CN104988216B - The relevant serum miRNA of chronic heart failure and its application - Google Patents
The relevant serum miRNA of chronic heart failure and its application Download PDFInfo
- Publication number
- CN104988216B CN104988216B CN201510308334.XA CN201510308334A CN104988216B CN 104988216 B CN104988216 B CN 104988216B CN 201510308334 A CN201510308334 A CN 201510308334A CN 104988216 B CN104988216 B CN 104988216B
- Authority
- CN
- China
- Prior art keywords
- mir
- heart failure
- mirnas
- chronic heart
- hsa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The relevant serum miRNA of chronic heart failure and its application.The present invention provides one kind peripheral blood miRNAs in chronic heart failure as the purposes in biomarker risk assessment/diagnosis and prognosis.Wherein, hsa-miR-4491, hsa-miR-1285-3p, hsa-miR-665, hsa-miR-660-3p, hsa-miR-206, hsa-miR-1268b, hsa-miR-130a-3p and hsa-miR-330-3p differential expression in Patients with Chronic Heart Failure peripheral blood；It proves the energy specific diagnosis chronic heart failure such as peripheral blood hsa-miR-665, and its expression and ejection fraction are in correlation, has the function of assessing prognosis.To which the expression by detecting above-mentioned miRNAs can be used to predict and assist to diagnose already existing chronic heart failure or assess the prognosis of chronic heart failure.
Description
Technical field
The present invention relates to the novel medical uses of a variety of endogenic non-coding tiny RNAs, more specifically to 8 kinds
Purposes of the microRNAs in the diagnosis and prognosis evaluation of chronic heart failure disease belongs to diagnosis, the prevention of cardiovascular disease
And therapy field.
Background technique
Chronic heart failure is different the clinical syndrome that cardiovascular disease develops to the terminal stage, main pathophysiological
Feature is that ventricular filling is damaged with blood ability is penetrated, and finally results in ventricular pump blood hypofunction, prognosis mala, the death rate is high, is
It threatens human health and leads to one of increased main cause of disease of medical burden, the China increasingly aggravated for aging of population comes
It says particularly important.Up to the present, part is suffered from the therapeutic agent combination based on diuretics, ACEI and beta-blocker
Person is invalid or effect is undesirable, and new remedy measures are urgently excavated；On the other hand, the risk factor of chronic heart failure is not complete
It illustrates entirely, it is therefore desirable to find new risk factor and use significantly more efficient methods of risk assessment.
Microrna (microRNA, miRNA) is that one kind is newfound has important regulating and controlling effect in a variety of biological processes
Non-coding RNA, the length for being derived from endogenous hairpin structure transcript is about the single stranded RNA s of 22 nucleotide.Usually
MiRNA is as guidance molecule, in conjunction with 3 ' UTR base complementrities of said target mrna, regulates and controls after mediating genetic transcription.Majority of case
Under, miRNA in conjunction with said target mrna after will inhibit protein translation and activate exonuclease degrade mRNA, if miRNA and target
MRNA height complementation, which combines, can then activate endonuclease activity.In complicated pathophysiological process, miRNA or miRNAs cluster
It is important one of the biological property of miRNA that collaboration, which participates in Multi-regulation,；It is also the theoretical basis for the application for the treatment of of miRNA
One of.Compared with traditional single target drug treatment, miRNA treatment can be the case where single nucleotide acid molecular target be treated
Under, from multiple level modulation disease pathology physiological status, reach more effective therapeutic effect.
Existing research shows that miRNAs can be secreted by cell to Peripheral Circulation, and is stabilized, and can be used as various diseases
New diagnosis marker.And RNA perturbation technique as with breakthrough potential applicability in clinical practice biotechnology, since occurring
The short several years between just there are multiple products to enter clinical test, obtain huge success.But exist with the presence or absence of one kind miRNAs
There is biomarker effect in diagnosis of chronic congestive heart failure and prognosis evaluation, can be chronic mental and physical efforts by detecting this kind of miRNA
It is still the challenge to field scientific research personnel that failure diagnosis and prognosis, which provide new strategy,.There is researcher to chronic heart failure
Peripheral blood in patients miRNAs express spectra carried out screening (Circulation.2014；129(9):1009-21；Proc Natl
Acad Sci U S A.2014；111 (30): 11151-6), also there is researcher to the pretherapy and post-treatment periphery of Patients with Chronic Heart Failure
Blood miRNAs express spectra carried out detection (Eur J Heart Fail.2013；15 (11): 1277-88), but not to identical trouble
The miRNAs of person cardiac muscular tissue and peripheral blood is detected and is compared simultaneously, and lacks corresponding epidemiology follow-up investigation.This
In invention, the miRNAs to same patient cardiac muscular tissue and peripheral blood of applicant's originality is detected and is compared simultaneously, and
Epidemiology follow-up investigation has been carried out to the progression of the disease of some patientss.Determine peripheral blood miRNAs express spectra as the chronic heart
Effect in force failure disease diagnosis and prognosis biomarker.
