CN104232638A - Cirrhosis microRNA molecular marker composition and application thereof - Google Patents
Cirrhosis microRNA molecular marker composition and application thereof Download PDFInfo
- Publication number
- CN104232638A CN104232638A CN201410155061.5A CN201410155061A CN104232638A CN 104232638 A CN104232638 A CN 104232638A CN 201410155061 A CN201410155061 A CN 201410155061A CN 104232638 A CN104232638 A CN 104232638A
- Authority
- CN
- China
- Prior art keywords
- seq
- liver cirrhosis
- combination
- cirrhosis
- mir
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a cirrhosis microRNA molecular marker composition, with sequence No. ranging from 1 to 13, as well as application of the molecular marker composition in preparing a cirrhosis personalized medicine diagnostic reagent. Due to a significant difference between content of a microRNA molecular marker of a cirrhosis patient in plasma/serum and content in plasma/serum in health control, cirrhosis patient can be effectively distinguished from people of the health control; in a process of applying medicines to the cirrhosis patient, administration can be stopped by guiding and assistance, when cirrhosis outcome microRNA molecular marker is adjusted to a normal level. Furthermore, the invention discloses a diagnostic kit for guiding personalized administration of the cirrhosis. The liver cirrhosis outcome microRNA molecular marker disclosed by the invention, when being used for guiding personalized administration of cirrhosis patients, has characteristics of being simple to operate, safe and noninvasive, high in specificity, high in sensitivity and easy in massive screening.
Description
Technical field
The present invention relates to liver cirrhosis personalized medicine diagnostic field, relate in particular to the combination of one group of liver cirrhosis microRNA molecule mark, it is diagnosed liver cirrhosis patient and/or the purposes of prognosis evaluation and the test kit containing its special primer.It can be applicable to diagnose and/or prognosis evaluation liver cirrhosis patient, instructs patient's Scientific Usage of Drugs and drug withdrawal, has both reduced patient medication misery, also reduce the waste of medical resource.
Background technology
MicroRNA (miRNA) is study hotspot in recent years, it is a kind of strand microRNA be extensively present in eukaryote, do not have an encoding function, but the flank region that it can be incorporated into gene order checks or suppresses the translation of said target mrna, there is the conservative property of height, timing and tissue specificity, played vital role in the field such as clinical diagnosis, Treatment and Prognosis evaluation of the various diseases such as tumour, hemopathy, virus infection at present.
Posthepatitic cirrhosis can be developed by chronic hepatitis caused by hepatitis B virus, hepatitis D virus, hepatitis C virus and form.Its prognosis and virus replication state, liver function state and closely related with or without serious complication.If the Compensated cirrhosis patient age is little, virus replication stops or low replication status, and anti-HBe is positive, and liver function is fair, and albumin is not low, and the nearly normal and portal hypertension those who are not high of hemobilirubin, the state of an illness may be stablized, compensatory even for a long time, and all one's life is asymptomatic.Once occur to lose compensatory symptom, 5 annual survival rates are lower than 50%.Lose compensatory liver cirrhosis, if not active treatment, half annual survival rate is not as good as half.Underlying cause of death is chronic liver failure, complication and liver cancer.
Affect the factor that liver cirrhosis lapses to a lot, comprise (1) sex, age; (2) liver function is large than person's good prognosis less than normal with prognosis liver volume; (3) complication, comprises portal hypertension, ascites, hepatogenic encephalopathy, infection, hepatorenal syndrome etc.; (4) state of virus infection and course inflammatory activity reaction; (5) pathology of viral hepatitis changes and prognosis.But still there is no lapsing to of Indexs measure liver cirrhosis at present, instruct clinical application.
