WO2010027370A1

WO2010027370A1 - Compositions and methods for the treatment of solid tumor cancers

Info

Publication number: WO2010027370A1
Application number: PCT/US2008/075761
Authority: WO
Inventors: Ronald J. Buckanovich
Original assignee: The Regents Of The University Of Michigan
Priority date: 2008-09-08
Filing date: 2008-09-10
Publication date: 2010-03-11
Also published as: WO2010027370A9

Abstract

The present invention relates to compositions and method for the treatment of solid tumor cancers. For example, the present invention provides therapeutic antibodies, including anti- CD52 immunoglobulin such as alemtuzumab, for the treatment and prevention solid tumor cancers, including ovarian cancer.

Description

COMPOSITIONS AND METHODS FOR THE TREATMENT OF SOLID TUMOR CANCERS

The present application claims priority to U.S. Provisional Application Serial Number 61/095,224, filed September 8, 2008, which is herein incorporated by reference.

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

Ovarian cancer is the fifth leading cause of cancer deaths in women, the leading cause of death from gynecological malignancy, and the second most commonly diagnosed gynecologic malignancy. The disease is more common in industrialized nations, with the exception of Japan. In the United States, females have a 1.4% to 2.5% (1 out of 40-60 women) lifetime chance of developing ovarian cancer. Older women are at highest risk. More than half of the deaths from ovarian cancer occur in women between 55 and 74 years of age and approximately one quarter of ovarian cancer deaths occur in women between 35 and 54 years of age.

Ovarian cancer is classified according to the histology of the tumor, obtained in a pathology report. Histology dictates many aspects of clinical treatment, management, and prognosis. Surface epithelial-stromal tumor, also known as ovarian epithelial carcinoma, is the most common type of ovarian cancer. It includes serous tumor, endometrioid tumor, and mucinous cystadenocarcinoma. Sex cord-stromal tumor, including estrogen-producing granulose cell tumor and virilizing SertoliOLeydig cell tumor or arrhenoblastoma, accounts for 8% of ovarian cancers. Germ cell tumor accounts for approximately 30% of ovarian tumors but only 5% of ovarian cancers. It tends to occur in young women and girls. The prognosis depends on the specific histology of germ cell tumor, but overall is favorable. Mixed tumors, containing elements of more than one of the above classes of tumor histology are also found. Ovarian cancer can also be a secondary cancer, the result of metastasis from a primary cancer elsewhere in the body. Common primary cancers are breast cancer and gastrointestinal cancer.

Ovarian cancer staging uses information obtained after surgery, which can include a total abdominal hysterectomy, removal of both ovaries and fallopian tubes, the omentum, and pelvic washings for cytology.

Stage I - limited to one or both ovaries

IA - involves one ovary; capsule intact; no tumor on ovarian surface; no malignant cells in ascites or peritoneal washings

IB - involves both ovaries; capsule intact; no tumor on ovarian surface; negative washings

IC - tumor limited to ovaries with any of the following: capsule ruptured, tumor on ovarian surface, positive washings

Stage II - pelvic extension or implants

IIA - extension or implants onto uterus or fallopian tube; negative washings IIB - extension or implants onto other pelvic structures; negative washings

IIC - pelvic extension or implants with positive peritoneal washings

Stage III - microscopic peritoneal implants outside of the pelvis; or limited to the pelvis with extension to the small bowel or omentum

IIIA - microscopic peritoneal metastases beyond pelvis IIIB - macroscopic peritoneal metastases beyond pelvis less than 2 cm in size

IIIC - peritoneal metastases beyond pelvis > 2 cm or lymph node metastases Stage IV - distant metastases to the liver or outside the peritoneal cavity

Treatments for ovarian cancer vary, but current treatments fall far short of those needed to manage the disease. Surgical treatment may be sufficient for malignant tumors that are well- differentiated and confined to the ovary. Addition of chemotherapy may be required for more aggressive tumors that are confined to the ovary. For patients with advanced disease a combination of surgical reduction with a combination chemotherapy regimen is standard. Chemotherapy has been a general standard of care for ovarian cancer for decades, although with highly variable protocols. Chemotherapy is used after surgery to treat any residual disease, if appropriate. This depends on the histology of the tumor. In some cases, there may be reason to perform chemotherapy first, followed by surgery. Ovarian cancer usually has a poor prognosis. It is disproportionately deadly because it lacks any clear early detection or screening test, meaning that most cases are not diagnosed until they have reached advanced stages. More than 60% of patients presenting with this cancer already have stage III or stage IV cancer, when it has already spread beyond the ovaries. Ovarian cancers shed cells into the naturally occurring fluid within the abdominal cavity. These cells can implant on other abdominal (peritoneal) structures. These cells can begin forming new tumor growths before cancer is even suspected. The 5 year survival rate for all stages is only 35% to 38%. If a diagnosis is made early in the disease, five-year survival rates can reach 90% to 98%.

New treatments for ovarian cancer are needed to treat the disease and prevent its spread and/or reoccurrence.

SUMMARY OF THE INVENTION

For example, in some embodiments, the present invention provides methods for treating a solid tumor cancer in a subject, comprising: administering an anti-CD52 immunoglobulin to a subject having a solid tumor. Subjects include humans, non-human mammals, and other animals. Typically, the subject is diagnosed as having one or more solid tumors. In some embodiments, the subject previously had a solid tumor and the therapy is administered to prevent reoccurrence or spread of cancer. The present invention is not limited by the type of solid tumor treated. However, in some embodiments, the solid tumor is a tumor of the ovary (e.g., associated with any stage of ovarian cancer). In some embodiments, the immunoglobulin is administered prior to, during, and/or following surgical removal of a tumor mass from the subject. The immunoglobulin therapy may be applied alone, or in combination with other therapies, including, but not limited to radiation or other chemotherapies (i.e., chemotherapies using a therapeutic agent other than the anti-CD52 immunoglobulin). In some embodiments, the anti- CD52 immunoglobulin comprises an antibody or a fragment thereof. In some embodiments, the anti-CD52 immunoglobulin is a monoclonal antibody. Commercially available anti-CD52 immunoglobulins may be used, including, but not limited to alemtuzumab, which is marketed as CAMPATH, MabCAMPATH, or CAMPATH-IH for treatment of chronic lyphocytic leukemia and T-cell lymphoma.

