WO2010040496A2

WO2010040496A2 - Location-specific recombination for activating genes in genetic systems

Info

Publication number: WO2010040496A2
Application number: PCT/EP2009/007148
Authority: WO
Inventors: Ralph Bertram
Original assignee: Universität Tübingen
Priority date: 2008-10-06
Filing date: 2009-10-06
Publication date: 2010-04-15
Also published as: DE102008051708A1; WO2010040496A3

Abstract

The invention relates to the use of identification sequences for location-specific recombinases, the identification sequences each containing two recombinase binding sequences that are separated by a spacer sequence, in order to regulate, especially activate, a target gene in a genetic system. The invention also relates to the corresponding use of a location-specific recombination system as well as a method for regulating, especially activating, a target gene in a genetic system.

Description

description

Site-specific recombination for gene activation in genetic systems

The invention relates to the use of recognition sequences for site-specific recombinases for activating a target gene in a genetic system and to a corresponding method therefor.

Transcription is understood to mean the transcription of a gene from DNA into RNA. In other words, a gene is read by the transcription. The result of the transcription process is a messenger RNA (mRNA) complementary to a read DNA template strand. By translation of the mRNA, and optionally subsequent post-translational modifications, a functional gene product, a protein, is usually obtained.

Artificial gene regulation in bacterial systems is currently mainly based on the control of transcription. In most cases, artificial gene regulation is based on the regulation of Transcription initiation. For this purpose, the gene to be expressed is usually preceded by a regulatable promoter which has a binding site for a repressor. By binding the repressor to the promoter, the gene to be expressed is inactivated. By adding a suitable inducer, the repressor releases from the promoter, thereby initiating transcription. A problem with this type of gene regulation is that, in some cases, inactivating a gene in the manner described in this section, some background or basal activity of the gene can often not be completely prevented.

The present invention therefore has for its object to provide an alternative possibility of gene regulation, in particular gene activation, which in particular avoids the problems known from the prior art.

This object is achieved by the use of recognition sequences having the features according to independent claim 1. Preferred embodiments are the subject of dependent claims 2 to 18. A method for regulating, in particular activating, a target gene in a genetic system is the subject of independent claim 19. Preferred Embodiments of the method are the subject of the dependent claims 20 to 22.

The present invention relates to the use of site-specific or sequence-specific recombinase recognition sequences for the regulation, in particular activation, of a target gene in a genetic system. The recognition sequences preferably each contain two recombinase binding sequences, which are preferably separated by a spacer sequence. The recognition sequences used according to the invention are inserted into a target gene, whereby its open reading frame or reading frame is interrupted or disrupted. As a result, the translation occurring after the transcription will generally not provide a meaningful protein. As a result, the target gene is selectively turned on or off by the insertion of the recognition sequences without any basal activity being observed. If the target gene is to be activated again, the recognition sequences are cut out with the appropriate site-specific recombinases from the target gene, as a rule a recognition sequence remains in the target gene. The recognition sequence remaining in the target gene and the disrupted sequence segments of the target gene are assembled (assembled) under the influence of the recombinases into a target-like, open reading frame. Thus, the target gene can be translated back to a functional target protein. In this way, therefore, a selective activation of the target gene is possible.

As a rule, the recognition sequences provided according to the invention are in the form of DNA double strands.

In a preferred embodiment, a total of two recognition sequences are provided for the activation of the target gene. These may be two identical recognition sequences or two different recognition sequences.

According to a particularly preferred embodiment, recognition sequences, in particular two recognition sequences, are provided for activation of the target gene, which are separated from each other by a DNA sequence. Preferably, the DNA sequence is a gene or gene cassette sequence. A gene cassette is usually understood to mean a genetic functional unit of promoter, gene and transcription terminator. Preferably, it is in the DNA sequence around the sequence for a reporter or marker gene. In particular, a gene cassette used may contain a corresponding reporter or marker gene. The marker genes may be positive and / or negative selection markers. For the purposes of the present invention, negative selection markers are to be understood as meaning marker genes whose gene products do not allow a cell to survive under certain conditions.

Reporter or marker genes in the context of the present invention are genes which code for proteins which enable a qualitative and / or quantitative detection of their expression. Reporter genes of this type are adequately described in the prior art and include, inter alia, the genes coding for β-galactosidase, luciferase, chloramphenicol acetyltransferase or the genes coding for various antibiotic resistances, in particular ampicillin, erythromycin, tetracycline, kanamycin or spectinomycin. To demonstrate successful recombination, cells can be disrupted and / or additional substances added whose biochemical conversion can be detected by the gene product of a reporter gene. The expression of β-galactosidase can be determined, for example, both colorimetrically (by staining the cell) by reacting the substrate ortho-nitrophenyl-β-D-galactoside (ONPG) or X-GaI, fluorometrically by reacting a 4-methylumbelliferyl-β galactopyranoside compound or by chemoluminescence based on the implementation of a 1, 2-dioxetane galactopyranoside derivative detect. To test an expressed antibiotic resistance, cells are usually transferred to nutrient media containing the appropriate antibiotics.

According to the invention, the recognition sequences may be wild-type sequences. Preferably, however, the recognition sequences are sequence mutants. Under sequence mutants in For the purposes of the present invention, recognition sequences are to be understood which have mutations. The mutations may be at least one mutation from the group of point mutations of one nucleotide or fewer adjacent nucleotides, multiple nucleotide mutations, deletions, insertions and substitutions. In principle, the spacing sequence can have mutations. Preferably, at least one of the two binding sequences, in particular both binding sequences, has mutations, preferably of the type described above.

In a further embodiment, the recognition sequences each have the same length of base pairs (bp). Preferably, the recognition sequences have a length of 34 base pairs (bp). The binding sequences for the recombinases preferably each have a length of 13 base pairs (bp). According to the invention, it is particularly preferred for the binding sequences to be palindromic sequences. The spacing sequence preferably has a length of 8 base pairs (bp).

As already mentioned, the recognition sequences provided according to the invention are recognition sequences for recombinases. For the purposes of the present invention, these are to be understood as meaning proteins or polypeptides which catalyze a DNA recombination. For the purposes of the present invention, DNA recombination is to be understood as meaning a process which leads to an exchange of DNA regions between two different DNA molecules or two different regions of a single DNA molecule and thus to a rearrangement of the genetic starting material. Especially preferred according to the invention are recognition sequences for λ integrases or tyrosine recombinases or serine recombinases. These recombinases recognize specific DNA sequences and catalyze the mutual (reciprocal) exchange of DNA segments between these recognition sequences.

The recognition sequences are therefore in a further embodiment, recognition sequences for recombinases from the group Cre recombinases, Flp recombinases, Fre recombinases, Tre recombinases and mutants thereof, wherein recognition sequences for recombinases from the group Cre recombinases, Flp recombinases and mutants thereof are particularly preferred.

In a suitable embodiment, the recognition sequences are / ox sequences, preferably / ox sequence mutants. Particularly preferred are recognition sequences which are / oxP sequence mutants.

According to the invention, the recognition sequences for site-specific recombinases in question may in particular be at least one recognition sequence from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 176 according to the attached sequence listing. In the publications Albert et al. Plant J (1995) 7; 649-659; Thomson et al. Genesis (2003) 36; 162-167; Araki et al. Nuclear Acids Res (2002) 19; e103; Lee & Saito Gene (1998) 216; 55-65; Sheen et al. Nucleic Acids Res (2007) 35; 5464-5473; Sauer J Mol Biol (1992) 223; 911-928; Santoro & Schultz PNAS (2002) 99; 4185-4190; Saraf-Levy et al. Bioorg Med Chem (2006) 14; 3081-3089; Langer et al. Nucleic Acids Res (2002); Thyagarajan et al. Gene 2000; Sauer NAR1996; Hoess NAR 1986; Corneille et al. Plant J (2003) 35; 753-762; Rufer & Sauer Nucleic Acids Res (2002) 30; 2764-2771; Buchholz & Stewart Nature Biotech (2001) 19; 1047-1052; Sarkar et al. Science (2007) 316; 1912-1915; Sauer & McDermott Nucleic Acids Res. (2004) 32; 6086-6095; Bolusani et al. Nucleic Acids Res. 2006 and Baldwin et al. Chem Biol (2003) 10; 1085-1094 and in the present The description provides further details of the sequences themselves and of the organisms in which the sequences were examined.

In a particularly preferred embodiment, the recognition sequences are lox sequences and the site-specific recombinases are Cre recombinases. A suitable site-specific recombination system is the Cre / 7ox system from the bacteriophage P1 or systems derived therefrom. The recombinase Cre of the bacteriophage P1 is a site-specific recombinase, which mediates a DNA rearrangement via a DNA target sequence, namely the so-called / oxP sequence. Each of the / oxP sequences consists of two 13 base pair (bp) recombinase binding elements that flank a central 8 base pair (bp) sequence as "inverted repeats." The central 8 bp sequence, which is a distance If there is a recombination between two identically aligned recognition sequences, a DNA segment lying between the recognition sequences is excised as a circular molecule together with one of the recognition sequences (excision). Due to the initial spatial proximity of both recognition sequences, this process is extremely efficient.