Research in recent years shows, hepatitis b virus infected, chronic hepatitis B, liver cirrhosis are closely related with miRNA, miRNA by acting on virus itself or acting on immunity system thus affect therapeutic process, therefore also can may have corresponding effect to the diagnosis of liver cirrhosis medication.More and the effect of the miRNA kind relevant to liver cirrhosis differs, and there are some researches show that after hepatitis b virus infected, in patient body, miRNA express spectra can change, and some of them specificity miRNA delivers Patents.Although carried out some researchs in this field, the miRNA after liver cirrhosis patient medication has expressed change and has not also studied at present, clinical with in research, need find curative effect after can effectively judging liver cirrhosis medication, instruct the miRNA marker of clinical drug withdrawal.
Summary of the invention
One aspect of the present invention provides a kind of liver cirrhosis and lapses to the combination of microRNA molecule mark, and it comprises more than one and is selected from following microRNA nucleic acid molecule: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13.
Preferably, described more than one are 2-13 kind, more preferably 3-10 kind, further preferred 3-8 kind, most preferably 4 kinds.
Preferably, described liver cirrhosis lapses to the combination of microRNA molecule mark containing SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10 and SEQ ID NO:11.
The invention provides one group of new liver cirrhosis and lapse to the molecular marker that relevant miRNA lapses to as liver cirrhosis, be made up of one group of miRNA, its sequence SEQ ID as follows NO:1 is to more than one in sequence number 13.
| MicroRNA title | MiRNA sequence |
| miR-1 | uggaauguaaagaaguauguau |
| miR-106b-5p | uaaagugcugacagugcagau |
| miR-122-5p | uggagugugacaaugguguuug |
| miR-146a-5p | ugagaacugaauuccauggguu |
| miR-15a-5p | uagcagcacauaaugguuugug |
| miR-185-5p | uggagagaaaggcaguuccuga |
| miR-18a-5p | uaaggugcaucuagugcagauag |
| miR-223 | ugucaguuugucaaauacccca |
| miR-25-3p | cauugcacuugucucggucuga |
| miR-27a-3p | uucacaguggcuaaguuccgc |
| miR-451a | aaaccguuaccauuacugaguu |
| miR-455-3p | gcaguccaugggcauauacac |
| miR-92a-3p | uauugcacuugucccggccugu |
In a preferred embodiment, described at least one microRNA contrasts differential expression in plasma/serum with at least one at least one target plasma/serum.
Preferably, described target plasma/serum is from liver cirrhosis patient, and described contrast plasma/serum is from normal healthy controls person.
In the embodiment be more preferably, the expression of described at least one microRNA at least one target plasma/serum contrasts with at least one compared with the expression in plasma/serum and is raised, and/or the expression of at least one microRNA wherein at least one target plasma/serum contrast in blood plasma expression with at least one compared with lowered.
Contriver finds, liver cirrhosis lapses to the content of microRNA molecule mark in liver cirrhosis patient blood plasma/serum and compares normal healthy controls crowd, there is significant difference, effectively can distinguish liver cirrhosis and normal healthy controls crowd, as can be seen here, liver cirrhosis lapse to the treatment of microRNA molecule mark and liver cirrhosis and prognosis closely related.
On the basis of above-mentioned discovery, the invention provides liver cirrhosis and lapse to the purposes of microRNA molecule mark in the diagnostic reagent preparing liver cirrhosis personalized medicine.
Therefore, a second aspect of the present invention provides a kind of described liver cirrhosis and lapses to microRNA molecule mark and be combined in the purposes prepared in liver cirrhosis personalized medicine diagnostic reagent, and described liver cirrhosis lapses to the combination of microRNA molecule mark combination preferably containing SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10 and SEQ ID NO:11.
Described diagnostic reagent lapses to the content of microRNA molecule mark combination preferably by detecting liver cirrhosis in subject's blood plasma, and judges whether to discontinue medication compared with normal healthy controls crowd mean level (ML).
Preferably, the method for use quantitative PCR detects the content that liver cirrhosis in subject's blood plasma lapses to the combination of microRNA molecule mark.