The present invention also provides methods for selecting and administering a therapy. Such methods may comprise testing a subject for the presence of a solid tumor. Upon identification of a solid tumor, the subject is administered an anti-CD52 immunoglobulin. In selecting the therapy, the treating physician may consider whether the solid tumor is of the type and stage suitable for use with the anti-CD52 immunoglobulin. In some embodiments, the treating physician selects the anti-CD52 immunoglobulin to target Tie2+ monocytes (e.g., vascular leukocytes that are CD45+, CD 14+ and VE-cadherin+) to regulate angiogenesis in the area of the solid tumor.

The present invention further provides methods for monitoring therapy, for example, to monitor the efficacy of the treatment or the progression (or lack thereof) of disease. In some embodiments, the method comprises: a) administering an anti-CD52 immunoglobulin to a subject having a solid tumor; and b) determining the presence of or amount of cancer or tumor growth at a time period after said administering (e.g., a day, two days, three days, four days, . . ., a week, . . ., a month, . . . a year, etc.).

The present invention further provides compositions (e.g., therapeutic compositions) useful in one or more the methods described herein. In some embodiments, the composition comprises an anti-CD52 immunoglobulin. In some embodiments, the composition further comprises a second agent useful in treating a solid tumor (e.g., an ovarian tumor), including, but not limited to platinum and taxane compounds (e.g., cisplatin, carboplatin, paclitaxel), "mustards" (e.g., melphalan), anthracyclines (e.g., doxorubicin), etoposide, hexamethylamine, 5- fluorouracil, leucovorin, and ifosfamide. The composition may further comprise additional agents that reduce the negative side effects of chemotherapy agents, including, but not limited to epoetin alfa (e.g., PROCRIT, EPOGEN, etc.) and amifostine. DESCRIPTION OF THE FIGURES

Figure 1 shows that VLCs express CD52. Fig. IA: RT-PCR demonstrating CD52 mRNA in 4 VLCs FACS isolated from 4 independent patient samples (NTC-no template control). Fig. IB: qRTPCR analysis of CD52 mRNA expression level in FACS isolated VLCs and tumor endothelial cells (TECs). Fig. 1C: FACS demonstrating purified VLCs express CD52 protein. Fig. ID. IF with anti-VE-Cadherin-PE and anti-CD52 FITC, arrows indicate CD52+/VE-Cadherin(-) lymphocytes. Figure 2 shows that VLCs are Tie2+ Monocytes.

Figure 3 shows Alemtuzumab as an anti-VLC anti-angiogenic. A) Complement mediated cytotoxicity assay of FACS isolated VLCs demonstrates Alemtuzumab in the presence of complement (Alemtuzumab (aka Campath) +sera) but not heat inactivated complement (Alemtuzumab+ Inactiv sera) induces cellular cytotoxicity as indicated by Annexin V and propidium iodide (PI) labeling. B) Complement mediated cytotoxicity assay in tumor ascites ex- vivo demonstrates (1) the addition of Alemtuzumab, but not heat inactivated (Inactiv) Alemtuzumab leads to a complete loss of CD45+/VE-Cadherin+ VLCs (shaded box). This is associated with an appropriate increase in the percent of Annexin V/ PI labeled cells (2).

Figure 4 shows anti-CD52 therapy restricts tumor growth. The impact of anti-CD52 antibody therapy was tested on ovarian tumor growth using the ID8-VEGF murine ovarian tumor model that has significant numbers of VLCs 10. Twice-weekly treatment of established tumors with CD52 therapy significantly reduced the number of tumor associated VLCs, and significantly restricted solid tumor growth throughout the course of therapy (p<0.05) (Fig 4A and data not shown). Elimination of VLCs was associated with a significant reduction in microvascular density (Fig 4B and C). This reduction in microvascular density correlated with a reduction in tumor perfusion density (Fig 4B and C).

DEFINITIONS

As used here, the term "antibody" is used in the broadest sense and specifically covers monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired biological activity. In certain embodiments, the antibodies of the present invention are directed toward CD52.

As used herein, the term "antibody fragments" refers to a portion of an intact antibody. Examples of antibody fragments include, but are not limited to, linear antibodies; single-chain antibody molecules; Fc or Fc' peptides, Fab and Fab fragments, and multispecific antibodies formed from antibody fragments. The antibody fragments preferably retain at least part of the hinge and optionally the CHl region of an IgG heavy chain. In other preferred embodiments, the antibody fragments comprise at least a portion of the CH2 region or the entire CH2 region. In certain embodiments, the antibody fragments of the present invention are directed toward CD52. As used herein, the term "functional fragment", when used in reference to a monoclonal antibody, is intended to refer to a portion of the monoclonal antibody which still retains a functional activity. A functional activity can be, for example, antigen binding activity or specificity. Monoclonal antibody functional fragments include, for example, individual heavy or light or light chains and fragments therof, such as VL, VH and Fd; monovalent fragments, such as Fv, Fab, and Fab'; bivalent fragments such as F(ab')2; single chain Fv (scFv); and Fc fragments. Such terms are described in, for example, Harlowe and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1989); Molec. Biology and Biotechnology: A Comprehensive Desk Reference (Myers, R.A. (ed.), New York: VCH Publisher, Inc.); Huston et al, Cell Biophysics, 22:189-224 (1993); Pluckthun and Skerra, Meth. Enzymol., 178:497-515 (1989) and in Day, E.D., Advanced Immunochemistry, Second Ed.,

Wiley-Liss, Inc., New York, NY (1990), all of which are herein incorporated by reference. The term functional fragment is intended to include, for example, fragments produced by protease digestion or reduction of a monoclonal antibody and by recombinant DNA methods known to those skilled in the art. As used herein, "humanized" forms of non-human (e.g., murine) antibodies are chimeric antibodies that contain minimal sequence, or no sequence, derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are generally made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a nonhuman immunoglobulin and all or substantially all of the FR residues are those of a human immunoglobulin sequence. The humanized antibody may also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Examples of methods used to generate humanized antibodies are described in U.S. Pat. 5,225,539 to Winter et al. (herein incorporated by reference). In certain embodiments, the present invention employs humanized anti-CD52 antibodies.