Another suitable recombination system is the FIp-FRT system or systems derived therefrom. The recombinase FIp (named for the flippase activity through which yeast sequence segments invert) has as target sequence the so-called FRT sequence (FRT: Flp-recombininear target). This target sequence has essentially the same structure as the / oxP sequence of the Cre recombinase.

The genetic system may be a prokaryotic or eukaryotic cell, for example a bacterial, yeast, plant zen-, insect or mammalian cell, in particular human cells, or even act on an animal or plant organism. Preferably, the genetic system is a prokaryotic system, preferably a bacterial cell. Cells of Escherichia coli, Bacillus subtilis, Staphylococcus aureus or Staphylococcus carnosus are particularly suitable as bacterial cells.

The present invention furthermore relates to the use of a site-specific recombination system which has the recognition sequences provided according to the invention and recombinases suitable therefor, for the regulation, in particular activation, of a target gene in a genetic system. The recombinant systems in question are preferably used for excision, inversion or insertion of recognition sequence-flanked DNA sequences.

In the following, the mode of operation of a site-specific recombination system is explained in more detail using the Cre / oxP system as an example. First, a DNA segment flanked on both sides by a loxP sequence ("floxed" DNA segment) is inserted into the target gene. As already mentioned, the open reading frame of the target gene is thereby interrupted and the target gene thus inactivated. For the insertion of the "floxed" DNA segment, the usual homologous recombination techniques are used which are well known to the person skilled in the art, so that they should not be discussed in more detail successful recombination events. The inserted into the target gene / oxP sequences allow efficient excision of the lox-flanked DNA segment under catalysis of the Cre recombinase. The excised fragment containing the flanked DNA sequence as well as one of the flanking / oxP sequences is broken down. healed and lost through degradation. The other / oxP sequence, however, remains in the target gene.

With regard to further features and details of the recombination systems which can be used according to the invention, in particular with regard to the usable recognition sequences and recombinases, reference is made in full to the previous description.

The present invention further relates to a method for regulating, in particular activation, a target gene in a genetic system, comprising the following steps:

a) providing two recognition sequences for site-specific recombinases, the recognition sequences each containing two recombinase binding sequences separated by a spacer sequence, b) inserting the two recognition sequences into the target gene with disruption of the open reading frame of the target gene, c) expressing a site-specific recombinase for performing a recombination event, wherein a recognition sequence remains in the target gene and the remaining recognition sequence together with the target gene forms an open reading frame for expression of a substantially active target gene product.

In the case of the target gene product, it is usually a protein. However, according to the invention, the target gene product may also be a polypeptide.

There are basically different options for providing suitable recognition sequences. These possibilities are described below by way of example by means of recognition in more detail with a length of 34 base pairs (bp). Such a recognition sequence, for example in the form of an Iox sequence or FRT sequence, together with two further base pairs theoretically encodes a sequence-specific section of 12 amino acids, a so-called dodecapeptide. In principle, six different reading frames are possible in the transcription of a double-stranded DNA since the transcription of both strands is possible. Accordingly, a recognition sequence with 34 base pairs together with two further base pairs can theoretically encode six different dode-capeptides. Since there are a total of 20 different proteinogenic amino acids, the likelihood that a target protein has within its natural sequence a sequence encoding one of these dodecapeptides is rather low. Moreover, if a portion of twelve of the amino acids naturally occurring in the target protein were to be replaced in an undirected manner against a / ox-encoded dodecapeptide (which would normally correspond to the situation after excision from the target gene), the modified protein would probably be less active or completely inactive. According to the invention, therefore, the measures described in more detail below have proven to be particularly advantageous.

In a preferred embodiment, the recognition sequences are inserted into the target gene in the form of a recognition sequence-flanked DNA sequence, preferably in the form of a recognition sequence-flanked gene cassette sequence. According to the invention, it is particularly preferred in this case if the recognition sequences are inserted into a section of the target gene which codes for a permissive region of the target gene product. For the purposes of the present invention, a permissive region is to be understood as meaning a region of the target gene product which is tolerable in relation to an exchange of one, two, three or more amino acids. In the context of the present invention, this was successfully demonstrated by the tetracycline repressor protein (TetR) are verified. Here, a lox sequence-flanked gene cassette was inserted into a portion of the tefR gene encoding a permissive loop region of the tefR protein. Subsequent recombination, mediated by the Cre recombinase, yielded a tefR gene which still contained one of the flanking lox sequences. Expression of this modified or mutated tefR gene revealed a TetR protein which was fully active. The sequence SEQ ID NO 177 stands for the gene sequence of tetR with an FRT sequence. The sequence SEQ ID NO 178 represents the sequence of tetR with an Iox72 / 1 sequence. The sequence SEQ ID NO 179 stands for the sequence of the wild-type tefR gene.

In the event that only the primary sequence of the target gene product is known, the primary sequence can be investigated specifically for amino acid sequences which are essentially codable by recognition sequences for recombinases. The greater the degree of correspondence between an amino acid sequence in the target gene product and a peptide encoded by the recognition sequence, the more likely that the modified or mutant target gene product has complete activity. Alternatively, or in combination, the primary sequence of a target protein may also be screened for whether a sequence of amino acids functionally corresponds to the amino acids encoded by the recognition sequences. In both cases, it is particularly advantageous if it is possible to resort to a sufficient number of recognition sequences for site-specific recombinases, in particular in the form of a sequence library, since this significantly increases the probability of a "hit." Therefore, it is particularly preferred according to the invention if the recognition sequences are selected by selection from a library of recognition sequences, in particular by selection from a library comprising at least one of the recognition sequences from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 176 according to the attached Sequence Listing. The library preferably comprises the recognition sequences SEQ ID NO: 1 to SEQ ID NO: 176 according to the attached sequence listing. The additionally required recombinases may be wild-type recombinases or mutants of recombinases. With regard to the recombinases in question, reference is made to the previous description.

The expression of the site-specific recombinase is achieved in a preferred embodiment by transformation or transfection of the genetic system with a vector encoding the recombinase. The vector may be a plasmid or a bacteriophage.

In addition, there are other possibilities for the expression of the site-specific recombinase. Thus, for example, the recombinase can be introduced into the genetic system as an RNA molecule at a desired time. Furthermore, the recombinase can already be encoded within the genetic system and induced by transcriptional control or low molecular weight substances at a desired time. In particular, the recombinases may also be encoded within the sequence to be excised.

The gene regulation described in the context of the present invention on the basis of recognition sequences for site-specific recombinases or site-specific recombination systems based thereon has the following advantages over conventional gene regulation based on transcription control systems:

The natural gene regulatory structure, in particular promoter and terminator, of the target gene remains intact. If the target gene is in a transcription unit with further genes (operon), the influence of "downstream" genes (polar effect) after the recombination event is minimized.

Furthermore, the gene is completely inactive before cleavage by a site-specific recombinase, d. H. no background or basal activity is observed. The activation can also be correlated with a positive or negative selectability. In particular, a change in phenotype associated with the activation is conceivable, for example by excising a fluorescence protein gene.

Further features and advantages of the invention will become apparent from the following description of preferred embodiments in the form of examples and figure descriptions in conjunction with the attached sequence listing and the features of the subclaims. Here, individual features of the invention can be realized alone or in combination with each other. The described embodiments are merely illustrative and for a better understanding of the invention and are in no way limiting. The figures and the attached sequence listing are hereby incorporated by reference in their entirety.

1. Material and methods

1.1 Bacterial strains and growth conditions

The cloning was performed in Escherichia coli (E. coli) DH5α (Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids J. Mol Biol 166: 577-80). Genetic manipulations of tetR were performed in vivo in Bacillus subtilis WH558 (Bertram, R., M. Köstner, J. Muller, J. Vazquez Ramos, and W. Hillen. 2005. Integrative elements for Bacillus subtilis yielding tetracycline-dependent growth phenotypes. Nucleic Acids Res 33: e153) and derivatives thereof as shown in Table 1. The cells were generally grown either in a liquid (with shaking) or on a solid nutrient medium LB or BM (Bera, A., S. Herbert, A. Jakob, W. Vollmer, and F. Götz. 2005. Why are pathogenic staphylococci so lysozyme resistant? The peptidoglycan O-acetyl transferase OatA is the major determinant of lysozyme resistance of Staphylococcus aureus, Mol Microbiol 55: 778-787). If necessary, the nutrient media were supplemented with ampicillin (Ap, 100 mg / L for E. coli) kanamycin (Km, 30 mg / L for E. coli or 15 mg / L for B. subtilis), chloramphenicol (Cm; l for E. coli, or 5 or 10 mg / L for B. subtilis) or with erythromycin (Em, 2.5 mg / L for B. subtilis). For cloning, E. coli strains were made competent and transformed using standard techniques (Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids J. Mol Biol 166: 557-80). Naturally, competent B. subtilis cells were obtained by a standard protocol (Kraus, A., C. Hueck, D. Gärtner, and W. Hillen, 1994. Catabolite repression of the Bacillus subtilis xyl operon context of an unrelated sequence, and glucose exerts additional xy / R-dependent repression J Bacteriol 176: 1738-45). All bacterial strains used in the invention are summarized in Table 1.