Summary of the invention
The technical problem to be solved by the present invention is to overcome the shortcomings of existing theory and technology, determine in chronic heart failure
In play the peripheral blood miRNAs of diagnosis and prognosis biomarker.
The present inventor has found through a large number of experiments, not only obtains and can be used as biomarker for the diagnosing chronic heart
Force failure peripheral blood in patients miRNAs express spectra has also obtained Patients with Chronic Heart Failure cardiac muscle miRNAs express spectra.Meanwhile this
Inventor has found the miRNAs express spectra in same Patients with Chronic Heart Failure peripheral blood miRNAs express spectra and its cardiac muscle not
It is completely the same, prompt simple relatively normal person and peripheral blood in patients miRNAs that will obtain non-specific biological marker.Another party
Face, the inventors discovered that portion perimeter blood miRNAs, such as hsa-miR-665 or hsa-miR-660-3p, with chronic heart failure
Cardiac Function of Patients is exhausted in significant correlation, cannot be only used for diagnosing, and is alternatively arranged as biomarker for prompting prognosis.
Specifically, the present invention provides a kind of miRNAs biomarker that can be used for diagnosing chronic heart failure patient.
Preferably, the peripheral blood miRNAs biomarker is hsa-miR-4491, hsa-miR-1285-3p, hsa-
MiR-665, hsa-miR-660-3p, hsa-miR-206, hsa-miR-1268b, hsa-miR-130a-3p and/or hsa-miR-
330-3p, sequential structure is respectively as shown in SEQ ID No.1-8.
The present invention also provides a kind of peripheral blood miRNAs biomarkers that can be used for assessing chronic heart failure prognosis.
Preferably, the miRNAs biomarker is miR-1285-3p, hsa-miR-665 and/or hsa-miR-660-
3p, sequential structure is as shown in SEQ ID No.2,3 and 4.
The present invention also provides the purposes that a kind of above-mentioned miRNAs biomarker is used to assess chronic heart failure prognosis.
The present invention also provides a kind of for detecting the reagent of above-mentioned miRNAs sequence, wherein the sequence includes SEQ ID
No.1,2,3,4,5,6,7 and/or 8.
Preferably, the miRNAs sequence is SEQ ID No.2,3 and/or 4.
Preferably, the reagent is the reverse transcriptase primer and amplimer of the miRNAs sequence.
It is furthermore preferred that the primer is obtained according to following design of primers principle: 1) spy based on the design of stem bulge loop structure
Anisotropic reverse transcriptase primer carries out the specificity for specific miRNA in conjunction with 3 ' terminal sequence of miRNA under reverse transcriptase effect
Reverse transcription reaction；2) specificity positive PCR primer, general reverse primer based on reverse transcriptase primer sequence design.
The present invention also provides a kind of mentioned reagents in preparation diagnosis or assesses the reagent of Patients with Chronic Heart Failure prognosis
Purposes in box.
Preferably, the chronic heart failure include congenital heart disease, coronary heart disease, acute myocardial infarction AMI, rheumatic heart disease,
Chronic heart failure caused by the causes of disease such as myocarditis, cardiomyopathy caused by hypertension, arrhythmia cordis, the various causes of disease.
The present invention also provides the kits of a kind of diagnosis or assessment Patients with Chronic Heart Failure prognosis, which is characterized in that
Wherein, the kit includes any of the above-described reagent.
Preferably, the chronic heart failure include congenital heart disease, coronary heart disease, acute myocardial infarction AMI, rheumatic heart disease,
Chronic heart failure caused by the causes of disease such as myocarditis, cardiomyopathy caused by hypertension, arrhythmia cordis, the various causes of disease.