As used herein, the term "hypervariable region" refers to the amino acid residues of an antibody which are responsible for antigen-binding. The hypervariable region comprises amino acid residues from a "complementarity determining region" or "CDR" (i.e. residues 24-34 (Ll), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (Hl), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain; Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)) and/or those residues from a "hypervariable loop" (i.e. residues 26-32 (Ll), 50-52 (L2) and 91-96 (L3) in the light chain variable domain and 26-32 (Hl), 53-55 (H2) and 96-101 (H3) in the heavy chain variable domain; Chothia and Lesk J. MoI. Biol. 196: 901-917 (1987)). "Framework" or "FR" residues are those variable domain residues other than the hypervariable region residues as defined herein. In certain embodiments, the present invention employs derivatives of Alemtuzumab where one or more amino acids in the hypervariable region are changed (e.g., as compared to the amino acids shown in U.S. Pat. 5,846,534).

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to compositions and method for the treatment of ovarian cancer and other solid tumors. For example, the present invention provides therapeutic antibodies, including Alemtuzumab, for the treatment and prevention cancer.

1. Anti-CD52 (anti-CD W52) Agents In certain embodiments, the anti-CD52 antibody or antibody fragment employed by the present invention is Alemtuzumab or derivative or fragment thereof. Alemtuzumab is a humanized anti-CD52 monoclonal antibody. Alemtuzumab is currently used in the treatment of chronic lymphocytic leukemia (CLL) and T-cell lymphoma. Alemtuzumab targets CD52 (also known as CDW52 or Campath-1 antigen), a protein present on the surface of mature lymphocytes, but not on the stem cells from which these lymphocytes were derived. Alemtuzumab is also currently used in some conditioning regimens for bone marrow transplantation and kidney transplantation. It is also used under clinical trial protocols for treatment of some autoimmune diseases, such as multiple sclerosis. Alemtuzumab is commercially available from Genzyme under the trade names

CAMPATH, MABCAMPATH or CAMPTH-IH. Details about Alemtuzumab and derivatives of Alemtuzumab are provided in U.S. Patent Nos. 5,846,534 and 6,569,430, both of which are herein incorporated by reference in their entireties. One of skill in the art (e.g., in molecular immunology) can design additional derivatives to the anti-CD52 antibodies described in U.S. Patent Nos. 5,846,534 and 6,569,430. For example, using the knowledge of the CDR regions described in these patents, one could employ directed evolution methods to identify additional anti-CD52 antibodies with optimized properties compared to the parental/donor antibody in these patents using methods generally described in U.S. Pat. Pub. 20040162413 (herein incorporated by reference). Additional methods are known in the art to identify improved derivates of parental antibodies.

Dosages and methods of patient administration of Alemtuzumab and derivatives can be determined by a treating physician. In certain embodiments, the dosage and methods of administration for Alemtuzumab recommended by the manufacturer are employed. For example, in certain embodiments, such antibodies are administered to a human by an IV infusion over 2 hours. In particular embodiments, the dosage is escalated up to a dose of 30 mg/day three times per week. In other embodiments, the patient is premedicated with oral antihistamine and acetaminophen prior to dosing.

The present invention is not limited to the use of Alemtuzumab or its derivatives and instead finds use with other anti-CD52 agents. Additional anti-CD52 agents are described, for example, in the following publications and patents: WO06126068 to Patell; US20060018898 to Tone et al; US20070219133 to Lazar et al; U.S. Pat. 7,264,806 to Carr et al; CN1508155 to Jing et al.; and U.S. Pat. 5,644,036 to Ramage et al., all of which are herein incorporated by reference in their entireties.

The anti-CD52 binding agents of the present invention are not limited to antibodies or antibody fragments. In certain embodiments, small molecules are employed to bind CD52. In other embodiments, nucleic acid molecules (e.g., identified employing the SELEX procedure) are employed to bind CD52.

2. Exemplary Methods of Generating Anti-CD52 Antibodies

Described below are exemplary methods of generating anti-CD52 antibodies for use with the methods and systems of the present invention.

(i) Polyclonal Antibodies

The present invention provides polyclonal antibodies directed toward CD52 for use in the systems and methods of the present invention. Polyclonal antibodies are preferably raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the relevant antigen and an adjuvant. It may be useful to conjugate the CD52 protein or portion thereof to a protein that is immunogenic in the species to be immunized (e.g. keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean tyrpsin inhibitor) using a bifunctional or derivitizing agent (e.g. maleimidobenzoyl sulfosuccinimide ester for conjugation through cystein residues, N-hydroxysuccinimide for conjugation through lysine residues, glutaraldehyde, succinic anhydride, SOCl₂, or RlN=C=NR, where R and Rl are different alkyl groups.

Examples of a general immunization protocol for a rabbit and mouse are as follows. Animals are immunized against CD52, CD52-conjugates, or derivatives by combining, for example, 100 μg or 5 μg of the protein or conjugate (e.g. for a rabbit or mouse respectively) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermally at multiple sites. One month later the animals are boosted with 1/5 or 1/10 the original amount of peptide or conjugate in Freund's complete adjuvant by subcutaneous injection at multiple sites. Seven to fourteen days later the animals are bled and the serum is assayed for antibody titer. Animals are boosted until the titer plateaus. Preferably, the animal is boosted with the conjugate of the same antigen, but conjugated to a different protein and/or through a different cross-linking reagent. Conjugates also can be made in recombinant cell culture as protein fusions. In addition, aggregating agents such as alum are suitably used to enhance the immune response.