Particularly, described diagnostic reagent learns by detecting subject the content that liver cirrhosis in blood plasma lapses to microRNA molecule mark, and the curative effect of liver cirrhosis medication is diagnosed compared with normal population mean level (ML), wherein, liver cirrhosis lapses to the content of microRNA molecule mark in liver cirrhosis patient blood plasma and compares normal healthy controls crowd, there is significant difference, preferably, this species diversity can be that the latter raises than the former otherness, also can be that otherness reduces.In a specific embodiment, use the method for quantitative PCR to detect liver cirrhosis in subject's plasma/serum and lapse to microRNA molecule mark content.
A third aspect of the present invention provides a kind of diagnostic kit instructing liver cirrhosis personalized medicine, it is characterized in that: the specific forward primer combination comprising the combination of described liver cirrhosis microRNA molecule mark, the specific forward primer of the combination preferably containing SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10 and SEQ ID NO:11.
Preferably, described specific forward primer comprises the combination of primers that more than one are selected from following sequence: SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, preferably containing SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:23 and SEQ ID NO:24.
Preferably, described test kit comprises further:
(1) plasma/serum total RNA extraction reagent,
(2) RNA adds polyA reagent,
(3) RT-PCR reagent,
(4) quantitative PCR reagent;
Preferably, wherein, liver cirrhosis described in quantitative PCR reagent lapses to the specific forward primer of microRNA molecule mark combination.
Preferably, described blood plasma total RNA extraction reagent comprises the external control sequence-1 (Extemal Control-1) that sequence is SEQ ID NO:27
Preferably, wherein, described RNA adds polyA reagent and comprises the external control sequence-2 (Extemal Control-2) that sequence is SEQ ID NO:28.
Preferably, wherein, described RT-PCR reagent comprises the reverse transcription primer (RT-Primer) that sequence is SEQ ID NO:29.
Preferably, wherein, described quantitative PCR reagent comprises general reverse primer UPM-short and UPM-long that sequence is respectively SEQ ID NO:30 and 31.Quantitative PCR reagent comprises the specific forward primer that liver cirrhosis lapses to microRNA molecule mark, and preferably, its sequence is SEQ ID NO:14 to SEQ ID NO:26 as follows.
| MicroRNA title | Primer sequence |
| miR-1 | GTGGAATGTAAAGAAGTA |
| miR-106b-5p | GTGCTGACAGTGCAGA |
| miR-122-5p | GTGGAGTGTGACAATGGT |
| miR-146a-5p | GAGAACTGAATTCCATGGGT |
| miR-15a-5p | GCAGCACATAATGGTTTGT |
| miR-185-5p | GAGAGAAAGGCAGTTCCTG |
| miR-18a-5p | AGGTGCATCTAGTGCAGA |
| miR-223 | TGTCAGTTTGTCAAATACC |
| miR-25-3p | TGCACTTGTCTCGGT |
| miR-27a-3p | TCACAGTGGCTAAGTTCC |
| miR-451a | ACCGTTACCATTACTGAG |
| miR-455-3p | GGCAGTCCATGGGCATA |
| miR-92a-3p | TGCACTTGTCCCGGC |
In a specific embodiment, described blood plasma total RNA extraction reagent comprises the external control sequence-1 (External Control-1) that sequence is 5 '-CAACCTCCTAGAAAGAGTA-3 ' (SEQ ID NO:27); Described RNA adds polyA reagent and comprises the external control sequence-2 (Extemal Control-2) that sequence is 5 '-TGAGCAACGCGAACAA-3 ' (SEQ ID NO:28); Described RT-PCR reagent comprise sequence be the reverse transcription primer (RT-Primer) of 5 '-CAGTGGTATCAACGCACTCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3 ' (SEQ ID NO:29) (wherein, V is A or C or G, N is A or T or C or G); Described quantitative PCR reagent comprises general reverse primer UPM-short and UPM-long that sequence is respectively 5 '-CTCACACGACTCACGACAC-3 ' (SEQ ID NO:30) and 5 '-CTCACACGACTCACGACACCAGTGGTATCAACGCACTC-3 ' (SEQ ID NO:31).