Detailed description of the invention
Fig. 1 Patients with Chronic Heart Failure peripheral blood miRNAs chip expression spectrum and cardiac muscle miRNAs chip expression spectrum analysis；
Figure 1A is that cardiac muscular tissue miRNAs chip expression composes scatter plot；Figure 1B is that peripheral blood miRNAs chip expression composes scatter plot；Fig. 1 C
Volcano figure is composed for cardiac muscular tissue's miRNAs chip expression；Fig. 1 D is that peripheral blood miRNAs chip expression composes volcano figure.
Fig. 2 peripheral blood miRNAs chip expression spectrum composes comparison result with cardiac muscular tissue miRNAs chip expression；Fig. 2A is the heart
The changing value of raised miRNAs is expressed when force failure in cardiac muscular tissue's chip, and its expression in peripheral blood chip changes
Situation；The changing value of the miRNAs of decline is expressed when Fig. 2 B is heart failure in cardiac muscular tissue's chip, and its in peripheral blood core
Expression in piece changes situation.
Fig. 3 use Real-time PCR method proofing chip screening results, wherein for eight kinds of Micrornas (microRNA,
MiRNA) relative level in chronic heart failure and normal control population's blood plasma (* indicate compared with the control group, p <
0.05；* indicate compared with the control group, p < 0.01).
The sensitivity of 8 kinds of miRNAs diagnosing chronic heart failure of Fig. 4.Fig. 4 A is ROC value, blood plasma miRNA s diagnosing chronic
The sensitivity of heart failure；Fig. 4 B is to penetrate with ultrasound detection heart function comparison result, blood plasma miRNA s content with cardiac ultrasonic
Blood system data/coherency.
Specific embodiment
The invention will now be further described with reference to specific embodiments, the advantages and features of the present invention will be with description and
It is apparent.But examples are merely exemplary for these, and it is not intended to limit the scope of the present invention in any way.Those skilled in the art
Member it should be understood that without departing from the spirit and scope of the invention can details to technical solution of the present invention and form into
Row modifications or substitutions, but these modifications and replacement are fallen within the protection scope of the present invention.
1. Patients with Chronic Heart Failure peripheral blood of embodiment and cardiac muscular tissue's miRNAs screening results
1. collecting 10 chronic heart failures (is derived from 2007-2014 in Internal Medicine-Cardiovascular Dept. inpatient, each case is equal
Classification is made a definite diagnosis by two or more clinicians) and 10 normal control's peripheral blood samples.After materials, room temperature 3,500rpm from
Heart 6min, takes upper plasma, is stored in -80 DEG C of refrigerators.1ml TRIZOL LS is added in every 0.25ml peripheral blood blood plasma
(Invitrogen company), extracts RNA, and RNasey Mini Kit (Qiagen) handles sample.It usesND-
1000 detection RNA mass.miRCURYTMAfter Array Power labeling kit (Exqion) label, in hybridization station
Carry out hybrid experiment.Axon GenePix 4000B microarray scanner scanning obtains chip image.GenePix
The analysis of pro V6.0 software obtains data, goes out the miRNA in middle differential expression using microarray technology high flux screening
Spectrum.The chip detects totally 3100 kinds of miRNAs, differential expression miRNAs 599 is filtered out, wherein 347 miRNAs are in the heart
It expresses and increases in force failure peripheral blood in patients, 252 miRNAs express decline in heart failure patient peripheral blood.
2. collecting Patients with Chronic Heart Failure in 1 (is derived from 2007-2014 in Internal Medicine-Cardiovascular Dept. inpatient, each disease
Example by two or more clinicians makes a definite diagnosis classification) cardiac muscular tissue and 10 normal control's peripheral blood samples.Materials
Afterwards, room temperature 3,500rpm are centrifuged 6min, take upper plasma, be stored in -80 DEG C of refrigerators.It is added in every 0.25ml peripheral blood blood plasma
1ml TRIZOL (Invitrogen company), extracts RNA, and RNasey Mini Kit (Qiagen) handles sample.It usesND-1000 detects RNA mass.miRCURYTMArray Power labeling kit (Exqion) label
Afterwards, hybrid experiment is carried out in hybridization station.Axon GenePix 4000B microarray scanner scanning obtains chip
Image.The analysis of GenePix pro V6.0 software obtains data, is gone out using microarray technology high flux screening in middle difference
Property expression miRNA spectrum.The chip detects totally 3100 kinds of miRNAs, differential expression miRNAs 74 is filtered out, wherein 51
MiRNAs expresses raising in myocardium of congestive heart failure, and 23 miRNAs are expressed in myocardium of congestive heart failure
Decline.
