBV components. The 13 microRNAs were compared in 100 control groups (50 healthy controls and 50 virus removers) and 75 HBV groups (25 HBV carriers). The expression in clusters of patients with chronic hepatitis B and 18 patients with chronic hepatitis C, cluster analysis using Cluster 3.0, these 193 samples can be divided into three categories: control group, HBV group and HCV group, normal There was indeed no significant difference between the control and the virus remover, between the chronic hepatitis B patients and the HBV carriers.

Based on the above results, the inventors also demonstrated six microRNAs among the selected 13 markers by cluster analysis: miR-375, miR-92a, miR-10a, miR-223, miR-423- 5 and miR-99a can distinguish the control group, the HBV group and the HCV group. There are only 2 cases in the 160 control group and only 135 cases in the HB V group are incorrectly classified, while the HC V group None of the cases were classified as errors.

Based on the results of the above series of studies, the inventors finally demonstrated 8 microRNAs among the 13 selected markers: miR-23b, miR-423-5p, miR-375, miR-23a, miR-342- 3p, miR-10a, miR-125b, miR-92a can separate the HBV-HCC group from the HBV group and the control group. The specific implementation method is:

The sera of 65 HBV-related HCC patients were collected for real-time PCR. The real-time PCR results were clustered with the above control results and HBV results. The results showed that 8 microRNAs: miR-23b, miR -423-5p, miR-375, miR-23a, miR-342-3p, miR-10a, miR-125b, miR-92a can separate the HBV-HCC group from the HBV group and the control group, 160 control groups Only 2 of the 135 HBV groups were misclassified, and none of the HBV-HCC groups were misclassified.

In addition, the inventors have also provided the diagnostic ability of low-expression or high-expression single or multiple markers to distinguish four groups of samples (Group N, Group HBV, Group HCV, Group HBV-HCC), and the specific implementation methods and results are as follows:

Risk-scores of real-time PCR results for normal control (Group N), HBV (Group HBV), HCV (Group HCV), and HBV-HCC (Group HBV-HCC) samples, expressed as microRNA per microRNA The 5% or 95% reference interval is the risk value, and the ROC curve is used to evaluate the sensitivity and specificity of the prediction, thereby assessing the ability of low or high expression of single or multiple microRNAs in the early diagnosis of liver cancer. ROC analysis showed that miR-375, miR-10a, miR-223 (miR-122a or miR-342-3p), miR-423 The control and HBV fractions were opened with 100% AUC (area under the ROC curve), miR-92a and miR-423-5 were separated from the HCV group by 99.6% AUC, miR-23b, miR-423-5p , miR-375, miR-23a and miR-342-3p open the control and HCC components with 99.9% AUC, while miR-375 and miR-92a open HBV and HCV components, miR-10a and miR-92a The HBV group and the HCC component were opened. When miR-375, miR-10a, miR-223 and miR-423-5p 4 markers were used to distinguish the control group from the HBV group, the AUC was 99.9 ± 0.1%, the sensitivity was 99.3%, and the specificity was 98.8%. When miR-92a, miR-423-5p 2 markers were used to distinguish the control group from the HCV group, the AUC was 99.6 ± 0.4%, the sensitivity was 97.9%, and the specificity was 99.4%. Similarly, when miR-23b, miR-423-5p, miR-375, miR-23a and miR-342-3p 5 markers were used to distinguish the control group from the HBV-HCC group, the AUC was 99.9% ± 0.1%. The sensitivity was 96.9% and the specificity was 99.4%. When the HBV group and the HBV-HCC group were distinguished by miR-10a and miR-125b, the AUC was 99.2%, the sensitivity was 98.5%, and the specificity was 98.5%.

According to the above diagnostic kit preparation method and the above series of experimental results, the inventors have also prepared a diagnostic kit which can be used for early diagnosis of liver cancer, and the diagnostic kit comprises a stable presence in the serum/plasma of the subject. Primers for detection of mature miR-375, miR-92a, miR-10a, miR-223, miR-423-5p, miR-23b, miR-23a, miR-342-3p, miR-99a, miR-125b tool.

Specifically, the above microRNAs combination, method, and diagnostic kit can be used for early diagnosis and dynamic monitoring of HBV-related liver cancer and HBV infection, for the clinician to quickly and accurately grasp the patient's disease state and severity, and to obtain more personality in time. Supported by a controlled regimen to minimize or eliminate HBV, reduce hepatic inflammatory necrosis and liver fibrosis, delay and prevent disease progression, reduce and prevent liver decompensation, cirrhosis, and primary hepatocellular carcinoma And its complications occur to improve quality of life and prolong survival.