(H) Monoclonal antibodies The present invention provides monoclonal antibodies that are specifically directed to

CD52 for use in the systems and methods of the present invention. Monoclonal antibodies may be made in a number of ways, including using the hybridoma method (e.g. as described by Kohler et al., Nature, 256: 495, 1975, herein incorporated by reference), or by recombinant DNA methods (e.g., U. S. Patent No. 4,816,567, herein incorporated by reference). In the hybridoma method, a mouse or other appropriate host animal, such as a hamster or macaque monkey, is immunized to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to CD52. Alternatively, lymphocytes may be immunized in vitro. Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell. The hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells. For example, if the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT- deficient cells.

Preferred myeloma cells are those that fuse efficiently, support stable high-level production of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. Among these, preferred myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse tumors available from the SaIk Institute Cell Distribution Center, San Diego, California USA, and SP-2 or X63-Ag8-653 cells available from the American Type Culture Collection, Rockville, Maryland USA. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (e.g., Kozbor, J. Immunol., 133: 3001 (1984), herein incorporated by reference). Culture medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies directed against the antigen. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). After hybridoma cells are identified that produce antibodies of the desired specificity, affinity, and/or activity, the clones may be subcloned by limiting dilution procedures and grown by standard methods. Suitable culture media for this purpose include, for example, D-MEM or RPMI- 1640 medium. In addition, the hybridoma cells may be grown in vivo as ascites tumors in an animal. The monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

DNA encoding the monoclonal antibodies is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the monoclonal antibodies). The hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. Recombinant production of antibodies is described in more detail below. In some embodiments, antibodies or antibody fragments are isolated from antibody phage libraries generated using the techniques described in, for example, McCafferty et al., Nature,

348: 552554 (1990). Clackson et al., Nature, 352:624-628 (1991) and Marks et al., J. MoI. Biol, 222: 581-597 (1991) describe the isolation of murine and human antibodies, respectively, using phage libraries. Subsequent publications describe the production of high affinity (nM range) human antibodies by chain shuffling (Marks et. al., BioTechnology, 10: 779-783 (1992)), as well as combinatorial infection and in vivo recombination as a strategy for constructing very large phage libraries (e.g., Waterhouse et al., Nuc. Acids. Res., 21: 2265-2266 (1993)). Thus, these techniques, and similar techniques, are viable alternatives to traditional monoclonal antibody hybridoma techniques for isolation of monoclonal antibodies.

Also, the DNA may be modified, for example, by substituting the coding sequence for human heavy-and light-chain constant domains in place of the homologous murine sequences (e.g., U. S. Patent No. 4,816,567, and Morrison, et al., Proc. Nat. Acad. Sci USA, 81: 6851 (1984), both of which are hereby incorporated by reference), or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide.

Typically such non-immunoglobulin polypeptides are substituted for the constant domains of an antibody, or they are substituted for the variable domains of one antigen- combining site of an antibody to create a chimeric bivalent antibody comprising one antigen- combining site having specificity for an antigen and another antigen-combining site having specificity for a different antigen.

(Hi) Humanized and human antibodies

The present invention provides humanized and human antibodies directed toward CD52 for use in the methods and systems of the present invention. In certain embodiments, a humanized antibody comprises human antibody amino acid sequences together with amino acid residues that are not from a human antibody. In some embodiments, the human sequences in a humanized antibody comprise the framework regions (FRs) and the sequences or residues that are not from a human antibody comprise one or more complementarity-determining regions (CDRs).

The residues in a humanized antibody that are not from a human antibody may be residues or sequences imported from or derived from another species (including but not limited to mouse), or these sequences may be random amino acid sequences (e.g. generated from randomized nucleic acid sequences), which are inserted into the humanized antibody sequence. As noted above, the human amino acid sequences in a humanized antibody are preferably the framework regions, while the residues which are not from a human antibody (whether derived from another species or random amino acid sequences) preferably correspond to the CDRs. However, in some embodiments, one or more framework regions may contain one or more non- human amino acid residues. In cases of alterations or modifications {e.g. by introduction of a non-human residue) to an otherwise human framework, it is possible for the altered or modified framework region to be adjacent to a modified CDR from another species or a random CDR sequence, while in other embodiments, an altered framework region is not adjacent to an altered CDR sequence from another species or a random CDR sequence. In preferred embodiments, the framework sequences of a humanized antibody are entirely human (i.e. no framework changes are made to the human framework).

Non-human amino acid residues from another species, or a random sequence, are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essentially performed following the method of Winter and co-workers (e.g., Jones et al, Nature, 321: 522-525 (1986); Riechmann et al, Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988), all of which are hereby incorporated by reference), by substituting rodent (or other mammal) CDRs or CDR sequences for the corresponding sequences of a human antibody. Also, antibodies wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non- human species may also be generated (e.g. 4,816,567, hereby incorporated by reference). In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies, or, as noted above, in which CDR sequences have been substituted by random sequences. By way of non- limiting example only, methods for conferring donor CDR binding affinity onto an antibody acceptor variable region framework are described in WO 01/27160 Al, herein incorporated by reference.

3. Targeting Tie2+ Monocytes and Vascular Leukocytes (VLCs) for Cancer Therapy The present invention provides compositions and methods for treating cancer by targeting, for example, CD52 expressing Tie2+ monocytes and vascular leukocytes (VLCs) in a patient. While the present invention is not limited to any particular mechanism, and an understanding of the mechanism is not necessary to practice the present invention, it is believed that targeting Tie2+ monocyles and VLCs is effective for treating cancer as these cells are believed to play an important role in tumor angiogenesis and vascularization.