The result shows that miRNAs expression changes in myocardium in rats with chronic heart failure.
2. Patients with Chronic Heart Failure peripheral blood miRNAs chip expression of embodiment spectrum and cardiac muscle miRNAs chip expression spectrum
Analysis
It is analyzed and is handled using chip data of the bioinformatic analysis method to acquisition.
1. scatter plot has reacted the repeatability between chip chamber or group, repeatability is better closer to diagonal line.In addition it uses
Pearson correlation coefficient measures repeatability, and related coefficient is better closer to 1 repeatability.Figure 1A and 1B the result shows that: chip complete
Reliable in quality, it is reproducible.
2. the case where comparison among groups, sees Fig. 1 C and 1D.With-log (Pvalue) for ordinate, log2 (Fold change) is
Abscissa to each miRNA map, can be intuitive to see significant difference miRNAs (Grey Point representative passes through Fold
The miRNAs of change and P-value screening).Fig. 1 C and 1D the result shows that: miRNAs can be used as a kind of chronic heart failure and examine
Disconnected candidate biomarker.
3. peripheral blood miRNAs express spectra of embodiment and cardiac muscular tissue miRNAs express spectra comparison result
The conduct diagnosis of chronic congestive heart failure for the differential expression that peripheral blood chip and cardiac muscular tissue's chip screening are obtained
The variation tendency of all miRNAs of candidate biomarker classify.The result shows that: it expresses and occurs in cardiac muscular tissue
Significant difference (including increasing or reducing) has 74 miRNAs, and significant difference (packet occurs in expression in peripheral blood
Include raising or reduction) have 599 miRNAs, there is expression of 25 miRNAs in two kinds of chips to change, wherein
Expression is raised 6 kinds of (Fig. 2A) (hsa-miR-4491, hsa-miR-1285-3p, hsa-miR-665, hsa-miR-660-
3p, hsa-miR-206 and hsa-miR-1268b), what expression declined has 2 kinds of (Fig. 2 B) (hsa-miR-130a-3p and hsa-
MiR-330-3p), the diagnosis for prompting this 8 kinds of miRNAs to can be used as candidate biological markers for chronic heart failure.By
In circulation miRNAs and organize miRNAs between expression and distribution it is affected by many factors, comprising: tissue generation, tissue degradation,
Tissue intake and tissue secretion etc., it is thus possible to circulation miRNAs occur and miRNAs expression is organized to change inconsistent situation
(Oncotarget.2015 Mar 10. [Epub ahead of print], PMID:25860935).And due to chronic mental and physical efforts
Failure is the disease of the involvement of the whole body multiple organ as caused by many reasons, and other organs function also changes in various degree, follows
Ring miRNAs expression quantity is not only closely related with myocardium miRNAs expression quantity, and other organs function may also influence peripheral blood
Expression (the Clin Chem.2013Dec of miRNAs；59(12):1742-52；J Hum Hypertens.2014 May；28(5):
288-91).Therefore only this 8 kinds of miRNAs are that most probable and chronic heart failure specificity are relevant.
4. chip results Real-time PCR of embodiment verifying
In second independent crowd, 200 Patients with Chronic Heart Failure and 200 normal control people are in addition collected respectively
Group's peripheral blood, extracts RNA in the manner described above.
The expression in two kinds of chips of said chip primary dcreening operation is sent out using Guangzhou Rui Bo company miRNA detection kit
The expression of the raw 8 kinds of miRNAs changed carries out real-time PCR detection in second independent crowd:
MiRNAs reverse transcription:
Reverse transcriptase primer (RT Primer Mix) configuration:
miRNA RT Primer 1μl
U6RT Primer 1μl
RNase free H2O 78μl
Reverse transcription reaction system:
RNA template 2μg
RT Primer Mix 4μl
RNase free H2O up to 19μl
After above system mixes, brief centrifugation, after 70 DEG C of incubation 10min, ice educates 2min, adds following reagent:
2×TS reaction buffer 25μl
TS enzyme 2.5μl
RNase free H2O 3.5μl
Reverse transcription reaction program:
42 DEG C of 60min, 70 DEG C of 10min；After stopping 4 DEG C it is spare, product is stored in -20 DEG C.
MiRNAs real-time PCR:
Reaction system: 2 × SYBR Green Mix, 9 μ l
RT product 2μl
miRNA Forward Primer 2μl
miRNA Reverse Primer 2μl
RNase-free H2O 5μl
Response procedures:
95℃30sec--(95℃10sec--60℃20sec--70℃1sec)×40 cycles--Melting Curve
As the result is shown: wherein 8 kinds of miRNAs, i.e. miR-4491, miR-1285-3p, miR-665, miR-660-3p, miR-
206, the result of miR-1268b, miR-130a-3p and miR-330-3p expression is consistent with chip test result, two chronic hearts
MiRNAs variation tendency result is identical (Fig. 3) in the peripheral blood of force failure patients.It is a kind of slow to show that 8 kinds of miRNAs can be used as
The candidate biomarker of heart failure diagnosis, real-time PCR detection method result are reliable.
The sensitivity of 5. differential expression miRNAs diagnosing chronic heart failure of embodiment
It collects 200 Patients with Chronic Heart Failure and (is derived from 2007-2014 Hospitals in Wuhan inpatient, each case
Classification is made a definite diagnosis by two or more clinicians) and 200 normal control population's peripheral bloods.RNA is extracted according to preceding method,
And the expression of the 8 kinds of miRNAs filtered out in embodiment 4 is detected, and carry out ROC analysis.
As the result is shown: miR-4491, miR-1285-3p, miR-665, miR-660-3p, miR-206 in peripheral blood in patients
It is increased to about 50 times, 40 times, 100 times, 800 times, 45 times and 50 times of control group crowd respectively with miR-1268b, and miR-
130a-3p and miR-330-3p drops to 50% or so (Fig. 3) of control group crowd respectively.And miR-4491, miR-1285-
3p, miR-665, miR-660-3p, miR-206 and miR-1268b to diagnosing chronic heart failure have it is highly sensitive (AUC >
0.9) (Fig. 4 A), the expression quantity and ejection fraction of miR-1285-3p, miR-665 and the miR-660-3p of Myocardial high abundance
Significant correlation (P < 0.05) (Fig. 4 B).
Currently, cardiac ejection fraction is clinically to be most commonly used for assessment cardiac function, cardiac ejection fraction is got over
Low prompt patient's prognosis is poorer.Show that miR-1285-3p, miR-665 and miR-660-3p can be used as a kind of diagnosis and assessment is slow
The biomarker of heart failure prognosis.
The kit of the preparation detection chronic heart failure risk assessment of embodiment 6.
Kit components: detection kit includes for expanding 8 kinds of miRNAs (miR-4491, miR-1285-3p, miR-
665, miR-660-3p, miR-206, miR-1268b, miR-130a-3p and miR-330-3p) specific reverse transcriptase primer and
Real-time PCR primer is to each a set of；For expanding the specific reverse transcriptase primer and real-time of control RNA (U6)
For PCR primer to a set of and related reagent, ingredient and content are following (100 times), are stored in -20 degree.The primer draws according to following
Object design principle obtain: 1) based on stem bulge loop structure design specific reverse transcriptase primer in conjunction with 3 ' terminal sequence of miRNA,
It carries out reacting for the specific reverse transcriptase of specific miRNA under reverse transcriptase effect；2) it is based on reverse transcriptase primer sequence design
Specificity positive PCR primer, general reverse primer.
The above reagent is provided by each source company, has been commercialized.Specific detection method and correlated response parameter reference
Embodiment 1.