The invention also provides a theoretical basis for the clinical application of serum microRNA biomarkers and monitoring kits, to find early indicators of changes in other diseases, to make early judgments on the therapeutic effects of diseases, to find more effective therapeutic targets for diseases, and to clarify diseases. The molecular mechanisms of occurrence and development provide theoretical basis and technical support.

In summary, the advantages of microRNA as an early diagnostic marker for HBV-associated liver cancer and HBV infection are: (1) Serum miRNA is a novel biomarker that is not only stable, minimally invasive, and easy to distinguish from traditional biomarkers. Detection, and quantitative accuracy, will greatly improve the sensitivity and specificity of disease diagnosis. The successful development of this kind of small molecule RNA biomarkers is the subversion of traditional protein-based biomarkers, which will be HBV-related liver cancer and Prevention and treatment of HBV infection Create a new situation and provide reference for the development of biomarkers for other diseases. (2) The serum miRNA monitoring kit is a systematic and comprehensive diagnostic kit. The serum miRNA monitoring kit can clarify the disease progression of HBV-related liver cancer patients, comprehensively reflect the patient's disease state, avoid the complicated detection, and save the economy. Cost and time, support clinicians to quickly and accurately grasp the patient's condition and timely access to more personalized prevention and treatment programs. (3) Using a rigorous, multi-stage validation and evaluation system, the inventors initially used Solexa sequencing technology to directly sequence serum miRNAs to obtain disease-specific serum miRNA expressions, and applied q-PCR methods in large The samples were independently validated; serum miRNA markers and diagnostic kits were evaluated for initial efficacy in existing patient resources, and then two large prospective follow-up cohorts were used for evaluation. The application of the above methods and strategies accelerated and ensured serum. The clinical application of miRNA biomarkers and diagnostic kits also provides methods and strategies for the development of biomarkers for other diseases.

In conclusion, the use of serum/plasma microribonucleoside S-history detection technology can early diagnose HBV-associated liver cancer and HBV infection. This new HBV-associated serum/plasma marker for liver cancer and HBV infection is not only comprehensively understood at the molecular level. The mechanism of the occurrence and development of liver cancer provides a material basis and accelerates the progress of clinical disease diagnosis and therapeutics in liver cancer. Of course, the effectiveness of early diagnostic kits for detecting liver cancer remains to be further clinically validated. However, based on the superiority of microRNA as an early diagnostic marker for HBV-associated liver cancer and HBV infection, it is believed that in the near future, serum/plasma microribonucleic acid diagnostic technology for liver cancer will become a new technology for early diagnosis of liver cancer. The doctor's application makes it easy for clinicians to make timely and effective individualized treatment for patients. Conquering liver cancer is no longer a dream. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows hsa-miR-122a, hsa-miR-423-5p, hsa-miR-92a, hsa-let-7c, hsa-miR-23a, hsa-miR-23b, hsa-miR-223, hsa- miR-342-3p, hsa-miR-375, hsa-miR-99a, hsa-miR-150, hsa-miR-125b, hsa-miR-lOa 13 microRNAs as markers against healthy controls (A) and viruses The scavenger (B) performs the results of the cluster analysis.

Figure 2 shows hsa-miR-122a, hsa-miR-423-5p, hsa-miR-92a, hsa-let-7c, hsa-miR-23a, hsa-miR-23b, hsa-miR-223, hsa- miR-342-3p, hsa-miR-375, hsa-miR-99a, hsa-miR-150, hsa-miR-125b, hsa-miR- 10a 13 microRNAs as markers for asymptomatic HBV carriers (C) The results of cluster analysis were performed with chronic hepatitis B patients (D).

Figure 3 shows hsa-miR-122a, hsa-miR-423-5p, hsa-miR-92a, hsa-let-7c, hsa-miR-23a, hsa-miR-23b, hsa-miR-223, hsa-miR-342-3p, hsa-miR-375, hsa-miR-99a, hsa-miR-150, hsa-miR-125b, hsa-miR- 10a 13 microRNAs as markers for healthy controls (A), viral scavengers (B), chronic hepatitis C patients (HCV), asymptomatic HBV-infected patients (C), and chronic hepatitis B patients (D) The result of the class analysis.

Figure 4 shows hsa-miR-122a, hsa-miR-423-5p, hsa-miR-92a, hsa-let-7c, hsa-miR-23a, hsa-miR-23b, hsa-miR-223, hsa- miR-342-3p, hsa-miR-375, hsa-miR-99a, hsa-miR-150, hsa-miR-125b, hsa-miR- 10a 13 microRNAs as markers when compared to normal control (N), chronic The results of cluster analysis were performed in the hepatitis C patient group (HCV) and the HBV group (HBV).

Figure 5 shows the ROC curve between the normal control group and the HBV group.

Figure 6 shows the ROC curve between the normal control group and the HCV group.

Figure 7 shows the normal control in the case of has-miR-375, has-miR-92a, has-miR-10a, has-miR-223, has-miR-423-5 and has-miR-99a 6 microRNAs as markers Group (N), chronic hepatitis C (HCV) and HBV (HBV) cluster analysis results.

Figure 8 shows the ROC curve between the normal control group and the HBV-HCC group.

Figure 9 shows the ROC curve between the HBV group and the HBV-HCC group.

Figure 10 shows that has-miR-23b, has-miR-423-5p, has-miR-375, has-miR-23a, has-miR-342-3p, has-miR-10a, has-miR-125b and The results of cluster analysis of the normal control (N), liver cancer patient group (HBV-HCC) and HBV group (HBV) were performed with 8 microRNAs of has-miR-92a as markers. The best way to implement the invention

Example 1 Collection of samples and preparation of sample data

The inventors collected a large number of serum samples from the First Affiliated Hospital of Nanjing Medical University and the Nanjing Infectious Disease Hospital from September 2007 to July 2008. The inventors selected 80 cases from the sample data. Healthy controls (mean age: 37.52 ± 12.09, age span: 20-75, male: 37, female: 43), 80 viral removers (mean age: 37.2 ± 9.85, age span: 25-52, male: 48 , Female: 32), 55 patients with long-term asymptomatic HBV infection (mean age: 35.80 ± 11.40, age span: 21-67, male: 33, female: 22), 80 patients with chronic hepatitis B (mean age: 36.22 ± 12.18 , Age span: 20-86, Male: 55, Female: 25), 65 patients with HBV-related HCC (mean age: 53.43 ± 9.10, age span: 40-83, male: 59, female: 6) and 48 patients Chronic hepatitis C patients (flat Mean age: 35.96 ± 7.15, age span: 24-58, male: 39, female: 9) Experimental samples for Solexa sequencing and subsequent series of q-PCR validations. The specific sample classification criteria are as follows: Group A: healthy control group (n=80)

1. Hepatitis B surface antibody, hepatitis B surface antigen and hepatitis B core antibody negative

2. Hepatitis C antibody and / or hepatitis C RNA negative

3. ALT <40IU/L, AST<45IU/L

4. No other systemic diseases

5. Age > 20

Group B: Virus Cleaner (n=80)

1. Hepatitis B surface antigen negative and / or HBV-DNA negative, hepatitis B surface antibody and hepatitis B core antibody positive and no vaccine injection history

2. Hepatitis C antibody and / or hepatitis C RNA negative

3. ALT <40IU/L, AST<45IU/L

4. No other systemic diseases

5. Age > 20

Group N: Control group (n=60) Integration of Group A and Group B

Group C: persistent asymptomatic HBV-infected (n=55)

1. Hepatitis B surface antigen and core antibody positive

2. Hepatitis C antibody and / or hepatitis C RNA negative

3. ALT <40IU/L, AST<45IU/L

4. No clinical symptoms of hepatitis

5. No clinical signs of cirrhosis

6. No other systemic diseases

7. Age > 20

Group D: Chronic hepatitis B patients (n=80)

1. Hepatitis B surface antigen and hepatitis B core antibody are positive for at least 6 months

2. Hepatitis C antibody and / or hepatitis C RNA negative

3. ALT and / or AST levels are more than twice the normal value

4. No clinical signs of cirrhosis

5. No other systemic diseases

6. Age > 20

Group HBV: HBV Group (n=135) Integration of Group C and Group D

Group HBV-HCC: HBV-associated hepatocellular carcinoma (n=65) 1 · Hepatitis B surface antigen and hepatitis B core antibody positive

2. Hepatitis C antibody and / or hepatitis C RNA negative

3. Tissue biopsy confirmed hepatocellular carcinoma

4. Age > 40

Group HCV: Chronic hepatitis C patients (n=48)

1. Hepatitis C antibody and / or hepatitis C RNA positive

2. Hepatitis B surface antigen negative

3. ALT and / or AST levels are more than twice the normal value

4. No clinical signs of cirrhosis

5. No other systemic diseases

6. Age > 20 Example 2 Solexa sequencing of serum/plasma microRNAs

Using Solexa sequencing technology, it was found and demonstrated that there were 88 differentially expressed microRNAs in serum/plasma of 30 healthy controls and 30 chronic hepatitis B patients. The specific steps are: (1) collecting serum/plasma from healthy controls and chronic hepatitis B patients

(2) Take 80-100ml of serum separately and add an equal volume of Trizol Reagent

(3) phase separation

Leave at room temperature for 15 min, then add 0.2 ml of chloroform mi Trizol Reagent to the volume ratio of chloroform. The education column is shaken for 15 s, room temperature for 15 min, 12,000 g, 4 ° C, centrifuge for 15 min.

(4) Transfer the aqueous phase to a new 50 ml centrifuge tube and remove the protein phase with 3 steps of phenol/chloroform.

(5) RNA precipitation

Transfer the aqueous phase to a new centrifuge tube, add isopropanol in a volume of 0.5 ml isopropanol / 1 ml Trizol Reagent, store at -20 °C for 60 min, 12,000 g, 4 °C, centrifuge for 60 min (6) with 1 ml Trizol Resuspend the pellet and transfer the suspension to a new 1.5 ml centrifuge tube

(7) Repeat steps 2 and 4 (the fourth step is changed to 15 minutes)

(9) RNA washing

Remove the supernatant, add 75% ethanol, 12,000g, centrifuge at 5 ° C for 5min

(10) Measuring concentration

Usually get 5~10 μg RNA/ 50-100 ml serum

( 11 ) Total RNA was recovered by PAGE to recover 17-27nt RNA molecules

(12) Enzyme adaptor prime to the 3' and 5' ends of small RNA molecules

(13) After RT-PCR reaction and sequencing (14) Data analysis and processing

The specific experimental results are shown in Table 1. Based on the Solexa results in the table, we selected microRNAs in chronic hepatitis B patients that were 20 times the copy number in healthy controls as serum markers for initial screening in the present invention, and copies of these microRNAs in chronic hepatitis B patients. The number is greater than 50 copies, due to technical operational problems, we have abandoned miR-221 and miR-629 (underlined in Table 1). By screening, hsa-miR-122a, hsa-miR-423-5p, hsa-miR-92a, hsa-let-7c, hsa-miR-23a, hsa-miR-23b, hsa-miR-223, hsa were selected. -miR-342-3p, hsa-miR-375, hsa-miR-99a, hsa-miR-150, hsa-miR-125b, hsa-miR- 10a 13 microRNAs (italicized in Table 1) for initial screening Markers, and designed reverse transcription and q-PCR primers (see Table 2).

Table 1 Serum Solexa sequencing results of healthy controls and chronic hepatitis B patients

Ϋ3/: O 8επο1£soiAV

Hsa-mi -10a-F ACACTCCAGCTGGGTACCCTGTAGATCCGAA

hsa-mir-122a-F ACACTCCAGCTGGGTGGAGTGTGACAATGG

Hsa-mi -125b-F ACACTCCAGCTGGGTCCCTGAGACCCTAAC

hsa-mir-150-F ACACTCCAGCTGGGTCTCCCAACCCTTGTA

Hsa-mi -223-F ACACTCCAGCTGGGTGTCAGTTTGTCAAAT

Hsa-mi -23a-F ACACTCCAGCTGGGATCACATTGCCAGGG

Hsa-mi -23b-F ACACTCCAGCTGGGATCACATTGCCAGGG

Hsa-mi -342-3p-F ACACTCCAGCTGGGTCTCACACAGAAATCGC

Hsa-mi -423-5p-F ACACTCCAGCTGGGTGAGGGGCAGAGAGCGA

Hsa-mi -92a-F ACACTCCAGCTGGGTATTGCACTTGTCCCG

Hsa-mi -99a-F ACACTCCAGCTGGGAACCCGTAGATCCGAT

Hsa-mi -375-F ACACTCCAGCTGGGTTTGTTCGTTCGGCTC Example 3 Real-time PCR of small RNA in serum including Solexa samples

Using the primers of Table 2, sera from 30 healthy controls (Solexa sequencing samples), 30 viral scavengers, 30 asymptomatic HBV infected patients, 30 chronic hepatitis B patients (Solexa sequencing samples), and 30 chronic hepatitis C patients were performed. qRT-PCR assay of microRNAs.

(1) Prepare cDNA samples: a) Take 500 ul of serum; b) Add an equal volume of water-saturated phenol, mix by shaking, centrifuge at 3200 °C for 3 minutes at 3200 °C, and take supernatant; c) Supernatant + 1/2 volume ( 250ul) phenol + 1/2 volume (250ul) chloroform, vortex and mix, centrifuge at 3200C, 13200rpm for 3 minutes, take the supernatant; d) add the same volume of chloroform to the supernatant, shake at 4 °C, 13200rpm After 3 minutes, the supernatant was taken as an RNA sample; e) cDNA was then obtained by reverse transcription of RNA. The reverse reaction system included 4 μl 5 AMV buffer, 2 μl lOmM each dNTP mixture ( Takara), 0.5 μl RNase Inhibitor ( Takara), 2 μ1 AMV ( Takara), and a 1.5 μ1 gene-specific reverse primer mixture. The reaction step is 15 minutes incubation at 16 ° C, 1 hour reaction at 42 ° C, and 5 minutes incubation at 85 ° C;

(2) q-PCR: dilute the cDNA in 1/5, extract the cDNA from the Ιμΐ, add 0.3μ1 Taq enzyme ( Takara), Ιμΐ 20xEVA GREEN, 0.2μ1 10μΜ forward primer, 0.2μ1 10μΜ universal reverse Primers, 1.2 l 25 mM MgCl ₂ , 1.6 μl 2.5 mM each dNTP mixture ( Takara), 2 μl lOx PCR buffer, 13.5 μl Η ₂ 0, 20 μl system for q-PCR. The instrument was an ABI Prism 7300 real-time PCR instrument. The reaction conditions for the PCR were: 95 ° C, 5 minutes for 1 cycle → 95 ° C, 15 seconds, 60 ° C, 1 minute for 40 cycles. The ratio of the expression level of serum microRNA in the two groups can be expressed by Equation 2 - ^AG , where AG = C _T groupi - C _{T g} rou _P 2 o The data results are clustered by Cluster 3.0, and the results are analyzed. There was no significant difference between healthy controls and virus removers, and there was no significant difference between HBV carriers and chronic hepatitis B patients. hsa-miR-122a, hsa-miR-423-5p, hsa-miR-92a, hsa-let-7c, hsa-miR-23a, hsa-miR-23b, hsa-miR-223, hsa-miR-342 -3p, hsa-miR-375, hsa-miR-99a, hsa-miR-150, hsa-miR-125b, hsa-miR- 10a 13 microRNAs were used as markers to cluster data analysis with Cluster 3.0. Figure 1, 2, 3. Figure 1 shows the results of cluster analysis of 30 healthy controls (A) and 30 viral scavengers (B). Figure 2 shows 30 patients with asymptomatic HBV carriers (C) and 30 patients with chronic hepatitis B (D). The results of the class analysis, Figure 3 are 30 healthy controls (A), 30 viral scavengers (B), 30 chronic hepatitis C patients (HCV), 30 asymptomatic HBV carriers (C), and 30 chronic Results of cluster analysis of hepatitis B patients (D). It can be seen from Figure 1 that the healthy control (A) and the virus remover (B) clusters are inseparable. It can be seen from Figure 2 that HBV carriers (C) and chronic hepatitis B patients (D) clusters are also inseparable. It can be seen from Figure 3 that healthy controls (A) and virus removers (B), HBV carriers (C), and chronic hepatitis B patients (D) can be separated from chronic hepatitis C patients (HCV), so healthy controls will be used. (A) and virus scavenger (B) were integrated into a control group (Group N), and HBV carriers (C) and chronic hepatitis B patients (D) were integrated into the HBV group (Group HBV). Example 4 Real-time PCR experiment of microRNA in serum after re-integration and expansion of sample volume

Using the primers of Table 2, 100 control groups (50 healthy controls and 50 viral scavengers),

The sera of 75 HBV groups (25 HBV carriers and 50 chronic hepatitis B patients) and 18 chronic hepatitis C patients were subjected to qRT-PCR assay of microRNA. The experimental method, the qRT-PCR result processing method, and the clustering method were the same as in the third embodiment.

The qRT-PCR results further demonstrate that there is indeed no significant difference between healthy controls and virus removers, between HBV carriers and chronic hepatitis B patients. hsa-miR-122a, hsa-miR-423-5p, hsa-miR-92a, hsa-let-7c, hsa-miR-23a, hsa-miR-23b, hsa-miR-223, hsa-miR-342 -3p, hsa-miR-375, hsa-miR-99a, hsa-miR-150, hsa-miR-125b, hsa-miR- 10a 13 microRNAs as markers for clustering analysis of data results with Cluster 3.0, clustering The results are shown in Figure 4. As can be seen from Figure 4, the 193 serum samples used in the experiment can be clearly divided into three groups: control group (N), human hepatitis C patient group (HCV) and HBV group (HBV).

In order to evaluate the diagnostic ability of these 13 microRNAs in the early diagnosis of HBV disease, the inventors also performed real-time PCR on samples of the control group, HBV group, HCV group and HBV-HCC group. Results Risk scores were taken, with a reference range of 5% or 95% of each microRNA expression being the wind P佥 value, and the ROC curve was plotted to assess the sensitivity and specificity of the prediction. The ROC analysis results are shown in Tables 3, 4, and 5 and Figures 5 and 6.

Table 3 shows that miR-375, miR-10a, miR-223 (miR-122a or miR-342-3p) and miR-423 open the control and HBV components at 100% AUC (area under the ROC curve), 4 shows that miR-92a and miR-423-5p open the control and HCV components with 99.6% AUC, while Table 5 shows that miR-375 and miR-92a open the HBV and HCV components. When miR-375, miR-10a, miR-223 and miR-423-5p 4 markers were used to distinguish the control group from the HBV group, the AUC was 99.9 + 0.1%, the sensitivity was 99.3%, and the specificity was 98.8%. 5). When miR-92a, miR-423 -5p 2 markers were used to distinguish the control group from the HCV group, the AUC was 99.6 ± 0.4%, the sensitivity was 97.9%, and the specificity was 99.4% (Fig. 6).

Table 3 AUCs distinguishing single or multiple microRNAs from the control and HBV groups

Table 4 AUCs distinguishing single or multiple microRNAs from the control and HCV groups

Table 5 AUCs distinguishing single or multiple microRNAs from the HBV and HCV groups

On the basis of the above results, clustering analysis was performed on 6 markers of miR-375, miR-92a, miR-10a, miR-223, miR-423-5 and miR-99a. The results of cluster analysis are shown in Fig. 7. Figure 7 shows that when using miR-375, miR-92a, miR-10a, miR-223, miR-423-5 and miR-99a 6 markers, the inventors were able to control, HBV and HCV groups. The three groups were divided, only two of the 160 control groups and only one of the 135 HBV groups were incorrectly classified, while none of the HCV groups were misclassified. Example 5 HBV-related liver cancer patients were slightly sera Real-time PCR of ribonucleic acid

The sera of 65 HBV-related liver cancer patients were subjected to qRT-PCR assay of microribonucleotide using the primers of Table 2. The experimental method, the qRT-PCR result processing method, and the clustering method were the same as those of Examples 3 and 4.

In order to evaluate the diagnostic ability of these 13 microRNAs in the early diagnosis of liver cancer, the inventors also performed risk-scores on the real-time PCR results of the control, HBV, HCV, and HBV-HCC samples, with each microRNA expression. The 5% or 95% reference interval is the risk value, and the ROC curve is plotted to assess the sensitivity and specificity of the prediction. The ROC analysis results are shown in Tables 6, 7 and Figures 8, 9.

Table 6 shows that miR-23b, miR-423-5p, miR-375, miR-23a and miR-342-3p open the control and HCC fractions with 99.9% AUC, showing miR-10a and miR-92a The HBV group and the HCC component were opened. When using miR-23b, miR-423-5p, miR-375, miR-23a and miR-342-3p 5 markers to distinguish between the control group and the HBV-HCC group, the AUC was 99.9% ± 0.1%, and the sensitivity was 96.9. %, the specificity was 99.4% (Fig. 8), and when the HBV group and the HBV-HCC group were distinguished by miR-10a and miR-125b, the AUC was 99.2%, the sensitivity was 98.5%, and the specificity was 98.5% (Fig. 9). ).

Based on the above results, miR-23b, miR-423-5p, miR-375, miR-23a, Cluster analysis was performed on 8 markers of miR-342-3p, miR-10a, miR-125b and miR-92a. The results of cluster analysis are shown in Fig. 10. Figure 10 shows that when using miR-23b, miR-423-5p, miR-375, miR-23a, miR-342-3p, miR-10a, miR-125b and miR-92a 8 markers, the inventors The HBV-HCC, HBV and control groups were divided into three groups. Only 4 of the 160 control groups and only 2 of the 135 HBV groups were misclassified, and none of the HBV-HCC groups were misclassified.

Table 6 AUCs distinguishing single or multiple microRNAs from the control and HBV liver cancer groups

Table 7 AUCs for distinguishing single or multiple microRNAs from HBV and HBV liver cancer groups

Example 6 Preparation of a microRNA kit for early diagnosis of HBV-associated liver cancer and HBV infection

The manufacturing process and operating procedures of the microRNA kit are based on solexa sequencing technology, real-time PCR technology and biochip technology.

First, more than one copy of the microRNA was determined in the serum/plasma of normal and human hepatitis B patients by sequencing and real-time PCR. Then, quantitative PCR and biochip technology were used to screen HBV-associated liver cancer, other diseases related to HBV infection, and a large amount of serum/plasma microRNAs under normal physiological conditions as a predictor of HBV-related. Liver cancer and HB V infection and indicators of the extent of disease diagnosis. The final screening of HBV-associated liver cancer and HBV-infected serum/plasma microRNAs is controlled in a few to a dozen, which is an optimized reduction based on the chip probe library. The kit includes a batch of serum/plasma microribonucleic acid primers, Taq enzymes, dNTPs and the like, wherein the primers of the microRNA include has-miR-375, has-miR-92a, has-miR-10a, has-miR- 223, has-miR-423-5p, has-miR-23b, has-miR-23a, has-miR-342-3p, Primers for has-miR-99a and has-miR-125b. The value of this kit is that only serum/plasma is needed without the need for other tissue samples, and the trend of microRNAs is detected by the most streamlined probe library, and the trend is used to predict the possibility of HBV liver cancer or to diagnose HBV liver cancer. Pathological stage. Therefore, putting this kit into practice can increase the possibility of early detection of HBV liver cancer and HBV infection, and help guide diagnosis and treatment.

Claims

Rights request

1. A combination of microRNAs differentially expressed in serum/plasma of chronic hepatitis B patients compared to normal humans, specifically including let-7c, miR-1, miR-10a, miR-122, miR-125b, miR- 128a, miR-128b, miR-150, miR-197, miR-221, miR-222, miR-223, miR-23a, miR-23b, miR-27a, miR-27b, miR-30a, miR-342- 3p, miR-361-5p, miR-423-5p, miR-532-5p, miR-574-3p, miR-629, miR-92a, miR-92b, miR-99a, miR-139-5p, miR- 193a-5p, miR-193b, miR-365, miR-375, miR-455-3p, miR-483-3p, miR-483-5p, miR-486-3p, miR-885-5p, miR-99b, Let-7f, let-7g, let-7i, miR-101, miR-103, miR-106a, miR-106b, miR-107, miR-126, miR-130a, miR-130b, miR-142-3p, miR-142-5p, miR-144, miR-146a, miR-146b-5p, miR-148b, miR-151-5p, miR-15a, miR-16, miR-17, miR-182, miR-183, miR-185, miR-186, miR-18a, miR-191, miR-19b, miR-20a, miR-20b, miR-21, miR-210, miR-26a, miR-26b, miR-29c, miR- 30e, miR-340, miR-362-5p, miR-3 63 , miR-374a, miR-378, miR-424, miR-451, miR-454, miR-532-5p, miR-652, miR-660, miR-7, miR-923, miR-93, miR- 96 and miR-98.

2. The normal person according to claim 1, wherein

(2) Hepatitis C antibody and / or hepatitis C RNA negative

(3) ALT<40IU/L, AST<45IU/L

(4) No other systemic diseases

(5) Age ≥ 20.

3. The chronic hepatitis B patient according to claim 1, wherein

(2) Hepatitis C antibody and / or hepatitis C RNA negative

(3) ALT and / or AST levels are more than twice the normal value

(4) No clinical signs of cirrhosis

(5) No other systemic diseases

(6) Age ≥ 20.

The combination of tiny ribonucleic acids according to claim 1, wherein a group of microRNAs which are differentially expressed 20 times higher than normal humans in serum/plasma of chronic hepatitis B patients are present. Conjugation, with specific body package containing mmiiRR--112222aa, mmiiRR--442233, mmiiRR--9922aa, lleett--77cc, mmiiRR--2233aa, mmiiRR--2233bb, mmiiRR--222233 , mmiiRR--334422--33pp, mmiiRR--337755,, mmiiRR--9999aa, mmiiRR--115500, mmiiRR--112255bb, mmiiRR--1100aa. .

55. The root combination according to the rights and interests of the micro-small ribonucleotide nucleic acid described in 44, the special feature of which is characterized in that The combination of the pico-nuclear ribonucleotide nucleic acid group can not distinguish between normal humans and viral virus clearing removers. .

55 66.. According to the rights and interests of the right to request the virus virus to clear the detoxification described in 55, its special characteristics are in,

(( 11 )) Hepatitis B liver surface surface anti-antigen negative negative and / or HHBBVV--DDNNAA negative-negative, hepatitis B hepatitis liver surface anti-antibody and hepatitis B liver nuclear core anti-antibody The antibody is positive for positivity and there is no history of vaccination vaccine injection

(( 22 )) Hepatitis C anti-antibody and/or hepatitis C virus RRNNAA negative

(( 33 )) AALLTT<<4400IIUU//LL,,AASSTT<<4455IIUU//LL

1100 (( 44 )) There is no other systemic systemic disease

(( 55 )) Age of age ≥ ≥ 2200. .

77. The root combination according to the rights and interests of the micro-small ribonucleotide nucleic acid described in 44, the special feature of which is characterized in that The combination of the micro-nuclear ribonucleotide nucleic acid group can not distinguish between patients with chronic hepatitis B liver disease and those with HHBBVV carrying. .

88.. According to the rights and interests of the requirements of the HHBBVV carrying the carrier as described in 77, its special characteristics are in,

1155 (( 11 )) Hepatitis B liver surface anti-antigen and nuclear core anti-antibody positive

(( 22 )) Hepatitis C anti-antibody and/or hepatitis C virus RRNNAA negative

(( 33 )) AALLTT<<4400IIUU//LL,,AASSTT<<4455IIUU//LL

(( 44 )) There is no hepatitis hepatitis inflammation clinical symptoms symptoms

(( 55 )) There is no sign of liver and liver hard sclerotherapy clinical bed marks

2200 (( 66 )) There is no other systemic disease

(( 77 )) Age of age ≥ ≥ 2200. .

99. The root combination according to the rights and interests of the micro-small ribonucleotide nucleic acid described in 44, the special feature of which is characterized in that The combination of the piconucleotide ribonucleic acid group may be separate from the control group, the patient with chronic hepatitis C and the HHBBVV group. .

1100.. According to the rights and interests of the claim, the reference group of the reference group described in 99 is characterized in that it is 2255 as described in the right claim. The normal normal person and the rights of the rights are required to be composed of the virus virus clearing and removing agent described in 66. .

1111.. According to the rights and interests of the authors, the patients with chronic hepatitis C virus liver disease described in 99, the special characteristics are in,

(( 11 )) Hepatitis C anti-antibody and/or or hepatitis C virus RRNNAA positive

(( 22 )) Hepatitis B liver surface surface anti-antigen negative negative

(( 33 )) AALLTT and / or or AASSTT water level is twice as high as twice the normal normal value

3300 * (5) No other systemic diseases

(6) Age ≥ 20.

The HBV group according to claim 9, comprising the chronic hepatitis B patient according to claim 3 and the HBV carrier according to claim 8. The combination of small ribonucleic acids according to claim 4, wherein the small ribonucleic acid combination has a small ribonucleic acid which separates the control group from the HBV group, specifically comprising miR-375, miR-10a. , miR-223 and miR-423-5p.

The combination of small ribonucleic acids according to claim 4, wherein the small ribonucleic acid combination has a small ribonucleic acid which separates the control group from the HCV group, specifically comprising miR-92a and miR-423. -5p.

The combination of small ribonucleic acids according to claim 4, wherein the microribonucleic acid combination has a small ribonucleic acid which separates the control group from the HBV-HCC group, specifically comprising miR-23b, miR. -423-5p, miR-375, miR-23a and miR-342-3p.

The combination of microRNAs according to claim 2, wherein the micro d and the ribonucleic acid combination have micro d and ribonucleic acid which distinguish the HBV group from the HBV-HCC group, and specifically include miR. - 10a and miR-125b.

17. The combination of tiny ribonucleic acids according to claims 4, 9, 13, and 14, wherein the microribonucleic acid combination has microRNAs that distinguish the control group, the HBV group, and the HCV group. Specifically, it includes miR-375, miR-92a, miR-10a, miR-223, miR-423-5 and miR-99a.

18. The combination of tiny ribonucleic acids according to claims 4, 9, 13, 15, and 16, wherein the microribonucleotide combination is distinguished from the control group, the HBV group, and the HBV-HCC group. A small ribonucleic acid, specifically comprising miR-23b, miR-423-5p, miR-375, miR-23a, miR-342-3p, miR-10a, miR-125b, miR-92a „ 19. according to claims 4 to 18 The microribonucleic acid, characterized in that the small ribonucleic acid comprises a small ribonucleic acid family in which each small ribonucleic acid is located, specifically comprising miR-122a, miR-423, miR-92a, let-7c, miR-23a , miR-23b, miR-223, miR-342-3p, miR-375, miR-99a, miR-150, miR-125b, a family of miR-lOa.

20. Diagnostic reagent prepared by microribonucleic acid combination according to claims 4 to 19. a cassette, characterized in that the kit comprises has-miR-375, has-miR-92a, has-miR-10a, has-miR-223, has-miR-423-5p, has-miR-23b, Primers of has-miR-23a, has-miR-342-3p, has-miR-99a and has-miR-I b, and reagents such as Taq enzyme and dNTP. The method for preparing a microribonucleic acid kit according to claim 20, which is characterized by the following steps:

(1) Predetermination of differentially expressed microRNAs in serum/plasma of normal and chronic hepatitis B patients by Solexa sequencing

(2) According to the results of sequencing, real-time quantitative PCR is further used to further determine the differential expression of microRNA in serum/plasma of normal, HBV and HBV patients.

(3) According to the PCR results, it can be finally identified as a marker for distinguishing normal people, HBV infected patients and HBV liver cancer patients.

(4) Design kit, which consists of primers for microRNAs and real-time quantitative PCR reagents.

The kit according to claims 20 and 21, wherein the kit can be used for early diagnosis and dynamic monitoring of HBV-related liver cancer and HBV infection, for the clinician to quickly and accurately grasp the disease state and condition of the patient. Severity and timely access to more personalized prevention and treatment programs to support, to maximize the long-term inhibition or elimination of HBV, reduce hepatocyte inflammation and necrosis and liver fibrosis, delay and prevent disease progression, reduce and prevent liver decompensation, Liver cirrhosis, primary hepatocellular carcinoma and its complications occur to improve quality of life and prolong survival.