VLCs are cells that CD45+, CD 14+ and VE-Cadherin+ cells. VLCs have previously been reported as being present in ovarian cancer (see, e.g., Conejo-Garcia et al., Blood. 2005 Jan 15;105(2):679-81; Coukos et al., Br J Cancer. 2005 Apr 11 ;92(7): 1182-7; McLean et al., Transl Res. 2008 Feb;151(2):59-67; and Balint et al., Adv Exp Med Biol. 2008;622:273-80; all of which are herein incorporated by reference in their entireties. The present inventors have also observed VLCs in various solid tumors including breast, lung, and colon cancer. Similarly, Tie2+ monocytes have been reported in several solid tumor types including colorectal, breast, gastric, pancreatic, and lung carcinomas (Venneri et al., Blood. 2007 Jun 15;109(12):5276-85, herein incorporated by reference). While the exact developmental relationship between VLCs and Tie2+ monocytes remains unclear, they share numerous markers in common and appear pheno typically similar (see, McLean et al). The present inventors have further determined that VLCs are a subset of Tie2+ monocycytes as it was observed that 50-70% of VLCs are CD14+/Tie2+. As Alemtuzumab was effective at eliminating essentially 100% of VLCs (as shown in the Example below), this indicates that Alemtuzumab (and other anti-CD52 agents) are an effective therapy to target Tie2+ monocytes. As such, in certain embodiments, Alemtuzumab or other anti-CD52 is used to treat patients in order to target pro-angiogenic myeloid cells, such as VLCs or Tie2+ monocytes. The present invention is not limited to the type of cancer that is treated. In certain embodiments, any type of solid tumor cancer in treated. For example, in certain embodiments, the type of cancer is selected from ovarian cancer, breast cancer, lung cancer, colon cancer, colorectal cancer, gastric cancer, or pancreatic cancer.

4. Cancer Diagnostics Prior to or During Treatment with Anti-CD52 Agents

In certain embodiments, prior to (or during, or after) treatment with anti-CD52 agents or selection of an anti-CD52 agent for treatment, the patient or samples from the patient are subjected to diagnostic procedures in order to diagnose the presence of cancer, such as a solid tumor based cancer. In certain embodiments, the presence (or amount) of Tie2+ cells in or near the tumor of a patient is determined prior to treatment with an anti-CD52 agent. Exemplary methods of diagnosing the presence of such cells are found in U.S. Pat. Pub. 20080057043 to Naldini et al., which is herein incorporated by reference in its entirety. In other embodiments, the presence or amount of Tie2+ cells in or near a patient tumor is determined during or after therapy with an anti-CD52 agent in order to monitor the effectiveness of such therapy. In other embodiments, the presence of VLCs in or near a tumor of a patient prior to, or during, or after, therapy with anti-CD52 agents is determined. In some embodiments, single markers or combinations of markers, such as CD45, CD 14 and VE-Cadherin are employed to determine the presence or amount of VLCs (e.g., as VLCs are CD45+, CD14+, and VE-Cadherin+). In certain embodiments, techniques such as flow cytometry and FACS are employed for such diagnostics (e.g., employing anti-Tie2, anti-CD45, anti-CD14, and/or anti-VE-Cadherein antibodies).

5. Therapeutic Formulations and Uses

In some embodiments, the present invention provides therapeutic formulations comprising anti-CD52 agents (e.g., anti-CD52 antibodies). It is not intended that the present invention be limited by the particular nature of the therapeutic composition. For example, such compositions can include an anti-CD52 agent, provided together with physiologically tolerable liquids, gels, solid carriers, diluents, adjuvants and excipients, and combinations thereof (See, e.g, Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980), herein incorporated by reference).

In addition, anti-CD52 agents may be used together with other therapeutic agents, including, but not limited to, salicylates, steroids, immunosuppressants, antibodies or antibiotics. Particular therapeutic agents which may be used with the anti-CD52 agents of the present invention include, but are not limited to, the following agents: azobenzene compounds (US Pat. No. 4,312,806, incorporated herein by reference), benzyl-substituted rhodamine derivatives (US Pat. No. 5,216,002, incorporated herein by reference), zinc L-carnosine salts (US Pat. No. 5,238,931, incorporated herein by reference), 3-phenyl-5-carboxypyrazoles and isothiazoles (US Pat. No. 5,294,630, incorporated herein by reference), IL-10 (US Pat. No. 5,368,854, incorporated herein by reference), quinoline leukotriene synthesis inhibitors (US Pat. No. 5,391,555, incorporated herein by reference), 2'-halo-2'deoxy adenosine (US Pat. No. 5,506,213, incorporated herein by reference), phenol and benzamide compounds (US Pat. No. 5,552,439, incorporated herein by reference), tributyrin (US Pat. No. 5,569,680, incorporated herein by reference), certain peptides (US Pat. No. 5,756,449, incorporated herein by reference), omega-3 polyunsaturated acids (US Pat. No. 5,792,795, incorporated herein by reference), VLA-4 blockers (US Pat. No. 5,932,214, incorporated herein by reference), prednisolone metasulphobenzoate (US Pat. No. 5,834,021, incorporated herein by reference), cytokine restraining agents (US Pat. No. 5,888,969, incorporated herein by reference), and nicotine (US Pat. No. 5,889,028, incorporated herein by reference). Anti-CD52 agents may be used together with agents which reduce the viability or proliferative potential of a cell. Agents which reduce the viability or proliferative potential of a cell can function in a variety of ways including, for example, inhibiting DNA synthesis, inhibiting cell division, inducing apoptosis, or inducing non-apoptotic cell killing. Specific examples of cytotoxic and cytostatic agents, include but are not limited to, pokeweed antiviral protein, abrin, ricin, and each of their A chains, doxorubicin, cisplastin, iodine-131, yttrium-90, rhenium-188, bismuth-212, taxol, 5-fluorouracil VP- 16, bleomycin, methotrexate, vindesine, adriamycin, vincristine, vinblastine, BCNU, mitomycin and cyclophosphamide and certain cytokines such as TNF-α and TNF-β. Thus, cytotoxic or cytostatic agents can include, for example, radionuclides, chemotherapeutic drugs, proteins, and lectins.

Therapeutic compositions may contain, for example, such normally employed additives as binders, fillers, carriers, preservatives, stabilizing agents, emulsifiers, buffers and excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. These compositions typically contain l%-95% of active ingredient, preferably 2%-70% active ingredient.

The anti-CD52 agents of the present invention can also be mixed with diluents or excipients which are compatible and physiologically tolerable. Suitable diluents and excipients are, for example, water, saline, dextrose, glycerol, or the like, and combinations thereof. In addition, if desired, the compositions may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, stabilizing or pH buffering agents.

In some embodiments, the therapeutic compositions of the present invention are prepared either as liquid solutions or suspensions, as sprays, or in solid forms. Oral formulations usually include such normally employed additives such as binders, fillers, carriers, preservatives, stabilizing agents, emulsifiers, buffers and excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations, or powders, and typically contain l%-95% of active ingredient, preferably 2%-70%. One example of an oral composition useful for delivering the therapeutic compositions of the present invention is described in US Pat. No. 5,643,602 (incorporated herein by reference). Additional formulations which are suitable for other modes of administration, such as topical administration, include salves, tinctures, creams, lotions, transdermal patches, and suppositories. For salves and creams, traditional binders, carriers and excipients may include, for example, polyalkylene glycols or triglycerides. One example of a topical delivery method is described in U.S. Pat. No. 5,834,016 (incorporated herein by reference). Other liposomal delivery methods may also be employed (See, e.g., US Pat. Nos. 5,851,548 and 5,711,964, both of which are herein incorporated by reference).

The formulations may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.

Sustained-release preparations may also be prepared. Suitable examples of sustained release preparations include semipermeable matrices of solid hydrophobic polymers containing the polypeptide variant, which matrices are in the form of shaped articles, e.g., films, or microcapsule. Examples of sustained-release matrices include, but are not limited to, polyesters, hydrogels (for example, poly (2-hydroxyethyl-methacrylate), or poly (vinylalcohol)), polylactides, copolymers of L-glutamic acid and y ethyl-L-glutamate, non-degradable ethylene- vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D- (-)-3-hydroxybutyric acid. While polymers such as ethylene -vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.

The anti-CD52 agents of the present invention may be administered by any suitable means, including parenteral, subcutaneous, topical, intraperitoneal, intrapulmonary, and intranasal, and, intralesional administration (e.g. for local immunosuppressive treatment). Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In certain embodiments, the dosing is given by injections, most preferably intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic. For the prevention or treatment of disease, the appropriate dosage of the anti-CD52 antibodies will depend on the type of disease to be treated, the severity and course of the disease, whether the anti-CD52 agent is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the anti-CD52 agent, and the discretion of the attending physician. The anti-CD52 agent is suitably administered to the patient at one time or over a series of treatments. For example, depending on the type and severity of the disease, about 1 ug/kg to 15 mg/kg (e.g., 30 mg/day for an average person) of anti-CD52 agent is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion. A typical daily dosage might range from about 1 ug/kg to 100 mg/kg or more, depending on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until the symptoms are sufficiently reduced or eliminated. The progress of this therapy can be monitored by conventional techniques and assays, and may be used to adjust dosage to achieve a therapeutic effect.

EXAMPLES

Detailed below are exemplary embodiments of the present invention. These embodiments are not to be construed as limiting the scope of the present invention.

EXAMPLE 1

Targeting VLCs with an Anti-CD52 Antibody

This Example describes determining that VLCs can be successfully targeted with an anti- CD52 antibody.

Materials and Methods:

Characterization of VLCs: CD45+/VE-Cadherin+/CD146+ VLCs were FACS isolated from freshly obtained ovarian tumors as previously described¹⁴. Tissue procurement procedures were approved by the University of Michigan institutional review board and human participants gave written informed consent. Quantitative RT PCR was performed using SYBRgreen (Applied Biosystems) using primers: 5' primer: CTTCCTCCT ACTC ACCAT CAGC (SEQ ID NO:1), and 3 'primer: CCACGAAGAAAAGGAAAATGC (SEQ ID NO:2). Immunohistochemistry was performed on fresh frozen acetone fixed tissue using an anti- CD52 antibody (1:100 GeneTex, Inc) anti-VE-Cadherin FITC antibody (1:200 Bender MedSystems) and anti-CD31 (1:800 BD Pharmingen).

Complement-mediated Cytotoxicity: FACS isolated VLCs cells were incubated with lOug/ml of Alemtuzumab (Genzyme) for thirty minutes. Isolated VLCs were washed and incubated with 10% human serum or heat inactivated serum at 37 C for one hour. Cells were then stained with Annexin-FITC (BD Pharmingen) and propidium-iodide (BD Pharmingen) per manufacturer's protocol. Whole ascites cells were incubated with Alemtuzumab or heat inactivated Alemtuzumab for 90 minutes and then labeled with CD45-APC (BD Pharmingen) and VE-Cadherin-PE (eBioscience) or Annexin-FITC and propidium-iodide.

Tumor Treatment: Anti-CD52 antibodies were biotinylated per protocol (Pierce). Biotinylation was confirmed using FACS and strepavidin-PE conjugate (BD Pharmingen). Biotinylated antibody was then conjugated with streptavidin-saporin. 2ug/ml anti-CD52-saporin conjugate was incubated with isolated ascites associated cells for 36 hours in vitro and cytotoxicity confirmed by trypan blue and FACS staining (data not shown). 10x10 6th ID8 VEGF cells were injected into the flanks or peritoneum of C57BL6 mice and the tumors were allowed to grow for two weeks. The animals were treated with 2 μg of anti-CD52-saporin immunotoxin or rat-IgG-saporin (n=5 and n=10 per group in two independent experiments) twice-weekly for two weeks. Ascites was assessed for CD52+ cells 36 hours after treatment to confirm in vivo cytotoxicity. At the time of sacrifice a subset of animals were perfused with biotinylated lycopersicon esculentum lectin.

Results:

VLCs express CD52 which is the target of the immunotherapeutic Alemtuzumab. In order to determine if ovarian cancer associated VLCs express the CD52 antigen, RNA was isolated from CD45(+)/VE-Cadherin+/CD146+ VLCs FACS isolated from 4 independent ovarian cancer specimens. RT-PCR and qRT-PCR revealed CD52 mRNA expression in all four VLCs specimens (Fig. IA and B). No CD52 expression was detected in CD45(-)/VE-

Cadherin+/CD146+ tumor endothelial cells (TECs). FACS confirmed CD52 protein expression on greater than 90% of VLCs (range 88-98%, Fig 1C). The level of expression was similar to that seen on B cells (data not shown). CD52 was not expressed on TECs or tumor cells (data not shown). Co-immunofluorescence identified large CD52+ VE-Cadherin+ cells primarily in a perivascular location and in ovarian tumor stroma, similar to that reported for Tie+ monocytes. Small CD52+/VECadherin(-) cells, consistent with tumor infiltrating lymphocytes, were also observed (Figure ID). CD52 was not detected in the tumor endothelium or tumor cells consistent with the RT-PCR and flow cytometry data. These results confirm the expression of the CD52 antigen on VLCs.

VLCs are a subset ofTie2+ monocytes

It has been previously reported that VLCs were CD 14+ cells which express numerous endothelial markers. More recent studies have reported a population of CD14+ cells expressing the vascular marker Tie2 (Tie2+ Monocytes). Like VLCs, Tie2+ Monocytes were found to be rare in normal tissue but increased in number in tumors. Tie2 monocytes were reported to be present in low numbers in the peripheral blood of cancer patients. FACS analysis was performed to determine if VLCs express Tie2. FACS demonstrated that -90% of VLCs are Tie2+ and CD 14+ Fig (2). As expected CD45(-)/VE-Cadherin+ tumor endothelial cells were also Tie2+ /CD14(-). Reciprocal staining demonstrates that CD14+/Tie2+ cells are at least 50% VE-Cadherin+. Finally, FACS demonstrates that Tie2+ monocytes express CD52. These data suggest that VLCs are a subset of Tie2+ monocytes and that Tie2+ monocytes express CD52 and therefore Alemtuzumab could also be used, in certain embodiments, as a therapeutic to target Tie2 monocytes.

Alemtuzumab induces complement mediated lysis of VLCs in vitro and ex vivo in tumor ascites.

Alemtuzumab has been shown to induce death of CD52 expressing cells by complement mediated cytotoxicity 15-17. It was then determined if Alemtuzumab could induce complement mediated cellular cytotoxicity of isolated VLCs. In the absence of Alemtuzumab, -90% of purified VLCs are viable (Fig 3A(I) and data not shown). The addition of Alemtuzumab and human serum (complement source) to isolated VLCs in vitro lead to the induction of apoptosis and cell death, as defined by Annexin V and propidium iodide staining, in nearly 100% (range 76-99%) of VLCs (Fig 3A(2)). Consistent with complement mediated cytotoxicity, heat inactivation of the sera lead to a loss of Alemtuzumab's cytotoxic activity.

As the tumor microenvironment can be immunosuppressive and express complement inhibitors, it was next sought to ascertain the ability of Alemtuzumab to kill VLCs within the tumor milieu. Alemtuzumab was added to freshly isolated tumor ascites and ascites associated cells ex- vivo. Addition of Alemtuzumab, in contrast to heat inactivated Alemtuzumab, eliminated essentially all detectable VLCs (Fig 3B (I)). This was associated with a proportionate increase in detectable apoptotic cells (Fig 3B(2)). This indicates that Alemtuzumab can induce complemented-mediated cytotoxicity of VLCs even within the tumor milieu.

Anti-CD52 therapy restricts tumor growth in a murine model of ovarian cancer. Finally, the impact of anti-CD52 antibody therapy was tested on ovarian tumor growth using the ID8-VEGF murine ovarian tumor model that has significant numbers of VLCs 10. Twice-weekly treatment of established tumors with CD52 therapy significantly reduced the number of tumor associated VLCs, and significantly restricted solid tumor growth throughout the course of therapy (p<0.05) (Fig 4A and data not shown). Elimination of VLCs was associated with a significant reduction in microvascular density (Fig 4B and C). This reduction in microvascular density correlated with a reduction in tumor perfusion density (Fig 4B and C).

REFERENCES 1. McLean K, Buckanovich RJ. Myeloid cells functioning in tumor vascularization as a novel therapeutic target. Translational Research: The Journal Of Laboratory & Clinical Medicine. 2008; 151 :59-67.

2. Seandel M, Butler J, Lyden D, Rafii S. A catalytic role for proangiogenic marrow-derived cells in tumor neovascularization. Cancer Cell. 2008; 13: 181- 183.

3. Yang L, DeBusk LM, Fukuda K, et al. Expansion of myeloid immune suppressor Gr+CDl lb+ cells in tumor-bearing host directly promotes tumor angiogenesis. Cancer Cell. 2004;6:409-421.

4. Rajantie I, Ilmonen M, Alminaite A, Ozerdem U, Alitalo K, Salven P. Adult bone marrow-derived cells recruited during angiogenesis comprise precursors for periendothelial vascular mural cells. Blood. 2004; 104:2084-2086.

5. Shojaei F, Wu X, Malik AK, et al. Tumor refractoriness to anti-VEGF treatment is mediated by CDl lb+Grl+ myeloid cells. Nat Biotechnol. 2007;25:911-920.

6. Lewis CE, De Palma M, Naldini L. Tie2-expressing monocytes and tumor angiogenesis: regulation by hypoxia and angiopoietin-2. Cancer Res. 2007;67:8429-8432. 7. Du R, Lu KV, Petritsch C, et al. HIFl alpha induces the recruitment of bone marrow-derived vascular modulatory cells to regulate tumor angiogenesis and invasion. Cancer Cell. 2008; 13:206-220.

8. Ahn GO, Brown JM. Matrix metalloproteinase-9 is required for tumor vasculogenesis but not for angiogenesis: role of bone marrow-derived myelomonocytic cells. Cancer Cell. 2008; 13: 193-205.

9. De Palma M, Naldini L. Role of haematopoietic cells and endothelial progenitors in tumour angiogenesis. Biochim Biophys Acta. 2006;1766:159-166.

10. Conejo-Garcia JR, Benencia F, Courreges MC, et al. Tumor-infiltrating dendritic cell precursors recruited by a beta-defensin contribute to vasculogenesis under the influence of Vegf-A. Nat Med. 2004; 10:950-958.

11. Conejo-Garcia JR, Buckanovich RJ, Benencia F, et al. Vascular leukocytes contribute to tumor vascularization. Blood. 2005;105:679-681.

12. Coukos G, Conejo-Garcia JR, Buckanovich R, et al. Vascular leukocytes: a population with angiogenic and immunossuppressive properties highly represented in ovarian cancer. Advances in Experimental Medicine & Biology. 2007;590: 185-193.

13. Bak SP, Walters JJ, Takeya M, Conejo-Garcia JR, Berwin BL. Scavenger receptor- A-targeted leukocyte depletion inhibits peritoneal ovarian tumor progression. Cancer Res. 2007;67:4783-4789.

14. Buckanovich RJ, Sasaroli D, O'Brien- Jenkins A, et al. Use of immuno-LCM to identify the in situ expression profile of cellular constituents of the tumor microenvironment. Cancer Biol Ther. 2006;5:635-642. 15. Nuckel H, Frey UH, Roth A, Duhrsen U, Siffert W. Alemtuzumab induces enhanced apoptosis in vitro in B-cells from patients with chronic lymphocytic leukemia by antibody-dependent cellular cytotoxicity. European Journal of Pharmacology. 2005;514:217-224. 16. Zent CS, Kay NE. Update on monoclonal antibody therapy in chronic lymphocytic leukemia. Clinical Advances in Hematology & Oncology. 2004;2:107-l 13.

17. Zent CS, Chen JB, Kurten RC, Kaushal GP, Marie Lacy H, Schichman SA. Alemtuzumab (ALEMTUZUMAB IH) does not kill chronic lymphocytic leukemia cells in serum free medium. Leukemia Research. 2004;28:495-507. 18. Venneri MA, Palma MD, Ponzoni M, et al. Identification of proangiogenic TIE2- expressing monocytes (TEMs) in human peripheral blood and cancer. Blood. 2007; 109:5276-5285.

All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in relevant fields are intended to be within the scope of the following claims.

Claims

We claim:

L A method for treating a solid tumor cancer in a subject, comprising: administering an anti-CD52 immunoglobulin to a subject having a solid tumor.

2. The method of claim 1 , wherein said solid tumor is an organ tumor.

3. The method of claim 2, wherein said solid tumor comprises a tumor of the ovary.

4. The method of claim 1 , wherein said immunoglobulin is administered to said subject following surgical removal of a tumor mass from the subject.

5. The method of claim 1 , wherein said immunoglobulin is administered to said subject prior to surgical removal of a tumor mass from the subject.

6. The method of claim 1, wherein said subject is further administered a second anticancer therapy.

7. The method of claim 4, wherein said second anti-cancer therapy is selected from the group consisting of radiation and a chemotherapy that is not treatment with an anti-CD52 immuno globulin .

8. The method of claim 1, wherein said anti-CD52 immunoglobulin is an antibody.

9. The method of claim 8, wherein said antibody is a monoclonal antibody.

10. The method of claim 1 , wherein said anti-CD52 immunoglobulin is alemtuzumab.

11. A method for selecting and administering a therapy, comprising: a) testing a subject for the presence of a solid tumor; b) administering an anti-CD52 immunoglobulin to a subject if a solid tumor is present in the subject.

12. The method of claim 1 1, wherein said solid tumor is a tumor of the ovary.

13. The method of claim 11 , wherein said immunoglobulin is administered to said subject following surgical removal of said solid tumor from the subject.

14. The method of claim 11 , wherein said immunoglobulin is administered to said subject prior to surgical removal of said solid tumor from the subject.

15. The method of claim 1 1, wherein said subject is further administered a second anti-cancer therapy.

16. The method of claim 15, wherein said second anti-cancer therapy is selected from the group consisting of radiation and a chemotherapy that is not treatment with an anti-CD52 immuno globulin .

17. The method of claim 11 , wherein said anti-CD52 immunoglobulin is an antibody.

18. The method of claim 17, wherein said antibody is a monoclonal antibody.

19. The method of claim 11 , wherein said anti-CD52 immunoglobulin is alemtuzumab.

20. A method of monitoring therapy comprising: a) administering an anti-CD52 immunoglobulin to a subject having a solid tumor; and b) determining the presence of or amount of cancer or tumor growth at a time period after said administering.

21. The method of claim 20, wherein said solid tumor is a tumor of the ovary.

22. The method of claim 20, wherein said anti-CD52 immunoglobulin is an antibody.

23. The method of claim 22, wherein said antibody is a monoclonal antibody.

24. The method of claim 20, wherein said anti-CD52 immunoglobulin is alemtuzumab.