Sequence table:
miR-4491、miR-1285-3p、miR-665、miR-660-3p、miR-206、miR-1268b、miR-130a-3p
And miR-330-3p
Hsa-miR-4491 nucleic acid sequence:
Sequence ID No.1:5`AAUGUGGACUGGUGUGACCAAA 3`
Hsa-miR-1285-3p nucleic acid sequence:
Sequence ID No.2:5`UCUGGGCAACAAAGUGAGACCU 3`
Hsa-miR-665 nucleic acid sequence:
Sequence ID No.3:5`ACCAGGAGGCUGAGGCCCCU 3`
Hsa-miR-660-3p nucleic acid sequence:
Sequence ID No.4:5`ACCUCCUGUGUGCAUGGAUUA 3`
Hsa-miR-206 nucleic acid sequence:
Sequence ID No.5:5`UGGAAUGUAAGGAAGUGUGUGG 3`
Hsa-miR-1268b nucleic acid sequence:
Sequence ID No.65`CGGGCGUGGUGGUGGGGGUG 3`
Hsa-miR-130a-3p nucleic acid sequence:
Sequence ID No.7:5`CAGUGCAAUGUUAAAAGGGCAU 3`
Hsa-miR-330-3p nucleic acid sequence:
Sequence ID No.8:5`GCAAAGCACACGGCCUGCAGAGA 3`
Claims (7)
1. a kind of for detecting the reagent of miRNAs sequence, which is characterized in that the sequence includes SEQ ID No.2,3 and 4.
2. reagent as described in claim 1, which is characterized in that the sequence includes SEQ ID No.1,2,3,4,5,6,7 Hes
8。
3. the reagent as described in claim 1-2 is any, which is characterized in that the reagent is the reverse transcription of the miRNAs sequence
Primer and amplimer.
4. any reagent of claim 1-3 is in the kit of preparation diagnosis or assessment Patients with Chronic Heart Failure prognosis
In purposes.
5. purposes as claimed in claim 4, which is characterized in that the chronic heart failure includes congenital heart disease, hat
Myocarditis caused by heart trouble, acute myocardial infarction AMI, rheumatic heart disease, hypertension, arrhythmia cordis, the various causes of disease, the cause of disease of cardiomyopathy are led
The chronic heart failure of cause.
6. the kit of a kind of diagnosis or assessment Patients with Chronic Heart Failure prognosis, which is characterized in that the kit includes
Any reagent of claim 1-3.
7. kit as claimed in claim 6, which is characterized in that the chronic heart failure include congenital heart disease,
Myocarditis caused by coronary heart disease, acute myocardial infarction AMI, rheumatic heart disease, hypertension, arrhythmia cordis, the various causes of disease, the cause of disease of cardiomyopathy
Caused chronic heart failure.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510308334.XA CN104988216B (en) | 2015-06-08 | 2015-06-08 | The relevant serum miRNA of chronic heart failure and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510308334.XA CN104988216B (en) | 2015-06-08 | 2015-06-08 | The relevant serum miRNA of chronic heart failure and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104988216A CN104988216A (en) | 2015-10-21 |
| CN104988216B true CN104988216B (en) | 2019-04-12 |
Family
ID=54300109
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510308334.XA Active CN104988216B (en) | 2015-06-08 | 2015-06-08 | The relevant serum miRNA of chronic heart failure and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104988216B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105903036B (en) * | 2015-07-15 | 2019-12-17 | 浙江大学 | application of miR-130a antisense nucleic acid and derivative thereof in Hippo-YAP signal pathway inhibitor |
| CN106692175A (en) * | 2016-12-26 | 2017-05-24 | 大连医科大学附属第二医院 | Application of miR-665-3p inhibitor to preparation of medicine for preventing and treating ischemia-reperfusion injuries |
| EP3375458A1 (en) * | 2017-03-14 | 2018-09-19 | I.C.G.E.B. International Centre for Genetic Engineering and Biotechnology | Microrna hsa-mir-665 in cardiac hypertrophy |
| CN107252491B (en) * | 2017-06-09 | 2021-06-29 | 汪道文 | Medicine for treating heart failure and screening method and preparation method thereof |
| CN110607360A (en) * | 2019-09-19 | 2019-12-24 | 华中科技大学同济医学院附属同济医院 | Primer group and kit for assessing chronic heart failure prognosis and method for assessing chronic heart failure prognosis |
| CN110878348B (en) * | 2019-11-19 | 2023-03-28 | 南京启医科技有限公司 | High-specificity lnc RNA biomarker for heart failure and detection method and application thereof |
| CN110946872B (en) * | 2019-12-30 | 2022-11-04 | 北京大学深圳医院 | Application of miR-4491 in preparation of medicine for treating breast cancer |