Table 1: Bacterial strains or plasmids

1.2 DNA Isolation and Modification

A plasmid DNA of E. coli was prepared according to the manufacturer's protocols using the E.Z.N.A. Plasmid miniprepkit (Peqlab, Erlangen, Germany), a Nukleospinplasmids (Macherey-Nagel, Düren, Germany) or the Plasmidmidikits (Qiagen, Hilden, Germany) produced. For the amplification of B. subtilis chromosomal DNA, bacterial colonies from a solid medium were inoculated directly into a PCR reaction mixture which provided for the use of PuReTaq Ready-To-Go PCR beads (GE Healthcare, Munich, Germany). Sequencing of the plasmids or PCR products was performed on an ABI PRISM 310 genetic analyzer (Applied Biosystems, Weiterstadt, Germany) or on a GATC (Konstanz, Germany). The primers were purchased from Biomers (Ulm, Germany) or MWG-Biotech (Ebersberg, Germany). Longer oligonucleotides were purchased from TIB-MOLBIOL (Berlin, Germany). The primer sequences used are shown in Table 2.

Table 2:

Oligo sequence (5 '→ 3') nucleotides

1.3 Preparation of a plasmid for expression of tetR alleles with recognition sequences for site-specific recombination

A chimeric TetR protein having a TetR (B) sequence with amino acid residues 1 to 50 and a TetR (D) sequence with amino acid residues 51 to 208 was used (Schnappinger, D., P. Schubert, K. Pfleiderer, and W. Hillen. 1998. Determinants of protein-protein recognition by four helix bundles: changing the dimerization specificity of Tet repressor. Embo J 17: 535-43; Schubert, P., D. Schnappinger, K. Pfleiderer, and W. Hillen. 2001. Identification of a stability determinant on the edge of the Tet repressor four-helix bundle dimerization motif. Biochemistry 40: 3257-3263). Hereinafter, the chimeric TetR (BD) protein will be referred to as TetR. For insertion into the tefR gene, complementary oligonucleotides containing an FRT or a / ox sequence were phosphorylated in their 5 'end by means of a T4 polynucleotide kinase (New England Biolabs, Frankfurt / Main, Germany). Subsequently, two complementary oligonucleotides were hybridized by mixing two aqueous solutions, each containing 37.5 pmol of each oligonucleotide, heated to 90 ⁰ C and then cooled to room temperature within one hour. The hybridized oligonucleotides had 3 'overhangs which were compatible or identical to those of PstI cut DNA. In addition, the hybridized oligonucleotides contained the following recognition sequences for site-specific recombination: FRT within flp_fw / flp_rev, and Iox72 in two different reading frames within lockP / Pkcol and lockP_fw / lockP_rev. After insertion of PstI cut pWH1926 (Kamionka, A., M. Majewski, K. Roth, R. Bertram, C. Kraft, and W. Hillen, 2006. Induction of single chain tetracycline repressor requires the binding of two inducers Res 34: 3834-3841) into the tefR gene, the following desired constructs were obtained: pWH1926-F with FRT in 5 '^ 3' reading frame 2, pWH1926-L1 (Iox72 in 3 '^ 5' reading frame 1) and pWH1926- L2 Iox72 (3 '^ 5' frame 2). In all constructs, recognition sequences for site-specific recombination were embedded in the open reading frame of the TetR gene. Plasmids in which the fragments were inserted in opposite orientation were determined accordingly and will be referred to hereinafter as "- inv". 1.4. Cloning of a B.subtilis integration vector to enable Cre mediated teff? Gene activation

To disrupt the tefR gene with a "floxed" kanamycin resistance marker, an apM /// cassette from plasmid pDG792 was amplified by PCR using primers Km_66_inv and Km_71_inv (Guerot-Fleury, AM, K. Shazand. N. Frandsen, and P. Stragier, 1995. Antibiotic resistance cassettes for Bacillus subtilis, Gene 167: 335-336.) The PCR product was inserted into pWH1926 via PstI of the two possible resulting plasmids aphAIII used in opposite orientation to the disrupted fefR gene and hereafter referred to as pWH1926-TLKLT (tetR'-lox66-aphAIII-lox71 -tetR) The target strain B. subtilis WH558 carried chromosomal DNA from pUC19 and was the precursor of pWH1926 To circumvent a possible undesired ectopic insertion after transformation with pWH 1926-TLKLT, the sequence tetR'-lox66-aphAIII-lox71 -tetR was cloned into pWH1411 BD using BglII and NcoI (Scholz, O., M Köstner, M. Reich, S. Gastiger, to d W. Hillen. 2003. Teaching TetR to recognize a new inducer. J Mol Biol 329: 217 = 227) to give p \ Λ / H 1411 -TLKLT. In order to provide a larger region with sequence identity for genomic integration, part of the chromosomal sequence within and downstream of tetR of B. subtilis RAB100 DNA was amplified (see Table 1). The primers DP8neu and lacA extd were used here (see Table 2). This fragment was inserted into pWH1411-TLKLT via Ncol and Pael to obtain the integration vector pWH1411-TLKLTextd. This vector was linearized by Nhel prior to the transformation of S. subtilis.

1.5 Techniques used for genome modification of B. subtilis strains The elimination of "floxed" apM /// cassettes from B. subtilis chromosomes was achieved by treatment of the respective cells with pCrePA, a plasmid prepared for Cre expression in B. anthracis (Pomerantsev, AP, R. Sitaraman G. Galloway, V. Kivovich, and SH Leppla, 2006. Genome engineering in Bacillus anthracis using Cre recombinase, Infect Immun 74: 682-693.) In general, 1 μg of this plasmid was used to transform B. subtilis were first at 30 ⁰ C on a medium containing 2.5 ug / ml EM (erythromycin) but no Km (Ka namycin) were cultured as was intended to eliminate aphAIII the resistance marker. EM-resistant colonies were plated and without EM incubated at 37 ⁰ C, a temperature which is not permissive for pCrePA. candidate clones were plated and incubated at 37 ⁰ C overnight a second time. clones which both vity against these sensitivity EM and g over Km, were checked by PCR analysis after this treatment and showed marker loss as well as loss of pCrePA.

1.6 Quantifications of β-galactosidase activity

The in vivo expression and induction capacities of TetR variants were β-galactosidase (β-gal) assays of mid-log cultures of E. coli WH207 λtetδO (Smith, LD, and KP Bertrand, 1988. Mutations in the Tn-ZO Tetrahedron Biol 203: 949-959; Wissmann, A., LV Wray, Jr., U. Somaggio, R. Baumeister, M. Geissendörfer, and W. 1991. Selection for Tn-ZO tet repressor binding to tet operator in Escherichia coli: isolation of temperature-sensitive mutants and combinatorial mutagenesis in the DNA binding motif Genetics 128: 225-232) or different B. subtilis strains ( Kamionka, A., R. Bertram, and W. Hillen, 2005. Tetracycline-dependent conditional gene knockout in Bacillus subtilis, Appl Environ Microbiol 71: 728-733, Scholz, O., EM Henssler, J. Bail, P. Schubert, J. Bogdanska-Urbaniak, S. Sopp, M. Reich, S. Wisshak, M. Köstner, R. Bertram, and W. Hillen. 2004. Activity reversal of Tet repressor caused by Single amino acid exchanges. Mol Microbiol 53: 777-89). The cells were grown in LB without additives (repressive conditions) or supplemented with 0.4 μm ATc (for the induction of TetR). Three independent cultures were assayed, with measurements taken at least twice. The values obtained for E. coli cells carrying the plasmid pWH1925Δ (plasmid without tetR, Bertram, R., Kraft, S. Wisshak, J. Mueller, O. Scholz, and W. Hillen Phenotypes of com- bined tet repressor mutants for effector and operator recognition and al- loyery J Mol Microbiol Biotechnol 8: 104-110) were set at 100% as they reflect complete induction of TetR. The standard deviations of these measurements were below 10%.

1.7 Western blot analysis

Immunodetection of the TetR protein in soluble B.st / bf / V / s extracts was performed with 75 μg of total protein, immunodetection based either on the use of a serum of TOP19 monoclonal antibody directed against TetR (B) (Pook, E., S. Grimm, A. Bonin, T. Winkler, and W. Hillen, 1998. Affinities of mAbs to Tet repressor complexed with operator or tetracyclines suggestional changes associated with induction.) Eur J Biochem 258: 915-922) or using a 1: 20,000 dilution of rabbit polyclonal antibodies which recognize TetR protein. Further, ECL Plus Western blotting detection reagents (GE Healthcare, Munich, Germany) were used in a manner known to those skilled in the art (Kamionka, A., R. Bertram, and W. Hillen, 2005. Tetracycline-dependent conditional gene knockout in Bacillus subtilis, Appl Environ Microbiol 71: 728-733). 2 results

2.1 In vivo activity of TetR variants, partially encoded by recognition sequences for site-specific recombination

The loop region between the helices α8 and α9 (Figure 1A) in the TetR protein consists of 15 amino acid residues (positions 152 to 167) and is identical to that of TetR (D). Previous studies have shown that lengths and sequence variations of this region are tolerated to some degree. The first goal was therefore to replace codons 161-167 with different recognition sequences for site-specific recombination while maintaining an open reading frame. For this, FRT or Iox72-containing sequences were cloned into the vector pWH1926 expressing the tetR gene. The desired constructs pWH1926-F1, pWH1926-L1 and pWH1926-L2 were obtained. The constructs pWH1926-F1-inv, pWH1926-L1-inv and pWH1926-L2-inv were also obtained. In the latter three vector constructs, the fragments were inserted in opposite orientation. Because of the location of the two PstI sites used for cloning within the TetR gene, the proteins derived from the "inv" plasmid constructs displayed sequence alterations affecting not only the loop region but also the region of the helix α9 This caused the construct L2-inv to be prematurely terminated by the open stop codon, so that this construct, termed tetR! ^{ox72 / 2} - ^inv , encoded only one truncated TetR protein-like polypeptide of 170 amino acids, encoding all other open reading frames for complete 214 or 215 amino acid residue TetR monomers, hereinafter referred to as TetR ^FRT (FRT sequence), TetR ^{lox72 / 1} (Iox72, first reading frame), _TetR ^{ioχ72 / 2} ₍ | _oχ72i second reading frame), TetR ^FRJ ^inv and TetR ^{lox72 / 1} - ^inv . The altered sequence sections of the variants and their in wVo activities in E. coli are shown in Fig. 1B All three showed it TetR variants in which only the loop region was changed, complete inducibility with ATc. Likewise, the repression capacities of TetR ^FRT and TetR ^{lox72 / 1 were} almost identical to those of the wild-type TetR protein. However, the repression ^{capacities were} reduced in the case of TetR ^{log72 / 2} . This is in marked contrast to the behavior of the ,, - inv "constructs, one of which had no regulatory properties The truncated y _e t R ^{lox72 / 2} - ^{|. Na} _wa r inactive, whereas TetR ^FRT and TetR ^{lox72 / 1} seems to tetO tied, but did not allow induction.

2.2 Vector for chromosomal integration of a split tetR-type sequence into B. subtilis

The next goal was to provide a model system by which an artificially disrupted tefR gene variant could be activated by Cre recombinase treatment. Based on the results reported so far, a lox66 (marker gene) -lox71 cassette should be excised in vivo between two portions of the fefR gene to yield ^{TetR lox72 / 1} as the final product. For various reasons, the corresponding manipulations within the B. subtilis chromosome were performed using the Cre / 7ox system. Thus B. subtilis is susceptible to transformation and integration of foreign DNA into the chromosome by a double homologous recombination (Fernandez, S., S. Ayora, and JC Alonso 2000. Bacillus subtilis homologous recombination: genes and products. Res Microbiol 151 : 481-6). In addition, strains of these species are available to quantify the in vivo activity of TetR variants (Bertram, R., M. Köstner, J. Müller, J. Vazquez Ramos, and W. Hillen, 2005. Integrative elements for Bacillus subtilis yielding tetracycline-dependent growth phenotypes, Nucleic Acids Res 33: e153, Kamionka, A., R. Bertram, and W. Hillen, 2005. Tetracycline-dependent conditional gene knockout in Bacillus subtilis, Appl Environ Microbiol 71: 728-733). Finally, the use of the Cre / lox system for this species has been described (Pomerantsev, AP, R. Sitaraman, C. R. Galloway, V. Kivovich, and SH Leppla, 2006. Genome Engineering n Bacillus anthracis using Cre recombinase.) Infect Immun 74: 682-693). To clone an integration vector, an apM /// cassette conferring kanamycin resistance was amplified and modified by PCR. This flanked the cassette upstream by an Iox66 sequence and seven codons corresponding to positions 168-174 of helix α9 of the TetR protein and downstream of an Iox71 sequence. This product was inserted between the PstI sites of tetR. In this way, a tetR'-lox66-aphAlll-lox71 'tetR sequence, hereinafter referred to as tlklt, was obtained. After subcloning and minor modifications (see the section "Materials and Methods"), the final B. sub / W / s integration vector pWH1411- TLKLTextd was obtained.

2.3 Multiple modifications of the B. subtilis genome and Cre-mediated activation of TetR ^{lox72 / 1}

S, subtilis WH558 (Figure 2A) was used as the initial host strain (Bertram, R., M. Köstner, J. Muller, J. Vazquez Ramos, and W. Hale, 2005. Integrative elements for Bacillus subtilis yielding tetracycline). dependent growth phenotypes: Nucleic Acids Res 33: e153). The strain carried the wild-type tefR gene, which was regulated by a constitutive promoter integrated in the lacA locus, and lacZ, downstream of a Pyi / tet promoter with two fef operators within amyE (Geissendörfer, M., and W 1990. Regulated expression of heterologous genes in Bacillus subtilis using the Tn 10 encoded tet regulatory element. Appl Microbiol Biotechnol 33: 657-663). First, an aphAI-Il gene had to be removed in the WH558 genome. Restoration of kanamycin sensitivity within the strain was a prerequisite for later selection of the tlklt cassette. The for the selection of WH558 used aphAIII resistance cassette was flanked with Iox66 and Iox71 (Bertram, R., M. Köstner, J. Muller, J. Vazquez Ramos, and W. Hillen, 2005. Integrative elements for Bacillus subtilis yielding tetracycline-dependent growth phenotypes Acids Res 33: e153). After treatment with the plasmid pCrePA prepared for expression of the Cre recombinase in B. anthracis, a kanamycin-sensitive derivative of WH558, hereinafter referred to as RAB100, was obtained (Pomerantsev, AP, R. Sitaraman, CR Galloway, V. Kivovich, and SH Leppla, 2006. Genome engineering in Bacillus anthracis using Cre recombinase, Infect Immun 74: 682-693). The reduction in size of the region downstream of the tetR gene in the chromosome corresponded to the length of the "floxed" marker gene, thus demonstrating the Cre-mediated excision of the aphAIII cassette RAB100 was transformed with pWH1411 BD-TLKLTextd.The integration of the tf / ctf- Fragments into the tetR gene of RAB100 yielded the strain RAB101, which was confirmed by PCR To assemble and activate tetR * ^{ox72 / 1} , competent RABI 01 cells were treated with pCrePA.A PCR-analysis of the kanamycin was more sensitive Candidates confirmed the absence of the "floxed" resistance cassette. One of the positive candidates in which the region of the tefR gene was confirmed by sequencing was designated RAB102. As expected, treatment with Cre had assembled the two halves of the fefR gene-like sequence into tetR ¹⁰ * ⁷² ' ¹ , leaving a / ox72 sequence within the αδ to α9 loop codons. The master manipulation described is summarized schematically in FIG. 2B. The corresponding PCR analyzes are shown in FIG. 2C. The regulatory capacities of the newly produced B. subtilis WH558 derivatives were investigated by measuring β-galactosidase activity. The results obtained therefrom are shown in the upper part of FIG. There were no differences in the β-galactosidase activity between WH558 and RAB100, which are found only in the aphAIII- Selection marker downstream of the tetR gene distinguished, observed. RAB101 did not show / acZ repression, which can be explained by a stop codon immediately downstream of Iox71 in tlklt. The construct tetR ^{lox72 / 2'ιnv} did not lead to the expression of a functional repressor. With respect to RAB102 (tetR ¹⁰ * ¹ ), a nearly identical activity profile to that of WH558 or RAB100 was observed. This agrees with the results obtained in E. coli (FIG. 1B). To determine the levels of the TetR protein (or the quantities of truncated coded products) of the respective βac / 7 / t / s strains, Western blot analyzes were performed. Fig. 3 (upper part) shows the results obtained with the monoclonal antibody TOP19 whose epitope matches the "helix-turn-helix" motif of TetR (B), which is identical to that of TetR (Pook, E., S. Grimm, A. Bonin, T. Winkler, and W. Hillen, 1998. Affinities of mAbs to Tet Representative Complexed with Operator or Tetracycline Suggested Conformational Changes Associated with Induction Eur J Biochem 258: 915-922 The approximately equally strong signals obtained with soluble protein extracts of WH557, WH558 and RAB100 contrast with the weaker band in the case of RAB102, but no signal was observed in the case of RAB101, which is the prematurely terminated TLKLT product which corresponded to amino acid residues 1-161 of the TetR protein, but with an additional 11 amino acids at the C-terminus Additional Western blot analysis using polyclonal antibodies directed against the TetR protein gave a stronger protein No reduction in signal intensity in RAB102 compared to WH558 and RAB100. This can be explained by fewer antibody recognition epitopes in the altered loop region of TetR ^{lox72 / 1} compared to the wild-type TetR protein. Nevertheless, the reduced regulatory levels of RAB102 were sufficient to achieve very efficient tet regulation in the B.sup./fs model system. 3rd figure description

Fig. 1A shows the structure of TetR (D). The target region of the TetR protein selected for this method is the region enclosed by the arrows.

Fig. 1B shows the orientation of amino acid sequences of various αδ-α9 loop regions. Shown are the amino acid sequences from the five C-terminal residues of helix αδ to the end of He-Nx α9 of TetR variants or TetR-like polypeptides. Identical positions are highlighted in black or gray. The C-terminal end of TetR ^{lox72 / 2'ιnv} is ^terminated with a black check. The positions of the two PstI sites used for cloning within the corresponding tefR alleles are indicated by arrows. The β-galactosidase activities of the corresponding constructs, which were determined in E. coli (in%), are indicated on the right.

Fig. 2A shows a schematic representation of gene regions in the strain WH558, the regions of the tefR gene and the P _xy ι / _tet - / acZ fusion are shown schematically. The open kinked arrows indicate the promoter Pt17 (for tefR expression) and Pχyi / _tet (tef-regulatable, upstream of lacZ). The black trapezoids indicate various lox sequences flanking the kanamycin resistance cassette (aphAIII) and their orientation. The boxes marked with an "O" represent the tef operator, a transcriptional terminator is shown as a hairpin, and the stop codons that follow are indicated by a bold "S".

Fig. 2B shows schematically the multiple changes of the fefR region. In a first step, the aphAIII gene was excised by Cre recombinase. This resulted in the marker-free Strain RAB1OO. In a second step, the tefR gene was replaced by a double homologous recombination against a tetR'-lox66-aphAllf-lox71-tetR sequence (tlklt). This provided B. subtilis strain RAB101. In a third step, the aphAIII gene was again eliminated by Cre. This gave the final construct RAB102, which had tetF ^ ^{ox72 / 1} . The primers used for the analytical PCR reactions are shown as narrow arrows and with a Roman numbering and mean: I) / ox_test_fw, II) DP3, III) DPnew, IV) Km 1, V) Km2, VI) / ox_test_rev ,

Fig. 2C shows the results of the analytical PCR. The PCR products of the four B. subtilis strains shown were obtained with the following pricerocombinations (see Fig. 2B for approximate primer localization): lane 1: 1) + VI), lane 2: IM) + VI) , Lane 3: I) + II) and lane 4: IV) + V) (from left to right). Furthermore, the sizes of selected reference bands (in bp) are shown.

Fig. 3 shows the regulatory capacities and regulatory amounts of various B. subtilis strains. The results of measurements of β-galactosidase activity are shown in the figure above. The y-axis represents the Miller units. As control strains were WH557 which tetR but not encoded lacZ, and WH560, which P _x y / teWacZ but did not have tetR. The open bars show the values obtained without ATc, whereas the closed bars reflect 0.4 μM ATc conditions. The results of western blot analyzes for the respective strains obtained using a monoclonal antibody are shown in the lower figure of FIG. Here, 80 ng of purified TetR protein was used as a control.

The sequences mentioned in the description are the sequences listed below: SEQ. ID. NO 1: loxP (bacteriophage P1, natural occurrence) ATAACTTCGTATA ATGTATGC TATACGAAGTTAT

SEQ. ID. NO 2: Iox66 (analysis in Nicotiana tabacum (tobacco plant), chemically / synthetically produced) TACCGTTCGTATA ATGTATGC TATACGAAGTTAT

SEQ. ID. NO 3: Iox71 (analysis in Nicotiana tabacum (tobacco plant), chemically / synthetically produced) ATAACTTCGTATA ATGTATGC TATACGAACGGTA

SEQ. ID. NO 4: Iox72 (analysis in Nicotiana tabacum (tobacco plant), chemically / synthetically produced) TACCGTTCGTATA ATGTATGC TATACGAACGGTA

SEQ. ID. NO 5: Iox76 (analysis in Nicotiana tabacum (tobacco plant), chemically / synthetically produced) TACCGGGCGTATA ATGTATGC TATACGAAGTTAT

SEQ. ID. NO 6: Iox75 (analysis in Nicotiana tabacum (tobacco plant), chemically / synthetically produced) ATAACTTCGTATA ATGTATGC TATACGCCCGGTA

SEQ. ID. NO 7: Iox78 (analysis in Nicotiana tabacum (tobacco plant), chemically / synthetically produced) TACCGGGCGTATA ATGTATGC TATACGCCCGGTA

SEQ. ID. NO 8: Iox43 (analysis in Nicotiana tabacum (tobacco plant), chemically / synthetically produced) CTCGGTACCTATA ATGTATGC TATACGAAGTTAT SEQ. ID. NO 9: Iox44 (analysis in Nicotiana tabacum (tobacco plant), chemically / synthetically produced) ATAACTTCGTATA ATGTATGC TATAGCATGCATT

SEQ. ID. NO 10: Iox65 (analysis in Nicotiana tabacum (tobacco plant), chemically / synthetically produced) CTCGGTACCTATA ATGTATGC TATAGCATGCATT

SEQ. ID. NO 11: JT1 (analysis in Escherichia coli, produced chemically / synthetically)

ATAACTTCGTATA ATGTATGC TATACGAATAGGA

SEQ. ID. NO 12: JT4 (analysis in Escherichia coli, produced chemically / synthetically)

ATAACTTCGTATA ATGTATGC TATACGAAACCCC

SEQ. ID. NO 13: JT5 (analysis in Escherichia coli, produced chemically / synthetically)

ATAACTTCGTATA ATGTATGC TATACGAAATTAA

SEQ. ID. NO 14: JT12 (analysis in Escherichia coli, produced chemically / synthetically)

ATAACTTCGTATA ATGTATGC TATACGAACAACT

SEQ. ID. NO 15: JT15 (analysis in Escherichia coli, chemically / synthetically producing) ATAACTTCGTATA ATGTATGC TATACGAATAATT

SEQ. ID. NO 16: JT21 (analysis in Escherichia coli, chemical / synthetically produced) ATAACTTCGTATA ATGTATGC TATACGAACGAAA SEQ. ID. NO 17: JT44 (analysis in Escherichia coli, chemically / synthetically producing) ATAACTTCGTATA ATGTATGC TATACGAACCTGT

SEQ. ID. NO 18: JT47 (analysis in Escherichia coli, chemical / synthetic) ATAACTTCGTATA ATGTATGC TATACGAACCCCG

SEQ. ID. NO 19: JT510 (analysis in Escherichia coli, chemically / synthetically producing) ATAACTTCGTATA ATGTATGC TATACGAACGTTA

SEQ. ID. NO 20: JT520 (analysis in Escherichia coli, chemically / synthetically producing) ATAACTTCGTATA ATGTATGC TATACGAACGATA

SEQ. ID. NO 21: JT530 (analysis in Escherichia coli, chemically / synthetically producing) ATAACTTCGTATA ATGTATGC TATACGAACCGTA

SEQ. ID. NO 22: JT540 (analysis in Escherichia coli, chemically / synthetically producing) ATAACTTCGTATA ATGTATGC TATACGAAGTAAA

SEQ. ID. NO 23: JTZ2 (analysis in Escherichia coli, chemical / synthetic production) AGGTATTCGTATA ATGTATGC TATACGAAGTTAT

SEQ. ID. NO 24: JTZ5 (analysis in Escherichia coli, chemically / synthetically producing) ACAGGTTGCTATA ATGTATGC TATACGAAGTTAT SEQ. ID. NO 25: JTZ10 (analysis in Escherichia coli, chemically / synthetically producing) CAATATTGCTATA ATGTATGC TATACGAAGTTAT

SEQ. ID. NO 26: JTZ17 (analysis in Escherichia coli, chemical / synthetic preparation) ATAAATTGCTATA ATGTATGC TATACGAAGTTAT

SEQ. ID. NO 27: Iox511 (analysis in Mus musculus (mouse), chemically / synthetically produced) ATAACTTCGTATA ATGTATAC TATACGAAGTTAT

SEQ. ID. NO 28: Iox2272 (analysis in Mus musculus (mouse), chemically / synthetically produced) ATAACTTCGTATA AAGTATCC TATACGAAGTTAT

SEQ. ID. NO 29: Iee11 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA GTGTATGC TATACGAAGTTAT

SEQ. ID. NO 30: Iee12 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA TTGTATGC TATACGAAGTTAT

SEQ. ID. NO 31: Iee13 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ACGTATGC TATACGAAGTTAT

SEQ. ID. NO 32: Iee21 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ACGTATGC TATACGAAGTTAT SEQ. ID. NO 33: Iee22 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA AAGTATGC TATACGAAGTTAT

SEQ. ID. NO 34: Iee23 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA AGGTATGC TATACGAAGTTAT

SEQ. ID. NO 35: Iee31 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATATATGC TATACGAAGTTAT

SEQ. ID. NO 36: Iee32 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATCTATGC TATACGAAGTTAT

SEQ. ID. NO 37: Iee33 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATTTATGC TATACGAAGTTAT

SEQ. ID. NO 38: Iee41 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGCATGC TATACGAAGTTAT

SEQ. ID. NO 39: Iee42 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGAATGC TATACGAAGTTAT

SEQ. ID. NO 40: Iee43 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGGATGC TATACGAAGTTAT SEQ. ID. NO 41: Iee51 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTGTGC TATACGAAGTTAT

SEQ. ID. NO 42: Iee52 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTTTGC TATACGAAGTTAT

SEQ. ID. NO 43: Iee53 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTCTGC TATACGAAGTTAT

SEQ. ID. NO 44: Iee61 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTACGC TATACGAAGTTAT

SEQ. ID. NO 45: Iee62 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTAAGC TATACGAAGTTAT

SEQ. ID. NO 46: Iee63 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTAGGC TATACGAAGTTAT

SEQ. ID. NO 47: Iee71 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTATAC TATACGAAGTTAT

SEQ. ID. NO 48: Iee72 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTATCC TATACGAAGTTAT SEQ. ID. NO 49: Iee73 (tested in vitro, chemically / synthetically produced) ATAACTTCGTATA ATGTATTC TATACGAAGTTAT

SEQ. ID. NO 50: Iee81 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTATGI TATACGAAGTTAT

SEQ. ID. NO 51: Iee82 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTATGG TATACGAAGTTAT

SEQ. ID. NO 52: Iee83 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTATGA TATACGAAGTTAT

SEQ. ID. NO 53: Iee2171 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ACGTATAC TATACGAAGTTAT

SEQ. ID. NO 54: Iee2271 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA AAGTATAC TATACGAAGTTAT

SEQ. ID. NO 55: Iee2371 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA AGGTATAC TATACGAAGTTAT

SEQ. ID. NO 56: Iee3171 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATATATAC TATACGAAGTTAT SEQ. ID. NO 57: Iee3271 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATCTATAC TATACGAAGTTAT

SEQ. ID. NO 58: Iee3371 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATTTATAC TATACGAAGTTAT

SEQ. ID. NO 59: Iee4171 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGCATAC TATACGAAGTTAT

SEQ. ID. NO 60: Iee4271 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGAATAC TATACGAAGTTAT

SEQ. ID. NO 61: Iee4371 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGGATAC TATACGAAGTTAT

SEQ. ID. NO 62: Iee5171 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTGTAC TATACGAAGTTAT

SEQ. ID. NO 63: Iee5271 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTITAC TATACGAAGTTAT

SEQ. ID. NO 64: Iee5371 (tested in vitro, chemically / synthetically produced) ATAACTTCGTATA ATGTCTAC TATACGAAGTTAT SEQ. ID. NO 65: Iee2172 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ACGTATCC TATACGAAGTTAT

SEQ. ID. NO 66: Iee2272 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA AAGTATCC TATACGAAGTTAT

SEQ. ID. NO 67: Iee2372 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA AGGTATCC TATACGAAGTTAT

SEQ. ID. NO 68: Iee3172 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATATATCC TATACGAAGTTAT

SEQ. ID. NO 69: Iee3272 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATCTATCC TATACGAAGTTAT

SEQ. ID. NO 70: Iee3372 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATTTATCC TATACGAAGTTAT

SEQ. ID. NO 71: Iee4172 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGCATCC TATACGAAGTTAT

SEQ. ID. NO 72: Iee4272 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGAATCC TATACGAAGTTAT SEQ. ID. NO 73: Iee4372 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGGATCC TATACGAAGTTAT

SEQ. ID. NO 74: Iee5172 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTGTCC TATACGAAGTTAT

SEQ. ID. NO 75: Iee5272 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTJTCC TATACGAAGTTAT

SEQ. ID. NO 76: Iee5372 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTCTCC TATACGAAGTTAT

SEQ. ID. NO 77: Iee2173 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ACGTATTC TATACGAAGTTAT

SEQ. ID. NO 78: Iee2273 (tested in vitro, chemically / synthetically produced) ATAACTTCGTATA AAGTATIC TATACGAAGTTAT

SEQ. ID. NO 79: Iee2373 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA AGGTATTC TATACGAAGTTAT

SEQ. ID. NO 80: Iee3373 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATTTATTC TATACGAAGTTAT SEQ. ID. NO 81: Iee4373 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGGATTC TATACGAAGTTAT

SEQ. ID. NO 82: Iee5373 (tested in vitro, chemically / synthetically produced) ATAACTTCGTATA ATGTCTTC TATACGAAGTTAT

SEQ. ID. NO 83: she39 (E. coli, chemically / synthetically produced) ATAACTTCGTATA ACCACTGC TATACGAAGTTAT

SEQ. ID. NO 84: she33 (E. coli, chemically / synthetically produced) ATAACTTCGTATA GCCACAGA TATACGAAGTTAT

SEQ. ID. NO 85: she9 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CCGAACAA TATACGAAGTTAT

SEQ. ! D. NO 86: she28 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CGCAACGG TATACGAAGTTAT

SEQ. ID. NO 87: she14 (E. coli, chemically / synthetically produced) ATAACTTCGTATA GCTTTAGT TATACGAAGTTAT

SEQ. ID. NO 88: she29 (E. coli, chemically / synthetically produced) ATAACTTCGTATA ATGATTCT TATACGAAGTTAT

SEQ. ID. NO 89: she592 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CCGCGTCC TATACGAAGTTAT

SEQ. ID. NO 90: she64 (E. coli, chemically / synthetically produced) ATAACTTCGTATA TAAACCGC TATACGAAGTTAT SEQ. ID. NO 91: she63 (E. coli, chemically / synthetically produced) ATAACTTCGTATA TACCTCCT TATACGAAGTTAT

SEQ. ID. NO 92: she37 (E. coli, chemically / synthetically produced) ATAACTTCGTATA GCCGTCTG TATACGAAGTTAT

SEQ. ID. NO 93: she25 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CCAATCCG TATACGAAGTTAT

SEQ. ID. NO 94: she4 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CTCAGCAA TATACGAAGTTAT

SEQ. ID. NO 95: shelO (E. coli, chemically / synthetically produced) ATAACTTCGTATA AGACATGC TATACGAAGTTAT

SEQ. ID. NO 96: she412 (E. coli, chemically / synthetically produced) ATAACTTCGTATA GATCGCGT TATACGAAGTTAT

SEQ. ID. NO 97: she7 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CGCCTCCT TATACGAAGTTAT

SEQ. ID. NO 98: she512 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CGCCACCC TATACGAAGTTAT

SEQ. ID. NO 99: she17 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CGCCCACA TATACGAAGTTAT

SEQ. ID. NO 100: sheθ (E. coli, chemically / synthetically produced) ATAACTTCGTATA CACGGCCC TATACGAAGTTAT

SEQ. ID. NO 101: she21 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CTATTGCC TATACGAAGTTAT SEQ. ID. NO 102: she3 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CACCGGAA TATACGAAGTTAT

SEQ. ID. NO 103: she206 (E. coli, chemically / synthetically produced) ATAACTTCGTATA TACATGAC TATACGAAGTTAT

SEQ. ID. NO 104: she270 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CATTCTGG TATACGAAGTTAT

SEQ. ID. NO 105: she271 (E. coli, chemically / synthetically produced) ATAACTTCGTATA ATGATTTG TATACGAAGTTAT

SEQ. ID. NO 106: she268 (E. coli, chemically / synthetically produced) ATAACTTCGTATA AATCCTGC TATACGAAGTTAT

SEQ. ID. NO 107: she267 (E. coli, chemically / synthetically produced) ATAACTTCGTATA AAGTATAC TATACGAAGTTAT

SEQ ID NO 108-she207 (E-coli, chemically / synthetically produced) ATAACTTCGTATA ATTGAAGA TATACGAAGTTAT

SEQ. ID. NO 109: she269 (E. coli, chemically / synthetically produced) ATAACTTCGTATA AGTTCGAA TATACGAAGTTAT

SEQ. ID. NO 110: she265 (E. coli, chemically / synthetically produced) ATAACTTCGTATA GATACTTA TATACGAAGTTAT

SEQ. ID. NO 111: she202 (E. coli, chemically / synthetically produced) ATAACTTCGTATA TTGCACAC TATACGAAGTTAT SEQ. ID. NO 112: she203 (E. coli, chemically / synthetically produced) ATAACTTCGTATA GCGTCACG TATACGAAGTTAT

SEQ. ID. NO 113: she208 (E. coli, chemically / synthetically produced) ATAACTTCGTATA GGCTTTTA TATACGAAGTTAT

SEQ. ID. NO 114: she266 (E. coli, chemically / synthetically produced) ATAACTTCGTATA CATTTATG TATACGAAGTTAT

SEQ. ID. NO 115: she204 (E. coli, chemically / synthetically produced) ATAACTTCGTATA GACCGTTC TATACGAAGTTAT

SEQ. ID. NO 116: saul (Naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ATAACTTCGTATA ATGTATTT TATAAGCTAATTT

SEQ. ID. NO 117: sau11 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) AAATTACGTTATA ATGTATTT TATAAGCTAATTT

SEQ. ID. NO 118: sau2 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ATAACTTCGTATA ATGTATGA TATATGTTGGAGC

SEQ. ID. NO 119: sau21 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) GCTCCAACATATA ATGTATGC TATATGTTGGAGC SEQ. ID. NO 120: sau3 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom)

ATAACTTCGTATA ATGTGATGA TATACCTΠTTTT

SEQ. ID. NO 121: sau31 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) AAAAAAAGGTATA ATGTATGC TATACCTTTTTT

SEQ. ID. NO 122: sau4 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ATAACTTCGTATA ATGTATGG AACAAGAAGGAAG

SEQ. ID. NO 123: sau41 (Naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) CTTCCTTCTTGTT ATGTATGC AACAAGAAGGAAG

SEQ. ID. NO 124: sau5 (Naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ATAACTTCGTATA ATGTATGG AACTCT I I I I GT

SEQ. ID. NO 125: sau51 (Naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ACAAAAAAGAGTT ATGTATGC AACTCTTTTTGT

SEQ. ID. NO 126: sow (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ATAACTTCGTATA ATGTATGT TAACTTATATGGT SEQ. ID. NO 127: sau61 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ACCATATAAGTTA ATGTATGC TAACTTATATGGT

SEQ. ID. NO 128: sau7 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ATAACTTCGTATA ATGTATGT TGTCCACAGGCAA

SEQ. ID. NO 129: sau71 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) TTGCCTGTGGACA ATGTATGC TGTCCACAGGCAA

SEQ. ID. NO 130: sowδ (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ATAACTTCGTATA ATGGCAAT TATACGAAGCTTG

SEQ. ID. NO 131: sau81 (Naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) CAAGCTTCGTATA ATGTATGC TATACGAAGCTTG

SEQ. ID. NO 132: sau9 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ATAACTTCGTATA ATGTTCCA TATAATGACCCAA

SEQ. ID. NO 133: sau91 (naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) TTGGGTCATTATA ATGTATGC TATAATGACCCAA SEQ. ID. NO 134: SaulO (Naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) ATAACTTCGTATA ATGTATGT TATCATTAATATA

SEQ. ID. NO 135: sau101 (Naturally occurring sequences in Saccharomyces cerevisiae (baker's yeast) and sequences derived therefrom) TATATTAATGATA ATGTATGC TATCATTAATATA

SEQ. ID. NO 136: M 1 (E. coli, chemically / synthetically produced) ATAACTTCATATA ATGTATGC TATAIGAAGTTAT

SEQ. ID. NO 137: M2 (E. coli, chemically / synthetically produced) ATAACTTCGTACA ATGTATGC TGTACGAAGTTAT

SEQ. ID. NO 138: M3 (E. coli, chemically / synthetically produced) ATAACTTCATACA ATGTATGC TGTAIGAAGTTAT

SEQ. ID. NO 139: M4 (E. coli, chemically / synthetically produced) ATAACTTTGTATA ATGTATGC TATACAAAGTTAT

SEQ. ID. NO 140: M5 (E. coli, chemically / synthetically produced) ATAACTTCGTGCA ATGTATGC TGCACGAAGTTAT

SEQ. ID. NO 141: M6 (E. coli, chemically / synthetically produced) ATAACTCIGTATA ATGTATGC TATACAGAGTTAT

SEQ. ID. NO 142: M7 (E. coli, chemically / synthetically produced) ATAACTCTATATA ATGTATGC TATATAGAGTTAT SEQ. ID. NO 143: M8 (E. coli, chemically / synthetically produced) ATAACTCTGTGTA ATGTATGC TACACAGAGTTAT

SEQ. ID. NO 144: PM7 (tested in vitro, chemically / synthetically prepared) ATAACTTCGTATA ATGTATGC TATATAGAGTTAT

SEQ. ID. NO 145: M7P (tested in vitro, chemically / synthetically prepared) ATAACTCTATATA ATGTATGC TATACGAAGTTAT

SEQ. ID. NO 146: lanM2 (E. coli / H, sapiens, chemically / synthetically produced) ATAACTTCGTATA AGAAACCA TATACGAAGTTAT

SEQ. ID. NO 147: lanM3 (E. coli / H, sapiens, chemically / synthetically produced) ATAACTTCGTATA TAATACCA TATACGAAGTTAT

SEQ. ID. NO 148: lanM7 (E. coli / H, sapiens, chemically / synthetically produced) ATAACTTCGTATA AGATAGAA TATACGAAGTTAT

SEQ. ID. NO 149: lanM11 (E. coli / H, sapiens, chemically / synthetically produced) ATAACTTCGTATA CGATACCA TATACGAAGTTAT

SEQ. ID. NO 150: psiloxmod22 (Naturally occurring sequences in H. sapiens / M. musculus, analysis in E. coli / H, sapiens) ATAACTTCGTATA ATATATAA TATACGAAGTTAT SEQ. ID. NO 151: psiloxmodδ ((Naturally occurring sequences in H. sapiens / M. musculus, analysis in E. coli / H, sapiens) ATAACTTCGTATA TGCATATA TATACGAAGTTAT

SEQ. ID. NO 152: mockloxFASI (S. cerevisiae, chemically / synthetically produced)

TAAGCTTCGTATA TACCTTTC TATACGAAGTTGT

SEQ. ID. NO 153: Iox514 (E. coli, chemically / synthetically produced) ATAACTTCGTATA ATGTACGC TATACGAAGTTAT

SEQ. ID. NO 154: loxsym (E. coli, chemically / synthetically produced) ATAACTTCGTATA ATGTACAT TATACGAAGTTAT

SEQ. ID. NO 155: lox-psbA (Naturally occurring sequences in N. tabacum)

ATTCAACAGTATA ACATGACT TATATACTCGTGT

SEQ. ID. NO 156:! OxK2 (E. coli, chemically / synthetically produced) GATACAACGTATA TACCTTTC TATACGTTGTTTA

SEQ. ID. NO 157: hybrid IOXH / IOXP (analysis in E. coli, produced chemically / synthetically (hybrid IoxH / IoxP) or in H. sapiens occurring (loxH)) ATATATACGTATA ATGTATGC TATACGTATATAT

SEQ. ID. NO 158: loxH (analysis in E. coli, produced chemically / synthetically (hybrid IoxH / IoxP) or occurring in H. sapiens (loxH)) ATATATACGTATA TATGTCTA TATACGTATATAT SEQ. ID. NO 159: loxLTR (analysis in E. coli / H, sapiens, loxLTRI: naturally occurring in virus HIV-1, all others: chemically / synthetically produced) ACAACATCCTATT ACACCCTA TATGCCAACATGG

SEQ. ID. NO 160: loxLTRI (analysis in E. coli / H, sapiens, loxLTRI: naturally occurring in virus HIV-1, all others: chemically / synthetically produced) ACAACATCCTATT ACACCCTA AATAGGATGTTGT

SEQ. ID. NO 161: loxLTRI a (analysis in E. coli / H, sapiens, loxLTRI: naturally occurring in virus HIV-1, all others: chemically / synthetically produced) ACAACATCGTATA ACACCCTA TATACGATGTTGT

SEQ. ID. NO 162: loxLTRI b (analysis in E. coli / H, sapiens, loxLTRI: naturally occurring in virus HIV-1, all others: chemically / synthetically produced) ATAACTTCCTATT ACACCCTA AATAGGAAGTTAT

SEQ. ID. NO 163: loxLTR2 (analysis in E. coli / H, sapiens, loxLTRI: naturally occurring in virus HIV-1, all others: chemically / synthetically produced) CCATGTTGGCATA ACACCCTA TATGCCAACATGG

SEQ. ID. NO 164: loxLTR2a (analysis in E. coli / H, sapiens, loxLTRI: naturally occurring in virus HIV-1, all others: chemically / synthetically produced) CCATCTTCGTATA ACACCCTA TATACGAAGATGG SEQ. ID. NO 165: loxLTR2b (analysis in E. coli / H, sapiens, loxLTRI: naturally occurring in virus HIV-1, all others: chemically / synthetically produced) ATAAGTTGGCATA ACACCCTA TATGCCAACTTAT

SEQ. ID. NO 166: rox (analysis in E. coli, naturally occurring in bacteriophage D6) TAACTTTAAATAAT GCCA ATTATTTAAAGTTA

SEQ. ID. NO 167: FRT (occurring naturally in S. cerevisiae) GAAGTTCCTATAC TTTCTAGA GAATAGGAACTTC

SEQ. ID. NO 168: sch1

GAAGTTCCTATAC TATCTAGA GAATAGGAACTTC

SEQ. ID. NO 169: sch2

GAAGTTCCTATAC TAAGTAGA GAATAGGAACTTC

SEQ. ID. NO 170: sch3

GAAGTTCCTATAC TATTTGAA GAATAGGAACTTC

SEQ. ID. NO 171: sch4

GAAGTTCCTATAC CTTCTAGA GAATAGGAACTTC

SEQ. ID. NO 172: sh5

GAAGTTCCTATAC CTTTTGAA GAATAGGAACTTC

SEQ. ID. NO 173: FL-IL10A (analysis in E. coli, FL-IL10A and FL-IL10B: naturally occurring in H. sapiens, all others: chemically / synthetically produced)

AGTGATTTGATAC TTACATGA GTAAAGGAATTAG SEQ. ID. NO 174: FL-IL10B (analysis in E. coli, FL-IL10A and FL-IL10B: naturally occurring in H. sapiens, all others: chemically / synthetically produced)

TTGTTTCCTTCGC TTTGAAAA GGAGAAGTGGGAA

SEQ. ID. NO 175: FLRTB (I-8g) (analysis in E. coli, FL-ILIOA and FL-IL10B: naturally occurring in H. sapiens, all others: chemically / synthetically produced) GAAGTTCCTTCGC TTTGAAAA GGAGAAGTACTTC

SEQ. ID. NO 176: FLRTB (1-10g) (analysis in E. coli, FL-IL10A and FL-IL10B: naturally occurring in H. sapiens, all others: chemically / synthetically produced) GAATTTCCTTCGC TTTGAAAA GGAGAAGTGGTTC

SEQ. ID. NO 177: tetR-FRT

ATGATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGA GCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTC GCCCAGAAGCTTGGTGTAGAGCAGCCTACATTGTATTGGCATGTAA

AAAATAAGCGGGCCCTACTGGATGCGCTGGCGGTGGAGATCTTGG

CGCGTCATCATGATTATTCACTGCCTGCGGCGGGGGAATCTTGGC

AGTCATTTCTGCGCAATAATGCAATGAGTTTCCGCCGCGCGCTGCT

GCGTTACCGTGACGGGGCAAAAGTGCACCTCGGCACGCGTCCTGA

TGAAAAACAGTATGATACGGTGGAAACCCAGTTACGCTTTATGACA

GAAAACGGCTTTTCACTGCGCGACGGGTTATATGCGATTTCAGCGG

TCAGTCATΠTACCTTAGGTGCCGTACTGGAGCAGCAGGAGCATAC

TGCCGCCCTGACCGACCGCCCTGCATTGAAGTTCCTATACTTTCTA

GAGAATAGGAACTTCCCGCTATTGCGGGAAGCGCTGCAGATTATG

GACAGTGATGATGGTGAGCAGGCCTTTCTGCATGGCCTGGAGAGC

CTGATCCGGGGGTTTGAGGTGCAGCTTACGGCACTGTTGCAAATA

GTCTGA SEQ. ID. NO 178: tetR-lox72 / 1

ATGATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGA

GCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTC

GCCCAGAAGCTTGGTGTAGAGCAGCCTACATTGTATTGGCATGTAA

AAAATAAGCGGGCCCTACTGGATGCGCTGGCGGTGGAGATCTTGG

CGCGTCATCATGATTATTCACTGCCTGCGGCGGGGGAATCTTGGC

AGTCATTTCTGCGCAATAATGCAATGAGTTTCCGCCGCGCGCTGCT

GCGTTACCGTGACGGGGCAAAAGTGCACCTCGGCACGCGTCCTGA

TGAAAAACAGTATGATACGGTGGAAACCCAGTTACGCTTTATGACA

GAAAACGGCTTTTCACTGCGCGACGGGTTATATGCGATTTCAGCGG

TCAGTCATTTTACCTTAGGTGCCGTACTGGAGCAGCAGGAGCATAC

TGCCGCCCTGACCGACCGCCCTGCAGCCTACCGTTCGTATAGCAT

ACATTATACGAACGGTATCCCGCTATTGCGGGAAGCGCTGCAGATT

ATGGACAGTGATGATGGTGAGCAGGCCTTTCTGCATGGCCTGGAG

AGCCTGATCCGGGGGTTTGAGGTGCAGCTTACGGCACTGTTGCAA

ATAGTCTGA

SEQ. ID. NO 179: wt-tetR

ATGATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGA

GCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTC

GCCCAGAAGCTTGGTGTAGAGCAGCCTACATTGTATTGGCATGTAA

AAAATAAGCGGGCCCTACTGGATGCGCTGGCGGTGGAGATCTTGG

CGCGTCATCATGATTATTCACTGCCTGCGGCGGGGGAATCTTGGC

AGTCATTTCTGCGCAATAATGCAATGAGTTTCCGCCGCGCGCTGCT

GCGTTACCGTGACGGGGCAAAAGTGCACCTCGGCACGCGTCCTGA

TGAAAAACAGTATGATACGGTGGAAACCCAGTTACGCTTTATGACA

GAAAACGGCTTTTCACTGCGCGACGGGTTATATGCGATTTCAGCGG

TCAGTCATTTTACCTTAGGTGCCGTACTGGAGCAGCAGGAGCATAC

TGCCGCCCTGACCGACCGCCCTGCAGCACCGGACGAAAACCTGCC

GCCGCTATTGCGGGAAGCGCTGCAGATTATGGACAGTGATGATGG

TGAGCAGGCCTTTCTGCATGGCCTGGAGAGCCTGATCCGGGGGTT

TGAGGTGCAGCTTACGGCACTGTTGCAAATAGTCTGA

Claims

claims

1. Use of recognition sequences for site-specific recombinases, wherein the recognition sequences each contain two recombinase binding sequences, which are separated by a distance sequence, for the regulation, in particular activation, of a target gene in a genetic system.

2. Use according to claim 1, characterized in that two recognition sequences are provided for the regulation of the target gene.

3. Use according to claim 1 or 2, characterized in that for the regulation of the target gene two recognition sequences are provided which are separated from each other by a DNA sequence, in particular a gene or gene cassette sequence.

4. Use according to claim 3, characterized in that the DNA sequence is the sequence for a reporter or marker gene.

5. Use according to one of the preceding claims, characterized in that it is the wild type sequences in the recognition sequences.

6. Use according to any one of claims 1 to 4, characterized in that the recognition sequences are sequence mutants.

7. Use according to one of the preceding claims, characterized in that at least one binding sequence of the recognition sequences has mutations.

8. Use according to one of the preceding claims, characterized in that the spacing sequence has mutations.

9. Use according to one of the preceding claims, characterized in that the recognition sequences each have a length of 34 bp.

10. Use according to one of the preceding claims, characterized in that the binding sequences for the recombinase each have a length of 13 bp.

11. Use according to one of the preceding claims, characterized in that the binding sequences for the recombinases are palindromic sequences.

12. Use according to one of the preceding claims, characterized in that the spacing sequence has a length of 8 bp.

13. Use according to one of the preceding claims, characterized in that the recognition sequences are recognition sequences for recombinases from the group Cre recombinases, Flp recombinase, Fre recombinases, Tre recombinases and mutants thereof, preferably from the group Cre. Recombinases, Flp recombinases and mutants thereof.

14. Use according to one of the preceding claims, characterized in that it is in the Erkennungssequen- zen um / ox sequences, especially around / ox sequence mutants.

Use according to claim 14, characterized in that the / ox sequence mutants are / oxP sequence mutants.

16. Use according to one of the preceding claims, characterized in that the recognition sequences are at least one recognition sequence from the group SEQ ID NO: 1 to SEQ ID NO: 176 according to the attached sequence listing.

17. Use according to one of the preceding claims, characterized in that the genetic system is a prokaryotic system, preferably a bacterial cell.

18. Use of a site-specific recombination system, comprising Erkeππuπgssequenzen according to any one of the preceding claims and recombinases for the recognition sequences, for the regulation, in particular activation of a target gene in a genetic system.

19. A method of regulating, in particular activating, a target gene in a genetic system, comprising the following steps:

a) providing two recognition sequences for site-specific recombinases, the recognition sequences each containing two recombinase binding sequences separated by a spacer sequence, b) inserting the two recognition sequences into the target gene with disruption of the open reading frame of the target gene, c) expressing a site-specific recombinase for carrying out a recombination event, leaving a recognition sequence in the target gene and the remaining recognition sequence together with the target gene an open reading frame for expression of a Substantially active target gene product forms ..

20. Method according to claim 19, characterized in that the recognition sequences are provided by selection from a library of recognition sequences, in particular by selection from a library comprising the recognition sequences SEQ ID NO: 1 to SEQ ID NO: 176.

21. Process according to claim 19 or 20, characterized in that the recognition sequences are inserted into the target gene in the form of a recognition sequence-flanked DNA sequence, preferably in the form of a recognition sequence-flanked gene cassette sequence.

22. The method according to any one of claims 19 to 21, characterized in that the recombinase is expressed by transformation or transfection of the genetic system with a vector encoding the recombinase.