Using liver cirrhosis of the present invention to lapse to microRNA molecule mark, to instruct the personalized medicine of liver cirrhosis to have simple to operate, safe hurtless measure, high specific, high sensitivity and be easy to the feature of a large amount of examination.
Accompanying drawing explanation
Fig. 1 describes and comprises the present invention for determining the Logic Regression Models of miR-1, miR-106b-5p, miR-122-5p, miR-146a-5p, miR-15a-5p, miR-185-5p, miR-18a-5p, miR-223, miR-25-3p, miR-27a-3p, miR-451a, miR-455-3p and miR-92a-3p and microRNA combination in the preferred microRNA of at least one liver cirrhosis plasma/serum.
Fig. 2 describe comprise the present invention for determine preferred miR-122-5p, miR-146a-5p, miR-27a-3p and miR-451a and microRNA combination at least one liver cirrhosis plasma/serum Logic Regression Models.
Embodiment
As described herein, microRNA or miRNA has its its ordinary meaning (such as seeing CN102943108A) in the art.That is, microRNA represents the RNA molecule from genetic site, and it is from the transcript processing that can form partial rna precursor microRNA structure.Ripe microRNA normal length is 20,21,22,23,24 or 25 Nucleotide, although the Nucleotide of other number also can exist, and such as 18,19,26,27 or 28 Nucleotide.
As described herein, " more than one " represent between 2-13 kind, preferred 2-10 kind, more preferably 3-8 kind, more preferably 4-6 kind, most preferably 4 kinds.
As described herein, liver cirrhosis diagnosis was according to Chinese Medical Association's viral hepatitis guideline of prevention and treatment in 2000, specific as follows: there is hepatitis B virus chronic infection medical history, hepatic fibrosis is filled the air in iconography prompting, regeneration knot circle is formed, other performances can have splenomegaly, hypersplenism, esophagus fundus ventricularis varication, and gold standard is that pathologic finding finds regenerated nodule.
The present invention sets forth technical scheme of the present invention further by specific embodiments and the drawings, but one of ordinary skill in the art will appreciate that: following embodiment and embodiment are intended to set forth the present invention, and should not be construed as and limit the present invention by any way.
Embodiment 1: plasma sample collection and preparation
During in March ,-2014 in June, 2012,150 plasma samples of patient meeting the definition of above liver cirrhosis and 150 plasma samples meeting normal health person are gathered from Beijing YouAn Hospital, Capital Medical University in advance.
Gather peripheric venous blood 10mi, EDTA anti-freezing, plasma collection flow process is as follows: whole blood sample to be placed in whizzer 4 DEG C, the centrifugal 15min of 1,500-3,000g.With 200 μ L liquid-transfering guns, upper plasma is transferred in the sterile centrifugation tube of 1.5mL without RNA enzyme carefully.Mark is carried out to each sample.Plasma sample must be put in very low temperature (-80 DEG C) refrigerator in 4 hours and preserve.
The extraction of total serum IgE in embodiment 2. blood plasma
Use RNA to extract test kit (Beijing Quanto Biotechnology Co., Ltd.) and extract total serum IgE in blood plasma, in every 250 μ l blood plasma, add the extraction quality that External Control-1 (synthesis of Shanghai Sheng Gong biotechnology company limited) that 1 μ l (20nM) sequence is 5 '-CAACCTCCTAGAAAGAGTA-3 ' (SEQ ID NO:27) monitors RNA in blood plasma.The total serum IgE extracted uses Thermo NanoDrop 2000c to measure concentration.
MiRNA in embodiment 3. three-step approach detection by quantitative blood plasma
(1) polyA tail is added:
I. in without the PCR pipe (Axygen company, 200 μ l) of RNA enzyme, prepare the reaction solution adding polyA tail, system is 20 μ i.Tailing and reverse transcription quality that External Control-2 (synthesis of Shanghai Sheng Gong biotechnology company limited) that 1 μ l (20nM) sequence is 5 '-TGAGCAACGCGAACAA-3 ' (SEQ ID NO:28) monitors miRNA is added in every 20 μ l systems.
(note: the enzyme that this experiment uses is the product of Beijing Quanto Biotechnology Co., Ltd..)
Ii. put into PCR instrument (Thermo) 37 DEG C hatch 1 hour by being equipped with the PCR pipe configuring reaction solution.(2) RT-PCR obtains cDNA strand:
I. the RT-Primer (synthesis of Shanghai Sheng Gong biotechnology company limited) that 0.5 μ l (0.5ng/ μ l) sequence is 5 '-CAGTGGTATCAACGCACTCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3 ' (SEQ ID NO:29) is added in the reaction solution obtained to (1), hatch 5min for 70 DEG C, be put into ice bath at least 2min on ice immediately.
Ii. inverse transcription reaction liquid is prepared:
(note: product used is the product of Beijing Quanto Biotechnology Co., Ltd..)
Iii. the solution mixing obtained by i and ii, hatches 70 DEG C of insulation 15min after 50min, puts cooled on ice, obtain cDNA for 50 DEG C.
Iv.-20 DEG C of preservations after product packing iii obtained.
(3) qPCR detection by quantitative:
I. preparation reaction solution in (Axygen company) is managed at 2ml EP:
(note: UPM-long, UPM-short all in the synthesis of Invitrogen company, all the other reagent are all from Beijing Quanto Biotechnology Co., Ltd.
green PCR Master Mix.)
Wherein, the sequence of general reverse primer UPM-short and UPM-long is respectively 5 '-CTCACACGACTCACGACAC-3 ' (SEQ ID NO:30) and 5 '-CTCACACGACTCACGACACCAGTGGTATCAACGCACTC-3 ' (SEQ ID NO:31).
Ii., after the reaction solution configured fully puts upside down mixing, be distributed in 96 hole point end PCR plate (Axygen company), every hole 18 μ l.
Iii. the volley of rifle fire (Eppendoff company is used, 1-10 μ l) add the liver cirrhosis microRNA molecule mark specific forward primer of sequence as shown in (SEQ ID NO:14 to 26) (synthesis of Invitrogen company) respectively, every hole 2 μ l (10 μMs).
Iv. seal with special pad pasting (ABI company) after adding 10 μ l paraffin oil fluid-tights.
V. put into ABI7900PCR instrument, program setting is:
Vi. draw melting curve, check the specificity of primer, program setting is: 95 DEG C of 15s, 60 DEG C of 15s, 95 DEG C of 15s.
Embodiment 4: interpretation of result:
Array Tools4.1.0 is adopted to carry out data analysis
About RT-PCR method and 2
-△ △ Ct method is shown in (the Analysis of relative gene expression data using real-time quantitative PCR and the2 such as Kenneth J Livak
-△ △ Ct method.Methods25,402-408 (2001), introduce for reference herein in full.
According to embodiment, the liver cirrhosis having carried out 150 routine liver cirrhosis and 150 routine normal healthy controls lapses to microRNA molecule marker expression level detection, and the miRNA expressed that finds differences has 28.And wherein between liver cirrhosis and normal control significant difference have 13, the results are shown in Table 1.
Table 1
| Detect thing | DDCt_A-D | P. value _ A-D |
| miR-1 | -1.69246 | 1.06E-11 |
| miR-106b-5p | 1.626214 | 1.16E-15 |
| miR-122-5p | -1.19064 | 5.4E-06 |
| miR-146a-5p | -1.97024 | 1.69E-19 |
| miR-15a-5p | 0.833156 | 4.71E-06 |
| miR-185-5p | 1.088384 | 4.96E-07 |
| miR-18a-5p | 1.184416 | 7.31E-10 |
| miR-223 | -0.86758 | 3.93E-05 |
| miR-25-3p | 1.891645 | 4.33E-07 |
| miR-27a-3p | -1.59104 | 8.05E-13 |
| miR-451a | 2.463369 | 7.43E-21 |
| miR-455-3p | -1.78424 | 2.52E-08 |
| miR-92a-3p | 1.344849 | 1.88E-15 |
Utilize Spss mapping software, with True Positive Rate (sensitivity) be ordinate zou, false positive rate (1-specificity) is for X-coordinate, draw ROC (receiver operating characteristic) curve, wherein 13 relevant miRNA and miRNA combination the results are shown in Figure 1, wherein miRNA combination AUC (area under curve) reaches 0.997, shows that liver cirrhosis lapses to microRNA molecule mark and can effectively distinguish liver cirrhosis and normal healthy controls.
According to above experimental result, the expression level of miR-1, miR-106b-5p, miR-122-5p, miR-146a-5p, miR-15a-5p, miR-185-5p, miR-18a-5p, miR-223, miR-25-3p, miR-27a-3p, miR-451a, miR-455-3p and miR-92a-3p combination in 28 routine experimenter's blood plasma is detected, according to miRNA expression level, prediction experimenter is liver cirrhosis patient or normal health contrast.Blind Test the results are shown in as following table 2.
Table 2
| ? | Liver cirrhosis | Normal healthy controls |
| Sample number | 20 | 8 |
| Result | 18 routine interpretations are correct, and 2 routine interpretations are hepatitis B | 8 routine interpretations are correct |
| Predictablity rate | 90％ | 100％ |
Embodiment 5
Utilize Spss mapping software, with True Positive Rate (sensitivity) be ordinate zou, false positive rate (1-specificity) is for X-coordinate, draw ROC (receiver operating characteristic) curve, miR-122-5p, miR-146a-5p, miR-27a-3p, miR-451a of wherein 4 relevant miRNA are analyzed, it the results are shown in Figure 2, visible in figure, wherein miRNA combination AUC (area under curve) reaches 0.985, shows that liver cirrhosis lapses to microRNA molecule mark and can effectively distinguish liver cirrhosis and normal healthy controls.
According to above experimental result, the expression level of miR-122-5p, miR-146a-5p, miR-27a-3p, miR-451a combination in 28 routine experimenter's blood plasma is detected, according to miRNA expression level, prediction experimenter is liver cirrhosis patient or normal health contrast.Blind Test the results are shown in as following table 3.
Table 3
| ? | Liver cirrhosis | Normal healthy controls |
| Sample number | 20 | 8 |
| Result | 17 routine interpretations are correct, and 3 routine interpretations are hepatitis B | 8 routine interpretations are correct |
| Predictablity rate | 85％ | 100％ |
Claims (9)
1. a liver cirrhosis lapses to the combination of microRNA molecule mark, it comprises more than one and is selected from following microRNA nucleic acid molecule: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID DO:11, SEQ ID NO:12, SEQ ID NO:13, preferably, described more than one are 2-13 kind, more preferably 3-10 kind, further preferred 3-8 kind, most preferably 4 kinds.
2. liver cirrhosis according to claim 1 lapses to the combination of microRNA molecule mark, and it contains SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10 and SEQ ID NO:11.
3. liver cirrhosis according to claim 1 lapses to microRNA molecule mark and is combined in the purposes prepared in liver cirrhosis personalized medicine diagnostic reagent, and described liver cirrhosis lapses to the combination of microRNA molecule mark preferably containing SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10 and SEQ ID NO:11.
4. purposes according to claim 3, wherein, described diagnostic reagent lapses to the content of microRNA molecule mark combination by detecting liver cirrhosis in subject's plasma/serum, and judges whether to discontinue medication compared with normal healthy controls crowd mean level (ML).
5. purposes according to claim 3, wherein, use the method for quantitative PCR to detect content that liver cirrhosis in subject's blood plasma lapses to the combination of microRNA molecule mark.
6. one kind is instructed the diagnostic kit of liver cirrhosis personalized medicine, it is characterized in that: the specific forward primer combination comprising liver cirrhosis microRNA molecule mark combination described in claim 1, the specific forward primer of the combination preferably containing SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10 and SEQ ID NO:11.
7. diagnostic kit according to claim 6, it is characterized in that described specific forward primer comprises the combination of primers that more than one are selected from following sequence: SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, preferably containing SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:23 and SEQ ID NO:24.
8. diagnostic kit according to claim 6, it comprises further:
(1) plasma/serum total RNA extraction reagent,
(2) RNA adds polyA reagent,
(3) RT-PCR reagent,
(4) quantitative PCR reagent;
Wherein, quantitative PCR reagent comprises liver cirrhosis described in claim 1 and lapses to the specific forward primer of microRNA molecule mark combination wherein, described blood plasma total RNA extraction reagent comprises the external control sequence-1 (Extemal Control-1) that sequence is SEQ ID NO:27, wherein, described RNA adds polyA reagent and comprises the external control sequence-2 (Extemal Control-2) that sequence is SEQ ID NO:28, wherein, described RT-PCR reagent comprises the reverse transcription primer (RT-Primer) that sequence is SEQ ID NO:29.
9. diagnostic kit according to claim 8, wherein, described quantitative PCR reagent comprises general reverse primer UPM-short and UPM-long that sequence is respectively SEQ ID NO:30 and 31.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410155061.5A CN104232638A (en) | 2014-04-18 | 2014-04-18 | Cirrhosis microRNA molecular marker composition and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410155061.5A CN104232638A (en) | 2014-04-18 | 2014-04-18 | Cirrhosis microRNA molecular marker composition and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104232638A true CN104232638A (en) | 2014-12-24 |
Family
ID=52221535
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410155061.5A Pending CN104232638A (en) | 2014-04-18 | 2014-04-18 | Cirrhosis microRNA molecular marker composition and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104232638A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106337051A (en) * | 2015-07-09 | 2017-01-18 | 首都医科大学附属北京佑安医院 | Hepatitis b/hepatic cirrhosis microRNA molecular marker combination and purpose thereof |
| CN106337050A (en) * | 2015-07-09 | 2017-01-18 | 首都医科大学附属北京佑安医院 | Liver cirrhosis micro RNA molecular marker, and applications thereof |
| CN107779504A (en) * | 2016-08-24 | 2018-03-09 | 北京旷博生物技术股份有限公司 | Colorectal cancer microRNA molecule mark and application thereof |
| CN110699450A (en) * | 2019-05-22 | 2020-01-17 | 璞晞（广州）生物免疫技术有限公司 | Application of miRNA biomarker in diagnosis and prognosis of liver disease |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101368213A (en) * | 2008-10-13 | 2009-02-18 | 南京大学 | Blood serum minuteness ribonucleic acid reagent kit and application in early diagnosis of hepatitis B |
| CN103237901A (en) * | 2010-03-01 | 2013-08-07 | 卡里斯生命科学卢森堡控股有限责任公司 | Biomarkers for theranostics |
-
2014
- 2014-04-18 CN CN201410155061.5A patent/CN104232638A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101368213A (en) * | 2008-10-13 | 2009-02-18 | 南京大学 | Blood serum minuteness ribonucleic acid reagent kit and application in early diagnosis of hepatitis B |
| CN103237901A (en) * | 2010-03-01 | 2013-08-07 | 卡里斯生命科学卢森堡控股有限责任公司 | Biomarkers for theranostics |
Non-Patent Citations (3)
| Title |
|---|
| JIAN ZHOU等: "Plasma MicroRNA Panel to Diagnose Hepatitis B Virus–Related Hepatocellular Carcinoma", 《JOURNAL OF CLINICAL ONCOLOGY》 * |
| MINHUA等: "Expression and clinicopathological significance of miR-146a in hepatocellular carcinoma tissues", 《UPSALA JOURNAL OF MEDICAL SCIENCES》 * |
| WINTHER等: "Hepatitis B Surface Antigen Quantity Positively Correlates with Plasma Levels of microRNAs Differentially Expressed in Immunological Phases of Chronic Hepatitis B in Children", 《PLOS ONE》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106337051A (en) * | 2015-07-09 | 2017-01-18 | 首都医科大学附属北京佑安医院 | Hepatitis b/hepatic cirrhosis microRNA molecular marker combination and purpose thereof |
| CN106337050A (en) * | 2015-07-09 | 2017-01-18 | 首都医科大学附属北京佑安医院 | Liver cirrhosis micro RNA molecular marker, and applications thereof |
| CN107779504A (en) * | 2016-08-24 | 2018-03-09 | 北京旷博生物技术股份有限公司 | Colorectal cancer microRNA molecule mark and application thereof |
| CN110699450A (en) * | 2019-05-22 | 2020-01-17 | 璞晞（广州）生物免疫技术有限公司 | Application of miRNA biomarker in diagnosis and prognosis of liver disease |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rezk et al. | Role of MicroRNA 126 in screening, diagnosis, and prognosis of diabetic patients in Egypt | |
| CN107385035B (en) | Serum/plasma miRNA marker related to type 2 diabetes retinopathy and application thereof | |
| CN104232636A (en) | Hepatitis B microRNA molecular marker composition and application thereof | |
| CN104232637A (en) | microRNA molecular marker of liver cirrhosis and use thereof | |
| CN104988216B (en) | The relevant serum miRNA of chronic heart failure and its application | |
| Koutova et al. | The impact of standard chemotherapy on miRNA signature in plasma in AML patients | |
| EP2406402A2 (en) | Method to assess human allograft status from microrna expression levels | |
| CN104232638A (en) | Cirrhosis microRNA molecular marker composition and application thereof | |
| CN105349642A (en) | Acute myocardial infarction marker and application thereof | |
| CN104450707B (en) | A kind of application of Serum miRNA biomarker | |
| CN107779504B (en) | MicroRNA molecular marker for colorectal cancer and application thereof | |
| EP3019627B1 (en) | Detection of brain cancer | |
| CN110055322A (en) | For the circulation miRNA marker of Diagnosis of Acute Myocardial Infarction and its application | |
| CN107653315A (en) | Applications of the lncRNAs active tuberculosis disease-specific mark | |
| KR20130029079A (en) | Marker consisting of plasma microrna and a new method for diagnosis of hepatocellular carcinoma | |
| CN106337051A (en) | Hepatitis b/hepatic cirrhosis microRNA molecular marker combination and purpose thereof | |
| CN115418397B (en) | Biomarker for auxiliary diagnosis of dilated cardiomyopathy and application thereof | |
| WO2010014975A2 (en) | Use of microrna signatures for assessing risk levels of neuroblastoma patients | |
| Saygili et al. | Differential expression of long noncoding RNAs in patients with coronary artery disease | |
| CN106244688A (en) | A kind of mark assessing adenocarcinoma of colon risk | |
| CN106609301B (en) | A kind of kit of auxiliary diagnosis type 1 diabetes | |
| CN109797218B (en) | Application of integrin beta 4 in preparation of reagent or medicine for distinguishing colon cancer from rectal cancer | |
| Elmadbouly et al. | The plasma level of miRNA-133a as a novel biomarker for prediction of left ventricular hypertrophy and dysfunction in hemodialysis patients | |
| CN109371129A (en) | Application of the hsa_circRNA_0000798 as hepatocarcinoma early diagnosis or prognosis evaluation biomarker | |
| CN106337050A (en) | Liver cirrhosis micro RNA molecular marker, and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C53 | Correction of patent of invention or patent application | ||
| CB02 | Change of applicant information |
Address after: The 100069 Beijing Fengtai District right outside the West No. 8 Applicant after: Beijing YouAn Hospital, Capital Medical University Applicant after: BEIJING QUANTOBIO BIOTECH CO., LTD. Address before: The 100069 Beijing Fengtai District right outside the West No. 8 Applicant before: Beijing YouAn Hospital, Capital Medical University Applicant before: Beijing Quanto Biotechnology Co., Ltd. |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20141224 |
|
| RJ01 | Rejection of invention patent application after publication |