| CN111440862A (en) * | 2020-05-19 | 2020-07-24 | 华中科技大学同济医学院附属同济医院 | Primer group, kit and method for evaluating prognosis of chronic heart failure patient |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101641440A (en) * | 2006-11-23 | 2010-02-03 | 米尔克斯治疗有限责任公司 | Oligonucleotides for modulating target RNA activity |
| CN102421917A (en) * | 2009-04-29 | 2012-04-18 | 阿姆斯特丹大学学术医学中心 | Means and methods for counteracting, preventing and/or determining heart failure, or a risk of heart failure |
| CN103764843A (en) * | 2011-05-24 | 2014-04-30 | 罗塞塔金诺米克斯有限公司 | Methods and compositions for determining heart failure or a risk of heart failure |
-
2015
- 2015-06-08 CN CN201510308334.XA patent/CN104988216B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101641440A (en) * | 2006-11-23 | 2010-02-03 | 米尔克斯治疗有限责任公司 | Oligonucleotides for modulating target RNA activity |
| CN102421917A (en) * | 2009-04-29 | 2012-04-18 | 阿姆斯特丹大学学术医学中心 | Means and methods for counteracting, preventing and/or determining heart failure, or a risk of heart failure |
| CN104087662A (en) * | 2009-04-29 | 2014-10-08 | 阿姆斯特丹大学学术医学中心 | Means and Methods for Counteracting, Preventing and/or Determining Heart Failure, or Risk of Heart Failure |
| CN103764843A (en) * | 2011-05-24 | 2014-04-30 | 罗塞塔金诺米克斯有限公司 | Methods and compositions for determining heart failure or a risk of heart failure |
Non-Patent Citations (1)
| Title |
|---|
| Identification of cardiac-related circulating microRNA profile in human chronic heart failure;Li huaping等;《Oncotarget》;20151216;第7卷(第1期);全文 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104988216A (en) | 2015-10-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104988216B (en) | The relevant serum miRNA of chronic heart failure and its application | |
| US11111541B2 (en) | Diagnostic MiRNA markers for Parkinson's disease | |
| KR102082016B1 (en) | Microrna biomarkers indicative of alzheimer's disease | |
| US10138520B2 (en) | Diagnostic miRNA markers for Alzheimer | |
| CN110205378B (en) | Vertebral column tuberculosis plasma miRNA combined diagnosis marker and application thereof | |
| Kitow et al. | Mitochondrial long noncoding RNAs as blood based biomarkers for cardiac remodeling in patients with hypertrophic cardiomyopathy | |
| CN107130017B (en) | Kit and application of reagent in preparation of kit | |
| US20170130269A1 (en) | Diagnosis of neuromyelitis optica vs. multiple sclerosis using mirna biomarkers | |
| CN104968802A (en) | Novel miRNAs as diagnostic markers | |
| CN103764843B (en) | For the method and composition for the risk for determining heart failure or heart failure | |
| CN114875142A (en) | Application of exosome miR-106b-3p, miR-550-5p and the like in lung cancer diagnosis | |
| WO2011044927A1 (en) | A method for the diagnosis or prognosis of an advanced heart failure | |
| EP2657348B1 (en) | Diagnostic miRNA profiles in multiple sclerosis | |
| García‑Becerril et al. | Differential expression of coxsackievirus and adenovirus receptor in endomyocardial tissue of patients with myocarditis | |
| CN107460241B (en) | Application of exosome small-molecule RNA in acute myocardial infarction risk assessment | |
| CN104630339B (en) | Circulation miRNAs and its application for acute coronary syndrome early diagnosis | |
| CN111235274A (en) | Screening method of laryngeal squamous carcinoma serum exosome marker and application of exosome source miR-941 | |
| CN115418397A (en) | Biomarker for auxiliary diagnosis of dilated cardiomyopathy and application of biomarker | |
| CN108165546A (en) | A kind of miRNA biomarker, composition and application thereof | |
| CN111566229A (en) | Breast cancer molecular typing and distant metastasis risk gene group, diagnosis product and application | |
| CN107164550A (en) | A kind of reagent for detecting myocardial infarction and its application | |
| WO2014193522A1 (en) | Biomolecular events in cancer revealed by attractor molecular signatures | |
| CN117568458A (en) | Methylation marker for assisting diagnosis of cardiovascular and cerebrovascular diseases | |
| WO2018191536A1 (en) | Method for prognosing adverse cardiovascular outcome in patients with coronary artery diseases | |
| CN113539365A (en) | Methylation marker for early diagnosis of cardiovascular and cerebrovascular diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |