NZ711060B2 - Combination therapy involving antibodies against claudin 18.2 for treatment of cancer - Google Patents

Abstract

The present invention provides a combination therapy for effectively treating and/or preventing diseases associated with cells expressing CLDN18.2, including cancer diseases such as pancreatic cancer and metastases thereof.

Description

COMBINATION THERAPY INVOLVING ANTIBODIES AGAINST CLAUDIN 18.2 FOR TREATMENT OF CANCER Pancreatic cancer is one of the most lethal cancers. The ity approaches 100% because of the propensity for early metastatic spread, and because the disease is highly ant to radiation and chemotherapy. Given that 27,000 new cases are sed every year in North America and 68 000 in Europe there is an urgent need to develop novel treatment strategies to reduce the ity of pancreatic cancer patients.

The tight junction molecule Claudin 18 splice variant 2 (Claudin 18.2 (CLDN18.2)) is a member of the claudin family of tight junction proteins. CLDN18.2 is a 27.8 kDa transmembrane protein comprising four membrane spanning s with two small extracellular loops. In normal tissues there is no detectable expression of CLDN18.2 by RTPCR with exception of stomach. Immunohistochemistry with CLDN18.2 specific antibodies reveals h as the only positive tissue. CLDN18.2 is a highly selective c lineage antigen expressed exclusively on short-lived differentiated gastric epithelial cells. CLDN18.2 is maintained in the course of malignant transformation and thus frequently displayed on the surface of human c cancer cells. Moreover, this pan-tumoral antigen is cally activated at significant levels in esophageal, pancreatic and lung adenocarcinomas.

The chimeric IgGl antibody IMAB362 which is directed t CLDN18.2 has been developed by Ganymed Pharmaceuticals AG. IMAB362 recognizes the first extracellular domain (ECD1) of CLDN18.2 with high affinity and icity. IMAB362 does not bind to any other claudin family member including the closely related splice t 1 of Claudin 18 (CLDN18.1). IMAB362 shows precise tumor cell specificity and bundles four independent highly potent mechanisms of action. Upon target binding IMAB362 mediates cell killing by ADCC, CDC and induction of apoptosis induced by cross linking of the target at the tumor cell surface and direct tion of proliferation. Thus, IMAB362 lyses efficiently CLDN 18.2-positive cells, including human gastric cancer cell lines in vitro and in vivo.

The toxicity and PK/TK profile of IMAB362 has been thoroughly examined in mice and cynomolgus monkeys including dose range finding studies, 28-day repeated dose toxicity studies in cynomolgus and a 3-month repeated dose ty study in mice. In both mice st treatment duration weekly administration for 3 months, highest dose levels 400 mg/kg) and cynomolgus monkeys (up to 5 weekly applications of up to 100 mg/kg) ed doses of IMAB362 i.v. are well tolerated. No signs of systemic or local toxicity are induced. ically, no gastric toxicity has been observed in any toxicity study. IMAB362 does not induce immune activation and cytokine release. No adverse effects on male or female uctive organs were recorded. IMAB362 does not bind to s lacking the target. tribution studies in mice indicate that the reason for lack of gastric toxicity is most likely compartimentalization of tight junctions at the luminal site in healthy gastric epithelia, which appears to impair accessibility of the IMAB362 epitope profoundly.

IMAB362 is in early clinical testing. A phase I clinical study has been conducted in human. 5 dose s (33 mg/m2, 100 mg/m2, 300 mg/m2, 600 mg/m2, 1000 mg/m2) of 3 patients each have received a single intravenous administration of IMAB362 and have been observed for 28 days. 2 was very well tolerated, with no relevant safety observation in the patients. In one patient all measured tumor markers decreased significantly within 4 weeks after treatment. In an g phase Ila clinical study IMAB362 is given repetitively.

Here we present data demonstrating that chemotherapeutic agents can stabilize or increase expression of CLDN18.2 on the surface of pancreatic cancer cells resulting in an enhanced drugability of .2 by an anti-CLDN18.2 antibody such as IMAB362. A synergistic effect of an anti-CLDN18.2 antibody such as IMAB362 with particular chemotherapeutic regimens, in particular chemotherapeutic regimens used for pancreatic cancer treatment was ed. Human cancer cells pre-treated with chemotherapy are more susceptible to dy-induced target-specific killing. In mouse tumor models, tumor control with an anti- CLDN18.2 antibody plus chemotherapy is superior to that with an anti-CLDN18.2 antibody as single agent.

SUMMARY OF THE INVENTION The present invention generally provides a combination therapy for effectively treating and/or preventing diseases associated with cells expressing CLDN18.2, including cancer diseases such as gastric cancer, esophageal , pancreatic cancer, lung cancer such as non small cell lung cancer (NSCLC), ovarian cancer, colon cancer, hepatic , head-neck cancer, and cancer of the gallbladder and metastases thereof, in particular gastric cancer metastasis such as Krukenberg tumors, peritoneal metastasis and lymph node metastasis. Particularly preferred cancer diseases are atic cancer and the metastases thereof.

In one aspect, the present invention provides a method of treating or preventing pancreatic cancer in a patient sing administering to the patient (i) an antibody having the ability of g to CLDN18.2 and (ii) an agent stabilizing or increasing expression, i.e. the level, of CLDN18.2. Expression of CLDN18.2 is ably at the cell surface of a cancer cell. The agent stabilizing or increasing expression of CLDN18.2 may be administered prior to, simultanously with or following stration of the antibody having the ability of binding to CLDN18.2, or a ation thereof.

The agent stabilizing or increasing expression of .2 may be a xic and/or cytostatic agent. In one embodiment, the agent stabilizing or increasing expression of CLDN18.2 comprises an agent which induces a cell cycle arrest or an accumulation of cells in one or more phases of the cell cycle, preferably in one or more phases of the cell cycle other than the Gl -phase such as the S-phase, G2-phase, or a combination thereof or a combination of the S-phase or the G2-phase with the Gl -phase. The agent izing or increasing expression of CLDN18.2 may se an agent ed from the group consisting of nucleoside analogs, platinum compounds, camptothecin analogs and taxanes, prodrugs thereof, salts thereof, and combinations thereof. The nucleoside analog may be ed from the group consisting of gemcitabine, 5-fluorouracil, gs thereof and salts thereof. The platinum compound may selected from the group consisting of oxaliplatin, cisplatin, prodrugs thereof and salts thereof. The camptothecin analog may be selected from the group consisting of irinotecan, topotecan, prodrugs thereof and salts thereof. The taxane may be selected from the group consisting of paclitaxel, docetaxel, prodrugs f and salts thereof. The agent stabilizing or increasing expression of CLDN18.2 may comprise an agent selected from the group consisting of abine, 5-fluorouracil, oxaliplatin, irinotecan, paclitaxel, prodrugs thereof, salts thereof and combinations thereof. The agent stabilizing or increasing expression of CLDN18.2 may se a combination of oxaliplatin and 5-fluorouracil or prodrugs thereof, a combination of cisplatin and 5-fluorouracil or prodrugs f, a combination of at least one taxane and oxaliplatin, a combination of at least one taxane and cisplatin, a combination of at least one taxane and 5-fluorouracil or prodrugs thereof, or a combination of at least one camptothecin analog and 5-fluorouracil or prodrugs thereof. The agent stabilizing or increasing expression of CLDN18.2 may comprise a combination of gemcitabine and oxaliplatin, a combination of gemcitabine and cisplatin, a combination of gemcitabine and carboplatin or a combination of oxaliplatin, 5-fluorouracil or prodrugs thereof and irinotecan.

Accordingly, the method of the invention may se administering a combination of abine and oxaliplatin, a combination of gemcitabine and cisplatin, a combination of gemcitabine and carboplatin or a combination of oxaliplatin, 5-fluorouracil or prodrugs thereof and irinotecan. In one embodiment, the method of the invention comprises administering c acid, rouracil or prodrugs f, irinotecan and oxaliplatin. The agent stabilizing or increasing expression of CLDN18.2 may se an agent inducing immunogenic cell death. The agent ng immunogenic cell death may comprise oxaliplatin.

In a further aspect, the present invention es a method of treating or preventing cancer in a patient comprising administering to the patient (i) an antibody having the ability of binding to CLDN18.2 and (ii) gemcitabine. In one embodiment, the cancer is selected from the group ting of c cancer, esophageal cancer, pancreatic cancer, lung , ovarian cancer, colon cancer, hepatic cancer, head-neck cancer, cancer of the gallbladder and the metastasis thereof. The cancer disease may be a Krukenberg tumor, peritoneal metastasis and/or lymph node metastasis. In one embodiment, the cancer is an adenocarcinoma, in particular an advanced adenocarcinoma. In one embodiment, the cancer is pancreatic cancer.

In one embodiment, the method of the invention r comprises administering an agent stimulating gd T cells. In one ment, the g d T cells are Vy9V62 T cells. In one embodiment, the agent stimulating gd T cells is a bisphosphonate such as a nitrogen- containing bisphosphonate (aminobisphosphonate). In one embodiment, the agent stimulating gd T cells is selected from the group consisting of zoledronic acid, clodronic acid, ibandronic acid, pamidronic acid, risedronic acid, minodronic acid, olpadronic acid, alendronic acid, incadronic acid and salts thereof. In one embodiment, the agent stimulating gd T cells is administered in combination with interleukin-2.

The method of the ion may r comprise administering at least one further chemotherapeutic agent which may be a cytotoxic agent.

The antibody having the ability of binding to CLDN18.2 may bind to native epitopes of CLDN18.2 present on the surface of living cells. In one embodiment, the antibody having the ability of binding to CLDN18.2 binds to the first extracellular loop of CLDN18.2. In one embodiment, the antibody having the ability of binding to CLDN18.2 mediates cell killing by one or more of complement dependent cytotoxicity (CDC) mediated lysis, antibody dependent cellular cytotoxicity (ADCC) mediated lysis, induction of apoptosis and inhibition of proliferation. In one ment, the antibody having the ability of binding to CLDN18.2 is a monoclonal, chimeric or humanized antibody, or a nt of an antibody. In one embodiment, the antibody mediates cell g when bound to cellular CLDN18.2, in particular to CLDN18.2 expressed by cells on their cell surface, n the cells are preferably cancer cells, such as cells of the cancers bed herein. In one embodiment, the antibody having the ability of binding to CLDN18.2 is an antibody selected from the group consisting of (i) an antibody produced by and/or obtainable from a clone ted under the accession no. DSM 7, DSM ACC2738, DSM ACC2739, DSM ACC2740, DSM ACC2741, DSM ACC2742, DSM ACC2743, DSM ACC2745, DSM ACC2746, DSM ACC2747, DSM ACC2748, DSM ACC2808, DSM ACC2809, or DSM ACC2810, (ii) an antibody which is a chimerized or humanized form of the antibody under (i), (iii) an antibody having the icity of the antibody under (i) and (iv) an antibody comprising the antigen binding n or n g site, in particular the variable region, of the antibody under (i) and preferably having the specificity of the antibody under (i). In one embodiment, the antibody is coupled to a therapeutic agent such as a toxin, a sotope, a drug or a cytotoxic agent.

In one embodiment, the method of the ion comprises administering the antibody having the ability of binding to CLDN18.2 at a dose of up to 1000 mg/m2. In one embodiment, the method of the invention comprises administering the antibody having the ability of binding to CLDN18.2 repeatedly at a dose of 300 to 600 mg/m2.

According to the invention, CLDN18.2 preferably has the amino acid sequence according to SEQ ID NO: 1.

In one embodiment, the cancer described herein is CLDN18.2 positive. In one embodiment, cancer cells of the cancer described herein are CLDN18.2 positive. In one embodiment, cancer cells of the cancer described herein express CLDN18.2 on their cell surface.

In one ment, the pancreatic cancer described herein comprises primary cancer, advanced cancer or metastatic , or a combination thereof such as a combination of pancreatic primary cancer and metastatic cancer. In one embodiment, the methods of the invention are for the simultanous treatment of primary cancer and metastatic cancer such as pancreatic primary cancer and pancreatic metastatic cancer. In one embodiment, the metastatic cancer comprises metastasis to the lymph nodes, ovary, liver or lung, or a combination thereof. In one embodiment, the pancreatic cancer ses cancer of the atic duct. In one embodiment, the pancreatic cancer comprises an adenocarcinoma or carcinoma, or a combination thereof. In one embodiment, the pancreatic cancer comprises a ductal adenocarcinoma, a mucinous adenocarcinoma, a neuroendocrine carcinoma or an acinic cell carcinoma, or a ation thereof. In one embodiment, the pancreatic cancer is partially or completely refractory to gemcitabine treatment such as gemcitabine monotherapy.

In one embodiment, preventing pancreatic cancer comprises preventing a ence of pancreatic cancer.

In one embodiment, the patient to be treated according to the invention had a surgery for pancreatic . In one embodiment, the patient has a precancerous pancreatic lesion, in particular a precancerous atic lesion comprising a beginning malignant histological change in the pancreatic ducts. In these embodiments, the methods of the invention preferably aim at preventing the development of malignant pancreatic cancer.

In a further , the present invention provides a medical ation for treating or preventing pancreatic cancer comprising (i) an antibody having the ability of binding to CLDN18.2 and (ii) an agent stabilizing or increasing expression of CLDN18.2. The medical preparation of the present invention may further comprise an agent stimulating g d T cells. The antibody having the ability of binding to CLDN18.2 and the agent stabilizing or increasing expression of CLDN18.2, and optionally the agent ating gd T cells, may be present in the medical ation in a e or separate from each other. The l preparation may be present in the form of a kit comprising a first container including the antibody having the ability of binding to CLDN18.2 and a second container including the agent izing or increasing expression of CLDN18.2, and optionally a container including the agent stimulating gd T cells. The medical preparation may further include printed instructions for use of the preparation for treatment or prevention of pancreatic cancer, in particular for use of the preparation in a method of the invention. Different ments of the medical ation, and, in particular, of the antibody having the ability of binding to CLDN1 8.2, the agent stabilizing or increasing expression of CLDN18.2 and the agent stimulating gd T cells are as described above for the methods of the invention.

In a particular aspect, the present invention provides a medical preparation comprising (i) an antibody having the ability of binding to CLDN18.2, and (ii) gemcitabine. The medical preparation of the present invention may further comprise an agent stimulating gd T cells. The antibody having the ability of binding to CLDN18.2 and gemcitabine, and optionally the agent stimulating gd T cells, may be present in the medical ation in a mixture or separate from each other. The medical ation may be for treating or preventing cancer such as pancreatic . The medical preparation may be present in the form of a kit comprising a first container including the antibody having the ability of binding to .2 and a second container ing gemcitabine, and optionally a container including the agent stimulating gd T cells. The medical preparation may further include printed instructions for use of the preparation for ent or prevention of cancer such as pancreatic cancer, in particular for use of the preparation in a method of the invention. Different ments of the medical preparation, and, in particular, of the dy having the ability of binding to CLDN18.2, the agent stabilizing or increasing expression of CLDN18.2 and the agent stimulating g d T cells are as described above for the methods of the ion.

The present invention also provides the agents described herein such as the antibody having the ability of binding to CLDN18.2 and/or the agent stabilizing or increasing expression of CLDN18.2 for use in the methods described herein. For example, the present invention also provides the antibody having the ability of binding to CLDN18.2 for stration in conjunction with an agent stabilizing or sing expression of .2 such as abine, and optionally an agent stimulating g d T cells.

Other features and advantages of the instant invention will be apparent from the following detailed description and claims.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. iral vector used for transduction of pancreas cancer cell linesHuman .2 was cloned downstream of the EFla promoter. The expression cassette is integrated between the long terminal s (5' and 3'-LTR) which enable packaging and reverse transcription of the viral mRNA. RSV: rous sarcoma virus allows Tat independent production of viral mRNA. Amp: Ampicillin ance gene. PGKp: Promoter of blasticidin.

WPRE: woodchuck posttranscriptional regulatory element; enhances transgene expression.

LTR: long terminal repeat, allows viral packaging. SV40A allows transcriptional termination and polyadenylation of mRNA. pUC: bacterial vector backbone. Bla: promoter of ampicillin.

Figure 2. Metastasis analysis of pancreas cells in mouse lung. Dissection scheme of mouse lungs after i.v. injection of mice with pancreas cancer cells.

Figure 3 . CLDN18.2 expression in normal and cancerous pancreatic tissues. Staining of normal pancreas in fixed paraffin embedded (FFPE) tissue (A) and pancreas arcinoma tissue (B) with the monoclonal murine 35-22A antibody (0.2 g/ml).

Haematoxylin counterstaining (2:00 min). Magnification 200x.

Figure 4. CLDN18.2 expression in normal and precancerous pancreatic tissues. 43-14A ng of various cerous structures (A) normal and PanlNl; (B) PanIN2; (C) PanIN3.

Magnification 200x.

Figure 5. Pilot study - Correlation between CLDN18.2 signal intensity and amount of positive tumor cells for the analyzed pancreas primary tumors. Each dot represents a pancreatic primary cancer case analyzed by staining FFPE sections using the onal, murine 35-22A antibody (0^g/ml). The dashed line marks the 10% value.

Figure 6. Pilot study - sion of CLDN18.2 in primary and metastatic pancreatic tumor tissue. Staining of FFPE tissue sections (3 m ) using the murine, monoclonal 35-22A antibody of (A) adenocarcinoma primary tumor and (B) lymph node metastasis. oxylin (Mayers) counterstained.

Figure 7. Main study: Correlation n CLDN18.2 signal ity and amount of positive tumor cells for the analyzed pancreas primary . Each dot represents a pancreatic ductal adenocarcinoma primary tumor (filled circle) or a ndocrine primary tumor (open circle) case analyzed by staining FFPE sections using monoclonal murine 43- 14A antibody (0.2 mg/ml).

Figure 8. Correlation between CLDN18.2 signal intensity and amount of positive tumor cells for the analyzed pancreas metastases. Each dot represents a pancreatic lymph node (filled circle) or liver (open ) metastasis case analyzed by staining FFPE sections using the monoclonal, murine 43-14A antibody (0.2 g/ml). The dashed line marks the 10% value.

Figure 9. Expression of CLDN18.2 in primary and metastatic pancreatic tumor tissue.

Staining of FFPE tissue sections (3 mh ) using the murine, monoclonal 43-14A antibody on (A, C, E) adenocarcinoma primary tumor and (B, D, F) lymph node metastasis. The sections were counterstained using Mayers Haematoxylin.

Figure 10. Graphical analysis - Expression of CLDN18.2 in matched pancreatic primary tumor and lymph node metastatic s.

Figure 11. sion of CLDN18.2 in matched pancreatic primary tumor and metastatic tissues. Staining of FFPE tissue sections (3 m ) of (A) primary adenocarcinoma, (B) liver metastasis and (C) lymph node metastasis, using the murine, monoclonal 43-14A antibody.

The sections were counterstained using Mayers Haematoxylin. 200x ication.

Figure 12. CLDN18.2 mR A levels in pancreatic carcinoma cell lines. (A) Q-PCR expression analyses of different pancreas CA cell lines, the lentivirally transduced (LVT) cell lines (gray bars), the stomach cancer cell line KATO-III ive control) and the breast cancer cell line SKBR-3 (negative l). CLDN18.2 ripts were amplified using gene specific primers. Endogenous cell lines showing a relative expression level above lxl 05 were scored as CLDN18.2 positive (hatched bars). NTC: H20 control sample. Error bars: Mean + SD. (B-D) Passage-dependent CLDN18.2 expression es in Patu8988S (B), Panc05.04 (C) and the indicated LVT cell lines (D). Passage number is indicated below each bar.

Figure 13. CLDN18.2 protein levels in cell lysates of pancreatic carcinoma cell lines.

Proteins were separated on a 12.5% SDS-PAGE. Western Blot analysis was performed using a CLDN18 antibody detecting the C-terminal of CLDN18.1 and CLDN18.2 (Zymed-MID) and using a loading control dy detecting b-actin. Exposure times of 140 sec (Pierce SuperSignal West Dura) and 20 sec (Pierce SuperSignal West Pico) were used respectively.

(A) Detection of CLDN18 in as cell line lysates, the positive control (HEK293-p740) and the negative control cell lysates (SKBR-3). (B) CLDN18.2 sion compared between non-transduced al cell lysates and lentivirally transduced (LVT) cell line lysates.

Patu8988S and SKBR-3 were added as positive and negative control, respectively.

Figure 14. Detection and cellular localization of CLDN18 expression in atic cancer cell lines. Staining of pancreatic cancer cell lines grown on cover slips. Antibody: 35-22A (20x magnification, the re time is indicated below each picture) DAPI was used to stain the nuclei (blue).(A: AsPCl; B : BxPC3; C: CFPAC; D : DANG; E : HPAF-II; F : HUP- T3; G : HUP-T4; H: KCI-MOH; I : Panel; J : Panc05.04; K : Panc02.04; L: Panc04.03; M : Patu8902; N : Patu8988S; O: Su86.86: P : Suit-2; Q : SW-1990; R : YAPC; S : gastric cancer control cell line KATO-III).

Figure 15. Detection and cellular localization of CLDN18 expression in CLDN18.2 transduced pancreatic cancer cell lines. CLDN18 detection in the lentivirally transduced (LVT) pancreatic cancer cell lines using 35-22A antibody after fixation and permeabilization.

Alexa488 or Alexa555 labeled secondary antibodies were used for detection. A: BxPC3-LVT; B: CAPAN1-LVT; C : DANG-LVT; D : HPAC-LVT; E : MiaPaCa2-LVT; F : Patu8902-LVT; G: -LVT; H: YAPC-LVT.

Figure 16. Binding of IMAB362 to the cell e of CLDN18.2 positive pancreas CA cell lines (pharmacodynamics). IF analysis of atic cancer cell lines (A,B D,E), lentivirally transduced pancreas cell lines (G-L) and KATO-III gastric cancer control cells (C, F) expressing .2. Cells were stained with IMAB362 under native ions (D-E) and for comparison with 35-22A after fixation and permeabilization of the cells (A-C). DAPI was used to stain the nuclei. Exposure times are ted in each panel. G : LVT; H : CAPAN1-LVT; I : DANG-LVT; J : MiaPaCa2-LVT; K : Patu8902-LVT; L : Suit2-LVT.

Figure 17. CLDN18.2 sion in xenograft tumors of different cell lines. Expression of CLDN18.2 in CAPAN1-LVT (A,B), BxPC3-LVT (C,D), PATU8988S-LVT (E,F), MiaPaCa2-LVT (G,H), YAPC-LVT (J,K) and DANG-LVT (L,M) xenograft tumors. Tissue staining was performed with Zymed-MID antibody. Magnification lens lOx (A,C,E,G,J,L) and 20x (B,D,F,H,K,M).

Figure 18. Engraftment check of Suit-2 and MiaPaCa2 pancreatic cancer cell lines. Cells were injected into the tail vein of nude mice. Animals were sacrificed 45 (A), 52 (B), 59 (C) days after Suit-2 (A-C) application or 59 (D), 66 (E), 73 (F) days after MiaPaCa2(D-F) injection. Lungs were prepared and stained with MHC class I antibodies human MHC I, clone EPR1394Y) to detect the human cells in mouse tissues.

Figure 19. Metastasis tment analysis of Patu8988S. Patu8988S cells were i.v. injected with lxlO 6 or 2xl0 6 cells in Nu/Nu mice and lungs (A) and livers (B) of the mice were isolated at different time points as indicated below the x-axis. To calculate the % of human DNA present in each tissue preparation, a standard curve was ed by mixing human and mouse DNA and preparing 7x 5-fold dilutions ing in 100% (1) - 0.0064% (7) human DNA.

Figure 20. IHC analysis of Patu8988S metastasis in mouse lung tissues. Mice injected in their tail veins with Patu8988S cells were sacrificed at ent time points (A-D = 70 days, E-H = 86 days) and lung s were isolated and stained with an MHC-I (EPR1394Y) antibody (A, B, E, F) diluted 1:1000 or with anti-Claudinl8 (Zymed-Mid) (C, D, G, H) at 0.2 g/ml. Magnifications: A, C, E, G = lOx and B, D, F, H = 20x.

Figure 21. IMAB362 mediated apoptosis of abine treated pancreas tumor cells.

Apoptosis induced by cross-linking of CLDN18.2 on CLDN18 after 48hours.

BxPC3~CLDN18 were cultivated in medium or medium + 100 ng/ml abine. Apoptotic cell fraction of mononuclear cells were shifted. Similar shifts were obtained by incubation of tumor cells with Camptotecin.

Figure 22. Potency of IMAB362-induced ADCC activity on pancreatic cancer cells. (A) ADCC performed with CLDN18.2 positive pancreatic cancer cell lines using PBMCs of different donors. (B-F) ADCC performed with LVT pancreas cell lines ectopically expressing CLDN18.2 and the corresponding parental cells. (G) Dot plot Figure 23. Potency of IMAB362-induced CDC activity on pancreatic cancer cells. (A) CDC performed with healthy human serum pool as complement source, IMAB362 and CLDN18.2 ve pancreas CDOKl-p740 control cells in 4 independent experiments (B) CDC performed with CLDN18.2 positive (Patu8988S, DANG, Panc05.04) and CLDN18.2 negative (CAPAN1, Suit2, BxPC3, YAPC) pancreas cell lines (C) CDC with cally sing LVT cell lines (D) Dot plot showing IMAB362 concentration causing half maximum lysis rates (EC50) on pancreatic cancer cell lines. (E) Maximum killing rates obtained with IMAB362 on pancreatic cancer cell lines.

Figure 24. Effect of IMAB362 treatment on subcutaneous a2-LVT xenografts.

MiaPaCa2-LVT xenograft tumors were inoculated by injection of le7 MiaPaCa2-LVT cells subcutaneous into the flank of 15 female hymic oxnlnu mice for each treatment group. On the third day after tumor cell injection, treatment was initiated with 200 mg IMAB362 or controls tively. ent was continued semi-weekly with ating i.p. and i.v. injection until animals were iced. (A) Effect of IMAB362 treatment on tumor growth. The size of s.c. tumors was measured twice weekly (mean + SEM). (B) Kaplan-Meier survival plots. Mice were sacrificed, when tumor reached a volume of 1400 mm3 or tumor became ulcerous.

Figure 25. IMAB362 treatment of subcutaneous BxPC3-LVT xenografts. BxPC3-LVT xenograft tumors were ated by injection of le7 BxPC3-LVT cells subcutaneous into the flank of 15 female Hsd:Athymic Nude-Foxnlnu mice for each treatment group. On the third day after tumor cell injection, treatment was initiated with 200 IMAB362 or controls respectively. Treatment was continued semi-weekly with alternating i.p. and i.v. injection until animals were sacrificed. (A) Effect of IMAB362 treatment on tumor growth. The size of s.c. tumors was measured twice weekly (mean + SEM, * p<0.05). (B) Kaplan-Meier al plots. Mice were sacrificed, when tumor reached a volume of 1400 mm3 or tumor became ulcerous.

Figure 26. Effect of IMAB362 treatment on growth of Suit2-LVT pancreas metastasis. 2xl0 6 Suit2-LVT tumor cells were injected intravenously into the tail vein of 12 female Hsd:Athymic Nude-Foxnlnu mice per ent group. On the third day after tumor cell injection, treatments were initiated with 200 mg IMAB362, 200 g isotype l or with an equal volume of PBS. Animals were sacrificed on day 42 post graft. (A) qPCR analysis (mean of 2-4 reactions per sample) ining the percentage of human DNA present in the mouse lung samples. (B) The percentage of human cells covering the mouse lung surface was determined by planimetry. Human cells were immunohistochemically stained in tissue sections with anti-human MHC-class I antibodies. * p<0.05 (Kruskal-Wallis test). Error bars: mean ± SD.

Figure 27. Q-PCR and IHC analysis of 88S lung metastasis. 2x1 06 Patu8988S cells were injected per mouse. s were sacrificed after 65 days. Open circles: mice sacrificed after 63 days. (A) Mice were treated with 200 mg IMAB362 semi-weekly or saline control.

Amount of human DNA (ng) detected in with Q-PCR , which was calculated from the Ct values. (B) Q-PCR experiment repeat as described in A. Here the percentage of human DNA present in mouse DNA was calculated from the Ct values. (C) Mice were treated with IMAB362 and isotype control antibody (rituximab). The percentage of human DNA present in the mouse lungs was calculated from the Ct values. For the IMAB362 group, one outlier was detected (open triangle). The significance is ted by including or ing the outlier values. (D/E) same experiment as in C. Here surface of the metastasis was determined using the Image J program. Dot plots show the significance of IMAB362 inhibition including (D) or excluding (E) the outlier value. P-value: unpaired t-test. Error bars ±SD Figure 28. Dose response curves for abine. Pancreas cancer cell lines show very different sensitivity for gemcitabine. Cell lines were exposed for 4 days with ent concentrations of gemcitabine and inhibition of proliferation analysed via ity assay.

Figure 29. Dose response curves for oxaliplatin. Pancreas cancer cell lines show very different sensitivity for oxaliplatin. Cell lines were exposed for 4 days with different concentrations of oxaliplatin and inhibition of eration analysed via viability assay.

Figure 30. Effect of treatment wih chemotherapeutic agents on CLDN18.2 expression (RNA). RNA of untreated, Gem ( 1 ng/ml) or GemOx (Gem 1 ng/ml + Ox 10 ng/ml) pretreated DANG (2 days) (A) or Patu8988S (B) cells 3 days pretreated with Gem (10 ng/ml or GemOx (Gem 10 ng/ml + Ox 100 ng/ml).RNA was converted to cDNA and. CLDN18.2 transcript level was analyzed in quantitative real-time PCR. Results are shown as relative units in comparison to transcript level of house keeping gene HPRT.

Figure 31. Effect of chemotherapy on CLDN18.2 protein level in atic carcinoma cells. Protein from total cell lysates of untreated (med), Gem ( 1 ng/ml) or GemOx (Gem 1 ng/ml + Ox 10 ng/ml) pretreated DANG (A) or Patu8988S (B) cells were analyzed for CLDN18.2 expression detected with Zymed C-term polyclonal antisera. Actin was used to show equal loading of proteins.

Figure 32. FACS analysis of CLDN18.2 cell surface expression. CLDN18 expression (filled histogram) of medium ated (left) and Gem treated (right) Patu8988S is shown in an overlay compared to Isotyp Co. Patu8988S are treated with gemcitabine (10 ng/ml)) for 3 days.

Figure 33. Cell cycle analyses of DANG cells d or not with either gemcitabine (Gem; 2ng/ml) or gemcitabine+oxaliplatin (GemOx; Ing/ml+lOng/ml) for two days. (A) Gemcitabine treatment leads to cell cycle arrest of cells in S-Phase. The area of each bar is divided to indicate the percentage of cells in G0/G1, S and G2 phase. (B) Western blot analyses showed upregulation of CLDN18 after treatment with Gem.

Figure 34. Influence of gemcitabine on cell cycle (A) and CLDN18.2 expression (B, C) in Patu8988S cells. Patu8988S cells were either untreated or treated with gemcitabine (10 ng/ml) for 2 days. (A) The area of each bar is divided to te the percentage of cells in G0/G1, S and G2 phase. The density of CLDN18.2 (x-axis) was d against the cell number (y-axis).

(B) CLDN18.2 expression of untreated d line) versus Gem d (solid line) is blotted.

(C) CLDN18.2 expression of gem treated Patu8988S cells in G0/G1 phase (dotted line) versus cells in S phase (solid line) is shown.

Figure 35. Effect of chemotherapy on gastric cancer cells. Cultivation of Kato III cells for 96 hours leads to a cell cycle arrest in the G0/G1 -phase (a) and downregulation of CLDN18.2 (c). Cytostatic nds resulting in a cell cycle arrest in ent phases of the cell cycle stabilize CLDN18.2-expression (c).

Figure 36. Effect of chemotherapy on gastric cancer cells. Cytostatic nds resulting in a cell cycle arrest in different phases of the cell cycle (S/G2-phase (Irinotecan) or G2-phase axel)). The area of each bar is d to indicate the tage of cells in G0/G1, S and G2 phase.

Figure 37. Dose response curves for IMAB362 mediated ADCC after chemotherapy treatment of DANG. (A) Dose response curves of one representary donor after pretreatment of DANG as cancer cells with Gem or GemOx for 40 h . (B) EC50 values (mean) for IMAB362 mediated ADCC. P-values: unpaired .

Figure 38. Effect of chemotherapy on c cancer cells, a : Cells treated with Irinotecan, xel or Cisplatin exhibit a lower level of viable cells compared to medium cultivated target cells b : .2 expression in cells treated with Irinotecan, Docetaxel or Cisplatin is increased compared to medium cultivated cells c/d: Treatment of cells with Irinotecan, Docetaxel or Cisplatin augments the potency of IMAB362 to induce ADCC.

Figure 39. Influence of chemotherapeutic agents on IMAB362 mediated CDC of MiaPaCa2-LVT cells. Dose response curves of 2 independent assays. MiaPaCa2-LVT were cultivated in medium, Gem ml) or GemOx (10 ng/ml Gem + 100 ng/ml Ox) for 70h.

Figure 40. Effects of chemotherapy on IMAB362-induced CDC Figure 41. Effect of IMAB362 treatment combined with Gem or GemOx on BxPC3-LVT xenografts. BxPC3-LVT xenograft tumors were inoculated by injection of 8.5e6 BxPC3-LVT cells subcutaneous into the flank of 10 female Hsd:Athymic Nude-Foxnlnu mice for each treatment group. On the third day after tumor cell injection, treatment was initiated with chemotherapy (50 mg/kg gemcitabine i.p., respectively 50 mg/kg gemcitabine plus 5 mg/kg oxaliplatin i.p.) and were continued weekly for six weeks. 24 h after injection of chemotherapeutic agents, 800 mg IMAB362 or controls were applied intravenous into the tail vein. IMAB362 treatment was continued weekly until mice were sacrificed. (A) Growth curves of subcutaneous BxPC3-LVT xenografts. The size of s.c. tumors was measured twice weekly (mean + SEM). (B) Kaplan-Meier survival curves. Mice were sacrificed, when tumors reached a volume of 1400 mm3 or tumors became ulcerous.

Figure 42. Enhancement of antitumoral efficacy by combination of gemcitabine regimen with IMAB362. BxPC3-LVT xenograft tumors were inoculated by injection of 8.5e6 BxPC3- LVT cells subcutaneous into the flanks of 10 female Hsd:Athymic Nude-Foxnlnu mice for each treatment group. On the third day after tumor cell injection, treatments were ted with chemotherapy (100 mg/kg gemcitabine i.p., or 100 mg kg gemcitabine plus 5 mg kg oxaliplatin i.p.) and were continued weekly for six weeks. 24h after injection of chemotherapeutic agents, 200 mg (1/2 dose) or 400 g (full dose) IMAB362 were d intravenous into the tail vein. IMAB362 treatment was continued eekly with i.p. and i.v. injections alternating until mice were sacrificed. (A) Growth curves of subcutaneous BxPC3-LVT xenografts. The size of s.c. tumors was measured twice weekly (mean + SEM).

(B) Kaplan-Meier survival curves. Mice were sacrificed, when tumors reached a volume of 1400 mm3 or tumors became ulcerous.

Figure 43. Effect of IMAB362 treatment combined with gemcitabine on MiaPaCa2-LVT xenografts. MiaPaCa2-LVT xenograft tumors were inoculated by injection of 5e6 MiaPaCa2- LVT cells aneous into the flank of 10 female Hsd:Athymic Nude-Foxnlnu mice for each treatment group. 4 days after tumor cell injection, treatment was ted with chemotherapy (50 mg/kg gemcitabine i.p) and were continued weekly for six weeks. 24 h after injection of chemotherapeutic , 200 mg IMAB362 or controls were applied intravenous into the tail vein. IMAB362 treatment was ued semi-weekly with i.p. and i.v. injections alternating until mice were sacrificed. (A) Growth of subcutaneous xenografts.

The size of tumors was measured twice weekly (mean + SEM). (B) Kaplan-Meier al curves. Mice were sacrificed, when tumors reached a volume of 1400 mm3 or tumors became ulcerous.

Figure 44. Effect of IMAB362 treatment combined with gemcitabine on established MiaPaCa2-LVT xenograft tumors. MiaPaCa2-LVT xenograft tumors were inoculated by injection of le7 MiaPaCa2-LVT cells aneous into the flank of female Hsd:Athymic Nude- u mice. 9 days after subcutaneous tumor inoculation, tumor bearing mice reorganised in homogenous ent groups with 8 animals per group and treatment was ted. Mice were treated with 150 mg/kg gemcitabine semi-weekly for 4 weeks i.p. 24h after gemcitabine injection, 200 mg IMAB362 or controls were applied enous into the tail vein. Treatment with 200 mg IMAB362 was continued semi-weekly with i.p. and i.v. ions alternating until mice were sacrificed. (A) The size of subcutaneous tumors was measured twice weekly (mean + SEM; **=p<0.01). (B) Kaplan-Meier survival curves. Mice were sacrificed, when tumor reached a volume of 1400 mm3 or tumor became ulcerous (Logrank (Mantel-Cox) test; **=p<0.01).

Figure 45. Effect of IMAB362 in combination with gemcitabine on lung metastases in Patu8988S xenograft model. 2xl0 6 Patu8988S tumor cells were injected intravenously into the tail vein of 1 female hymic Nude- x i nu mice per ent group. Two weeks after intraveneous tumor cell injection treatment was initiated with maintenance treatment of 200 mg IMAB362 semi-weekly i,.p.) combined with administration of 100 mg/kg gemcitabine i.p. semi-weekly for 4 weeks. l group was treated with 200 mg isotype control antibody combined with 100 mg/kg gemcitabine semi-weekly. Animals were sacrificed on day 70 post graft. (A) Quantitative PCR is (mean of 3 reactions per sample) of human DNA in lung samples of 2 and e antibody treated mice.

Significant difference (P = 0.0035, Mann Whitney test) versus isotype control (B) The percentage of stained human cells covering the mouse lung surface was ined by er-based analysis. histological staining was performed with anti human MHCI antibody (clone EPR1394Y) on paraffin embedded lung tissues (Mean ± SEM; P = 0.0003, Mann Whitney test). C and D : Examples for immunohistological stainings with anti MHC-I antibody on Patu8988s lung metastases in 2 + gemcitabine (C) or isotype antibody + gemcitabine treated mice (D).

DETAILED DESCRIPTION OF THE INVENTION gh the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodologies, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

In the following, the elements of the present invention will be described. These elements are listed with ic embodiments, however, it should be understood that they may be ed in any manner and in any number to create additional embodiments. The variously described examples and preferred embodiments should not be construed to limit the present invention to only the explicitly described embodiments. This description should be understood to t and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed and/or preferred ts. Furthermore, any permutations and combinations of all described elements in this application should be ered disclosed by the ption of the present application unless the context indicates ise.

Preferably, the terms used herein are defined as bed in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", H.G.W. Leuenberger, B. Nagel, and H.

Kolbl, Eds., Helvetica Chimica Acta, 0 Basel, Switzerland, (1995).

The practice of the present invention will employ, unless ise indicated, conventional methods of chemistry, biochemistry, cell biology, immunology, and recombinant DNA techniques which are explained in the literature in the field (cf, e.g., Molecular Cloning: A Laboratory Manual, 2nd Edition, J . Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989).

Throughout this specification and the claims which follow, unless the t es otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated member, integer or step or group of members, integers or steps but not the exclusion of any other member, integer or step or group of members, integers or steps gh in some embodiments such other member, r or step or group of members, integers or steps may be excluded, i.e. the subject-matter consists in the inclusion of a stated member, integer or step or group of members, integers or steps. The terms "a" and "an" and "the" and similar reference used in the t of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as"), provided herein is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

Several documents are cited hout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

The term "CLDN18" relates to n 18 and es any variants, including claudin 18 splice variant 1 in 18.1 (CLDN18.1)) and claudin 18 splice variant 2 (claudin 18.2 (CLDN18.2)).

The term "CLDN18.2" preferably relates to human CLDN18.2, and, in particular, to a protein sing, ably consisting of the amino acid sequence according to SEQ ID NO: 1 of the sequence listing or a variant of said amino acid sequence.

The term "CLDN18.1" preferably relates to human CLDN18.1, and, in particular, to a protein comprising, preferably consisting of the amino acid sequence according to SEQ ID NO: 2 of the sequence listing or a variant of said amino acid sequence.

The term "variant" according to the invention refers, in particular, to mutants, splice variants, mations, isoforms, allelic variants, species variants and species homologs, in particular those which are naturally present. An allelic variant relates to an alteration in the normal sequence of a gene, the significance of which is often unclear. Complete gene sequencing often identifies numerous allelic variants for a given gene. A species g is a nucleic acid or amino acid sequence with a different species of origin from that of a given c acid or amino acid sequence. The term "variant" shall encompass any posttranslationally modified variants and conformation ts. ing to the invention, the term "CLDN18.2 ve cancer" means a cancer ing cancer cells expressing CLDN18.2, preferably on the surface of said cancer cells.

"Cell surface" is used in ance with its normal meaning in the art, and thus includes the outside of the cell which is accessible to binding by proteins and other molecules. For example, a transmembrane protein having one or more extracellular portions is considered as being expressed on the cell surface.

CLDN18.2 is expressed on the surface of cells if it is located at the surface of said cells and is accessible to binding by CLDN18.2-specific antibodies added to the cells.

According to the invention, CLDN18.2 is not substantially expressed in a cell if the level of expression is lower compared to expression in stomach cells or stomach tissue. Preferably, the level of expression is less than 10%, preferably less than 5%, 3%, 2%, 1%, 0.5%, 0.1 % or 0.05% of the sion in stomach cells or stomach tissue or even lower. Preferably, CLDN18.2 is not substantially expressed in a cell if the level of expression exceeds the level of expression in ncerous tissue other than h by no more than , preferably 1,5-fold, and preferably does not exceed the level of expression in said non-cancerous .

Preferably, CLDN18.2 is not substantially expressed in a cell if the level of expression is below the detection limit and/or if the level of expression is too low to allow binding by .2-specific antibodies added to the cells.

According to the invention, CLDN1 8.2 is expressed in a cell if the level of expression exceeds the level of expression in non-cancerous tissue other than stomach preferably by more than 2- fold, preferably 10-fold, 100-fold, 1000-fold, or 10000-fold. Preferably, .2 is expressed in a cell if the level of expression is above the detection limit and/or if the level of expression is high enough to allow binding by CLDN18.2-specific antibodies added to the cells. Preferably, CLDN18.2 expressed in a cell is sed or exposed on the e of said cell. ing to the invention, the term "disease" refers to any pathological state, including cancer, in particular those forms of cancer described herein. Any reference herein to cancer or ular forms of cancer also includes cancer metastasis thereof. In a preferred embodiment, a disease to be treated according to the present application involves cells expressing CLDN18.2.

"Diseases associated with cells expressing CLDN18.2" or similar expressions means according to the invention that CLDN18.2 is sed in cells of a diseased tissue or organ.

In one embodiment, expression of CLDN18.2 in cells of a diseased tissue or organ is increased compared to the state in a y tissue or organ. An increase refers to an increase by at least 10%, in particular at least 20%, at least 50%, at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000% or even more. In one embodiment, expression is only found in a diseased tissue, while expression in a corresponding healthy tissue is repressed. For example, CLDN18.2 is expressed in pancreatic cancer tissue while expression is not detectable in non-cancerous pancreatic tissue. According to the invention, diseases associated with cells expressing CLDN18.2 include cancer diseases. Furthermore, according to the invention, cancer diseases preferably are those wherein the cancer cells express CLDN18.2.

As used , a "cancer disease" or "cancer" includes a disease characterized by aberrantly regulated cellular growth, proliferation, entiation, on, and/or migration. By "cancer cell" is meant an abnormal cell that grows by a rapid, uncontrolled cellular proliferation and continues to grow after the stimuli that initiated the new growth cease.

Preferably, a "cancer disease" is characterized by cells sing CLDN18.2 and a cancer cell expresses CLDN18.2. A cell expressing CLDN18.2 ably is a cancer cell, preferably of the cancers described herein.

According to the invention, a "carcinoma" is a malignant tumor d from epithelial cells.

"Adenocarcinoma" is a cancer that originates in glandular tissue. This tissue is also part of a larger tissue category known as epithelial tissue. Epithelial tissue includes skin, glands and a y of other tissue that lines the cavities and organs of the body. Epithelium is derived embryologically from ectoderm, endoderm and mesoderm. To be classified as adenocarcinoma, the cells do not necessarily need to be part of a gland, as long as they have secretory properties. This form of carcinoma can occur in some higher mammals, including humans. Well differentiated adenocarcinomas tend to resemble the glandular tissue that they are derived from, while poorly differentiated may not. By staining the cells from a biopsy, a pathologist will ine whether the tumor is an adenocarcinoma or some other type of cancer. Adenocarcinomas can arise in many tissues of the body due to the ubiquitous nature of glands within the body. While each gland may not be secreting the same substance, as long as there is an exocrine function to the cell, it is considered lar and its malignant form is therefore named adenocarcinoma. Malignant arcinomas invade other tissues and often metastasize given enough time to do so.

The pancreas, an organ of endodermal derivation, is the key regulator of protein and carbohydrate digestion and glucose homeostasis. The ne as (80% of the tissue mass of the organ) is composed of a branching k of acinar and duct cells that produce and deliver digestive s into the gastrointestinal tract. The acinar cells, which are organized in functional units along the duct network, synthesize and secrete enzymes into the ductal lumen in response to cues from the stomach and duodenum. Within the acinar units near the ducts are centroacinar cells. The endocrine pancreas, which regulates metabolism and glucose homeostasis through the secretion of hormones into the bloodstream, is ed of four specialized endocrine cell types ed together into clusters called Islets of Langerhans.

Pancreatic cancer is a malignant neoplasm ating from transformed cells g in tissues forming the pancreas. Pancreatic cancer is the fourth most common cause of related deaths in the United States and the eighth worldwide. Early pancreatic cancer often does not cause symptoms, and the later symptoms are usually nonspecific and .

Therefore, pancreatic cancer is often not diagnosed until it is advanced. Pancreatic cancer has a poor prognosis: for all stages ed, the 1- and 5-year relative survival rates are 25% and 6%, respectively. For local disease the 5-year survival is approximately 20% while the median survival for locally advanced and for metastatic disease, which collectively represent over 80% of individuals, is about 10 and 6 months respectively.

Pancreatic cancer includes adenocarcinomas (tumors exhibiting glandular architecture) g within the exocrine component of the pancreas and neuroendocrine carcinomas arising from islet cells.

The most common form of pancreatic cancer, ductal adenocarcinoma, is typically characterized by moderately to poorly differentiated glandular structures on microscopic examination. Pancreatic ductal adenocarcinoma (PDAC) commonly arises in the head of the pancreas with infiltration into surrounding tissues including lymphatics, spleen, and peritoneal cavity, and with metastasis to the liver and lungs. PDAC primarily exhibits a glandular pattern with duct-like structures and varying degrees of cellular atypia and differentiation. Less common subtypes of PDAC include colloid, adenosquamous, or sarcomatoid histology. Often within an individual tumor, there are al differences in histology, tumor grade, and degree of differentiation. Even the smallest primary lesions commonly exhibit perineural and lympho-vascular invasion, suggesting a propensity for early distant spread.

The second most common type of ne as cancer is mucinous. Mucinous adenocarcinoma produces a large volume of mucin that results in a cystic appearance on imaging studies.

Pancreatic neuroendocrine tumors form in hormone-making cells (islet cells) of the pancreas.

Acinic cell neoplasms arise from the acinar cells of the pancreas.

According to the invention, the term "cancer" also includes cancer metastasis of a y tumor such as primary atic cancer. Thus, if reference is made, for example, to pancreatic cancer, this also includes metastasis of the pancreatic cancer, for example asis to the lung, liver and/or lymph nodes.

By "metastasis" is meant the spread of cancer cells from its original site to another part of the body. The formation of metastasis is a very complex process and depends on detachment of malignant cells from the primary tumor, invasion of the extracellular matrix, penetration of the endothelial nt membranes to enter the body cavity and s, and then, after being transported by the blood, infiltration of target organs. Finally, the growth of a new tumor at the target site depends on angiogenesis. Tumor metastasis often occurs even after the removal of the primary tumor because tumor cells or components may remain and develop metastatic potential. In one embodiment, the term "metastasis" according to the invention relates to "distant metastasis" which s to a metastasis which is remote from the primary tumor and the al lymph node system. In one embodiment, the term "metastasis" according to the invention relates to lymph node asis. One particular form of metastasis which is treatable using the therapy of the invention is metastasis originating from pancreatic cancer as primary site. In preferred embodiments such pancreatic cancer metastasis is metastasis into lymph nodes, metastasis into lung and/or metastasis into liver.

Krukenberg tumor is an uncommon metastatic tumor of the ovary accounting for 1% to 2% of all n tumors. berg tumor is a metastatic signet ring cell adenocarcinoma of the ovary. Stomach is the primary site in most Krukenberg tumor cases (70%). Carcinomas of colon, appendix, and breast (mainly invasive lobular carcinoma) are the next most common primary sites. Rare cases of Krukenberg tumor originating from omas of the gallbladder, biliary tract, pancreas, small intestine, ampulla of Vater, cervix, and urinary bladder/urachus have been reported.

A refractory cancer is a malignancy for which a particular treatment is ineffective, which is either initially unresponsive to treatment, or which becomes unresponsive over time.

By "treat" is meant to administer a compound or composition or a combination of compounds or compositions to a subject in order to prevent or eliminate a disease, including reducing the size of a tumor or the number of tumors in a subject; arrest or slow a disease in a subject; inhibit or slow the development of a new disease in a subject; decrease the frequency or severity of symptoms and/or recurrences in a t who currently has or who previously has had a disease; and/or prolong, i.e. increase the lifespan of the subject.

In particular, the term "treatment of a disease" includes curing, shortening the duration, ameliorating, preventing, slowing down or inhibiting ssion or worsening, or preventing or delaying the onset of a disease or the symptoms thereof.

The term "patient" means ing to the invention a subject for treatment, in ular a diseased subject, ing human beings, nonhuman primates or r animals, in ular s such as cows, horses, pigs, sheeps, goats, dogs, cats or rodents such as mice and rats. In a particularly preferred embodiment, a patient is a human being.

The term "agent stabilizing or increasing expression of CLDN18.2" refers to an agent or a combination of agents the ion of which to cells results in increased RNA and/or protein levels of CLDN18.2 in said cells, preferably in increased levels of CLDN18.2 protein on the cell surface, compared to the situation where the cells are not provided with the agent or the ation of agents. Preferably, the cells are cancer cells, in particular cancer cells expressing CLDN18.2 and thus are a target for CLDN18.2 binding antibodies, such as cells of the cancer types desribed , in particular pancreatic cancer. The term "agent stabilizing or increasing expression of CLDN18.2" refers, in particular, to an agent or a combination of agents the provision of which to cells results in a higher density of CLDN18.2 on the surface of said cells compared to the situation where the cells are not provided with the agent or the combination of agents. "Stabilizing expression of CLDN18.2" includes, in particular, the situation where the agent or the combination of agents prevents a decrease or s a decrease in expression of CLDN18.2, e.g. expression of CLDN18.2 would decrease without provision of the agent or the combination of agents and provision of the agent or the combination of agents prevents said decrease or reduces said decrease of CLDN18.2 expression. "Increasing expression of CLDN18.2" includes, in particular, the situation where the agent or the ation of agents increases expression of CLDN18.2, e.g. expression of CLDN1 8.2 would decrease, remain ially constant or se without provision of the agent or the combination of agents and provision of the agent or the combination of agents increases CLDN18.2 expression compared to the situation without provision of the agent or the combination of agents so that the resulting expression is higher compared to the situation where expression of CLDN18.2 would decrease, remain essentially constant or increase without provision of the agent or the combination of agents.

According to the invention, the term "agent stabilizing or increasing sion of CLDN18.2" includes chemotherapeutic agents or combinations of chemotherapeutic agents such as cytostatic agents. Chemotherapeutic agents may affect cells in one of the following ways: (1) damage the DNA of the cells so they can no longer reproduce, (2) inhibit the synthesis of new DNA s so that no cell replication is le, (3) stop the mitotic processes of the cells so that the cells cannot divide into two cells.

According to the invention, the term "agent izing or increasing expression of CLDN18.2" ably relates to an agent or a combination of agents such a cytostatic compound or a ation of cytostatic compounds the provision of which to cells, in particular cancer cells, results in the cells being arrested in or accumulating in one or more phases of the cell cycle, preferably in one or more phases of the cell cycle other than the G l and GO-phases, preferably other than the Gl -phase, preferably in one or more of the G2- or S- phase of the cell cycle such as the G1/G2-, S/G2-, G2- or S-phase of the cell cycle. The term "cells being arrested in or accumulating in one or more phases of the cell cycle" means that the percentage of cells which are in said one or more phases of the cell cycle increases. Each cell goes through a cycle comprising four phases in order to replicate itself. The first phase called Gl is when the cell prepares to replicate its chromosomes. The second stage is called S, and in this phase DNA sis occurs and the DNA is duplicated. The next phase is the G2 phase, when the RNA and protein duplicate. The final stage is the M stage, which is the stage of actual cell division. In this final stage, the duplicated DNA and RNA split and move to separate ends of the cell, and the cell actually divides into two identical, functional cells.

Chemotherapeutic agents which are DNA ng agents usually result in an accumulation of cells in the G and/or G2 phase. Chemotherapeutic agents which block cell growth by interfering with DNA synthesis such as antimetabolites usually result in an accumulation of cells in the S-phase. Examples of these drugs are gemcitabine, 6-mercaptopurine and 5- uracil.

According to the invention, the term "agent stabilizing or sing expression of CLDN18.2" es nucleoside analogs such as gemcitabine, rouracil or prodrugs thereof, platinum compounds such as oxaliplatin and cisplatin, taxanes such as paclitaxel and docetaxel, and camptothecin analogs such as irinotecan and topotecan, and combinations of drugs such as combinations of drugs comprising one or more of gemcitabine, oxaliplatin and rouracil such as a combination of drugs comprising abine and oxaliplatin, gemcitabine and 5-fluorouracil, oxaliplatin and 5-fluorouracil or other drug combinations described herein. According to the invention a nce to an agent stabilizing or increasing expression of CLDN18.2, such as a reference to a nucleoside , a platinum compound, a camptothecin analog or a taxane, for example, a reference to gemcitabine, 5-fluorouracil, oxaliplatin, irinotecan or paclitaxel is to include any prodrug such as ester, salt or derivative such as conjugate of said agent. es are conjugates of said agent with a carrier substance, e.g. protein-bound paclitaxel such as albumin-bound paclitaxel. Preferably, salts of said agent are pharmaceutically acceptable.

In one preferred embodiment, an "agent stabilizing or increasing expression of CLDN18.2" is or comprises an "agent inducing genic cell death".

In specific circumstances, cancer cells can enter a lethal stress pathway linked to the on of a spatiotemporally defined combination of signals that is decoded by the immune system to activate tumor-specific immune responses (Zitvogel L. et al. (2010) Cell 140: 798-804). In such scenario cancer cells are triggered to emit signals that are sensed by innate immune effectors such as dendritic cells to trigger a cognate immune response that involves CD8+ T cells and IFN-g signalling so that tumor cell death may elicit a productive anticancer immune response. These s include the pre-apoptotic exposure of the endoplasmic reticulum (ER) on calreticulin (CRT) at the cell surface, the optotic secretion of ATP, and the post-apoptotic release of the nuclear protein HMGBl. Together, these processes constitute the molecular determinants of immunogenic cell death (ICD). Anthracychnes, oxaliplatin, and g irradiation are able to induce all signals that define ICD, while cisplatin, for example, which is ent in inducing CRT ocation from the ER to the surface of dying cells - a process requiring ER stress - requires complementation by thapsigargin, an ER stress inducer.

According to the invention, the term "agent inducing genic cell death" refers to an agent or a combination of agents which when provided to cells, in particular cancer cells, is capable of inducing the cells to enter a lethal stress pathway which finally results in tumor- specific immune responses. In particular, an agent inducing immunogenic cell death when provided to cells induces the cells to emit a spatiotemporally defined combination of signals, including, in particular, the pre-apoptotic exposure of the endoplasmic reticulum (ER) chaperon calreticulin (CRT) at the cell e, the pre-apoptotic ion of ATP, and the post-apoptotic release of the nuclear protein HMGB 1.

According to the invention, the term "agent inducing immunogenic cell death" es anthracychnes and oxaliplatin.

The term "nucleoside analog" refers to a structural analog of a nucleoside, a category that includes both purine analogs and pyrimidine analogs.

The term "gemcitabine" is a compound which is a a nucleoside analog of the following formula: In particular, the term refers to the compound 4-amino-l-(2-deoxy-2,2-difluoro - -D-erythropentofuranosyl )pyrimidin-2(lH)-one or 4-amino-l-[(2R,4R,5R)-3,3-difluorohydroxy (hydroxymethyl)oxolanyl]- 1,2-dihydropyrimidinone.

According to the invention, gemcitabine is preferably administered by the enous route.

Preferably, gemcitabine is administered in dose ranges of 0.5 to 2 g/m2, preferably 0.8 to 1.5 g/m2, more preferably 1 to 1.2 g/m2 of body surface area. For example, abine may be given at a dose of 1000 mg per square meter weekly for 7 of 8 weeks and then weekly for 3 of 4 weeks.

The term "nucleoside analog" includes fluoropyrimidine derivatives such as fluorouracil and prodrugs thereof. The term "fluorouracil" or orouracil" (5-FU or f5U) (sold under the brand names Adrucil, Carac, , Efudex and Fluoroplex) is a compound which is a pyrimidine analog of the following formula: In particular, the term refers to the compound 5-fluoro-lH-pyrimidine-2,4-dione.

The term "capecitabine" (Xeloda, Roche) refers to a chemotherapeutic agent that is a prodrug that is converted into 5-FU in the tissues. Capecitabine which may be orally administered has the ing formula: In particular, the term refers to the compound pentyl [l-(3,4-dihydroxy methyltetrahydrofuranyl)fluorooxo-lH-pyrimidinyl]carbamate.

According to the invention, the term "platinum compound" refers to compounds containing platinum in their structure such as platinum complexes and includes compounds such as cisplatin, carboplatin and latin.

The term "cisplatin" or "cisplatinum" refers to the compound cis- diamminedichloroplatinum(II) (CDDP) of the following formula: The term "carboplatin" refers to the compound cis-diammine(l,lcyclobutanedicarboxylato )platinum(II) of the following formula: The term "oxaliplatin" refers to a compound which is a platinum compound that is xed to a diaminocyclohexane carrier ligand of the following formula: In ular, the term platin" refers to the compound [(lR,2R)-cyclohexane-l,2- diamine](ethanedioato-0,0')platinum(II). Oxaliplatin for injection is also marketed under the trade name Eloxatine.

Taxanes are a class of diterpene compounds that were first derived from l sources such as plants of the genus Taxus, but some have been synthesized artificially. The principal mechanism of action of the taxane class of drugs is the disruption of microtubule function, thereby inhibiting the process of cell on. Taxanes include docetaxel (Taxotere) and paclitaxel (Taxol).

According to the invention, the term "docetaxel" refers to a compound having the following formula: In particular, the term "docetaxel" refers to the compound l,7p,10p-trihydroxyoxo-5P,20- epoxytax-l l-ene-2a,4,13a-triyl 4-acetate 2-benzoate 13-{(2R,3S)[(tert-butoxycarbonyl)- amino]hydroxyphenylpropanoate}.

According to the invention, the term "paclitaxel" refers to a compound having the ing formula: In particular, the term taxel" refers to the nd (2a,4a,5p ,7 ,10p,13a)-4,10-bis- (acetyloxy){[(2R,3S)- 3-(benzoylamino)hydroxyphenylpropanoyl]oxy}- 1,7- dihydroxyoxo-5,20-epoxytax-l l-enyl benzoate.

According to the invention, the term "camptothecin analog" refers to derivatives of the compound camptothecin (CPT; (S)ethylhydroxy-lH-pyrano[3',4':6,7]indolizino[l,2-b] quinoline-3,14-(4H,12H)-dione). Preferably, the term "camptothecin " refers to compounds comprising the following structure: According to the invention, preferred camptothecin analogs are inhibitors of DNA enzyme topoisomerase I (topo I). Preferred camptothecin s according to the ion are irinotecan and topotecan.

Irinotecan is a drug ting DNA from unwinding by inhibition of topoisomerase I . In chemical terms, it is a semisynthetic analogue of the natural alkaloid camptothecin having the following formula: In particular, the term "irinotecan" refers to the nd (S)-4,l 1-diethyl-3,4,12,14- tetrahydrohydroxy-3 ,14-dioxo 1H-pyrano[3 ',4 ':6,7]-indolizino[ 1,2-b]quinolinyl- [1,4 '- bipiperidine]- 1'-carboxylate.

Topotecan is a topoisomerase inhibitor of the formula: In particular, the term "topotecan" refers to the compound (S)[(dimethylamino)methyl] ethyl-4,9-dihydroxy-lH-pyrano[3\4^6,7]indolizino[l,2-b]quinoline-3,14(4H,12H)-dione drochloride.

Anthracyclines are a class of drugs commonly used in cancer chemotherapy that are also antibiotics. Structurally, all anthracyclines share a common four-ringed 7,8,9,10- tetrahydrotetracene-5,12-quinone structure and usually require glycosylation at specific sites.

Anthracyclines preferably bring about one or more of the following mechanisms of action: 1.

Inhibiting DNA and RNA synthesis by intercalating n base pairs of the DNA/RNA , thus preventing the replication of rapidly-growing cancer cells. 2. Inhibiting topoisomerase II enzyme, preventing the relaxing of supercoiled DNA and thus blocking DNA transcription and replication. 3. Creating iron-mediated free oxygen ls that damage the DNA and cell membranes.

According to the invention, the term "anthracycline" preferably relates to an agent, preferably an ncer agent for inducing apoptosis, preferably by inhibiting the ing of DNA in topoisomerase II.

Preferably, according to the invention, the term "anthracycline" generally refers to a class of compounds having the following ring structure including analogs and derivatives, pharmaceutical salts, hydrates, esters, conjugates and prodrugs thereof.

Examples of anthracyclines and anthracycline analogs include, but are not limited to, daunorubicin (daunomycin), doxorubicin (adriamycin), epirubicin, idarubicin, rhodomycin, pyrarubicin, valrubicin, N-trifluoro-acetyl doxorubicin- erate, aclacinomycin, morpholinodoxorubicin (morpholino-DOX), cyanomorpholino-doxorubicin (cyanomorpholino-DOX ), 2-pyrrolino-doxorubicin (2-PDOX), 5-iminodaunomycin, mitoxantrone and aclacinomycin A (aclarubicin). ntrone is a member of the anthracendione class of compounds, which are anthracycline analogs that lack the sugar moiety of the anthracyclines but retain the planar polycylic aromatic ring structure that permits intercalation into DNA.

Particularly preferred as anthracyline according to the invention is a compound of the following formula: wherein R i is selected from the group consisting of H and OH, R2 is selected from the group consisting of H and OMe, R 3 is selected from the group ting of H and OH, and R4 is ed from the group consisting of H and OH.

In one embodiment, R is H, R2 is OMe, R 3 is H, and R4 is OH. In another embodiment, R i is OH, R2 is OMe, R3 is H, and R is OH. In another embodiment, R i is OH, R2 is OMe, R 3 is OH, and is H . In another embodiment, R i is H, R2 is H, R 3 is H, and is OH.

Specifically contemplated as anthracycline in the context of the present invention is epirubicin. icin is an anthracycline drug which has the following formula: and is marketed under the trade name Ellence in the US and Pharmorubicin or Epirubicin Ebewe elsewhere. In particular, the term "epirubicin" refers to the compound (8R,10S) S,5R,6S)aminohydroxymethyl-oxanyl]oxy-6,l l-dihydroxy(2- hydroxyacetyl)-l -methoxymethyl-9, 10-dihydro-7H-tetracen-5, n. Epirubicin is favoured over doxorubicin, the most popular anthracycline, in some chemotherapy regimens as it s to cause fewer side-effects.

According to the invention, an agent stabilizing or increasing expression of CLDN18.2 may be a chemotherapeutic agent, in particular a chemotherapeutic agent established in cancer treatment and may be part of a combination of drugs such as a combination of drugs established for use in cancer treatment. Such combination of drugs may be a drug combination used in chemotherapy, and may be a drug combination as used in the FOLFIRINOX chemotherapeutic regimen.

The drug combination used in INOX chemotherapy comprises of leucovorin, fluorouracil, irinotecan (such as irinotecan hydrochloride) and oxaliplatin. Oxaliplatin may be given at 85 mg per square meter of body-surface area; irinotecan at 180 mg per square meter; leucovorin at 400 mg per square meter; and uracil at 400 mg per square meter given as a bolus ed by 5-fluorouracil at 2400 mg per square meter given as a continuous infusion of preferably 46-hours, preferably every 2 weeks).

The term ic acid" or "leucovorin" refers to a compound useful in synergistic combination with the chemotherapy agent 5-fluorouracil. Thus, if reference is made herein to the administration of 5-fluorouracil or a prodrug f, said administration in one ment may comprise an administration in conjunction with folinic acid. Folinic acid has the following formula: In particular, the term refers to the nd (2S){[4-[(2-aminoformyloxo-5, 6,7,8- tetrahydro- 1H-pteridinyl)methylamino]benzoyl] amino}pentanedioic acid. gd T cells (gamma delta T cells) represent a small subset of T cells that possess a distinct T cell receptor (TCR) on their surface. A majority of T cells have a TCR composed of two glycoprotein chains called a- and b-TCR chains. In contrast, in g d T cells, the TCR is made up of one g -chain and one d-chain. This group of T cells is usually much less common than b T cells. Human gd T cells play an important role in stress-surveillance responses like ious diseases and autoimmunity. Transformation-induced s in tumors are also suggested to cause stress-surveillance responses mediated by gd T cells and enhance antitumor immunity. antly, after antigen engagement, activated gd T cells at lesional sites provide nes (e.g. INFy, TNFa) and/or chemokines mediating tment of other effector cells and show immediate effector functions such as cytotoxicity (via death receptor and cytolytic granules pathways) and ADCC.

The majority of gd T cells in peripheral blood express the Vy9V62 T cell receptor (TCRy0).

Vy9V62 T cells are unique to humans and primates and are assumed to play an early and essential role in sensing "danger" by invading pathogens as they expand dramatically in many acute ions and may exceed all other lymphocytes within a few days, e.g. in tuberculosis, salmonellosis, ehrlichiosis, losis, tularemia, iosis, toxoplasmosis, and malaria. gd T cells respond to small ptidic phosphorylated antigens (phosphoantigens) such as pyrophosphates synthesized in bacteria and isopentenyl pyrophosphate (IPP) produced in mammalian cells through the mevalonate pathway. Whereas IPP production in normal cells is not sufficient for activation of gd T cells, dysregulation of the mevalonate pathway in tumor cells leads to accumulation of IPP and gd T cell activation. IPPs can also be therapeutically increased by aminobisphosphonates, which inhibit the mevalonate pathway enzyme farnesyl pyrophosphate synthase (FPPS). Among others, zoledronic acid (ZA, zoledronate, Zometa™, Novartis) ents such an iphosphonate, which is already ally administered to patients for the treatment of osteoporosis and metastasic bone disease. Upon treatment of PBMCs in vitro, ZA is taken up especially by monocytes. IPP lates in the monocytes and they differentiate to antigen-presenting cells stimulating development of gd T cells. In this g, the addition of interleukin-2 (IL-2) is preferred as growth and survival factor for activated gd T cells. Finally, certain alkylated amines have been described to activate V 9V 2 T cells in vitro, however only at olar concentrations.

According to the invention, the term "agent stimulating gd T cells" s to compounds stimulating development of gd T cells, in particular Vy9V62 T cells, in vitro and/or in vivo, in particular by ng activation and expansion of gd T cells. Preferably, the term relates to compounds which in vitro and/or in vivo increase isopentenyl pyrophosphate (IPP) ed in mammalian cells, preferably by inhibiting the mevalonate pathway enzyme farnesyl pyrophosphate synthase (FPPS).

One particular group of compounds stimulating gd T cells are bisphosphonates, in ular nitrogen-containing bisphosphonates (N-bisphosphonates; aminobisphosphonates).

For example, le bisphosphonates for use in the invention may include one or more of the following compounds including analogs and derivatives, pharmaceutical salts, hydrates, esters, conjugates and prodrugs thereof: [l-hydroxy(lH-imidazol-l-yl)ethane-l,l-diyl]bis(phosphonic acid), zoledronic acid, e.g. zoledronate; (dichloro-phosphono-methyl)phosphonic acid, e.g. clodronate {l-hydroxy[methyl(pentyl)amino]propane-l,l-diyl}bis(phosphonic acid), ibandronic acid, e.g. ibandronate (3-amino-l-hydroxypropane-l,l-diyl)bis (phosphonic acid), pamidronic acid, e.g. onate; ( 1-hydroxy- l-phosphonopyridinyl-ethyl)phosphonic acid, risedronic acid, e.g. risedronate; ( 1-Hydroxyimidazo[ 1,2-a]pyridinyl- 1-phosphonoethyl)phosphonic acid, minodronic acid; [3-(dimethylamino)-l-hydroxypropane-l,l-diyl]bis(phosphonic acid), olpadronic acid. [4-amino-l -hydroxy- l-(hydroxy-oxido-phosphoryl)-butyl]phosphonic acid, alendronic acid, e.g. alendronate; [(Cycloheptylamino)methylene]bis(phosphonic acid), incadronic acid; (l-hydroxyethan-l,l-diyl)bis(phosphonic acid), etidronic acid, e.g. etidronate; and {[(4-chlorophenyl)thio]methylene}bis(phosphonic acid), tiludronic acid.

According to the invention, zoledronic acid (INN) or zoledronate (marketed by Novartis under the trade names Zometa, Zomera, Aclasta and Reclast) is a particularly preferred bisphosphonate. Zometa is used to t skeletal fractures in patients with cancers such as multiple myeloma and prostate cancer, as well as for treating osteoporosis. It can also be used to treat alcemia of malignancy and can be helpful for treating pain from bone metastases.

In one particularly red embodiment, an agent ating gd T cells according to the invention is administered in combination with IL-2. Such combination has been shown to be particularly effective in mediating expansion and activation of g9d2 T cells.

Interleukin-2 (IL-2) is an interleukin, a type of cytokine signaling molecule in the immune system. It is a protein that attracts lymphocytes and is part of the body's natural response to ial infection, and in discriminating n foreign (non-self) and self. IL-2 mediates its effects by binding to IL-2 receptors, which are expressed by lymphocytes.

The IL-2 used according to the invention may be any IL-2 supporting or enabling the stimulation of gd T cells and may be derived from any species, preferably human. 11-2 may be isolated, recombinantly produced or synthetic IL-2 and may be naturally occurring or modified IL-2.

The term "antigen" relates to an agent such as a protein or peptide sing an epitope t which an immune response is directed and/or is to be directed. In a preferred embodiment, an antigen is a tumor-associated antigen, such as .2, i.e., a constituent of cancer cells which may be derived from the asm, the cell surface and the cell s, in particular those antigens which are produced, preferably in large quantity, ellular or as surface antigens on cancer cells.

In the context of the present invention, the term "tumor-associated antigen" ably relates to proteins that are under normal ions specifically expressed in a limited number of tissues and/or organs or in specific developmental stages and are expressed or aberrantly sed in one or more tumor or cancer tissues. In the context of the present invention, the tumor-associated antigen is preferably associated with the cell surface of a cancer cell and is preferably not or only rarely expressed in normal tissues.

The term "epitope" refers to an antigenic determinant in a molecule, i.e., to the part in a molecule that is recognized by the immune system, for example, that is recognized by an antibody. For example, epitopes are the discrete, dimensional sites on an antigen, which are recognized by the immune system. Epitopes y consist of chemically active surface ngs of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as ic charge characteristics.

Conformational and non mational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing ts. An epitope of a protein such as CLDN18.2 preferably comprises a continuous or discontinuous portion of said protein and is preferably between 5 and 100, preferably between 5 and 50, more preferably between 8 and 30, most preferably n 10 and 25 amino acids in length, for example, the epitope may be preferably 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length.

The term "antibody" refers to a glycoprotein sing at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, and includes any molecule comprising an antigen binding portion thereof. The term "antibody" es monoclonal antibodies and fragments or derivatives of antibodies, including, without limitation, human antibodies, humanized antibodies, chimeric antibodies, single chain antibodies, e.g., scFv's and antigen-binding antibody fragments such as Fab and Fab' fragments and also includes all recombinant forms of antibodies, e.g., antibodies sed in prokaryotes, unglycosylated antibodies, and any antigen-binding antibody fragments and derivatives as described herein.

Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), persed with regions that are more conserved, termed ork regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.

The antibodies described herein may be human antibodies. The term "human antibody", as used herein, is ed to include antibodies having variable and nt regions derived from human ne globulin sequences. The human antibodies described herein may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).

The term "humanized antibody" refers to a molecule having an n binding site that is substantially derived from an immunoglobulin from a non-human species, wherein the remaining immunoglobulin structure of the molecule is based upon the ure and/or sequence of a human immunoglobulin. The antigen g site may either comprise complete variable domains fused onto constant domains or only the complementarity determining regions (CDR) grafted onto appropriate framework regions in the variable domains. Antigen binding sites may be wild-type or modified by one or more amino acid substitutions, e.g. ed to resemble human immunoglobulins more closely. Some forms of humanized antibodies preserve all CDR sequences (for example a humanized mouse antibody which contains all six CDRs from the mouse antibody). Other forms have one or more CDRs which are altered with respect to the original antibody.

The term "chimeric antibody" refers to those antibodies n one portion of each of the amino acid sequences of heavy and light chains is homologous to corresponding sequences in antibodies derived from a particular s or belonging to a particular class, while the remaining segment of the chain is homologous to corresponding sequences in another.

Typically the variable region of both light and heavy chains mimics the le regions of antibodies derived from one species of mammals, while the constant portions are homologous to sequences of antibodies derived from another. One clear advantage to such chimeric forms is that the variable region can conveniently be derived from presently known sources using y available B-cells or hybridomas from non-human host organisms in combination with constant regions derived from, for example, human cell preparations. While the le region has the advantage of ease of preparation and the specificity is not affected by the source, the constant region being human, is less likely to elicit an immune response from a human subject when the antibodies are injected than would the constant region from a non human source. However the definition is not limited to this particular example.

The terms en-binding portion" of an antibody (or simply "binding n") or "antigenbinding fragment" of an antibody (or simply "binding fragment") or r terms refer to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antigen-binding portion" of an antibody include (i) Fab fragments, monovalent fragments consisting of the VL, VH, CL and CH domains; (ii) F(ab')2 fragments, bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) Fd fragments consisting of the VH and CH domains; (iv) Fv fragments consisting of the VL and VH s of a single arm of an antibody, (v) dAb fragments (Ward et al., (1989) Nature 341: 544-546), which t of a VH domain; (vi) isolated complementarity determining regions (CDR), and (vii) combinations of two or more isolated CDRs which may optionally be joined by a synthetic linker. Furthermore, although the two domains of the Fv nt, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242: 6; and Huston et al. (1988) Proc. Natl. Acad.

Sci. USA 85: 5879-5883). Such single chain antibodies are also intended to be encompassed within the term en-binding fragment" of an antibody. A further example is bindingdomain immunoglobulin fusion proteins comprising (i) a binding domain polypeptide that is fused to an immunoglobulin hinge region polypeptide, (ii) an immunoglobulin heavy chain CH2 constant region fused to the hinge region, and (iii) an globulin heavy chain CH3 constant region fused to the CH2 constant region. The binding domain polypeptide can be a heavy chain variable region or a light chain variable region. The binding-domain globulin fusion proteins are further disclosed in US 2003/01 18592 and US 2003/0133939. These antibody fragments are obtained using conventional ques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.

The term "bispecific molecule" is intended to include any agent, e.g., a protein, peptide, or protein or peptide complex, which has two different binding specificities. For example, the molecule may bind to, or interact with (a) a cell surface antigen, and (b) an Fc receptor on the surface of an effector cell. The term "multispecific molecule" or "heterospecific molecule" is intended to include any agent, e.g., a protein, peptide, or protein or peptide complex, which has more than two different binding specificities. For e, the molecule may bind to, or interact with (a) a cell e antigen, (b) an Fc receptor on the surface of an effector cell, and (c) at least one other component. Accordingly, the ion includes, but is not limited to, bispecific, trispecific, tetraspecific, and other multispecific molecules which are directed to CLDN18.2, and to other targets, such as Fc receptors on or cells. The term "bispecific dies" also includes diabodies. Diabodies are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing n the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see e.g. , Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448; , R. J., et al. (1994) Structure 2 : 1121-1 123).

An antibody may be conjugated to a therapeutic moiety or agent, such as a xin, a drug (e.g., an immunosuppressant) or a radioisotope. A cytotoxin or cytotoxic agent includes any agent that is detrimental to and, in particular, kills cells. Examples e taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, cin, etoposide, tenoposide, stine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Suitable therapeutic agents for forming antibody conjugates include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, guanine, cytarabine, fludarabin, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, a chlorambucil, melphalan, carmustine (BSNU) and lomustine , hosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), cyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC), and anti-mitotic agents (e.g., vincristine and vinblastine). In a preferred embodiment, the therapeutic agent is a cytotoxic agent or a radiotoxic agent. In another ment, the therapeutic agent is an immunosuppressant. In yet another embodiment, the therapeutic agent is GM-CSF. In a preferred embodiment, the eutic agent is doxorubicin, cisplatin, bleomycin, sulfate, carmustine, chlorambucil, cyclophosphamide or ricin A.

Antibodies also can be conjugated to a radioisotope, e.g., -131, yttrium-90 or indium- I l l , to generate xic radiopharmaceuticals.

The antibody ates of the invention can be used to modify a given biological response, and the drug moiety is not to be construed as limited to classical chemical therapeutic agents.

For example, the drug moiety may be a protein or polypeptide possessing a desired ical activity. Such proteins may include, for e, an enzymatically active toxin, or active fragment thereof, such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor or interferon-g ; or, biological response modifiers such as, for example, lymphokines, eukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors.

Techniques for conjugating such therapeutic moiety to antibodies are well known, see, e.g., Arnon et al., "Monoclonal dies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer y, Reisfeld et al. (eds. ), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., odies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in onal Antibodies '84: Biological And Clinical Applications, Pincheraet al. (eds. ), pp. 475-506 (1985); sis, Results, And Future ctive Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev., 62: 119-58 (1982).

As used herein, an antibody is ed from" a particular germline sequence if the antibody is obtained from a system by immunizing an animal or by screening an immunoglobulin gene library, and wherein the selected antibody is at least 90%, more preferably at least 95%, even more preferably at least 96%, 97%, 98%, or 99% identical in amino acid sequence to the amino acid sequence d by the germline immunoglobulin gene. lly, an antibody derived from a particular germline ce will display no more than 10 amino acid ences, more preferably, no more than 5, or even more preferably, no more than 4, 3, 2, or 1 amino acid difference from the amino acid sequence encoded by the germline immunoglobulin gene.

As used herein, the term "heteroantibodies" refers to two or more antibodies, derivatives thereof, or antigen binding regions linked together, at least two of which have different specificities. These different specificities include a binding specificity for an Fc receptor on an effector cell, and a binding specificity for an antigen or e on a target cell, e.g., a tumor cell.

The antibodies described herein may be monoclonal antibodies. The term "monoclonal antibody" as used herein refers to a preparation of antibody molecules of single molecular composition. A monoclonal antibody displays a single binding specificity and affinity. In one embodiment, the monoclonal antibodies are produced by a hybridoma which includes a B cell ed from a non-human animal, e.g., mouse, fused to an alized cell.

The antibodies bed herein may be recombinant antibodies. The term "recombinant antibody", as used herein, es all antibodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (e.g., a mouse) that is enic or transchromosomal with respect to the immunoglobulin genes or a hybridoma prepared therefrom, (b) antibodies isolated from a host cell transformed to express the antibody, e.g., from a transfectoma, (c) antibodies isolated from a recombinant, atorial antibody library, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of immunoglobulin gene sequences to other DNA sequences.

Antibodies described herein may be derived from different species, including but not limited to mouse, rat, rabbit, guinea pig and human. dies described herein include polyclonal and monoclonal antibodies and include IgA such as IgAl or IgA2, IgGl, IgG2, IgG3, IgG4, IgE, IgM, and IgD antibodies. In s embodiments, the antibody is an IgGl dy, more particularly an IgGl, kappa or IgGl, lambda isotype (i.e. IgGl, k, l), an IgG2a antibody (e.g. IgG2a, k, l), an IgG2b antibody (e.g.

IgG2b, K, l), an IgG3 antibody (e.g. IgG3, k , l) or an IgG4 dy (e.g. IgG4, k , l) .

The term "transfectoma", as used herein, includes recombinant eukaryotic host cells expressing an antibody, such as CHO cells, NS/0 cells, HEK293 cells, HEK293T cells, plant cells, or fungi, including yeast cells.

As used herein, a "heterologous antibody" is d in on to a transgenic organism ing such an antibody. This term refers to an antibody having an amino acid sequence or an encoding nucleic acid sequence corresponding to that found in an organism not consisting of the transgenic organism, and being generally derived from a species other than the transgenic organism.

As used herein, a "heterohybrid antibody" refers to an antibody having light and heavy chains of different organismal origins. For example, an dy having a human heavy chain associated with a murine light chain is a heterohybrid antibody.

The invention includes all dies and derivatives of antibodies as described herein which for the purposes of the invention are encompassed by the term "antibody". The term "antibody derivatives" refers to any modified form of an antibody, e.g., a conjugate of the antibody and another agent or antibody, or an antibody fragment.

The antibodies described herein are preferably isolated. An "isolated antibody" as used herein, is ed to refer to an antibody which is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds to CLDN18.2 is substantially free of antibodies that specifically bind antigens other than CLDN18.2). An isolated dy that specifically binds to an epitope, isoform or variant of human CLDN18.2 may, however, have cross-reactivity to other related antigens, e.g., from other species (e.g., CLDN18.2 species homologs). Moreover, an isolated antibody may be substantially free of other cellular material and/or chemicals. In one ment of the invention, a combination of "isolated" monoclonal dies relates to antibodies having different icities and being ed in a well defined composition or mixture.

The term "binding" according to the invention preferably relates to a specific binding.

According to the present invention, an antibody is capable of binding to a predetermined target if it has a significant affinity for said predetermined target and binds to said predetermined target in standard assays. "Affinity" or "binding affinity" is often measured by equilibrium dissociation constant (K D). Preferably, the term "significant affinity" refers to the binding to a predetermined target with a dissociation constant (K D) of 5 M or lower, 10 6 M or lower, 10 M or lower, 10 8 M or lower, 10 9 M or lower, 10 10 M or lower, 10 M or lower, or 10 12 M or lower.

An antibody is not (substantially) capable of binding to a target if it has no significant ty for said target and does not bind icantly, in particular does not bind detectably, to said target in standard assays. Preferably, the antibody does not detectably bind to said target if present in a concentration of up to 2, preferably 10, more preferably 20, in ular 50 or 100 g/ml or higher. Preferably, an antibody has no significant affinity for a target if it binds to said target with a K D that is at least 10-fold, 100-fold, 103-fold, 104-fold, 105-fold, or 106- fold higher than the K D for g to the ermined target to which the antibody is capable of binding. For example, if the K D for binding of an antibody to the target to which the antibody is capable of binding is 10 7 M, the KD for g to a target for which the antibody has no significant affinity would be is at least 10 6 M, 10 5 M, 10 4 M, 10 3 M, 10 2 M, or 10 M.

An antibody is specific for a predetermined target if it is capable of binding to said predetermined target while it is not capable of binding to other targets, i.e. has no significant ty for other targets and does not icantly bind to other targets in standard assays.

According to the ion, an antibody is specific for CLDN18.2 if it is capable of binding to CLDN18.2 but is not (substantially) capable of binding to other targets. Preferably, an antibody is specific for CLDN18.2 if the affinity for and the binding to such other targets does not significantly exceed the affinity for or binding to CLDN18.2-unrelated proteins such as bovine serum albumin (BSA), casein, human serum albumin (HSA) or non-claudin transmembrane proteins such as MHC molecules or transferrin receptor or any other specified polypeptide. Preferably, an antibody is specific for a predetermined target if it binds to said target with a KD that is at least 10-fold, 100-fold, 10 -fold, 104-fold, ld, or ld lower than the K D for binding to a target for which it is not specific. For example, if the K D for binding of an dy to the target for which it is specific is 10 7 M, the K D for binding to a target for which it is not specific would be at least 10 6 M, 10 5 M, 10 4 M, 10 3 M, 10 2 M, or O 1 M.

Binding of an antibody to a target can be determined experimentally using any suitable method; see, for example, Berzofsky et al., "Antibody-Antigen ctions" In Fundamental Immunology, Paul, W. E., Ed., Raven Press New York, N Y (1984), Kuby, Janis logy, W. H. Freeman and Company New York, N Y (1992), and methods described herein. ties may be readily determined using conventional ques, such as by equilibrium dialysis; by using the BIAcore 2000 instrument, using general procedures outlined by the manufacturer; by radioimmunoassay using radiolabeled target antigen; or by another method known to the skilled artisan. The affinity data may be analyzed, for example, by the method of Scatchard et al., Ann N.Y. Acad. ScL, 51:660 . The measured affinity of a particular antibody-antigen interaction can vary if measured under different conditions, e.g., salt concentration, pH. Thus, ements of affinity and other antigen-binding parameters, e.g., KD, IC50, are preferably made with standardized solutions of antibody and antigen, and a rdized buffer.

As used herein, "isotype" refers to the antibody class (e.g., IgM or IgGl) that is encoded by heavy chain constant region genes.

As used herein, "isotype switching" refers to the phenomenon by which the class, or isotype, of an antibody changes from one Ig class to one of the other Ig classes.

The term ally occurring" as used herein as applied to an object refers to the fact that an object can be found in nature. For example, a polypeptide or cleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring.

The term "rearranged" as used herein refers to a configuration of a heavy chain or light chain immunoglobulin locus wherein a V segment is positioned immediately adjacent to a D-J or J segment in a conformation encoding essentially a complete VH or VL domain, respectively.

A rearranged immunoglobulin (antibody) gene locus can be fied by comparison to ne DNA; a rearranged locus will have at least one ined heptamer/nonamer homology element.

The term "unrearranged" or "germline uration" as used herein in reference to a V segment refers to the configuration wherein the V segment is not recombined so as to be immediately adjacent to a D or J segment.

According to the invention an dy having the ability of binding to CLDN18.2 is an antibody capable of binding to an epitope present in CLDN18.2, ably an epitope located within the extracellular domains of CLDN18.2, in particular the first extracellular domain, preferably amino acid positions 29 to 78 of CLDN1 8.2. In particular embodiments, an antibody having the ability of binding to CLDN1 8.2 is an antibody capable of g to (i) an e on .2 which is not present on CLDN18.1, preferably SEQ ID NO: 3, 4, and 5, (ii) an epitope localized on the CLDN18.2-loopl, preferably SEQ ID NO: 8, (iii) an epitope localized on the CLDN18.2-loop2, preferably SEQ ID NO: 10, (iv) an epitope localized on the CLDN18.2-loopD3, preferably SEQ ID NO: 11, (v) an epitope, which encompass CLDN18.2-loopl and CLDN18.2-loopD3, or (vi) a non-glycosylated epitope localized on the CLDN18.2-loopD3, preferably SEQ ID NO: 9.

According to the invention an antibody having the ability of binding to CLDN18.2 preferably is an antibody having the ability of binding to CLDN18.2 but not to CLDN18.1. ably, an antibody having the ability of binding to CLDN18.2 is specific for CLDN18.2. Preferably, an antibody having the ability of binding to CLDN18.2 preferably is an antibody having the ability of binding to .2 expressed on the cell surface. In particular preferred embodiments, an antibody having the ability of binding to .2 binds to native es of CLDN18.2 present on the surface of living cells. Preferably, an antibody having the ability of binding to CLDN18.2 binds to one or more peptides selected from the group consisting of SEQ ID NOs: 1, 3-1 1, 44, 46, and 48-50. Preferably, an antibody having the ability of binding to CLDN18.2 is specific for the afore mentioned proteins, es or immunogenic fragments or derivatives thereof. An antibody having the ability of binding to CLDN18.2 may be obtained by a method comprising the step of immunizing an animal with a n or peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3-1 , 44, 46, and 48-50, or a nucleic acid or host cell expressing said n or peptide. Preferably, the antibody binds to cancer cells, in particular cells of the cancer types mentioned above and, preferably, does not bind substantially to non-cancerous cells.

Preferably, binding of an antibody having the ability of binding to .2 to cells expressing CLDN18.2 s or mediates killing of cells expressing CLDN18.2. The cells expressing CLDN18.2 are preferably cancer cells and are, in ular, selected from the group consisting of tumorigenic gastric, esophageal, pancreatic, lung, ovarian, colon, hepatic, head-neck, and gallbladder cancer cells. Preferably, the antibody induces or es killing of cells by inducing one or more of complement ent cytotoxicity (CDC) mediated lysis, antibody dependent cellular cytotoxicity (ADCC) mediated lysis, apoptosis, and inhibition of proliferation of cells expressing CLDN18.2. Preferably, ADCC mediated lysis of cells takes place in the presence of or cells, which in particular embodiments are selected from the group consisting of monocytes, mononuclear cells, NK cells and PMNs.

Inhibiting proliferation of cells can be measured in vitro by determining eration of cells in an assay using bromodeoxyuridine (5-bromodeoxyuridine, BrdU). BrdU is a synthetic side which is an analogue of thymidine and can be incorporated into the newly synthesized DNA of replicating cells (during the S phase of the cell cycle), substituting for thymidine during DNA replication. Detecting the incorporated chemical using, for example, antibodies specific for BrdU indicates cells that were actively replicating their DNA.

In preferred embodiments, antibodies described herein can be characterized by one or more of the following properties: a) specificity for CLDN1 8.2; b) a binding ty to CLDN18.2 of about 100 nM or less, preferably, about 5-10 nM or less and, more preferably, about 1-3 nM or less, c) the ability to induce or mediate CDC on CLDN1 8.2 positive cells; d) the ability to induce or mediate ADCC on CLDN1 8.2 ve cells; e) the ability to inhibit the growth of CLDN1 8.2 ve cells; f) the ability to induce apoptosis of CLDN1 8.2 positive cells.

In a particularly preferred embodiment, an antibody having the ability of binding to CLDN18.2 is produced by a hybridoma deposited at the DSMZ (Mascheroder Weg lb, 31824 Braunschweig, y; new address: Inhoffenstr. 7B, 31824 Braunschweig, Germany) and having the following ation and accession number: a. 182-D1 106-055, accesssion no. DSM ACC2737, deposited on October 19, 2005 b. 182-D1 106-056, accesssion no. DSM ACC2738, deposited on October 19, 2005 c. 182-D 1106-057, accesssion no. DSM ACC2739, deposited on October 19, 2005 d. 182-D1 106-058, accesssion no. DSM 0, ted on October 19, 2005 e. 182-D1 106-059, accesssion no. DSM ACC2741, ted on October 19, 2005 f . 182-D1 106-062, accesssion no. DSM ACC2742, ted on October 19, 2005, g. 182-D 1106-067, accesssion no. DSM ACC2743, deposited on October 19, 2005 h. 182-D758-035, accesssion no. DSM ACC2745, deposited on Nov. 17, 2005 i . 182-D758-036, accesssion no. DSM ACC2746, deposited on Nov. 17, 2005 j . 182-D758-040, accesssion no. DSM ACC2747, deposited on Nov. 17, 2005 k. 182-D 1106-061, accesssion no. DSM ACC2748, deposited on Nov. 17, 2005 1. 182-D1 106-279, accesssion no. DSM ACC2808, deposited on Oct. 26, 2006 m. 182-D1 106-294, accesssion no. DSM ACC2809, deposited on Oct. 26, 2006, n. 182-D1 106-362, accesssion no. DSM ACC2810, deposited on Oct. 26, 2006.

Preferred antibodies according to the invention are those produced by and obtainable from the above-described hybridomas; i.e. 37G1 1 in the case of 182-D1 106-055, 37H8 in the case of 182-D1 106-056, 38G5 in the case of 182-D1 106-057, 38H3 in the case of 182-D1 106-058, 39F1 1 in the case of 182-D1 106-059, 43A11 in the case of 182-D 1106-062, 61C2 in the case of 182-D1 7, 26B5 in the case of 182-D758-035, 26D12 in the case of 182-D758-036, 28D10 in the case of 182-D75 8-040, 42E12 in the case of 182-D 1106-061, 125E1 in the case of 182-D 1106-279, 163E12 in the case of 182-D 94, and 175D10 in the case of 182- Dl 106-362; and the chimerized and zed forms thereof.

Preferred chimerized antibodies and their sequences are shown in the following table. chimerized clone mAb Isotype variable region antibody heavy chain 43A1 182-D 1106-062 IgG2a SEQ ID NO:29 SEQ ID NO: 14 163E12 182-D 1106-294 IgG3 SEQ ID NO:30 SEQ ID NO: 15 125E1 182-D1 106-279 IgG2a SEQ ID NO:31 SEQ ID NO: 16 166E2 182-D1 106-308 IgG3 SEQ ID NO:33 SEQ ID NO: 18 175D10 182-D1 106-362 IgGl SEQ ID NO:32 SEQ ID NO: 17 45C1 182-D758-187 IgG2a SEQ ID NO:34 SEQ ID NO: 19 light chain 43A1 1 182-D 1106-062 IgK SEQ ID NO:36 SEQ ID NO:21 163E12 182-D 1106-294 IgK SEQ ID NO:35 SEQ ID NO:20 125E1 182-D 1106-279 IgK SEQ ID NO:37 SEQ ID NO:22 166E2 182-D1 8 IgK SEQ ID NO:40 SEQ ID NO:25 175D10 182-D1 106-362 IgK SEQ ID NO:39 SEQ ID NO:24 45C1 182-D758-187 IgK SEQ ID NO:38 SEQ ID NO:23 45C1 182-D758-187 IgK SEQ ID NO:41 SEQ ID NO:26 45C1 182-D758-187 IgK SEQ ID NO:42 SEQ ID NO:27 45C1 182-D758-187 IgK SEQ ID NO:43 SEQ ID NO:28 In preferred embodiments, antibodies, in particular chimerised forms of antibodies according to the invention include antibodies comprising a heavy chain constant region (CH) comprising an amino acid sequence derived from a human heavy chain constant region such as the amino acid sequence ented by SEQ ID NO: 13 or a fragment thereof. In further preferred embodiments, antibodies, in particular chimerised forms of antibodies according to the ion include dies comprising a light chain constant region (CL) comprising an amino acid sequence derived from a human light chain constant region such as the amino acid sequence represented by SEQ ID NO: 12 or a fragment thereof. In a particular preferred embodiment, antibodies, in particular ised forms of dies according to the invention include antibodies which comprise a CH sing an amino acid sequence derived from a human CH such as the amino acid sequence represented by SEQ ID NO: 13 or a fragment thereof and which comprise a CL comprising an amino acid ce derived from a human CL such as the amino acid sequence ented by SEQ ID NO: 12 or a fragment thereof.

In one ment, an antibody having the ability of binding to CLDN18.2 is a ic mouse/human IgGl monoclonal antibody comprising kappa, murine variable light chain, human kappa light chain constant region allotype Km(3), murine heavy chain variable region, human IgGl constant region, pe Glm(3).

In certain preferred embodiments, chimerised forms of antibodies include dies comprising a heavy chain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 14, 15, 16, 17, 18, 19, and a fragment thereof and/or comprising a light chain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 20, 21, 22, 23, 24, 25, 26, 27, 28, and a fragment thereof.

In certain preferred embodiments, chimerised forms of antibodies include antibodies comprising a combination of heavy chains and light chains selected from the following possibilities (i) to (ix): (i) the heavy chain comprises an amino acid sequence represented by SEQ ID NO: 14 or a fragment thereof and the light chain comprises an amino acid sequence represented by SEQ ID NO: 2 1 or a fragment thereof, (ii) the heavy chain comprises an amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof and the light chain comprises an amino acid sequence represented by SEQ ID NO: 20 or a fragment thereof, (iii) the heavy chain comprises an amino acid sequence represented by SEQ ID NO: 16 or a nt thereof and the light chain comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof, (iv) the heavy chain comprises an amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof and the light chain comprises an amino acid sequence ented by SEQ ID NO: 25 or a fragment f, (v) the heavy chain comprises an amino acid ce represented by SEQ ID NO: 7 or a fragment thereof and the light chain comprises an amino acid sequence ented by SEQ ID NO: 24 or a fragment thereof, (vi) the heavy chain comprises an amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof and the light chain comprises an amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof, (vii) the heavy chain comprises an amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof and the light chain comprises an amino acid sequence represented by SEQ ID NO: 26 or a fragment thereof, (viii) the heavy chain comprises an amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof and the light chain comprises an amino acid ce represented by SEQ ID NO: 27 or a fragment thereof, and (ix) the heavy chain comprises an amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof and the light chain comprises an amino acid ce represented by SEQ ID NO: 28 or a fragment thereof.

"Fragment" or "fragment of an amino acid sequence" as used above relates to a part of an antibody sequence, i.e. a sequence which represents the antibody sequence shortened at the N- and/or C-terminus, which when it replaces said antibody sequence in an antibody retains g of said antibody to CLDN18.2 and preferably functions of said antibody as described herein, e.g. CDC mediated lysis or ADCC ed lysis. Preferably, a fragment of an amino acid sequence comprises at least 80%, preferably at least 90%, 95%, 96%, 97%, 98%, or 99% of the amino acid residues from said amino acid sequence. A fragment of an amino acid sequence selected from the group consisting of SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, and 28 preferably relates to said sequence wherein 17, 18, 19, 20, 21, 22 or 23 amino acids at the inus are removed.

In a preferred embodiment, an antibody having the ability of binding to CLDN18.2 comprises a heavy chain le region (VH) sing an amino acid sequence selected from the group ting of SEQ ID NOs: 29, 30, 31, 32, 33, 34, and a fragment thereof.

In a preferred ment, an antibody having the ability of binding to .2 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 35, 36, 37, 38, 39, 40, 41, 42, 43, and a fragment thereof.

In certain preferred embodiments, an antibody having the ability of binding to CLDN18.2 comprises a combination of heavy chain variable region (VH) and light chain variable region (VL) selected from the following ilities (i) to (ix): (i) the VH comprises an amino acid sequence represented by SEQ ID NO: 29 or a fragment thereof and the VL ses an amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof, (ii) the VH comprises an amino acid sequence represented by SEQ ID NO: 30 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 35 or a fragment thereof, (iii) the VH comprises an amino acid ce represented by SEQ ID NO: 3 1 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof, (iv) the VH comprises an amino acid ce represented by SEQ ID NO: 33 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 40 or a fragment thereof, (v) the VH comprises an amino acid sequence represented by SEQ ID NO: 32 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 39 or a fragment thereof, (vi) the VH comprises an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof and the VL comprises an amino acid ce represented by SEQ ID NO: 38 or a fragment thereof, (vii) the VH comprises an amino acid sequence represented by SEQ ID NO: 34 or a fragment f and the VL comprises an amino acid sequence represented by SEQ ID NO: 4 1 or a fragment f, (viii) the VH comprises an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 42 or a fragment thereof, (ix) the VH comprises an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 43 or a fragment thereof.

In a preferred embodiment, an antibody having the ability of binding to CLDN18.2 comprises a VH sing a set of complementarity-determining regions CDR1, CDR2 and CDR3 ed from the ing embodiments (i) to (vi): (i) CDRl: positions 45-52 of SEQ ID NO: 14, CDR2: positions 70-77 of SEQ ID NO: 14, CDR3: ons 116-125 of SEQ ID NO: 14, (ii) CDRl: positions 45-52 of SEQ ID NO: 15, CDR2: positions 70-77 of SEQ ID NO: 15, CDR3: positions 116-126 of SEQ ID NO: 15, (iii) CDRl : positions 45-52 of SEQ ID NO: 16, CDR2: positions 70-77 of SEQ ID NO: 16, CDR3: positions 116-124 of SEQ ID NO: 16, (iv) CDRl: positions 45-52 of SEQ ID NO: 17, CDR2: ons 70-77 of SEQ ID NO: 17, CDR3: positions 116-126 of SEQ ID NO: 17, (v) CDRl: positions 44-51 of SEQ ID NO: 18, CDR2: positions 69-76 of SEQ ID NO: 18, CDR3: ons 115-125 of SEQ ID NO: 18, and (vi) CDRl: positions 45-53 of SEQ ID NO: 19, CDR2: positions 71-78 of SEQ ID NO: 19, CDR3: positions 117-128 of SEQ ID NO: 19.

In a preferred embodiment, an antibody having the ability of binding to .2 comprises a VL comprising a set of mentarity-determining regions CDRl, CDR2 and CDR3 selected from the following embodiments (i) to (ix): (i) CDRl : positions 47-58 of SEQ ID NO: 20, CDR2: positions 76-78 of SEQ ID NO: 20, CDR3: positions 115-123 of SEQ ID NO: 20, (ii) CDRl: positions 49-53 of SEQ ID NO: 21, CDR2: positions 71-73 of SEQ ID NO: 21, CDR3: positions 110-1 18 of SEQ ID NO: 21, (iii) CDRl: positions 47-52 of SEQ ID NO: 22, CDR2: positions 70-72 of SEQ ID NO: 22, CDR3: positions 109-1 17 of SEQ ID NO: 22, (iv) CDRl: positions 47-58 of SEQ ID NO: 23, CDR2: positions 76-78 of SEQ ID NO: 23, CDR3: positions 115-123 of SEQ ID NO: 23, (v) CDRl : positions 47-58 of SEQ ID NO: 24, CDR2: positions 76-78 of SEQ ID NO: 24, CDR3: positions 115-123 of SEQ ID NO: 24, (vi) CDRl: positions 47-58 of SEQ ID NO: 25, CDR2: positions 76-78 of SEQ ID NO: 25, CDR3: positions 115-122 of SEQ ID NO: 25, (vii) CDRl: positions 47-58 of SEQ ID NO: 26, CDR2: positions 76-78 of SEQ ID NO: 26, CDR3: positions 115-123 of SEQ ID NO: 26, (viii) CDRl : ons 47-58 of SEQ ID NO: 27, CDR2: positions 76-78 of SEQ ID NO: 27, CDR3: positions 115-123 of SEQ ID NO: 27, and (ix) CDRl: ons 47-52 of SEQ ID NO: 28, CDR2: positions 70-72 of SEQ ID NO: 28, CDR3: positions 109-1 17 of SEQ ID NO: 28.

In a preferred embodiment, an antibody having the ability of binding to CLDN18.2 comprises a combination of VH and VL each comprising a set of complementarity-determining s CDR1, CDR2 and CDR3 selected from the following ments (i) to (ix): (i) VH: CDR1: positions 45-52 of SEQ ID NO: 14, CDR2: positions 70-77 of SEQ ID NO: 14, CDR3: positions 116-125 of SEQ ID NO: 14, VL: CDR1 : positions 49-53 of SEQ ID NO: 21, CDR2: positions 71-73 of SEQ ID NO: 21, CDR3: positions 110-1 18 of SEQ ID NO: 21, (ii) VH: CDR1: positions 45-52 of SEQ ID NO: 15, CDR2: positions 70-77 of SEQ ID NO: , CDR3: positions 116-126 of SEQ ID NO: 15, VL: CDR1 : positions 47-58 of SEQ ID NO: , CDR2: positions 76-78 of SEQ ID NO: 20, CDR3: positions 115-123 of SEQ ID NO: 20, (iii) VH: CDR1 : positions 45-52 of SEQ ID NO: 16, CDR2: positions 70-77 of SEQ ID NO: 16, CDR3: positions 116-124 of SEQ ID NO: 16, VL: CDR1 : positions 47-52 of SEQ ID NO: 22, CDR2: ons 70-72 of SEQ ID NO: 22, CDR3: positions 109-1 17 of SEQ ID NO: 22, (iv) VH: CDR1: positions 44-51 of SEQ ID NO: 18, CDR2: positions 69-76 of SEQ ID NO: 18, CDR3: positions 115-125 of SEQ ID NO: 18, VL: CDR1: positions 47-58 of SEQ ID NO: , CDR2: positions 76-78 of SEQ ID NO: 25, CDR3: positions 115-122 of SEQ ID NO: 25, (v) VH: CDR1 : positions 45-52 of SEQ ID NO: 17, CDR2: positions 70-77 of SEQ ID NO: 17, CDR3: positions 116-126 of SEQ ID NO: 17, VL: CDR1: positions 47-58 of SEQ ID NO: 24, CDR2: positions 76-78 of SEQ ID NO: 24, CDR3: positions 115-123 of SEQ ID NO: 24, (vi) VH: CDR1: positions 45-53 of SEQ ID NO: 19, CDR2: positions 71-78 of SEQ ID NO: 19, CDR3: positions 117-128 of SEQ ID NO: 19, VL: CDR1: ons 47-58 of SEQ ID NO: 23, CDR2: positions 76-78 of SEQ ID NO: 23, CDR3: positions 115-123 of SEQ ID NO: 23, (vii) VH: CDR1 : positions 45-53 of SEQ ID NO: 19, CDR2: positions 71-78 of SEQ ID NO: 19, CDR3: positions 117-128 of SEQ ID NO: 19, VL: CDR1: positions 47-58 of SEQ ID NO: 26, CDR2: positions 76-78 of SEQ ID NO: 26, CDR3: ons 115-123 of SEQ ID NO: 26, (viii) VH: CDR1: positions 45-53 of SEQ ID NO: 19, CDR2: positions 71-78 of SEQ ID NO: 19, CDR3: positions 117-128 of SEQ ID NO: 19, VL: CDR1: positions 47-58 of SEQ ID NO: 27, CDR2: positions 76-78 of SEQ ID NO: 27, CDR3: ons 115-123 of SEQ ID NO: 27, (ix) VH: CDR1: positions 45-53 of SEQ ID NO: 19, CDR2: positions 71-78 of SEQ ID NO: 19, CDR3: positions 117-128 of SEQ ID NO: 19, VL: CDR1 : ons 47-52 of SEQ ID NO: 28, CDR2: positions 70-72 of SEQ ID NO: 28, CDR3: positions 109-1 17 of SEQ ID NO: 28.

In further preferred embodiments, an antibody having the ability of binding to CLDN18.2 preferably comprises one or more of the complementarity-determining regions (CDRs), preferably at least the CDR3 variable , of the heavy chain variable region (VH) and/or of the light chain variable region (VL) of a monoclonal antibody against CLDN18.2, preferably of a onal antibody against CLDN18.2 described herein, and preferably comprises one or more of the complementarity-determining s (CDRs), preferably at least the CDR3 variable region, of the heavy chain variable regions (VH) and/or light chain variable regions (VL) described herein. In one embodiment said one or more of the complementarity-determining regions (CDRs) are selected from a set of complementaritydetermining regions CDR1, CDR2 and CDR3 described . In a particularly preferred embodiment, an antibody having the ability of binding to CLDN18.2 preferably comprises the complementarity-determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or of the light chain variable region (VL) of a monoclonal antibody against CLDN18.2, preferably of a monoclonal antibody t CLDN18.2 described herein, and preferably comprises the complementarity-determining regions CDR1, CDR2 and CDR3 of the heavy chain variable regions (VH) and/or light chain variable regions (VL) described herein.

In one embodiment an antibody comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs together with their ening framework regions. Preferably, the n will also include at least about 50% of either or both of the first and fourth framework regions, the 50% being the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region.

Construction of antibodies made by inant DNA techniques may result in the introduction of residues N- or C-terminal to the le regions d by linkers uced to facilitate cloning or other manipulation steps, including the uction of linkers to join le regions of the invention to further protein sequences including immunoglobulin heavy chains, other variable domains (for example in the tion of diabodies) or protein labels.

In one embodiment an antibody comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs in a human antibody framework.

Reference herein to an antibody comprising with respect to the heavy chain thereof a particular chain, or a particular region or ce preferably relates to the situation wherein all heavy chains of said antibody comprise said particular chain, region or sequence. This applies pondingly to the light chain of an antibody.

The term "nucleic acid", as used , is intended to include DNA and RNA. A c acid may be single-stranded or double-stranded, but preferably is double-stranded DNA. ing to the invention, the term "expression" is used in its most general meaning and comprises the production of RNA or of RNA and protein/peptide. It also comprises partial expression of nucleic acids. Furthermore, expression may be d out transiently or stably.

The teaching given herein with respect to specific amino acid ces, e.g. those shown in the sequence listing, is to be ued so as to also relate to variants of said specific sequences resulting in ces which are functionally equivalent to said specific sequences, e.g. amino acid sequences exhibiting ties identical or similar to those of the specific amino acid sequences. One important ty is to retain binding of an antibody to its target or to sustain effector functions of an antibody. Preferably, a sequence which is a variant with respect to a specific sequence, when it replaces the specific sequence in an antibody retains binding of said antibody to .2 and preferably functions of said antibody as described herein, e.g. CDC mediated lysis or ADCC mediated lysis.

It will be appreciated by those skilled in the art that in particular the sequences of the CDR, hypervariable and variable regions can be modified without losing the ability to bind CLDN18.2. For example, CDR regions will be either identical or highly homologous to the regions of antibodies specified herein. By "highly gous" it is contemplated that from 1 to 5, preferably from 1 to 4, such as 1 to 3 or 1 or 2 substitutions may be made in the CDRs.

In addition, the hypervariable and variable regions may be modified so that they show substantial homology with the regions of dies specifically disclosed herein.

For the purposes of the present invention, "variants" of an amino acid sequence comprise amino acid insertion variants, amino acid addition ts, amino acid deletion variants and/or amino acid substitution variants. Amino acid deletion variants that comprise the deletion at the N-terminal and/or C-terminal end of the protein are also called N-terminal and/or C-terminal tion variants.

Amino acid insertion variants comprise insertions of single or two or more amino acids in a particular amino acid sequence. In the case of amino acid sequence variants having an insertion, one or more amino acid residues are inserted into a particular site in an amino acid sequence, although random insertion with appropriate screening of the resulting t is also possible.

Amino acid addition variants comprise amino- and/or carboxy-terminal fusions of one or more amino acids, such as 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids.

Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence, such as by removal of 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletions may be in any position of the protein.

Amino acid substitution variants are characterized by at least one residue in the sequence being removed and another residue being inserted in its place. Preference is given to the modifications being in positions in the amino acid ce which are not conserved between homologous ns or es and/or to replacing amino acids with other ones having similar properties. Preferably, amino acid changes in protein variants are conservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids. A conservative amino acid change involves substitution of one of a family of amino acids which are related in their side chains. Naturally occurring amino acids are generally divided into four families: acidic tate, glutamate), basic (lysine, arginine, histidine), non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, phan), and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, ne) amino acids.

Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.

Preferably the degree of similarity, ably ty between a given amino acid sequence and an amino acid sequence which is a variant of said given amino acid ce will be at least about 60%, 65%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The degree of similarity or identity is given preferably for an amino acid region which is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference amino acid sequence. For example, if the reference amino acid ce consists of 200 amino acids, the degree of rity or identity is given preferably for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids, preferably uous amino acids. In preferred embodiments, the degree of similarity or ty is given for the entire length of the reference amino acid sequence. The alignment for determining sequence similarity, preferably sequence identity can be done with art known tools, preferably using the best sequence alignment, for example, using Align, using standard settings, ably EMBOSS ::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.

"Sequence similarity" indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences.

The term "percentage identity" is intended to denote a percentage of amino acid residues which are identical between the two sequences to be compared, obtained after the best alignment, this percentage being purely statistical and the differences between the two sequences being distributed randomly and over their entire length. Sequence comparisons between two amino acid sequences are conventionally carried out by comparing these sequences after having aligned them optimally, said comparison being carried out by t or by "window of comparison" in order to identify and compare local regions of sequence similarity. The l alignment of the sequences for comparison may be produced, besides manually, by means of the local gy algorithm of Smith and Waterman, 1981, Ads App. Math. 2, 482, by means of the local homology algorithm of Neddleman and Wunsch, 1970, J . Mol. Biol. 48, 443, by means of the similarity search method of Pearson and , 1988, Proc. Natl Acad. Sci. USA 85, 2444, or by means of computer programs which use these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N and TFASTA in Wisconsin cs Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).

The percentage identity is calculated by ining the number of identical positions between the two ces being compared, dividing this number by the number of positions compared and multiplying the result obtained by 100 so as to obtain the percentage identity between these two sequences.

The term "transgenic animal" refers to an animal having a genome sing one or more transgenes, preferably heavy and/or light chain transgenes, or transchromosomes (either integrated or non-integrated into the animal's natural genomic DNA) and which is preferably capable of expressing the transgenes. For example, a transgenic mouse can have a human light chain transgene and either a human heavy chain transgene or human heavy chain transchromosome, such that the mouse produces human anti-CLDN18.2 antibodies when immunized with CLDN18.2 antigen and/or cells expressing CLDN18.2. The human heavy chain transgene can be integrated into the chromosomal DNA of the mouse, as is the case for transgenic mice, e.g., HuMAb mice, such as HCo7 or HCol2 mice, or the human heavy chain transgene can be maintained hromosomally, as is the case for transchromosomal (e.g., KM) mice as described in WO 02/43478. Such transgenic and transchromosomal mice may be capable of producing multiple isotypes of human monoclonal antibodies to CLDN18.2 (e.g., IgG, IgA and/or IgE) by undergoing V-D-J recombination and isotype switching.

"Reduce", "decrease" or "inhibit" as used herein means an overall decrease or the ability to cause an l decrease, preferably of 5% or greater, 10% or greater, 20% or greater, more preferably of 50% or greater, and most preferably of 75% or greater, in the level, e.g. in the level of sion or in the level of proliferation of cells.

Terms such as ase" or "enhance" preferably relate to an increase or enhancement by about at least 10%, preferably at least 20%, preferably at least 30%, more preferably at least 40%, more ably at least 50%, even more preferably at least 80%, and most ably at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000% or even more. isms of mAb action Although the ing provides considerations regarding the mechanism underlying the therapeutic efficacy of antibodies of the invention it is not to be considered as limiting to the invention in any way.

The antibodies bed herein preferably interact with components of the immune system, preferably through ADCC or CDC. Antibodies described herein can also be used to target payloads (e.g., radioisotopes, drugs or toxins) to directly kill tumor cells or can be used istically with traditional chemotherapeutic , attacking tumors through complementary mechanisms of action that may include anti-tumor immune responses that may have been compromised owing to a chemotherapeutic's cytotoxic side s on T lymphocytes. However, antibodies bed herein may also exert an effect simply by binding to CLDN1 8.2 on the cell surface, thus, e.g. ng eration of the cells.

Antibody-dependent cell-mediated cytotoxicity ADCC describes the cell-killing ability of effector cells as described herein, in particular cytes, which preferably requires the target cell being marked by an antibody.

ADCC preferably occurs when antibodies bind to antigens on tumor cells and the antibody Fc domains engage Fc receptors (FcR) on the surface of immune effector cells. l families of Fc receptors have been identified, and specific cell populations characteristically express defined Fc receptors. ADCC can be viewed as a mechanism to directly induce a variable degree of immediate tumor destruction that leads to antigen presentation and the induction of tumor-directed T-cell responses. Preferably, in vivo induction of ADCC will lead to tumordirected T-cell responses and host-derived dy responses.

Complement-dependent cytotoxicity CDC is another cell-killing method that can be directed by antibodies. IgM is the most effective isotype for complement activation. IgGl and IgG3 are also both very ive at directing CDC via the classical complement-activation pathway. ably, in this cascade, the formation of antigen-antibody complexes results in the uncloaking of multiple Clq binding sites in close proximity on the C H2 domains of participating antibody molecules such as IgG molecules (Clq is one of three subcomponents of complement CI). Preferably these uncloaked Clq binding sites t the previously low-affinity Clq-IgG interaction to one of high avidity, which triggers a cascade of events involving a series of other complement proteins and leads to the lytic release of the effector-cell chemotactic/activating agents C3a and C5a. Preferably, the complement cascade ends in the formation of a membrane attack complex, which creates pores in the cell membrane that facilitate free passage of water and solutes into and out of the cell. tion and testing of antibodies dies described herein can be produced by a variety of ques, including conventional monoclonal antibody methodology, e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256: 495 (1975). Although somatic cell hybridization procedures are preferred, in ple, other techniques for producing monoclonal antibodies can be employed, e.g., viral or oncogenic ormation of B- lymphocytes or phage display techniques using libraries of antibody genes.

The preferred animal system for preparing hybridomas that secrete monoclonal antibodies is the murine . Hybridoma production in the mouse is a very well established procedure.

Immunization protocols and techniques for isolation of immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known.

Other preferred animal systems for preparing hybridomas that secrete monoclonal antibodies are the rat and the rabbit system (e.g. described in Spieker-Polet et al., Proc. Natl. Acad. Sci.

U.S.A. 92:9348 (1995), see also Rossi et al, Am. J . Clin. . 124: 295 (2005)).

In yet another preferred embodiment, human monoclonal antibodies can be generated using transgenic or hromosomal mice carrying parts of the human immune system rather than the mouse . These transgenic and transchromosomic mice include mice known as HuMAb mice and KM mice, respectively, and are collectively ed to herein as "transgenic mice." The production of human antibodies in such transgenic mice can be performed as described in detail for CD20 in WO2004 035607 Yet another strategy for generating monoclonal antibodies is to directly isolate genes encoding antibodies from cytes producing antibodies of defined specificity e.g. see Babcock et al., 1996; A novel strategy for generating monoclonal antibodies from single, isolated lymphocytes producing antibodies of defined specificities. For details of recombinant antibody engineering see also Welschof and Kraus, Recombinant antibodes for cancer therapy ISBN896038 and Benny K.C. Lo Antibody Engineering ISBN 1092-1.

To generate antibodies, mice can be zed with carrier-conjugated peptides derived from the n sequence, i.e. the sequence against which the antibodies are to be directed, an enriched preparation of recombinantly expressed antigen or fragments thereof and/or cells expressing the antigen, as described. Alternatively, mice can be immunized with DNA encoding the antigen or fragments thereof. In the event that immunizations using a purified or enriched preparation of the n do not result in antibodies, mice can also be immunized with cells sing the antigen, e.g., a cell line, to promote immune responses.

The immune response can be monitored over the course of the zation protocol with plasma and serum samples being obtained by tail vein or retroorbital bleeds. Mice with sufficient titers of immunoglobulin can be used for fusions. Mice can be boosted intraperitonealy or intravenously with antigen expressing cells 3 days before sacrifice and removal of the spleen to increase the rate of specific antibody secreting omas.

To generate hybridomas producing monoclonal antibodies, splenocytes and lymph node cells from immunized mice can be isolated and fused to an riate immortalized cell line, such as a mouse myeloma cell line. The resulting hybridomas can then be screened for the production of antigen-specific antibodies. Individual wells can then be ed by ELISA for antibody secreting hybridomas. By Immunofluorescence and FACS analysis using antigen expressing cells, antibodies with specificity for the antigen can be identified. The antibody secreting hybridomas can be ed, screened again, and if still ve for monoclonal antibodies can be subcloned by limiting dilution. The stable subclones can then be cultured in vitro to generate antibody in tissue culture medium for characterization.

Antibodies also can be produced in a host cell transfectoma using, for example, a combination of recombinant DNA techniques and gene transfection methods as are well known in the art (Morrison, S. (1985) Science 229: 1202).

For example, in one embodiment, the gene(s) of st, e.g., antibody genes, can be ligated into an expression vector such as a eukaryotic expression plasmid such as used by the GS gene expression system sed in WO 87/04462, WO 89/01036 and EP 338 841 or other sion systems well known in the art. The purified plasmid with the cloned antibody genes can be introduced in eukaryotic host cells such as CHO cells, NS/0 cells, HEK293T cells or HEK293 cells or alternatively other otic cells like plant derived cells, fungal or yeast cells. The method used to introduce these genes can be methods described in the art such as electroporation, lipofectine, lipofectamine or others. After introduction of these antibody genes in the host cells, cells expressing the dy can be identified and selected.

These cells ent the transfectomas which can then be amplified for their expression level and upscaled to produce antibodies. Recombinant antibodies can be isolated and purified from these culture supernatants and/or cells.

Alternatively, the cloned antibody genes can be expressed in other expression systems, including prokaryotic cells, such as microorganisms, e.g. E. coli. rmore, the antibodies can be ed in transgenic non-human animals, such as in milk from sheep and rabbits or in eggs from hens, or in transgenic plants; see e.g. Verma, R., et al. (1998) J . Immunol. Meth. 216: 1; Pollock, et al. (1999) J . l. Meth. 231 : 147-157; and Fischer, R., et al. (1999) Biol. Chem. 380: 825-839.

Chimerization Murine monoclonal antibodies can be used as therapeutic antibodies in humans when labeled with toxins or radioactive isotopes. Nonlabeled murine antibodies are highly genic in man when repetitively applied leading to reduction of the therapeutic effect. The main immunogenicity is mediated by the heavy chain constant s. The immunogenicity of murine antibodies in man can be reduced or completely avoided if respective antibodies are chimerized or humanized. Chimeric antibodies are antibodies, the different portions of which are derived from different animal species, such as those having a variable region derived from a murine antibody and a human immunoglobulin constant region. Chimerisation of antibodies is achieved by joining of the variable regions of the murine antibody heavy and light chain with the constant region of human heavy and light chain (e.g. as described by Kraus et al., in Methods in lar Biology series, Recombinant dies for cancer therapy ISBN 896038). In a preferred embodiment chimeric antibodies are generated by g human kappa-light chain constant region to murine light chain variable region. In an also preferred ment chimeric antibodies can be generated by joining human lambda-light chain constant region to murine light chain variable region. The preferred heavy chain constant regions for generation of chimeric antibodies are IgGl, IgG3 and IgG4. Other preferred heavy chain constant regions for generation of chimeric antibodies are IgG2, IgA, IgD and IgM.

Humanization Antibodies interact with target antigens predominantly through amino acid residues that are d in the six heavy and light chain complementarity ining regions (CDRs). For this reason, the amino acid sequences within CDRs are more diverse between individual antibodies than sequences e of CDRs. Because CDR sequences are responsible for most antibody-antigen ctions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing sion vectors that include CDR sequences from the specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see, e.g., Riechmann, L. et al. (1998) Nature 332: 323-327; Jones, P. et al. (1986) Nature 321 : 522-525; and Queen, C. et al. (1989) Proc. Natl. Acad. Sci. U. S. A. 86: 10029-10033). Such framework sequences can be obtained from public DNA databases that include germline antibody gene sequences. These germline sequences will differ from mature antibody gene sequences e they will not e completely assembled variable genes, which are formed by V (D) J joining during B cell maturation. Germline gene ces will also differ from the sequences of a high affinity secondary repertoire antibody at individual evenly across the variable region.

The ability of antibodies to bind an antigen can be determined using standard binding assays (e.g., ELISA, Western Blot, Immunofluorescence and flow cytometric analysis).

To purify antibodies, selected hybridomas can be grown in ter spinner-flasks for monoclonal antibody purification. Alternatively, antibodies can be ed in dialysis based bioreactors. Supernatants can be filtered and, if necessary, concentrated before affinity chromatography with protein arose or protein A-sepharose. Eluted IgG can be checked by gel electrophoresis and high performance liquid chromatography to ensure purity. The buffer solution can be exchanged into PBS, and the concentration can be determined by OD280 using 1.43 tion coefficient. The monoclonal antibodies can be aliquoted and stored at -80°C.

To determine if the selected monoclonal antibodies bind to unique epitopes, site-directed or multi-site directed mutagenesis can be used.

To determine the isotype of antibodies, isotype ELISAs with s commercial kits (e.g.

Zymed, Roche stics) can be performed. Wells of microtiter plates can be coated with anti-mouse Ig. After blocking, the plates are reacted with monoclonal dies or purified isotype controls, at ambient temperature for two hours. The wells can then be reacted with either mouse IgGl, IgG2a, IgG2b or IgG3, IgA or mouse IgM-specific peroxidase-conjugated probes. After g, the plates can be developed with ABTS substrate ( 1 mg/ml) and analyzed at OD of 405-650. Alternatively, the IsoStrip Mouse Monoclonal Antibody Isotyping Kit (Roche, Cat. No. 1493027) may be used as described by the manufacturer.

In order to demonstrate presence of antibodies in sera of immunized mice or binding of monoclonal antibodies to living cells expressing antigen, flow cytometry can be used. Cell lines expressing naturally or after transfection antigen and negative controls lacking antigen expression (grown under standard growth conditions) can be mixed with s concentrations of monoclonal dies in hybridoma supernatants or in PBS containing 1% FBS, and can be incubated at 4°C for 30 min. After washing, the APC- or 47-labeled anti IgG antibody can bind to antigen-bound monoclonal antibody under the same conditions as the primary antibody staining. The samples can be analyzed by flow cytometry with a FACS instrument using light and side scatter properties to gate on single, living cells. In order to distinguish antigen-specific monoclonal dies from non-specific binders in a single measurement, the method of co-transfection can be employed. Cells transiently transfected with ds encoding antigen and a scent marker can be stained as described above.

Transfected cells can be detected in a different fluorescence l than antibody-stained cells. As the majority of transfected cells express both transgenes, antigen-specific monoclonal antibodies bind preferentially to fluorescence marker expressing cells, whereas non-specific antibodies bind in a able ratio to non-transfected cells. An alternative assay using fluorescence microscopy may be used in addition to or instead of the flow cytometry assay. Cells can be stained exactly as described above and examined by scence microscopy.

In order to trate ce of antibodies in sera of immunized mice or g of monoclonal antibodies to living cells expressing antigen, immunofluorescence microscopy analysis can be used. For e, cell lines expressing either spontaneously or after transfection antigen and negative controls lacking antigen expression are grown in chamber slides under standard growth conditions in DMEM/F12 medium, supplemented with 10 % fetal calf serum (FCS), 2 M L-glutamine, 100 IU/ml penicillin and 100 mg/ml streptomycin.

Cells can then be fixed with methanol or paraformaldehyde or left untreated. Cells can then be reacted with monoclonal antibodies against the antigen for 30 min. at 25°C. After washing, cells can be reacted with an Alexa555-labelled anti-mouse IgG ary antibody (Molecular Probes) under the same conditions. Cells can then be examined by fluorescence microscopy.

Cell extracts from cells sing antigen and appropriate negative ls can be prepared and subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. After electrophoresis, the separated antigens will be transferred to nitrocellulose membranes, blocked, and probed with the monoclonal antibodies to be tested. IgG g can be ed using anti-mouse IgG peroxidase and developed with ECL substrate.

Antibodies can be further tested for reactivity with n by Immunohistochemistry in a manner well known to the skilled person, e.g. using paraformaldehyde or acetone fixed cryosections or paraffin embedded tissue sections fixed with paraformaldehyde from non- cancer tissue or cancer tissue samples obtained from ts during routine surgical ures or from mice carrying xenografted tumors inoculated with cell lines expressing spontaneously or after transfection antigen. For immunostaining, antibodies reactive to antigen can be incubated followed by horseradish-peroxidase conjugated goat anti-mouse or goat anti-rabbit antibodies (DAKO) according to the vendors instructions.

Antibodies can be tested for their ability to mediate phagocytosis and killing of cells expressing CLDN18.2. The testing of monoclonal antibody activity in vitro will provide an initial ing prior to testing in vivo models.

Antibody dependent cell-mediated cytotoxicity (ADCC) Briefly, polymorphonuclear cells (PMNs), NK cells, monocytes, mononuclear cells or other effector cells, from healthy donors can be purified by Ficoll Hypaque density centrifugation, followed by lysis of contaminating erythrocytes. Washed effector cells can be suspended in RPMI supplemented with 10% nactivated fetal calf serum or, alternatively with 5% heat-inactivated human serum and mixed with 5 Cr labeled target cells expressing CLDN18.2, at various ratios of effector cells to target cells. Alternatively, the target cells may be labeled with a fluorescence enhancing ligand ). A highly fluorescent chelate of Europium with the enhancing ligand which is released from dead cells can be measured by a fluorometer. Another alternative technique may utilize the transfection of target cells with luciferase. Added lucifer yellow may then be ed by viable cells only. Purified anti- CLDN18.2 IgGs can then be added at various concentrations. Irrelevant human IgG can be used as negative control. Assays can be carried out for 4 to 20 hours at 37°C depending on the effector cell type used. Samples can be assayed for cytolysis by measuring 5 Cr release or the presence of the EuTDA chelate in the culture supernatant. Alternatively, luminescence resulting from the oxidation of lucifer yellow can be a measure of viable cells.

LDN18.2 monoclonal antibodies can also be tested in various combinations to determine whether cytolysis is enhanced with multiple monoclonal antibodies. ment dependent cytotoxicity (CDC) Monoclonal anti-CLDN18.2 antibodies can be tested for their ability to mediate CDC using a y of known techniques. For example, serum for complement can be obtained from blood in a manner known to the skilled person. To determine the CDC activity of mAbs, different methods can be used. 5 Cr release can for example be measured or elevated membrane permeability can be assessed using a propidium iodide (PI) exclusion assay. Briefly, target cells can be washed and 5 x 10 /ml can be incubated with various concentrations of mAb for -30 min. at room temperature or at 37°C. Serum or plasma can then be added to a final concentration of 20% (v/v) and the cells incubated at 37°C for 20-30 min. All cells from each sample can be added to the PI solution in a FACS tube. The mixture can then be analyzed immediately by flow cytometry analysis using FACSArray.

In an alternative assay, induction of CDC can be determined on nt cells. In one embodiment of this assay, cells are seeded 24 h before the assay with a density of 3 x 104/well in tissue-culture flat-bottom microtiter plates. The next day growth medium is removed and the cells are incubated in triplicates with antibodies. Control cells are ted with growth medium or growth medium containing 0.2% saponin for the determination of ound lysis and maximal lysis, respectively. After incubation for 20 min. at room temperature supernatant is removed and 20% (v/v) human plasma or serum in DMEM (prewarmed to 37°C) is added to the cells and ted for another 20 min. at 37°C. All cells from each sample are added to propidium iodide solution (10 mg/ml). Then, supernatants are replaced by PBS containing 2.5 mg/ml ethidium e and fluorescence on upon excitation at 520 nm is measured at 600 nm using a Tecan Safire. The percentage specific lysis is calculated as s: % specific lysis = (fluorescence sample-fluorescence ound)/ (fluorescence maximal fluorescence background) x 100.

Induction of apoptosis and tion of cell proliferation by monoclonal antibodies To test for the ability to initiate apoptosis, monoclonal LDN18.2 antibodies can, for e, be incubated with CLDN18.2 positive tumor cells, e.g., SNU-16, DAN-G, KATO- III or CLDN18.2 transfected tumor cells at 37°C for about 20 hours. The cells can be harvested, washed in Annexin-V binding buffer (BD ences), and incubated with n V conjugated with FITC or APC (BD biosciences) for 15 min. in the dark. All cells from each sample can be added to PI solution (10 g/ml in PBS) in a FACS tube and assessed immediately by flow cytometry (as above). Alternatively, a general inhibition of cell- eration by monoclonal antibodies can be detected with commercially available kits. The DELFIA Cell Proliferation Kit n-Elmer, Cat. No. AD0200) is a non-isotopic immunoassay based on the measurement of 5-bromo-2'-deoxyuridine (BrdU) incorporation during DNA synthesis of proliferating cells in microplates. Incorporated BrdU is detected using europium labelled monoclonal antibody. To allow antibody detection, cells are fixed and DNA denatured using Fix solution. Unbound antibody is washed away and DELFIA inducer is added to dissociate europium ions from the labelled antibody into solution, where they form highly fluorescent es with components of the DELFIA Inducer. The fluorescence measured - ing time-resolved fluorometry in the detection - is proportional to the DNA synthesis in the cell of each well. nical studies Monoclonal antibodies which bind to CLDN18.2 also can be tested in an in vivo model (e.g. in immune ent mice carrying xenografted tumors inoculated with cell lines expressing CLDN18.2, e.g. DAN-G, , or KATO-III, or after transfection, e.g. HEK293) to determine their efficacy in controlling growth of CLDN18.2-expressing tumor cells.

In vivo studies after xenografting CLDN1 8.2 expressing tumor cells into immunocompromised mice or other animals can be performed using antibodies described herein. Antibodies can be administered to tumor free mice followed by injection of tumor cells to measure the effects of the antibodies to prevent formation of tumors or tumor-related symptoms. Antibodies can be administered to tumor-bearing mice to determine the therapeutic efficacy of respective antibodies to reduce tumor growth, metastasis or tumor related symptoms. Antibody ation can be combined with application of other substances as cystostatic drugs, growth factor inhibitors, cell cycle blockers, angiogenesis inhibitors or other antibodies to ine synergistic cy and potential toxicity of combinations. To analyze toxic side effects mediated by antibodies animals can be inoculated with antibodies or control reagents and thoroughly investigated for symptoms possibly related to CLDN1 8.2- antibody therapy. Possible side effects of in vivo application of CLDN18.2 antibodies particularly include toxicity at CLDN18.2 expressing tissues including stomach. Antibodies recognizing CLDN18.2 in human and in other s, e.g. mice, are particularly useful to predict potential side effects mediated by application of monoclonal CLDN18.2-antibodies in humans.

Mapping of epitopes ized by antibodies can be performed as described in detail in "Epitope Mapping Protocols ds in Molecular Biology) by Glenn E. Morris ISBN- 0896039 and in "Epitope Mapping: A Practical Approach" Practical Approach Series, 248 by Olwyn M . R. Westwood, Frank C. Hay.

The compounds and agents bed herein may be administered in the form of any suitable pharmaceutical composition.

Pharmaceutical compositions are usually provided in a uniform dosage form and may be ed in a manner known per se. A ceutical composition may e.g. be in the form of a on or suspension.

A pharmaceutical composition may comprise salts, buffer substances, vatives, carriers, diluents and/or excipients all of which are preferably pharmaceutically able. The term "pharmaceutically acceptable" refers to the non-toxicity of a material which does not interact with the action of the active component of the ceutical ition.

Salts which are not pharmaceutically acceptable may used for preparing pharmaceutically acceptable salts and are included in the invention. Pharmaceutically acceptable salts of this kind comprise in a non limiting way those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic acids, and the like. ceutically acceptable salts may also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts or calcium salts.

Suitable buffer substances for use in a pharmaceutical composition include acetic acid in a salt, citric acid in a salt, boric acid in a salt and phosphoric acid in a salt.

Suitable vatives for use in a pharmaceutical composition include benzalkonium de, chlorobutanol, paraben and thimerosal.

An injectible formulation may comprise a pharmaceutically acceptable excipient such as Ringer Lactate.

The term "carrier" refers to an organic or inorganic component, of a natural or synthetic nature, in which the active ent is combined in order to tate, e or enable application. According to the invention, the term "carrier" also includes one or more compatible solid or liquid fillers, diluents or encapsulating substances, which are suitable for stration to a patient.

Possible carrier substances for parenteral administration are e.g. sterile water, Ringer, Ringer lactate, sterile sodium chloride solution, polyalkylene glycols, enated naphthalenes and, in ular, biocompatible lactide polymers, lactide/glycolide copolymers or polyoxyethylene/polyoxy- propylene copolymers.

The term "excipient" when used herein is intended to indicate all substances which may be present in a pharmaceutical composition and which are not active ingredients such as, e.g., carriers, binders, lubricants, thickeners, surface active agents, preservatives, emulsifiers, buffers, flavoring agents, or colorants.

The agents and compositions described herein may be administered via any conventional route, such as by eral administration ing by injection or infusion. Administration is preferably parenterally, e.g. enously, intraarterially, subcutaneously, intradermally or intramuscularly.

Compositions suitable for parenteral administration usually comprise a sterile aqueous or nonaqueous ation of the active compound, which is preferably isotonic to the blood of the recipient. Examples of compatible carriers and solvents are Ringer solution and isotonic sodium de solution. In addition, usually sterile, fixed oils are used as solution or suspension medium.

The agents and compositions described herein are administered in effective amounts. An "effective amount" refers to the amount which es a d reaction or a desired effect alone or together with r doses. In the case of treatment of a particular disease or of a particular condition, the desired reaction preferably relates to inhibition of the course of the disease. This comprises slowing down the progress of the disease and, in particular, interrupting or reversing the progress of the disease. The desired reaction in a treatment of a e or of a condition may also be delay of the onset or a prevention of the onset of said disease or said condition.

An effective amount of an agent or composition described herein will depend on the condition to be treated, the ness of the disease, the individual parameters of the patient, including age, physiological condition, size and weight, the duration of treatment, the type of an accompanying y (if present), the specific route of administration and similar factors.

Accordingly, the doses stered of the agents described herein may depend on various of such ters. In the case that a reaction in a patient is insufficient with an l dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be used.

The agents and compositions described herein can be administered to patients, e.g., in vivo, to treat or prevent a y of disorders such as those bed herein. Preferred patients include human patients having disorders that can be corrected or ameliorated by administering the agents and compositions described herein. This includes disorders involving cells characterized by an altered expression pattern of CLDN18.2.

For example, in one embodiment, antibodies described herein can be used to treat a patient with a cancer disease, e.g., a cancer disease such as described herein characterized by the presence of cancer cells expressing CLDN18.2.

The pharmaceutical itions and methods of treatment described according to the invention may also be used for immunization or vaccination to prevent a disease described herein.

The present invention is further illustrated by the following examples which are not be ued as limiting the scope of the invention.

EXAMPLES Example 1; Material and Methods 1. Antibodies Table 1: dies used herein 2. Immunhistochemistry (IHC) Tissue sections (4 mhi thickness) were stored at 2-8 °C until use.

Prior to the deparaffinization process the sections were incubated at 58-60 °C in a drying oven for 1 hour to melt the paraffin and to quantitatively remove water, y ing adherence of the tissues to the glass slides ("baking").

Deparaffinization After melting and drying, the slides were deparaffinized using two xylol steps (5 minutes) and rehydrated using a descending alcohol array (at an ambient temperature of 20-27 °C): • 5 (±1 ) minutes in a xylene bath; • this step was repeated once in a fresh bath; • excess liquid; • 5 (±1) minutes in te ethanol; • repeat this step once with a fresh bath; • remove excess liquid; • 5 (±1) minutes in 96 % ethanol; • repeat this step once with a fresh bath; • remove excess liquid; • 5 (±1) minutes in 80 % l; • remove excess liquid; • 5 (±1) minutes in 70 % l; • remove excess liquid; • 5 minutes in distilled or deionized water; Epitope retrieval and quenching Following the paraffin removal the target epitopes were retrieved by using a heat induced epitope retrieval procedure. Therefore the slides were put in staining jars filled with 200 ml of retrieval buffer (10 raM Citric buffer; 0.05 % Tween-20; pH 6) and incubated in a pressure cooker (PASCAL, Dako) at 120 °C for 10 minutes. Afterwards the jars were removed from the cooker and allowed to cool in the e Retrieval Solution for 10 (±1) min at room temperature. The slides were rinsed in Wash Buffer (lx PBS).

After cooling the sections were moved into staining jars filled with 200 ml quenching solution (0.3 % Peroxidase in l x PBS) and incubated for 15 min at room temperature, followed by 2x minutes washing steps in fresh wash buffer.

Blocking and antibody incubation The excess wash buffer was removed, the slides were covered with 200 mΐ blocking buffer (10% goat serum in l x PBS) and ted at RT for 30 minutes. The blocking buffer was removed and replaced by 200 mΐ diluted antibody solution (dilution in ng ). The slides were incubated with the primary antibody overnight at 2-8 °C: Table 2: Dilution of primary antibodies for histology analysis - stock concentration and final concentration of the antibodies used in histological assays On the next day the primary antibody on was removed and the sections were washed for 3x 5 min with washing . Afterwards the excess wash buffer was removed and 200 mΐ of the ready-to-use secondary antibody solution was added (Power Vision HRP goat-a-mouse; Immunologic; NL). The slides were incubated for 30 min at RT. The excess liquid was removed and the slides washed for 3x 5 min in fresh washing buffer.

Substrate reaction and counterstaining After removal of excess washing buffer the sections were covered with approx. 50-150 mΐ of the y prepared substrate-chromogen on (VectorRed; Vector Labs) for 2 min. The excess substrate was removed and the slides were incubated in jars with deionized water for 1-5 min.

Subsequently, a counterstain of the tissue was performed by immersing the sections in jars containing 200 ml of Mayer 's haematoxylin for 2 min. ards the sections were placed in tap water for 5-10 min for the blueing of the nuclei.

Dehydration and mounting After performing the counterstaining, the sections were dehydrated using an ascending alcohol array: • dipping in 70% ethanol x. 5-10 sec) • dipping in 80% ethanol (approx. 5-10 sec) • dipping in 96% ethanol (approx. 5-10 sec) • dipping in 96% l (approx. 5-10 sec) • g in absolute ethanol (approx. 5-10 sec) • 5 min in xylene • 5 min in xylene For the mounting of the samples a non-aqueous mounting medium (X-TRA-Kit, Medite) was used. The slides were mounted directly from the last xylene filled jar and air dried at RT.

Table 3: Tissue micro arrays for histology analysis 3 . Cell culture All atic cancer cell lines and onal l cell lines used for experiments presented herein are cultivated in media according to data sheets of origin and following standard tissue culture procedures. Conditions are summarized in Table 4. For all newly obtained cell lines, cells were tested for mycoplasm contamination and a master cell bank was prepared.

Table 4. Cell culture conditions for human pancreatic cancer and control cell lines 1: LVT refers to cell lines stably transduced with lentivirus for expression of CLDN 18.2. 2 : Seeding density in the mentioned flask or dish for cultivation of cells for 2 or 3 days. 3 : adM : Cells are-recultivated from subcutaneous tumors Seeding density Cell line 1 Flask/dish Medium Incubation 2 days 2 3 days 2 CFPAC-1 T150 Iscove 's M D + 10% FCS 5% C0 , 37°C 5e6 3e6 DANG 1C5F2 15 cm RPMI + 1% Pen/Strep + 10% FCS 5% C0 , 37°C 4e6 2e6 RPMI + 1% Pen/Strep + 10% FCS + 1 Mg/ml DANG 1C5F2 LVT 15 cm 5% C0 , 37°C 4e6 2e6 Blasticidin (fresh) DMEM:F12 + 1% Pen/Strep + 10% FCS + 7.5 % C0 , HEK293p740#A5 15 cm 8e6 5e6 1.5mg/mL Geneticin (G-418) 37"C DMEM:F12 +15 mM HEPES + 0.002mg/ml HPAC T150 5% C0 , 37°C 6e6 4e6 human Insulin + 10 ng/mL EGF + 5% FCS DMEM:F12 +15 mM HEPES + 0.002 mg/ml HPAC-LVT T150 human Insulin + 10 ng/mL EGF + 5% FCS + 1% 5% C0 , 37°C 6e6 4e6 Pen/Strep + 3.5 / ml Blasiticidin (fresh) HPAF-II T150 MEM + 10% FCS 5% C0 2, 37°C 5e6 5e6 MEM + l x MEM NEAA + 1 mM sodium HUP-T3 T150 5% C0 , 37°C 6e6 3e6 pyruvate + 10% FCS MEM + l x MEM NEAA + 1 mM sodium HUP-T4 T150 5% C0 , 37°C 6e6 4e6 pyruvate + 20% FCS KATO III FGF-BP RPMI + 1% Pen/Strep + 4 mM Glutamax 7.5 % C0 , T150 8e6 5e6 #12 adM 3 (total) + 20% FCS 37°C KP-2 T150 RPMI + 10% FCS 5% C0 2, 37°C 8e6 6e6 MiaPaCa-2 T150 MEM+ 10% FCS 5% C0 , 37 C le7 8e6 MEM+ 10% FCS + 1% Pen/Strep + 1.5 g/ m aLVT T150 5% C0 , 37"C le7 8e6 Blasticidin UGC-4 sub lOcHll subElO T150 RPMI + 1% rep + 10% FCS 5% C0 , 37°C 8e6 C 5e6 C Luci#2 Panc-1 T150 DMEM + 10% FCS 5% C0 , 37°C 6e6 C 4e6 C RPMI + 10 mM HEPES + 1 mM sodium Panc03.27 T150 pyruvate + 4.5 g/L glucose + O.Olmg/mL 5% C0 , 37°C 6e6 C 4e6 C Insulin + 15% FCS RPMI + 10 mM HEPES + 1 mM sodium Panc05.04 T150 pyruvate + 4.5g/L glucose + 0.01 mg/mL 5% C0 , 37°C 6e6 C 4e6 C Insulin + 15% FCS RPMI + 10 mM HEPES + 1 mM sodium Panc05.04 T150 pyruvate + 4.5 g/L glucose + 0.01 mg/ml 5% C0 2, 37°C 7e6 C 5e6 C subclones Insulin + 15% FCS Patu8902 T150 DMEM+ 10% FCS 5% C0 , 37°C 5e6 C 4e6 C DMEM+ 10% FCS + 1% Pen/Strep + Patu8902-LVT T150 5% C0 , 37°C 5e6 C 4e6 C 9 g/ l Blasticidin (fresh) Patu8988T T150 DMEM + 5% horse serum + 5% FCS 5% C0 , 37°C 3e6 C le6 C -7.5% C0 Patu8988S T150 DMEM + 5% horse serum + 5% FCS 2 1.5e7 le7 37°C RPMI + 10 mM HEPES + 1 mM sodium 6 T150 5% C0 2, 37°C 5e6 3e6 pyruvate + 4.5g/L e + 10% FCS Suit-2 T150 RPMI + 10% FCS (use new flask for each split) 5% C0 , 37°C 1.5e7 1.2e7 RPMI + 10% FCS + 1% Pen/Strep + 5 Mg/ml SuitLVT T150 Blasticidin ) 5% C0 , 37°C 1.5e7 1.2e7 (use new flask for each split) SW1990 T150 Leibovitz's L-15 + 10% FCS 37°C 4e6 3e6 YAPC T150 RPMI + 10% FCS Gold 5% C0 , 37°C 1.5e7 le7 Seeding density Cell line 1 Flask/dish Medium tion 2 days2 3 days2 P I + 10% FCS Gold + 1% rep + 0.5 YAPC-LVT T150 5% C0 , 37°C 1.5e7 le7 g/ml Blasticidin (fresh) 4. Luciferase ection of pancreas cell lines For ADCC assays pancreatic cancer cell lines were transiently transfected with luciferase RNA. This luciferase RNA (pSTl-luc2mut-2hBgUTR-A121-EciI vector (pSTl-109)) was produced with an ARCA cap and dissolved in H20 . RNA was stored in 22 mΐ aliquots at - 80°C. For all pancreas cell lines the optimal electroporation conditions were determined resulting in highest ection rates and viability of the cells. In each assay cells were detached with PBS/ 5 mM EDTA and 2.5x1 06 cells dissolved in 250 mΐ X-Vivo were mixed in ice-cold cuvettes with 10 mg RNA. Cells were immediately electroporated (GenePulser Xcell, Biorad) and ended in pre-warmed Assay-medium adjusting the cells to 5x1 05 cells/ml.

Tested electroporation conditions were for all cell lines: EP1: 250 V, 475 m EP2: 200 V, 300 m EP3: 150 V, 300 m EP4: 200 V, 400 m EP5: 250 V, 950 m Control: 0 V, 0 mR The viability of the cells was ined directly after electroporation using CASY or by staining cells with Trypan blue and determining the percentage of dead cells in the Neubauer chamber. Cells were seeded in quadruplicates in white 96-well plates (2.5x1 04 cells/well) and incubated for 24h. Subsequently, luciferase activity was measured in a luminometer (Tecan Infinite200) after addition of luciferin mix for 90 min. Transfection was successful and consequently ADCC measurable, if RLU values > 1.000 were obtained. . tative real-time PCR (Q-PCR) For RNA isolation from pancreatic cancer cell lines, cells were seeded in 10 cm dishes and grown for 2-3 days until 80% confluent. RNA was isolated according to instructions supplied with the RNeasy® Mini Kit (Qiagen). cDNA ation was performed following manufacturers instructions provided with the Superscript® III First Strand kit (Invitrogen).

RNA and cDNA samples were stored at -80°C.

Quantitative analysis of CLDN18.2 transcripts was performed by amplifying oligo(dT)- primed cDNAs in a 40 cycle PCR reaction using PCR primers #5054s (5'- AGAGAGCTCTGGCTTCACCGAGTG-3 ') and #5060as (5'- CCAGAAGTT AGTCACCAGCATGTTGG-3 ') entiating between .1 and .2 isoforms. The reaction was prepared with SYBR Green (QuantiTect SYBR Green PCR Kit, Qiagen), which intercalates in double stranded DNA. The reactions and measurements were performed using the ABI-PRISM7900 Sequence Detection System instrument and software (Applied Biosystems).

The ve expression levels of CLDN18 transcripts was computed using AACT calculation with respect to the house keeping gene HPRT. 6. n blot analysis For ion of proteins of pancreatic cancer cell lines, cells were seeded in 10 cm dishes and grown for 2-3 days until 80% confluent. Cells were lysed by addition of 800 mΐ 4x SDS sample buffer (34% glycin, 250 mM Tris pH6.8, 5% b-mercaptoethanol, 8.2% SDS). To disintegrate the c DNA, the protein samples were sonified under following conditions: Output Control: level 1, Duty Cycle: 70% for 20-25 sec. n concentration was measured in a spectrophotometer (Absorption at 280nm) and samples were stored at -80°C until use.

To detect CLDN18.2 expression in Western blots, a 12.5% poly acrylamide gel for separation (for 2 small gels 4.1 ml 29:1 acrylamide/bis-acrylamide, 100 mΐ 10% SDS, 2.5 ml Tris pH8.8, 3.2 ml H20 , 100 mΐ APS, 10 mΐ TEMED) was prepared between two fixed glass plates. After rization the gel was overlaid with a stacking gel (1.5 ml 29:1 mide/bisacrylamide , 100 mΐ 10% SDS, 2.5 ml Tris pH6.8, 5.8 ml H20 , 100 mΐ APS, 10 mΐ TEMED) and a gel comb was placed between the glass plates. After polymerization the gel was loaded with 75 mg of each protein sample prepared by addition of ( 1:20) 4x SDS-sample buffer (250 mM Tris-HCL, 34% Glycerine, 8.2% SDS, pH 6.8) and 7.5 mΐ of a size marker-mix (1.5 mΐ Magic Mark XP n Standard mixed with 6 mΐ SeaBlue Plus2 Prestained Standard). Gels were run in l x SDS running buffer (25 mM Tris, 0.192 M Glycin, 0.1% SDS) at 80 V for 30 min and 180 V for 60 min. Semi-dry blotting of the gel on a nitrocellulose membrane was performed for 90 min at 160 mA in l x transfer buffer (25 mM Tris, 0.192 mM glycin, 20% MeOH). Blots were first blocked in 5% milk powder/PBS and primary antibodies (0.25 mg/ml anti-Claudinl8 (C-term) or 0.1 g/ml anti- -actin) were added in a solution of 1% milk powder/PBS. Blots were incubated over night at 4°C, washed 3 times 10 min in l x PBS/0.05% Tween20 and then ted for l h with labelled secondary antibodies at room ature in 1% milk /PBS (goat-anti-rabbit IgG (FC) diluted 1:1000). Blots were washed again 3 times 10 min in l x PBS/0.05% Tween20 and detection was performed by addition of 1-3 ml detection solution (Pico and Dura Detection System (Pierce) for 1 min and scanning of the blots in a LAS-3000 detection box (Increment: lOsec, Interval Time: lOsec, Sensitivity: high) ing to GA_056_Chemolumineszenzentwickler LAS3000. 7. Flowcytometry (FACS) Cells were harvested with PBS/5 mM EDTA or Trypsin/EDTA from an exponentially growing culture at 70-85% confluency. Cells were counted, centrifuged for 5 min (468 g) and the pellet was ended in FACS buffer (2% FCS, 0.1% sodium azide in PBS) adjusting the concentration to 2xl0 /ml. 100 mΐ cells were plated in round bottom 96-well plates and again centrifuged (5 min, 468 g). IMAB362 (or isotype control Rituximab) was ly diluted 0.1-200 ^g/ml ( 11 dilution steps + no antibody control) in 50 mΐ FACS-buffer and added to the cells for 30 min at 4°C. Then, 200 mΐ FACS buffer was added to each well and plates were centrifuged (5 min, 468 g). The supernatant was removed and washing was ed. Secondary goat anti-human antibodies (FC specific, F(ab ')2 conjugated with APC (Dianova)) were diluted ) in FACS buffer and 30 mΐ was added to each well. Plates were incubated for 30 min at 4°C. After incubation plates were washed again two times with 200 mΐ FACS buffer and the pellet was finally resuspended in 100 mΐ FACS buffer for measurement FACS Array Bioanalyzer (BD) according to GA_018_BD FACS Array bioanalyzer. 8. Lentiviral transduction Lentiviral vector construction: Lentiviruses belong to the R A viruses, which stably integrate into human genomic DNA of both dividing and non-dividing cells. Vector pLenti6.4 (Invitrogen) was used as backbone. It contains a Blasticidin gene for ion of vely transduced cells. CLDN18.2 fused to the EFla promoter was cloned into the recombination region of the vector generating pL64B42E (EFla-hCLaudinl8.2)-Blasticidin (Figure 1). ion of cell lines: Cell lines were selected according to literature data or, which were previously tested in vivo. ion criteria included homogenous subcutaneous growth in nude mice and a therapeutic window of 20-100 days. Three cell lines (DANG, YAPC and BxPC3) were ated that already showed weak expression of CLDN18.2 mRNA and three (MiaPaCa-2, Patu8902 and Suit-2) that are able to metastasize according to literature. Two other cell lines (known to grow as homogenous subcutaneous tumors in vivo) were selected randomly (HPAC, CAPAN1).

Determination of blasticidin selection conditions: For all cell lines the blasticidin tration required for selection of cells after lentiviral transduction was determined before transduction was performed. Pancreatic cancer cells were seeded in 6 well plates at a high density, resulting in 80-90% ence after 24h. Blasticidin (Stock: 10 mg/ml, Invitrogen) was added to the wells in increasing concentrations g from 0.5-12 g/ml (5 dilution steps + no blasticidin control). The medium was exchanged every 3-4 days and cells were analyzed in a microscope before removing the medium. The amount of dead cells and the condition of the living cells was documented. Cells were cultivated for 14 days. The lowest blasticidin concentration causing 100% apoptotic cells after 14 days was preferred for ion of lentivirally transduced cells. The required blasticidin concentrations for each of the established LVT cell lines are indicated in Table 4.

Envelope selection: For lentiviral transduction, GFP-lentiviral control vector pL64B42E- (EF 1a-GFP)-blast was packaged into different pe particles (VSV-G, GALV, RD1 14, Mokola-G and Rabies-G). Depending on the proteins present in the envelope and the composition of the cellular membrane, attachment to the target cancer cells is more or less ent. For all pancreatic cancer cell lines the VSV-G envelope showed highest transduction efficiency (68.5-91.2%) (Table 5). Consequently, the CLDN18.2 expression vector pL64B42E hCLaudinl8.2)-Blasticidin was packaged into VSV-G envelopes. Producer cells were ed and the viruses were isolated from the medium at high titers (3.86xl0 7 particles/ml). Viral supernatants were stored at -80°C.

Table 5: Generation of CLDN18.2 over-expressing atic cancer cell lines by lentiviral transduction Efficiencies obtained by packaging of the vector in VSV-G envelope particles, measured 2 days after infection.

Lentiviral transduction of pancreatic cancer cell lines: For infection of the pancreatic cancer target cell lines, a 24-well plate was coated with 200 mΐ l x retronectin® (20 g l, Takara Inc.) and the plate was sealed with parafilm® and incubated for 3-16 h at 4°C. Plates were washed with 200 ml PBS and blocked with PBS/2%BSA for 30 min at RT. Plates were washed again and loaded with 300 mΐ viral supernatant by centrifugation for 25 min at 2500 rpm at 15°C. The supernatant was removed and loading was repeated 3 times. The plates were finally washed once with PBS and target cells at low passage were seeded in each well. For all pancreatic cancer cell lines, 5xl0 5-lxl0 7 cells per 24 well were . Plates were incubated for 2 days at 37°C. Subsequently cells were ed and transduction efficiency was determined by FACS using a FITC-labeled IMAB362 dy. Cells were expanded and a master cell bank was ed for each cell line. 9. ADCC assay Pancreatic cancer target cells were seeded two days in advance in flasks to obtain 80-90% confluent cultures on the day ADCC started. Pancreatic cancer cells were transfected with luciferase RNA and were seeded in white 96 well plates at a density of lxl 04 cells per well in 50 mΐ assay medium (culture medium as described in Table 4 with 20 mM HEPES). NUGC-4 sub lOcHl l subElO Luci#2 cells (8000 cells/well) were seeded in addition as positive controls in all assays. Cells were cultivated for 4-6 h before addition of antibody and purified PBMCs.

PBMCs were prepared from fresh human buffy coat obtained from y donors. About 3x -25 ml blood was diluted ( 1:2) with PBS and carefully d on 4x 15 ml Paque Plus (GE care) in 50 ml Falcon tubes. Gradients were centrifuged (25 min, 700 g).

After centrifugation, peripheral blood mononuclear cells (PBMC) were collected from the hase, washed in PBS/2 mM EDTA, centrifuged (5 min, 468 g), again resuspended in PBS/2 mM EDTA and centrifuged (10 min, 208 g) to remove the platelets. The pellets were ended in 50 ml PBS/2 mM EDTA and cells were counted. PBMCs were centrifuged (5 min, 468 g) and resuspended in X-Vivo-15 culture medium at a concentration of 1.6xl0 7 cells/ml for addition to the pancreas cells and 1.28xl0 7 cells/ml for on to the NUGC-4 sub lOcHl l subElO Luci#2 cells.

Antibodies (IMAB362 and the isotype control antibody ch78Hl l 1H6) were serially diluted (4.5 fold) 10 times resulting in a concentration range of 200 mg/ml-0.26 ng/ml. Of each dilution 25 mΐ was added in quadruplicates to the target cells. PBS without antibodies was added in the medium and lysis control wells. Subsequently, 25 mΐ PBMCs were added to each well (E:T ratio = 40:1) and plates were incubated for 24 h ± 1 h at 37°C, 5% C0 2.

The next day, 10 m 8% Triton X100/PBS solution was added to the lysis control wells and 10 mΐ PBS in all other wells. Finally, 50 mΐ freshly prepared luciferin stock on was added (160 mM HEPES, l x PBS, 3.84 mg/ml D-Luciferin (BD Biosciences)) to each well and plates were incubated for 80 min at RT in the dark. Luminescence resulting from the oxidation of lucifer yellow by the luciferase of viable cells was measured using a microplate-reader (Infinite200, Tecan, Switzerland). Percentage of cellular cytotoxicity was calculated using the following formula: Specific killing (%) = 100 - [(RLU SamPle - RLU triton) / (RLUmedium Ctrl - RLUtriton) x 100] . CDC CDC was performed as follows.

Target cells (CHO-K1 p740 MACS/FACS (24H5) p3151 Luci#2A5) were seeded in 50 mΐ assay medium in 96-well white assay plates (10,000 cells/well) and grown for 24h+20 min at 37°C, 7.5% C02 und 95% rH before addition of the s. Each 96-well assay plate sed a total number of 3 different negative controls (heat inactivated serum, serum with and without IMAB362 and serum with an isotype l antibody (Rituximab)) and a positive control of healthy human serum pool (lot #3103201 1) with 500 ng/ml IMAB362. An additional positive control was generated at the end of the reaction by addition of 0.8% Triton XI00 to a second medium control well causing total lysis. One of the 96-well assay plates comprised a functional positive l generated by 7 serial 3.16fold dilutions of IMAB362 (10 000 - 31.8 ng/ml). This control resulted in a sigmoid dose-dependent lysis of target cells.

All samples were prepared (200 mΐ each) at the same time in a 96 well deepwell dilution plate.

Samples were taken 3 times from each well by reverse pipetting to generate the triplicates in the assay plates. After addition of 50 mΐ of each test and control item to the assay plates, plates were incubated for 80+5 min at 37°C, 7.5% C02 und 95% rH.

To each well 10 mΐ PBS was added, except in the Triton-Lysis control wells. To each Triton- Lysis control well, 10 mΐ 0.8% /PBS on was added. Luciferin ate solution was prepared (61 14 mΐ Aqua bidest, 2496 mΐ HEPES (1M), 1998 mΐ lxDPBS, 4992 mΐ D- Luciferin Stocksolution (12 mg/ml)). To each well 50 mΐ Luciferin ate solution was added. Plates were incubated at 37°C, 7.5% C02 und 95% rH for 45 min. Plates will be measured in a microplate reader.

• Complement-dependent lysis was calculated using formula: Specific lysis (%) = 100 - [(RLUsample - RLUtriton) / (RLUHSCM - RLUtriton) x 100 )] Modifications for testing the pancreatic cancer cell lines: • Pancreatic cancer cells were ected with luciferase RNA using optimized conditions. For each cell line tested, 1.5x104 cells were seeded per well.

• Since most pancreatic cancer cell lines are difficult to detach and to singularize, n was used on day 1.

• Pancreatic cancer cells in assay plates were cultured at 37°C, 5% C02.

• CDC assays with herapeutic agents ated cells was done with following IMAB362 or as isotype control antibody ch78Hl l 1H6 antibody concentrations: 640000, 160000, 40000, 10000, 2500, 625, 156 and 39 ng/ml. 11. Inhibition of proliferation To analyze dose-response curves of each chemotherapeutic agent, a proliferation assay was performed.

Table 6: Pancreas cancer cell lines to analyze efficacy of gemcitabine or oxaliplatin Inhibition of proliferation after applying gemcitabine or latin in different concentrations for each pancreas cancer cell line was analyzed .

Cells were seeded in 96well plates and after 4-6 hours gemcitabine or oxaliplatin was added in following concentrations: 1000, 500, 250, 100 and 20 ng/ml. The proliferation assay was incubated for 4 days at 37°C and 5% C02. 50 mΐ XTT complete reagent (50 parts XTT + 1 part coupl. reagent mixed) was added and incubated at 37°C. Measurement of absorbance (cells plus supernatant) was done with the Tecan Safire after 3 h and 4 h. Inhibition of proliferation was calculated ed to medium values set as 100%. EC50 values for gemcitabine and oxaliplatin were calculated in the GraphPad Prism program. 12. Cultivation of pancreas cancer cell lines with chemotherapeutic drugs for ADCC or CDC For DANG 4 to 6E+06 cells were seeded and cultivated for 2 days in medium or medium + 1 ng/ml gemcitabine or 1 ng/ml abine + 10 ng/ml latin. 1-1.4E+07 Patu8988S were seeded and cultivated without or with 10 ng/ml gemcitabine or 10 ng/ml gemcitabine in combination with oxaliplatin 100 ng/ml.

On the day ADCC started, the protocol described above was ed and cell surface expression of CLDN18 was determined in FACS analysis as described above. 13. Ce cycle analyses Cells were plated in six-well plates, and 5-6 hours later chemotherapeutic agents were added for either 24 h 48 h or 3 days. Cells floating in the medium were combined with the adherent cell layer, which was trypsinized. Cells were . Either cell cycle analysis was started directly or cell surface ng was done before as described above. Cells are resuspended in 1 ml PBS and added to 3 ml 4% PFA. After 15 min fixation of cells at room temperature cells are pelleted and washed. For RNAse treatment cells were resuspended in 200 mΐ RNAse (10000 U/ml) plus 0.05% Triton X-100 and incubated for 30 min at 37°C. 1 ml PBS was added and samples were centrifuged and resuspended in 200 mΐ PBS/PJ 50 g l. At least 30 min later samples were ready to be analyzed by flow cytometry. Cell cycle phase distribution was determined using FlowJo software to analyze DNA content rams. 14. Apoptose assay Following the ted treatments, apoptosis was measured by annexin V binding (detection kit I) or by a DNA fragmentation assay irect) as recommended by the manufacturer ingen, San Diego, CA). Briefly, cells floating in the supernatant were combined with the adherent fraction, which was trypsinized and then washed. An aliquot of 5E+05 cells was incubated with annexin V-APC and PI for 15 min at room temperature in the dark. Cells were immediately analyzed by flow cytometry. Viable cells exclude both annexin V-APC and PI.

Early apoptotic cells are n V-APC-positive and Pi-negative, s cells that are no longer viable due to apoptotic or necrotic cell death are positively stained by both annexin V and PI. Percentage of stained cells in each quadrant was quantified using FlowJo software (BD Biosciences, Franklin Lakes, NJ).

The apoptotic assay based on DNA fragmentation was performed as follows. Treated cells (adherent and floating) were fixed in 70% icecold EtOH overnight. After washing, 106 fixed cells were incubated with al deoxynucleotidyl transferase enzyme (TdT) and FITC- dUTP for 90 min at 37°C to label DNA breaks. Cells were rinsed, incubated in RNase A/propidium iodide in the dark for 30 min at room temperature to stain total DNA, then analyzed by flowvcytometry. Cell doublets and clumps were eliminated from the is by gating.

. In vivo s All in vivo experiments were carried out in compliance with the al regulations and ethical guidelines for experimental animal studies. .1 ent of xenografts Xenograft tumors were inoculated by subcutaneous injection of tumor cells in 200 mΐ PBS into the flanks of female Hsd:Athymic Nude- x«i nu mice. Tumor bearing mice were treated with 0 mg, 200 g, 400 g or 800 mg antibody ed i.v. weekly or alternating i.v./i.p. semiweekly.

Chemotherapeutic agents were applied i.p. weekly or semi-weekly. Tumor sizes and animal health were monitored semi-weekly. At the end of chemotherapy treatment, antibody applications were continued until tumors reached a volume of >1400 mm3 or until tumors became ulcerous. Tumor samples were cryo conserved or fixed in 4 % formalin for subsequent analysis. .2 Metastasis assay Different pancreatic cancer cell lines were first analyzed for their ability to form metastasis after i.v. application of the cells in nude mice. For these engraftment analyses a group of 5-10 mice were ed with lxlO 6 and/or 2xl0 6 cells and single mice were sacrificed at different time points to find the time point of metastasis engraftment and growth.

Metastasis treatments were med with 10-12 Hsd:Athymic Nude- «7nu mice per treatment group. They were injected with 2xl0 6 cells (Patu8988S or Suit2-LVT) enously. All mice were sacrificed at the same time point, as soon as the first symptoms of metastasis disease appeared (loss of weight, weakness, shortness of breath), or the first mouse died.

Preparation of tissue: For engraftment studies mice were sacrificed at different time points, or as soon as mice showed clear physiological signs of metastatic disease (loss of weight, weakness, shortness of breath). All their organs were macroscopically analyzed for metastasis. Only for Patu8988S and Suit-2 cells, lungs and lungs/livers displayed macroscopically visible metastasis, respectively. These organs were dissected into 4 equal peaces, two (lung: upper right and lower left lobe), which were stored for genomic DNA ion. The other two peaces were in fixed and stored for IHC analysis (Figure 2).

Preparation of genomic DNA and Q-PCR strategy: Genomic DNA was ted from lung or liver tissue. As ls, genomic DNA was also isolated from human pancreatic cancer cells Patu8988S as well as of a non-injected ve control mouse.

The Q-PCR strategy is based on the amplification of human DNA present in the metastases.

The relative detection level of human DNA in the mouse lung sample correlates directly with the amount and/or size of the metastases. Since this method is biased by the fact that the metastases do not spread evenly in the lung and sometimes one lobe is more affected than the other, two different regions of the lungs were mixed in one DNA preparation (Figure 2).

The Q-PCR on was performed with primer pair #5861 5'- GGGATAATTTCAGCTGACTAAAC AG-3 ' and #5862 5'- TTCCGTTTAGTTAGGTGC AGTTATC-3 ' specifically amplifying the alpha-satellite DNA present in human chromosome 17, but not in mouse DNA. To generate a standard curve and as positive control, Patu8988S DNA was mixed with mouse DNA and 5fold dilutions were prepared, resulting in 100%, 20%, 4%, 0.8%, 0.16%, 0.032% and 0.0064% human DNA in mouse DNA. The curve was used to calculate (linear regression) the amount of human metastasis DNA present in mouse lung . Q-PCR reactions were performed in 50 mΐ final volume comprised of 20 mΐ (200 ng) mouse lung DNA, 25 mΐ Sybr Green n), 1.6 mΐ sense pirmer (10 mM) and 1.6 mΐ anti-sense primer and 1.8 mΐ H20 .

Example 2: CLDN18.2 expression in normal and neoplastic human pancreas tissues To analyze the expression level and pattern of CLDN18.2 in normal and pancreatic tumor tissues histological staining of FFPE sections was carried out with two murine monoclonal dy reagents (Figure 3).

Exploratory pilot experiments were performed by using the ype antibody 35-22A on tissue microarrays (TMAs). A major disadvantage of TMAs is the le quality of the spotted tissues and the small size and thus non-representative character of the s. This together with the not fully optimized staining protocol may have resulted in an underestimation of positive cases.

The main experiments were performed with the antibody 43-14A. These stainings were conducted on tissue sections, which (compared to the TMAs) were larger and pre-assessed for presence of tumor cells.

The precancerous lesions, which origin from the pancreas ducts can be ranked according to the international pancreas intraepithelial sia (PanIN) system (PanIN-lA, -IB, -2, -3 subtype).

PanIN- 1 lesions (Figure 4A) are flat, composed of tall columnar cells with basally located nuclei and abundant supranuclear mucin. The nuclei are small and round to oval in shape and are oriented perpendicular to the basement membrane. There is histological overlap between non-neoplastic flat hyperplastic lesions and flat stic lesions without atypia.

The lesions of the subtype PanIN- IB have a ary, apillary or basally pseudostratified architecture and are otherwise cal to PanIN- 1A. (Hruban et al. Am J Surg Pathol. 2001 May;25(5):579-86.) PanIN-2 lesions (Figure 4B) are flat or papillary, have typical nuclear abnormalities, including some loss of polarity, nuclear crowding, enlarged nuclei, pseudo-stratification and hyperchromatism. Mitoses are rare, but when present are non-luminal (not apical) and not atypical. (Hruban et al. Am J Surg Pathol. 2001 (5):579-86.) 3 lesions (Figure 4C) are y papillary or micropapillary, however, they may rarely be flat. True cribriforming, budding off of small clusters of epithelial cells into the lumen and luminal necroses suggest the diagnosis of PanIN-3. Lesions are characterized by a loss of nuclear polarity, dystrophic goblet cells (goblet cells with nuclei oriented towards the lumen and mucinous cytoplasm oriented toward the basement membrane), mitoses which may occasionally be abnormal, nuclear irregularities and ent (macro) nucleoli. n et al. Am J Surg Pathol. 2001 May;25(5):579-86.) The expression of CLDN18.2 in precancerous tissues was analyzed with the 43-14A antibody using tissue samples of various sources.

CLDN18.2 was detected frequently in PanIN structures of the es PanIN- 1, -2 and -3 demonstrating an early expression of CLDN18.2 in precancerous lesions (Figure 4), which is conserved in the later stages. In contrast, no sion was observed in normal pancreas tissue s including the ductal structures of the pancreas.

In conclusion, .2 is an early marker of beginning malignant histological changes in the pancreatic ducts.

Two studies were performed to assess expression of .2 in primary pancreatic cancer.

For the pilot study several TMAs with a total of 141 primary pancreatic cancer cases were stained with the monoclonal CLDNA18.2 specific antibody 35-22A. The overall quality of the analyzed TMA was unsatisfying. Many spots were partially lost during the retrieval and inhomogenous counterstaining with haematoxylin was suggestive for suboptimal tissue sing of FFPE tissues.

Overall >48.9% of the stained cases were positive for .2, including 49.2% (65/132) ductal adenocarcinomas, 50% (1/2) acinic cell carcinoma and 3 of 7 ndocrine carcinomas (Table 7). The tumor cell membrane was stained without any background on other cell types (Figure 6).

Moreover, we observed a correlation between CLDN18.2 expression intensity and the fraction of stained tumor cells within the tumor (Table 8, Figure 5).

Table 7 : Pilot study: Number of CLDN18.2 positive cases divided in the pancreas cancer subtypes. Tissues were stained using the monoclonal, murine 35-22A (0,2 m / I) antibody and reviewed for CLDN18.2 positive tumor cells.

Table 8: Pilot study: Correlation n CLDN18.2 signal intensity and amount of positive tumor cells for the analyzed pancreas y tumors. Percentage of positive y tumor cases correlated to the ng intensity. The cases were grouped in six fractions depending on the amount of positive tumor cells for a better visualization.

Table 9 : Pilot study: Grading of the CLDN18.2 positive tumor The grading of the tumor cells describes the cell appearance and the level of cell differentiation. Whereat grade 1 describes well differentiated cells; grade 2 moderately differentiated cells and grade 3 poor differentiated.

A second study was conducted with an zed staining protocol with the highly sensitive antibody 43-14A using quality controlled tissue sections.

Table 10: Main study - number of CLDN18.2 positive cases grouped in pancreas cancer subtypes. Tissues were stained using the murine, monoclonal 43-14A (0.2 g/ml) antibody and ed for CLDN18.2 positive tumor cells.

Table A Table B In total 42 primary ductal pancreatic cancer samples were analyzed. About 90% (38 of 42 cases) of these were positive for CLDN18.2 (Table 10), most of which (>60%) showed a strong signal intensity of +++ (Figure 7, Table 11). Also here a correlation n the CLDN18.2 expression level and the fraction of positive tumor cells was observed. Most of the analyzed cases (62%) were grade 3 tumors (Table 12).

Table 11: Main study: Correlation between CLDN18.2 signal intensity and amount of positive tumor cells for the analyzed pancreas primary tumors. Percentage of positive primary tumor cases correlated t o the staining intensity. The cases were grouped in six fractions ing on the amount of positive tumor cells for a better visualization.

Table 12: Main study - Grading of the CLDN18.2 positive tumor cases. For most of the analyzed tumor cases a grading done by the corresponding pathologist was available. The grading of the tumor cells measures the cell ance and the level of cell differentiation.

Whereat grade 1 describes well differentiated cells; grade 2 moderately differentiated cells and grade 3 poorly differentiated.

Pancreas cancer is sed in most patients in an advanced stage. Patients tumors have already metastasized in lymph nodes and other organs, in ular into the liver. In the main study 79 FFPE tissue samples of lymph node and liver meatsatses of pancreatic cancer were analyzed in an immunohistochemical assay, using the CLDN18.2 specific 43-14A antibody. 70.5% of the lymph node metastases (31/44 cases) and 68.6% of the distant liver metastases (24/35 cases) demonstrated clear tumor cell staining for CLDN18.2 (Table 13). The staining pattern of the positive tumor cells was membranous, in some cases with additional weaker asmic signals (Figure 9). In accordance with the results of the primary tumor analysis, a correlation was found between the CLDN18.2 sion level and the fraction of CLDN18.2 positive tumor cells in the metastatic samples (Figure 8).

No correlation was found between grading of the analyzed tumors and expression level of CLDN1 8.2 or fraction of positive tumor cells.

Table 13: Number of CLDN18.2 positive ases cases grouped by target organ. Tissues were stained using the monoclonal, murine 43-14A (0.2 g/ml) antibody and reviewed for CLDN18.2 positive tumor cells.

To test whether the CLDN18.2 expression of positive primary tumor cases is conserved in ases of the same patient, matched primary cancer/lymph node metastases doublets were screened using antibody 43-14A.

Table 14: CLDN18.2 expression in matched pancreas primary and lymph node metastatic tumor samples - Matched samples of y adenocarcinoma and lymph node (LN) metastasis were analyzed for the sion of CLDN18.2 in tumor cells.

H/2007/13983 6C &6J ++ (15%) ++ (1%) H/2007/14400 6C &6J - - H/2006/5616 3 J &3D +++ (35%) +++ (5%) H/2006/9779 3 D &3 K + (5%) + (15%) In 25 (92.5%) of the 27 analyzed paired cases both primary tumor and lymph node pairs were positive for CLDN18.2. In a single case both tissues were negative and in one other case the primary tumor was positive for CLDN18.2, s the asis was negative.

In 2 1 of 26 (80.7%) positive tested doublets the signal intensity of the primary tumor and metastatic tumor cells was identical. In 5 cases the signal intensity declined from +++ to ++.

In 11 of 25 (44%) paired tissues the number of positive tumor cells was lower in the metastases as compared to the primary tumor (Table 14).

In summary, the CLDN18.2 expression appears to be conserved when primary tumor cells advance to the metastatic stage. The overall intensity and the fraction of positive tumor cells in lymph node ases was only ly lower as compared to the primary tumor (Figure ).

For a small number of patients tissue samples derived from the primary tumor, the lymph node metastasis and the liver metastasis were available. These d ts were stained, to test the conservation of CLDN18.2 expression in distant metastases. Six matched triplets were analyzed with antibody 43- 14A.

Table 15: CLDN18.2 expression in matched pancreas primary and metastatic tumor samples - Matched s of primary adenocarcinoma, liver asis and lymph node (LN) metastasis were analyzed for the expression of CLDN18.2 in tumor cells.

In 3 of 6 triplets, all three tissues specimen were comparable with regard to their positivity score for CLDN18.2 (Figure 1). In three cases a on of the tumor cells was CLDN18.2 positive in the primary , whereas the metastatic lesions showed no CLDN18.2 staining (Table 15).

Example 3 : Target expression in human pancreatic cancer cell lines used for in vitro and in vivo models and atic cancer models Source of cell lines A primary aim of this pre-clinical evaluation study was to analyze the inhibitory effects of IMAB362 treatment in le model systems. To identify CLDN18.2-positive cell lines that can be used for in vitro and in vivo characterization of IMAB362 effects, a set of 26 commercially available pancreatic cancer cell lines was screened for CLDN18.2 expression and characterized in detail. A cell bank for experimental use was prepared immediately upon arrival for each of the cell lines. They were derived from primary pancreatic adenocarcinomas (10 of which 6 mucinous adenocarcinomas), primary carcinomas (4), atic adenocarcinomas metastases into liver (5) or spleen (1), or isolated from ascites (5) (see Table 16). l of these cell lines (8) were lentivirally transduced to express CLDN18.2. lines. as cell characteristics of and cellular Published origin Table 16: 23> .338 4 Sémumfl 4 SEEK :.m 3.3 $2.8 A ... mmwiam A A 4 ,6. E .82. 32.9.30: 3.83 :_ .32. .E. .E. MONémfi 9:. 8.5.-va ._w ..~ .m 3.292 58.3%,...53 E BS 6H 3-3 ..m .3ch .3ch EE. w .05 3 a r.» :.m J» ”ms 3 ...m é .._m ”v >8 .32. 3.5ng .8855; um 3333 a m in: 2255.2 .9355“. 22:52 umEEmcofi mmwbcmm .w .m .E< «u .E< .6260 :8 .32. 38: ._m SH E :98 .82. 39: as. 222 .85 m.:=> .853 .RS. :~.Ew=m .85 muta— .8 Ema. wetn— .0m ESESooam .326 ..~-z<n.-3n: -853 £3-40 5-25 M39335 uzmwbcma .23 {m8 Nanak 2:... 8.22-2055; <5 <8 .mcozuce 5:88. 5.5:. .3.8 3.5.x. mcmmzcm .0 .o aft. 35.2% scaosm .8 c0582 8365.3 Sousa... UwumUOmmm 8-360 =mEm $5 N99 ; 292.283 2252. 2:29.35 2:89.85 32:3 3 3.238.: >2 .33.. 8:: .0 8 83. -v__>> 9.0.35.8... 5.6% .38 .39. E; <uo< .233 SEE 6me .98... .8 .mu.0u..8uou:.w 822.8 682.53%“. muss 8 m>Emcwm 28.2.2. 2.8.3.033 5396 +5. 8339.3 ucm <uo< 9 m .uzmumfimE 329ch 882.3 3:03:23 E0: 8E. Euro uwumzcmbtfi Ea: c0322: .532. fiwumzcmbtfi 252. watfiéwi >__mE.:..>. E0: Eot .8360 mus: :. SEE 5.3 526.0 mcommfiwmewu E0... ES“. .2330...an 3?th 232mg... 288265. 2285.35: 2.8.3.03... date €33.55...ch .mmmeSmamm 3250 mammouco 83.50 :ozmucmamcmb :. 06m 2.83qu 8% 05305.0 50:35.35: oUm .mtm £32m :. 2. ~mm> 28.38:... cozumE. 26.. 9...: E 8.3. mm; mm; 2. mm; 86.0.52. mw> EI<UD <UQ<-D (U- -mé <UQ< <Uo< <95 ._.n. Fa. <U Fm Fa . .

NEmQ N.>_mn_ N530 mav— mxua mmua 82 UU._.< UU._.< :00 33 MFA—DI Eun— I D: . NmUmn—EE mcdogfin— h~.m°uc~a Zellkulturen. carcinoma und CA: pancreas von Mikroorganismen E: epitheloid, T: tubular, Deutsche Sammlung ductal, D: Bank, DSMZ: Resources ADCA: arcioma, Research Science asis, spleen IL: interleukin Health SM: antigen, HSRRB: Collection; liver metastasis, LM: CAxarbohydrate Culture antigen, Type tumor, AS: ascites, carcinoembryonic : 1 ATCC:American PT: primary : CEA: .2 transcript expression in human pancreatic cancer cell lines To identify CLDN18.2-expressing pancreas cell lines, transcript levels were determined with quantitative real-time PCR (RT-PCR) using a forward primer binding to exon 1 of CLDN18.2 and a reverse primer binding to exon 3 of CLDN18. The endogenously CLDN18.2 expressing human gastric carcinoma cell line KATO-III and the CLDN18.2 negative breast cancer cell line SKBR-3 were included as positive and negative controls, respectively. The RT-PCR revealed clear endogenous CLDN18.2 expression in the pancreatic cancer cell lines DANG, Panc03.27, Panc05.04, Patu8988S and YAPC with ve levels ing lxlO 5.

Interestingly, Patu8988S cells showed CLDN18.2 expression levels (~lxl 08) comparable to stomach CA KATO-III cells (Figure 12A). In conclusion, we detected robust CLDN18.2 expression in 5 out of 22 atic cancer cell lines.

In addition to the nous cell lines, the LVT cell lines ectopically expressing CLDN18.2 were analyzed on the transcript level (Figure 12A). For 6 out of 8 LVT cell lines, relative CLDN18.2 sion levels of more than lxlO 8 were detected. Only in HAPC-LVT and Suit2-LVT cells, the expression level was above lxlO 5.

We investigated if CLDN18.2 expression is stable during in vitro cultivation. Patu8988S, Panc05.04 cells and the lentivirally transduced cell lines LVT, MiaPaCa2-LVT and Patu8902-LVT were passaged up to 15 times and CLDN18.2 transcript was analyzed (Figure 12B-D). We observed loss of CLDN18.2 expression in both endogenous and transduced cells with a higher passage number. Loss of expression was highest in the transduced cells.

Therefore, early passages were used, wherever possible for the in vitro ments and expression of CLDN18.2 in tumor xenografts was ed in the below engraftment experiments.

CLDN18.2 protein expression in human pancreatic cancer cell lines Detection of CLDN18.2 in total cell lysates In addition to the transcript analyses, the expression of CLDN18.2 was analyzed on the n level by Western blot and IF. For Western blot is cell lysates of the 26 pancreatic cancer cell lines were investigated by western blotting (WB) using the CLDN18 specific dy anti-Claudinl8 (C-term). Lysates of SKBR-3 cells were again used as negative control, whereas lysates of HEK293 cells stably transfected with CLDN18.2 (HEK293-p740) were used as positive control. Here, we detected high n expression in Patu8988S, DANG and Panc05.04 cells, confirming the RNA data. Faint bands were detectable in .27 and BxPC3 cell lysates. YAPC cells, which were identified positive on the RNA level showed a faint band of smaller size in western blots. All other cell lines were negative (Figure 13).

Cellular expression of CLDN18 in pancreatic cancer cells To obtain supportive protein expression data, pancreatic carcinoma cell lines were investigated by immunofluorescence (IF) after fixation and permeabilization of the cells and using antibody 35-22A for detection. IF analyses confirmed previous RNA and protein data showing that most pancreatic cancer cell lines are negative for CLDN18.2 ng (Figure 14). In a few cell lines (like AsPCl, DANG, HUP-T3, HUP-T4, PancOl) nuclear dots were ed, which most likely represent staining artifacts. DANG, Panc03.27 and BxPC3 cells that were identified to feature low CLDN18.2 on the RNA and/or protein level, were negative in the IF analysis, which has a lower detection sensitivity. In contrast, membranes and cytoplasm of Panc05.04, Patu8988S and ATO- II c carcinonoma control cells stained ly ve for CLDN18.2. Staining intensity was different for each cell and also negative cells were ed within the population (Figure 14J and N). In the LVT cell lines we found strong membrane staining of more than 80% of all cells.

Confirmation of CLDN18.2 expression in pancreatic cancer cells To m expression of CLDN18.2 and to assess amount of this target on the cell surface the endogenous cell lines Panc05.04 and 88S as well as in the LVT cell lines were stained with IMAB362 using a native ng protocol. Although staining of Patu8988S, Panc05.04 and the KATO-III gastric cancer control cells with IMAB362 was less intense and the tage of positive cells was reduced compared to staining cells with 35-22A (Figure 16A-F), the IF analysis confirmed that CLDN18.2 is expressed on the surface of pancreatic cancer cells. For the 8 LVT pancreatic cancer cell lines ectopically expressing CLDN18.2, clear membrane staining was observed on almost all cells (as shown for 6 LVT cell lines in Figure 16G-L).

In conclusion, the CLDN18.2 expression analyses resulted in identification of endogenously expressing pancreatic cancer cell lines Panc05.04 and Patu8988S and all 8 lentivirally transduced cell lines BxPC3-LVT, -LVT, DANG-LVT, MiaPaCaLVT, Suit LVT, Patu8902-LVT and VT as suitable CLDN18.2 positive cell model systems.

Development of pancreatic cancer xenograft and metastasis models Engraftment studies for identification of suitable aneous pancreatic cancer tumor models A total of 37 engraftment studies with different pancreatic cancer cell lines were performed to identify le subcutaneous xenograft models for testing in vivo efficacy of IMAB362. Of all tested cell lines, the BxPC3-LVT, CAPAN1-LVT, MiaPaCaLVT, HPAC-LVT, DANGLVT and YAPC-LVT cell lines with ectopic CLDN18.2 expression were selected for subcutaneous xenograft models, showing high tment rates and homogeneous tumor growth. In addition, subcutaneous aft models with endogenously CLDN18.2 expressing Patu8988S and DANG cell lines were selected for testing IMAB362 efficacy in vivo. S.c. injection of .04 cells did not result in formation of subcutaneous tumors.

Table 17: Summary of tested engraftment conditions for development of s.c. xenograft models for pancreatic cancer. al 49 days Engraftment | , Experimental sat-up “— Misc.

Patu8988$ 18 28.11. 5e6 cells subcutaneous into heterogeneous tumor not recommended subclone 2011 the left flank of 5 female growth; slow tumor 41 Hstpb: NMRl-Foxnlnu mice growth; ulcerating tumors; median survival 108 days Patu8988$ EC1_C237 06.02. 5e6 cells subcutaneous into slow tumor growth; reasonably model subclone 2012 the left flank of 5 female bloody cysts, but not for aneous adM#13 Hstpb: NMRl-Foxnlnu mice ulcerating; median xenografts al 73 days Patu89885 EC1_C238 06.02. 5e6 cells subcutaneous into geneous tumor not recommended subclone 2012 the left flank of 5 female growth; slow tumor adM#19 Hstpb:NMRl-Foxn1nu mice growth; ulcerating tumors; median survival 42 days Patu8988s EC1_C239 13.02. 5e6 cells subcutaneous into heterogeneous tumor not ended subclone 2012 the left flank of 5 female growth; slow tumor adM#1 Hstpb:NMRl-Foxn1nu mice growth; ulcerating tumors; median survival 77 days Patu8988$ EC1_C24O 13.02. 5e6 cells subcutaneous into slow tumor growth; reasonably model subclone 2012 the left flank of 5 female bloody cysts, but not for subcutaneous adM#16 Hstpb: NMRl—Foxnlnu mice ulcerating; median xenografts survival 66 days Patu8988$ EC1_C241 13.02. 5e6 cells aneous into slow tumor growth; reasonably model subclone 2012 the left flank of 5 female bloody cysts, but not for subcutaneous adM#9 Hstpb: NMRl-Foxnlnu mice ulcerating; median xenografts survival 59 days Suit2 EC1_C196 25.07. 1e7 cells subcutaneous into take rate 100%; fast not recommended 2011 the left flank of 5 female tumor growth; Hstpb: NMRl-Foxnlnu mice ting tumors; median survival 35 days EC2_C196 25.07. experimental metastasis assay. metastases in lung, le model for 2011 Intravenous injection of 2exp6 liver and s lung metastasis cells into 10 female Hstpb: assay oxnlnu mice Panc02.03 EC1_Panc 1e7 cells subcutaneous into take rate 100%; suitable conditions 02.03 the left flank of 5 female median survival 54 for subcutaneous Hstpb: NMRl-Foxnlnu mice days xenograft model Panc03.27 1e7 cells subcutaneous into take rate 100%; le conditions the left flank of 5 female median survival for subcutaneous Hstpb: NMRI-Foxnlnu mice 91days aft model Panc04.03 1e7 cells subcutaneous into take rate 100%; suitable conditions the left flank of 5 female median survival 39 for subcutaneous Hstpb:NMRl-Foxn1nu mice days xenograft model Panc05.04 1e7 cells aneous into no subcutaneous not recommended the left flank of 5 female tumor growth Hstpb: NMRl-Foxnlnu mice Panc05.04 ECS_Panc 2e7 cells suspended in RPMI no subcutaneous not recommended 05.04 subcutaneous into the left flank tumor growth of 5 female Hstpb: NMRl- Foxnlnu mice MiaPaCaZ 95 1e7 cells subcutaneous into the take rate 100%; le conditions 2011 left flank of 5 female Hstpb: median survival 42 for subcutaneous NMRl-Foxnlnu mice days xenograft model MiaPaCaZ - EC1_C219 18.11. 5e6 or 1e7 cells subcutaneous take rate 100%; suitable conditions LVT 2011 into the left flank of 10 female median survival 40 for subcutaneous Hstpb: NMRI—Foxnlnu mice days xenograft model MiaPaCaz EC2_C195 25.07. experimental metastasis assay. metastases in lung, suitable model for 2011 Intravenous injection of 2e6 liver and lymph nodes lung metastasis Engraftment Cell line Date Experimental set-up Results Comments check (EC) cells into 10 female HsdCpb: assay NMRI-Foxnlnu mice HPAC EC1_HPAC 19.04. 1.5e7 cells subcutaneous into take rate 100%; suitable conditions 2010 the left flank of 5 female median survival 29 for subcutaneous HsdCpb: NMRI-Foxnlnu mice days xenograft model YAPC EC1_YAPC 10.05. le7 cells subcutaneous into the take rate 100%, very limited xenograft 2010 left flank of 5 female HsdCpb: aggressive tumor model NMRI-Foxnlnu mice ; homo s tumor growth; ulcerating tumors; median survival 28 days YAPC-LVT EC2_YAPC 10.05. 5e5-7.5e6 cells subcutaneous take rate 100%, very limited aft 2010 into the left flank of 20 female aggressive tumor model HsdCpb: NMRI-Foxnlnu mice growth; homo¬ geneous tumor growth; ulcerating tumors; median survival 27 days Engraftment s for identification of suitable metastasis models To study effects of IMAB362 on metastasis ion, metastatic cancer models were established in nude mice. atic cancer cell lines were analyzed for their ability to metastasize upon i.v. application. CAPAN1-LVT, MiaPaCa-2, Patu8988S, Patu8902 and Suit-2 cells were injected into tail veins of nude mice as described by Mohanty and Xu 2010.

To determine the time point of metastasis engraftment and growth rate, the mice were sacrificed at different time points (Table 18).

Table 18: Metastasis engraftment analysis of pancreas cancer cell lines Engraftment analysis of Patu8902 cells and CAPAN1-LVT was not feasible, since most mice died almost immediately. In lungs and livers of 5 surviving mice challenged with CAPANLVT cells no macroscopically visible metastasis were detected after 72 day. Suit-2 and MiaPaCa2 cell injections, in contrast, were well-tolerated. Lung tissues of these mice were analyzed in IHC analysis at different time points after ion. In mice challenged with MiaPaCa-2 cells no metastases were detected in the lungs after up to 73 days, and therefore this cell line was not selected as an IMAB362 treatment model. Suit-2 cancer cells metastasized into the lungs of the mice. Multiple foci were detected throughout the tissue.

Therefore, the lentivirally CLDN18.2 transduced SuitLVT cell line was selected as a model system to analyze the effects of IMAB362 treatment on formation of metastasis.

In on to Suit-2 also the ability of 88S cells endogenously expressing .2 to form metastasis was analyzed. Engraftment checks were performed with 2 different cell numbers (lxlO 6, 2xl0 6) i.v. injected per mouse. Lungs and livers were isolated at different time points as ted in Table 18. First, the different tissues obtained were analyzed using Q-PCR. Lungs and livers obtained up to day 70 were analyzed by amplifying human c - satellite DNA of chromosome 17. The results of the lungs show a clear increase in the percentage of human DNA in mouse lungs over time, which was not dependent on the injected cell number. By i.v. application of lxlO 6 or 2xl0 6 cells 5.8% and 3.7% human DNA could be detected after 70 days, respectively (Figure 19). In , hardly any human DNA was amplified. After 70 days the percentage was slightly increased, but still below 0.005%.

To verify CLDN18.2 expression in the Patu8988S metastasis, lung tissues were immunohistochemically stained using uman MHC class I dies for detection of human cells in mouse tissue, as well as the anti-Claudinl8 (Mid) dy. MHC-I staining showed that clear metastasis foci were detectable in mouse lung tissue sections, but not in liver ns (Figure 20). Furthermore, the membranes of the cells in these foci were stained with the anti-Claudinl8 (Mid) antibody showing clear expression of the IMAB362 target protein in these cells. Therefore, in addition to the Suit2-LVT model, this endogenous metastasis model was ed for IMAB362 treatment investigation.

Example 4: IMAB362-mediated cell killing effects IMAB362 cosslinking induces efficient apoptosis Antibody binding to a cell e target may initiate aberrant signalling resulting directly in cell death. Such signalling events may depend on the target epitope, the valency of binding and whether binding is ated with cross-linking of the target. For several CD20 positive lymphoma cell lines, for example induction of apoptosis by mab is only ed under cross-linking conditions. Such cross-linking may take place in vivo when high affinity Fc- receptor-positive immune cells interact with antibody-coated tumor cells.

Cross-linking of IMAB362 induces direct apoptosis within 18-42 hours in human gastric cancer cells NUGC-4 and KATO-III as measured by the TUNEL assay. The magnitude of apoptosis correlates with the dose of the antibody and level of target sion on the cancer cell. Treatment with gemcitabine leads to cell cycle arrest of tumor cells followed by apoptotic cell death. Apoptosis of abine treated pancreas tumor cells is shown in Figure IMAB362-mediated ADCC activity against pancreatic cancer cells IMAB362 is highly potent in ting and activating Fcy-receptor-positive immune or cells, such as natural killer cells. Binding of IMAB362 to target cells, induces antibodydependent cellular cytotoxicity (ADCC) by mes and perforins secreted by the effector cells upon binding of their Fey receptors to the antibody. The impact of this mechanism of action was previously shown for luciferase- and CLDN18.2-positive h CA cells (like NUGC-4 and KATO-III) by incubation with IMAB362 for 24 hours in the presence of human eral blood mononuclear cells (PBMC) (effector to target ratio = 40:1). Application of up to 200 g/ml IMAB362 resulted in maximum lysis rates of 80-100%.

Here, we determined the ADCC activity of IMAB362 against pancreatic cancer cell lines.

Increasing concentrations of IMAB362 were incubated with the different cell lines at an E:T ratio of 40:1. PBMCs of different donors were added in each experiment. Results for all cell lines are summarized in Table 19. Of the 5 initially identified CLDN18.2-positive pancreas cell lines, only Patu8988S, Panc05.04 and DANG were efficiently killed by on of IMAB362 and PBMCs (Figure 22A). Although CLDN18.2 surface expression was not detectable in FACS for Panc05.04 and DANG, the expression level is significant enough to cause or cell-dependent killing (EC : Patu8988S: 0.01- l^g/ml, DANG/Pan05.04: 0.1-38 mg/ml). From these data it can be concluded that only cells expressing relative RNA levels >5.5xl0 5 are efficiently lysed.

ADCC analyses were also performed with LVT pancreatic cancer cell lines and their corresponding parental cell lines (Figure 22B-F). ADCC strictly depends on the specific binding of IMAB362 to the target, since only CLDN18.2 ve target cells are killed by IMAB362 and PBMCs. Half maximum killing and maximum killing rates induced in human pancreatic cancer cells by IMAB362 varied between PBMC donors and were also ent on passage number of the cells affecting CLDN18.2 expression level The IMAB362 concentrations causing half m killing rates of the target cells as well as the maximum killing rates are shown in Figure 22G-H. The LVT pancreas CA cell lines were killed upon addition of small amounts of antibody at high rates, whereas for DANG and Panc05 highest antibody concentrations are required to reach a -50% maximum killing rate.

For Panc05.04 results obtained with subclone 15D3 (CLDN18.2 positive clone selected by limited dilution of Panc05.04 and FACS) are included in the figure showing comparable ADCC lysis rates as with the LVT cell lines. Unfortunately, CLDN18.2 expression in this clone is y silenced in vitro after subculturing the cells and thus this clone was not used for further experiments.

IMAB362-mediated CDC activity against pancreatic cancer cells Pancreatic cancer cells, which were killed with IMAB362 in ADCC assays, were analyzed for their sensitivity towards the complement-dependent lytic activity of IMAB362. In addition, the LVT cell lines and the parental strains were tested in CDC.

CDC activity is activated by complexes of antigen and IgM or IgG antibodies (classical y) or by bial surfaces (alternative pathway). In the classical y complement C5 is converted to C5b. The anaphyloatoxins C3a, C4a and C5b are ed and a ne attack complex (MAC) is formed by the sequential binding of C5b, C7, C8 and C9. This pathway is inhibited by e but also membrane bound proteins (e.g.

CR1, DAF, MCP, CD59, CD55, CD46) protect self-tissues.

CHO-K1 cells stably transfected with CLDN18.2 (p740) and luciferase were used as assay ve ls in each assay (Figure 23A). The cell lines DANG, BxPC3, YAPC, Patu8988S, Panc05.04, CAPAN1 and Suit2 were not lysed by IMAB362 and addition of y human serum pool (Figure 23B). Although DANG, Patu8988S and .04 cells are CLDN18.2 positive as shown in all the previous experiments, these cells were not lysed in a complement-dependent manner. This is most likely due to the fact that neoplastic cells over- express one or more membrane bound ment inhibitory proteins (e.g. CD46, CD55 and CD59) (Geis et al., Curr Cancer Drug Targets, 2010 10:922-931). r, if expression of these inhibitory proteins on tumor cells affect clinical outcome of an antibody therapy is still contradictory (Dzietczenia et al. Med. Oncol. 2010, 27:743-6; Weng and Levy at al., Blood 2001 98:1352-7).

In addition to the endogenous cell lines, all the LVT cell lines were tested in CDC assays. As shown in Figure 23, IMAB362 and serum addition to MiaPaCaLVT, Suit2-LVT and CAPAN1-LVT ed in dose-dependent lysis with EC5o values ranging from 0.3 to 2.6 g/ml. lines lines. cancer cell cancer cell pancreas human atic of in in vivo characteristics CLDN18.2 expression vitro and house in Overview of In Table 19 «5.58: P3 2.3 #3 m6 be .3? 8 L8 @3205 Sta umm: 8_E 3332. 83 38: mmcoa .AmSuwuoa 88 ..u.m £995 9:9. .2 8 3:958: .tmhmcm flmcfi £8 £296 tfimcw 8 £295 twiwmno ho mv .flcchm..mcw 2.3 macmEhEmcm 8 cormsfiam 8:28 m0=u=um 2% 2%.. 2% min .3 £8 5he £8 35:58: 2.8 mEESm :26me 4338832: afimcw £8 L8 m__mu 223232: con: U EomUw ins. «.3 oE-C .mn aims H H amUm MS: :8 H H ¢.mm wwfim fimmvv I «UUD< $9. «.2 AK.“ w.N-.E fiw 06 wéw- QmHHso Nél .1: $9 H H .me. .E.: .E.: méé H NS : fiwn Ed .E.: 3; + + + + 3 Son Son Son .5 83:3 cozmzfiuo. E: E3395 mcmBEmE 529:: 3293: ~m>zmmwc E3335 25559: 58.03: ~025me Emmaoiu E3335 wcmEEmE gnome: 83395 wcmEEmE .5 38.3. 5335.8 L85. Axummd Romm fivmd AXRNd fimw Xomk xwmé $3 Ax.m.m.o £895 _u>o_ +++ +++ + ++ +++ N.w.n2n_._u mmo . . n mm: mmmé wm©.H ma: we =wu ._.>._-u<a: -~mu~%_s_ 5.. moécucmn. mcucma -Ncmwsumm ._.>._ determined. n.d. not cells measureable; (Zymed) g/ml IMAB362 n.m.: not 50 and permeabilized donors; (C-term) antibody m I with least 2 35-22A o n fixed with at of 2E5 cells/100 1: using anti-Claudinl8 2: ng 3: using antibody 4: Results obtained Example 5; Efficacy of IMAB362 on pancreatic cancer xenograft models 0 of the 41 tested pancreatic cancer xenograft models were chosen to investigate the efficacy of IMAB362 in vivo. Using pancreatic xenograft models with high expression of .2, IMAB362 treatment showed a high antitumoral effect. This was investigated by treatment of mice g BxPC3-LVT or MiaPaCaLVT afts subcutaneous in the left flank.

Treatment was initiated 3 days after tumor inoculation with injections of 200 mg IMAB362 semi- weekly. The IMAB362 treated mice showed icantly inhibited tumor growth compared to mice d with saline control. In addition tumor growth suppression of IMAB362 treated mice resulted in prolonged median survival (Figure 24 and Figure 25). IMAB362 efficacy correlates with the duration of treatment. Initiation of IMAB362 treatment at early time points had an increased effect on tumor growth inhibition than late ent starts to examine effect on ished tumors. Furthermore the moral effect of IMAB362 depended on the amount of CLDN18.2 target expression. IMAB362 ed growth inhibition of low CLDN18.2 expressing tumors like DANG and Patu8988S xenografts was reduced compared to inhibition of tumor growth using high CLDN18.2 expressing xenograft tumors.

Example 6: Treatment of pancreatic metastasis mouse models Table 20: Summary of treatments for testing IMAB362 efficacy on pancreatic cancer metastasis Suit2-LVT metastasis model: Mice were intravenously injected with 2xl0 6 Suit2-LVT cells and were d with 200 g IMAB362, isotype control antibody 27), or with PBS as indicated in Table 20. After 35 days the first mouse (isotype control group) died. Consequently, all mice were sacrificed on day 42 and lungs and livers were taken for IHC and Q-PCR analyses.

Q-PCR analysis of human DNA in the lungs of mice was ed at least twice in triplicate. The calculation of the percentage of human DNA with the obtained Ct values revealed a significant decrease (P<0.05) in Suit2-LVT metastases detected in the lungs, if mice were treated with 2 (Figure 26A) as compared to both PBS and isotype control ents. To confirm these results, tissue sections of the lung samples were prepared and d using MHC-I antibodies. The surface of the positively stained cells in the lung sections was calculated using the ImageJ Program. For IMAB362 treatment icant inhibition (P<0.05) was observed as compared to PBS treatment confirming the results obtained with Q-PCR. For the isotype control antibody however, the differences were not significant (Figure 26B). This discrepancy is most likely due to differences in tissue processing: IHC processing of tissue sections provides only insight into a very small section of the lung compared to Q-PCR analysis, for which the genomic DNA is extracted from half of the tissue.

In addition to tissue processing, it is possible that the result represents unexpected inhibiting effects of the isotype control antibody ing CLDN6. To investigate this , the Suit2- LVT cells were ed for CLDN6 expression and 7 binding in FACS. The addition of 200 g/ml IMAB362 to Suit2-LVT cells confirmed strong binding to the cells, whereas addition of 200 g ml IMAB027 ed in weak binding of the antibody to these target cells, indicating that CLDN6 is indeed weakly expressed on these cells. These results suggest that at least two factors (tissue processing and weak IMAB027 inhibition) resulted in the observed discrepancies with the isotype control antibody.

Patu8988S metastasis model To analyze the effect of IMAB362 treatment on the development and growth of Patu8988S metastasis in vivo, 10 mice per group were injected with 2xl0 6 Patu8988S cells. The first ment was performed by comparing IMAB362 treatment to PBS treated mice. In each group 1 mouse died immediately after injection of the cells. In the other 8 mice, the metastasis developed very quickly as compared to the engraftment experiments. After 63 days the first 2 mice in the PBS group were sacrificed due to bad health conditions. All other mice were sacrificed after 65 days. The optical analysis of the lungs revealed large metastasis throughout the lung tissues. The amount of metastasis was analyzed in Q-PCR experiments (Figure 27). The results show that IMAB362 inhibits the growth of metastasis in lung tissue.

A second experiment with 11 mice per group was performed by comparing IMAB362 treatment with isotype control (Rituximab) control treatment. In this ment metastasis developed slowly as observed in the engraftments. Nevertheless, for ability this second experiment was terminated after 65 days. Again lung tissues were analyzed in Q-PCR and again IMAB362 reduced the growth of the metastasis. One mouse of the IMAB362 group was identified as outlier and exclusion of this outlier resulted in almost significant (P=0.0588) inhibition. These data were verified by IHC surface analysis as described for the Suit2-LVT metastasis experiment. Here the same r could be ed, and omitting this value in the t-test, the inhibition of IMAB362 is also at the border of being significant (P=0.0691), that values of the same mouse.

Example 7: Primary codynamics of IMAB362 in combination with chemotherapy Sensitivity of pancreatic carcinoma cells to gemcitabine and latin Pancreatic cancer cell lines tutively expressing CLDN18.2 (DANG, Patu8988S) and cells stably transduced with CLDN18.2 (MiaPaCaLVT, BxPC3-LVT) were used to investigate modes of action of IMAB362 in combination with the chemotherapeutic agents oxaliplatin or gemcitabine.

Chemically, gemcitabine (Gemzar, marketed by Eli Lilly&Co) is a nucleoside analog. As with 5- fluorouracil (5-FU) and other analogues of pyrimidines, the triphosphate ue of abine replaces one of the building blocks of nucleic acids during DNA replication. The process arrests tumor growth, as only one additional nucleoside can be attached to the "faulty" nucleoside, resulting in apoptosis.

Oxaliplatin functions by g both inter- and intra-strand cross links in DNA. Cross links in DNA prevent DNA replication and transcription, resulting in cell death. (Graham, Joanne; Mushin, d; Kirkpatrick, Peter (January 2004). "Oxaliplatin". Nature s Drug Discovery 3 (1): 11-2.) Dose response curves of gemcitabine and oxaliplatin showed different sensitivities of tested pancreatic tumor cell lines (Figure 28 and Figure 29).

Table 21: IC50 values of gemcitabine and oxaliplatin for pancreatic carcinoma cell lines.

To inhibit cell eration of Patu8988S high concentrations of gemcitabine (IC50 > 100 ng/ml) or latin (IC50 > 500 ng/ml) are necessary. DANG and BxPC3-LVT reacts very sensitive to abine but not to oxaliplatin. MiaPaCaLVT cells react most sensitive to latin but less sensitive to treatment with gemcitabine e 28, Figure 29 and Table 21).

Effect of chemotherapeutic agents on CLDN18.2 expression in atic carcinoma cell lines Mode of action triggered by IMAB362 binding depends strictly on the presence and cell surface density of its target .2. atment of DANG and 88S cells with gemcitabine (Gem) as well as gemcitabine in combination with oxaliplatin (GemOx) resulted in increased mRNA and protein levels of CLDN18.2 shown by RT-PCR (Figure 30) and western blot (Figure 31) analysis of untreated and chemotherapy pretreated cells. Consequently, the amount of CLDN18.2 protein targetable by IMAB362 on the surface of Gem or GemOx pretreated pancreatic cancer cell lines was increased as shown by flow cytometry (Figure 32).

Treatment of DANG and Patu8988S with gemcitabine leads to upregulation of CLDN18.2.

Patu8988S show strong upregulation of CLDN18.2 with Gem and lower upregulation with GemOx.

Effect of chemotherapeutic compounds on cell cycle and CLDN18.2 expression Cell cycle progression refers to the ce of events between one mitotic division and another in a cell. A resting phase (G0/G1) is followed by a DNA synthesis phase (S), then by a phase of cell enlargement (G2) and DNA replication (M) is followed by a division of the cell into two progeny cells. Any interference with the cell machinery may inhibit all cycle progression at any phase of the cell cycle. For example, specific chemotherapeutic agents may block progression in either G2 or M or in both G2 an M (G2/M).

Gemcitabine treatment of DANG or Patu8988S leads to cell cycle arrest in S-Phase (Figure 33, Figure 34). Patu8988S cultivated with Gem were analysed. Gemcitabine treatment not only leads to cell cycle arrest it also changes expression of CLDN18.2 (Figure 34B). The change of CLDN18.2 density after abine treatment is even higher when comparing proliferating cells in S phase to resting cells in G0/G1 phase (Figure 34C). In Patu8988S cells, CLDN18.2 is expressed in all phases of the cell cycle. Upon treamtent with gemcitabine, its sion is even increased, with the highest levels of CLDN18.2 per cell being found in the S phase cell population.

This perturbation of tumour cell phenotype has a significant impact on the biological effectiveness of therapeutic antibodies. ADCC and CDC are dose-related and ore an increase of the target structure .2 provides synergistic benefit to standard chemotherapeutic regimes.

Kato III cells, a human gastric tumor cell line, was cultivated in RPMI 1640 medium (Invitrogen) containing 20% FCS o) and 2 mM Glutamax rogen) at 37°C and 5% C0 2, with or without cytostatic compounds. 5-FU (Neofluor from p AG) was tested at a concentration of 10 or 100 ng/ml, and latin (Hospira) was tested at a concentration of 50 or 500 ng/ml. 8xl0 5 Kato III cells were cultivated for 96 hours without medium change or for 72 hours followed by 24 hours cultivation in standard medium to release cells from cell cycle arrest in a 6-well tissue culture plate at 37°C, 5% C0 2. Cells were harvested with rypsin, washed and analysed.

For extracellular ion of CLDN18.2 cells were stained with the monoclonal anti-CLDN18.2 antibody IMAB362 (Ganymed) or an isotyp-matched control antibody (Ganymed). As secondary t goat-anti-huIgG-APC from Dianova was used.

Cell cycle stages were determined based on measurement of cellular DNA content. This allows one to discriminate between cells in the G1-, S- or G2-phase of the cell cycle. In the S-phase DNA duplication occurs whereas in the G2-phase cells grow and prepare for mitosis. Cell cycle analysis was done using the CycleTEST PLUS DNA Reagent Kit from BD Biosciences following the manufacturer's protocol. Flow cytometry acquisition and analysis were performed by using BD FACS I (BD Biosciences) and FlowJo (Tree Star) software.

The columns in Figure 35a and b show the respective percentage of cells in the G1-, S- or G2- phase of the cell cycle. Medium ated Kato III cells show a cell cycle arrest predominantly in the Gl -phase. Cells treated with 5-FU are blocked predominantly in the S-phase. latin treated Kato III cells show enrichment of cells inantly in the Gl - and G2-phases. As can be seen in Figure 35c, a cell cycle arrest in the S-phase or G2-phase results in stabilization or upregulation of CLDN18.2. As soon as cells are released from any phase of the cell cycle (Figure 35b) the expression of CLDN18.2 on the cell surface of Kato III cells is upregulated (Figure 35d).

Kato III cells were pretreated for 4 days with Irinotecan or Docetaxel and analysed for CLDN18.2 expression and cell cycle arrest. Treatment of cells with Irinotecan resulted in a dose dependent inhibition of cell growth and a cell cycle arrest in the hase (Figure 36). ent of cells with Docetaxel resulted in a dose dependent inhibition of cell growth and a cell cycle arrest in the G2-phase (Figure 36).

Effect of herapy on IMAB362 induced antibody dependent ar cytotoxicity (ADCC) A series of experiments were performed with tutively CLDN18.2 expressing pancreatic cancer cell lines Patu8988S and DANG. To investigate the s of abine (Gem) or gemcitabine + oxaliplatin (GemOx) on IMAB362-mediated ADCC. Dose-response curves for IMAB362 mediated cell lyses of pretreated cells were compared with medium ated.

Dose response curves of Gem ( 1 ng/ml) or GemOx (Gem 1 ng/ml + Ox 10 ng/ml) pretreated DANG (2 days) are shifted upwards and to the left compared to untreated target cells (Figure 37A). Treatment of tumor cells with Gem or GemOx leads to upregulation of CLDN18.2 and higher susceptibility for IMAB362 mediated ADCC. We could observe a decrease of the EC50 values and higher maximal cell lyses for IMAB362-mediated ADCC (Figure 37B) in DANG cells after treatment with herapeutic agents.

Peripheral blood mononuclear cells (PBMCs) including NK cells, monocytes, mononuclear cells or other effector cells from healthy human donors were purified by Ficoll Hypaque density centrifugation. Washed effector cells were seeded in X-Vivo medium. Kato III cells which express CLDN18.2 endogenously and are of gastric origin were used as target cells in this setting. Target cells stably expressed luciferase, lucifer yellow, which is oxidized by viable cells only. Purified anti-CLDN18.2 antibody IMAB362 was added at various concentrations and as an isotype control antibody an irrelevant chim hulgGI antibody was used. Samples were assayed for cytolysis by measuring luminescence resulting from the oxidation of lucifer yellow which is a value for the amount of viable cells left after IMAB362 induced cytotoxicity. Kato III pretreated for 3 days with Irinotecan (1000 ng/ml), xel (5 ng/ml) or tin (2000 ng/ml) were compared to untreated medium cultivated target cells and IMAB362 induced ADCC was quantified.

Kato III cells ated for 3 days with Irinotecan, Docetaxel or Cisplatin exhibited a lower level of viable cells compared to medium cultivated target cells (Figure 38a) and claudinl8.2 expression in cells pretreated with Irinotecan, Docetaxel or Cisplatin was increased compared to medium cultivated cells (Figure 38b).

Furthermore, pretreatment of Kato III cells with Irinotecan, xel or Cisplatin augmented the potency of IMAB362 to induce ADCC (Figure 38c, d).

Effect of chemotherapy on IMAB362 induced CDC The CDC y of IMAB362 has been characterized by incubation with target cells in the presence of human serum as source of complement.

Medium cultivated MiaPaCaLVT show EC50 values for 2 specific lyses of 7665 ng/ml. Treatment with Gem leads to decrease of EC50 to 4677 ng/ml ed with increase of max lyses (Figure 39). s of chemotherapeutic agents on IMAB362-induced CDC were analyzed by pretreating KATO III gastric cancer cells with 10 ng/ml 5-FU and 500 ng/ml oxaliplatin (5-FU + OX) for 48 hours. Representative dose response curves of IMAB362-induced CDC using chemotherapeutic pretreated KATO III cells are shown in Figure 40. Pretreatment of tumor cells for 48 hours augmented the potency of IMAB362 to induce CDC, resulting in higher maximal cell lysis of pretreated tumor cells compared to untreated cells.

Example 8 : Efficacy of IMAB362 in combination with chemotherapy in mouse tumor models moral ty of IMAB362 in combination with Gem or GemOx was examined in subcutaneous pancreatic carcinoma xenograft models, which were used for testing efficacy of IMAB362 as single agent before.

BxPC3-LVT or MiaPaCaLVT tumor bearing nude mice treated with IMAB362 showed significant tumor growth retardation compared to control mice treated with saline control.

Chemotherapy with up to 100 mg/kg gemcitabine without additional IMAB362 treatment showed no significant therapeutic effect on BxPC3-LVT or MiaPaCaLVT xenograft. In st, the combined treatment with 50-100 mg/kg gemcitabine plus 2 resulted in significantly increased tumor growth inhibition and in prolonged survival of tumor bearing mice compared to mice d with chemotherapy alone e 41, Figure 42, Figure 43). These observations indicate the existence of synergistic therapeutic effects by combination of gemcitabine and IMAB362 immunotherapy.

When using high doses of gemcitabine with 2x 150 mg/kg per week, established MiaPaCa LVT aft tumors are strongly inhibited in tumor growth independent from IMAB362 treatment (Figure 44A). However, mice treated with combined therapy of 2 and gemcitabine showed highly significant prolonged survival compared to mice treated with abine as single agent (Figure 44B).

Example 9: ZA/IL-2 ent results in expansion of high amounts of VY9V52 T-cells PBMCs were cultivated for 14 days in RPMI medium supplemented with 300 U/ml IL-2 and with or w/o 1 mM zoledronic acid (ZA). The percentage of 2+ T cells within the CD3+ lymphocyte population and the percentage of CD 16+ cells within the CD3+Vy9+V52+ T cell population was determined by multicolor FACS on day 0 and day 14.

IL-2 addition in the PBMC cultures is required for survival and growth of cytes. They efficiently expand in cultures supplied with 300 U/ml IL-2. FACS analysis using Vy9 and V52 specific antibodies reveal that addition of ZA/IL-2 specifically induces the accumulation of Vy9V52 T cells. After 14 days, the CD3+ cyte population can comprise up to 80% of Vy9V62 T cells. A portion of Vy9V52 T cells express CD 16, whereas enrichment of these cells within the CD3+ lymphocyte population is 10-700fold, dependent on the donor. Enrichment of the CD16+Vy9+V62+ T cells in the cultures is 10-600fold higher as compared to cultures grown t ZA. We conclude that 2 treatment of PBMCs in vitro results in the up-regulation of the ADCC-mediating Fcylll receptor CD 16 in a significant proportion of gd T cells.

Similar to NK cells, the ZA/IL-2 expanded Vy9V62 T cells are positive for CD 16, the FcyRIII receptor via which a cell-bound antibody triggers ADCC. To evaluate whether V 9V 2 T cells are capable of inducing potent ADCC in conjunction with 2 a series of experiments has been performed.

PBMCs derived from 2 ent donors (#1 and #2) were cultivated in medium with 300 U/ml IL-2 and with or w/o 1 mM ZA. After 14 days cells were harvested and added with increasing concentrations (0.26 ng/ml - 200 m ΐ )of 2 to NUGC-4 cells sing CLDN18.2.

Specific killing was determined in luciferase assays. ADCC assays were performed with 27 donors grown in 300 U/ml IL-2 and either with or w/o ZA wherein NUGC-4 served as target cells. For each donor, the EC50 values calculated from the dose-response curves and the maximum ic killing rate at a dose of 200 mg/ml IMAB362 were scored in the scatter plots.

Strong IMAB362-dependent ADCC activity was observed against CLDN18.2-positive NUGC-4 cells using PBMCs cultivated for 14 days with ZA/IL-2. Using ZA/ILtreated PBMC cultures, ADCC depends on the presence of Vy9V52 T cells. If cells are cultured without ZA, ADCC activity is d for most donors. In these cultures, residual ADCC activity is NK-cell ent. By testing more than 20 donors, ADCC assays reveal that ZA/IL-2 treatment of PBMCs improves the EC50 and maximum ic killing rates as compared to PBMCs cultured with IL-2 alone.

Example 10: Efficacy of IMAB362 in combination with gemcitabine in mouse asis model: To analyze the effect of IMAB362 in combination with gemcitabine treatment on Patu8988S lung metastases in vivo, 12 Hsd:Athymic Nude- « u mice per group were treated with an intravenous injection 2xl0 6 Patu8988S cells into the tail vein. 14 days post tumor cell injection mice were treated with 200 g 2 or PBS as control (i.v./i.p.) semi-weekly plus a weekly dose 100 mg/kg gemcitabine i.p. for 4 weeks. Treatment with IMAB362 or PBS was maintained until mice were sacrificed on day 70 post tumor cell injection. Analysis of the xenografted tumor load in the lungs was performed by QPCR of human DNA in the prepared lungs and by an optical analysis of an immunohistological staining with an anti-human MHC-I antibody (clone EPR1394Y). The results show that mice treated with IMAB362 plus gemcitabine have a significantly reduced amount of human DNA in their lungs (Figure 45A) and that the surface of lung slices stained against human MHC-I complex is significantly smaller than in lungs of mice treated with an irrelevant antibody plus gemcitabine e 45B). Both methods reveal a reduced tumor load of Patu8988s xenografts in the lungs of 2 plus gemcitabine treated mice, showing that the combination with IMAB362 is significantly superior to a monotherapy with gemcitabine.

INDICATIONS RELATING TO DEPOSITED MICROORGANISM OR OTHER BIOLOGICAL MATERIAL (PCT Rule \ 3bis) A. The indications made below relate to the deposited microorganism or other ical material ed to in the description on page 4 . | j 3 . IDENTIFICATION OF DEPOSIT Further deposits are identified on an onal sheet Name of depositary institution DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH Address of tary institution (including postal cod and country) Mascheroder Weg b 381 24 Braunschweig Date of deposit ion Number October 9 , 2005 DSM ACC2737 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet - Mouse (Mus musculus) myeloma P3X63Ag8U.1 fused with mouse (Mus musculus) splenocytes - Hybridoma ing antibody against human claudin-1 8A2 D. DESIGNATED STATES FOR W IC INDICATIONS ARE MADE (if the indications arc notfor all designated States) E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable) The indications listed below will be ted to the International Bureau later (specify thegeneral nature o the indications e.g.. "Accession N lx r of Deposit") For receiving Office use only For International Bureau use only I IThis sheet was ed with the international application I IThis sheet was received by the International Bureau on: Authorized officer Authorized officer Form PCT RO/ 1 4 (July1998; reprint January 2004) New International Patent ation Ganymed Pharmaceuticals AG, et al.

ATION THERAPY INVOLVING ANTIBODIES AGAINST CLAUDIN 18.2 FOR TREATMENT OF CANCER" Our Ref.: 342-73 PCT onal Sheet for Biological Material Identification of further deposits: 1) The Name and Address of depositary institution for the deposits (DSM 8, DSM ACC2739, DSM ACC2740, DSM ACC2741, DSM 2, DSM ACC2743, DSM ACC-2745, DSM ACC2746, DSM ACC2747, DSM ACC2748) are: DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH Mascheroder Weg l b 38124 Braunschweig 2) The Name and Address of depositary institution for the deposits (DSM ACC2808, DSM ACC2809, DSM ACC2810) are: DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH Inhoffenstr. 7 B 38124 Braunschweig Additional Indications for all above mentioned deposits: Mouse (Mus musculus) myeloma g8U.l fused with mouse (Mus musculus) splenocytes Hybridoma secreting antibody against human claudin-1 8A2 3) Depositor: All above mentioned depositions were made by: Ganymed ceuticals AG FreiligrathstraBe 2 55131 Mainz

Claims (32)

Claims:

1. Use of an antibody having the ability to bind to CLDN18.2 for the preparation of a medicament for treating or preventing a cancer disease in a combination therapy with an agent stabilizing or increasing expression of CLDN18.2, n the cancer is CLDN18.2 positive, and wherein (a) the antibody binds to CLDN18.2 and mediates killing of cells expressing .2, and (b) the agent izing or increasing expression of CLDN18.2 comprises an agent ed from the group consisting of gemcitabine and a salt, ester or conjugate thereof.

2. Use of an agent for stabilizing or increasing sion of CLDN18.2 for the preparation of a medicament for treating or preventing a cancer disease in a combination therapy with an antibody having the y of binding to CLDN18.2, wherein the cancer is CLDN18.2 positive, and wherein (a) the antibody binds to CLDN18.2 and mediates killing of cells expressing CLDN18.2 and (b) the agent stabilizing or increasing expression of CLDN18.2 comprises an agent selected from the group consisting of gemcitabine and a salt, ester or conjugate thereof.

3. The use of claim 1 or 2, wherein the antibody comprises an antibody heavy chain amino acid sequence and an antibody light chain amino acid sequence, wherein the antibody heavy chain comprises a heavy chain variable region comprising the set of complementarity-determining regions CDR1, CDR2 and CDR3 of SEQ ID NO: 32 or a variant thereof and the dy light chain comprises a light chain le region comprising the set of complementarity-determining regions CDR1, CDR2 and CDR3 of SEQ ID NO: 39 or a variant thereof, wherein said variant ses up to 5 amino acid substitutions in said CDR region.

4. The use of any one of claims 1 to 3, wherein the antibody heavy chain amino acid sequence of said antibody comprises the amino acid sequence shown in SEQ ID NO: 17 and the antibody light chain amino acid ce comprises the amino acid sequence shown in SEQ ID NO: 24.

5. The use of any one of claims 1 to 4, wherein expression of CLDN18.2 is at the cell surface of a cancer cell.

6. The use of any one of claims 1 to 5, wherein the agent stabilizing or increasing expression of CLDN18.2 comprises an agent which induces a cell cycle arrest or an accumulation of cells in one or more phases of the cell cycle.

7. The use of any one of claims 1 to 6, n the agent stabilizing or increasing expression of CLDN18.2 comprises an agent selected from the group consisting of side analogs, platinum compounds, camptothecin analogs, t axanes, salts thereof, and combinations thereof.

8. The use of any one of claims 1 to 7, wherein the agent stabilizing or increasing expression of CLDN18.2 comprises an agent selected from the group consisting of gemcitabine, rouracil, oxaliplatin, irinotecan, paclitaxel, albumin-bound paclitaxel, salts thereof, and combinations thereof.

9. The use of any one of claims 1 to 8, wherein the agent izing or increasing expression of CLDN18.2 ses an agent ng immunogenic cell death.

10. The use of claim 9, wherein the agent inducing immunogenic cell death comprises oxaliplatin.

11. The use of any one of claims 1 to 10, wherein the therapy comprises administering a combination of gemcitabine and oxaliplatin, a combination of gemcitabine and cisplatin, a combination of gemcitabine and carboplatin or a combination of oxaliplatin, 5-fluorouracil or capecitabine and irinotecan.

12. The use of any one of claims 1 to 11, wherein the therapy comprises administering folinic acid, oxaliplatin, 5-fluorouracil or capecitabine and ecan.

13. The use of any one of claims 1 to 12, wherein the therapy further comprises administering an agent stimulating γδ T cells, wherein said agent is a sphonate.

14. The use of claim 13, wherein the γδ T cells are Vγ9Vδ2 T cells.

15. The use of claim 13 or 14, wherein the agent stimulating γδ T cells is a nitrogencontaining bisphosphonate.

16. The use of any one of claims 13 to 15, wherein the agent stimulating γδ T cells is selected from the group consisting of zoledronic acid, clodronic acid, ibandronic acid, pamidronic acid, risedronic acid, minodronic acid, olpadronic acid, alendronic acid, incadronic acid and salts thereof.

17. The use of any one of claims 13 to 16, n the agent stimulating γδ T cells is stered in combination with interleukin-2.

18. The use of any one of claims 1 to 17, wherein the antibody having the ability of binding to CLDN18.2 binds to the first extracellular loop of CLDN18.2.

19. The use of any one of claims 1 to 18, wherein the antibody having the ability of g to CLDN18.2 mediates cell killing by one or more of com plement ent cytotoxicity (CDC) mediated lysis, antibody ent cellular cytotoxicity (ADCC) mediated lysis, induction of a poptosis and inhibition of prolif eration.

20. The use of any one of claims 1 to 19, wherein the therapy comprises administering the antibody having the ability of binding to CLDN18.2 at a dose of up to 1000 mg/m2.

21. The use of any one of claims 1 to 20, wherein the therapy comprises administering the antibody having the ability of binding to CLDN18.2 repeatedly at a dose of 300 to 600 mg/m2.

22. The use of any one of claims 1 to 21, wherein CLDN18.2 has the amino acid sequence according to SEQ ID NO: 1.

23. The use of any one of claims 1 to 22, wherein the cancer is a pancreatic cancer.

24. The use of claim 23, wherein the atic cancer comprises primary cancer, advanced cancer or metastatic cancer, or a combination thereof such as a combination of pancreatic primary cancer and metastatic cancer.

25. The use of claim 24, wherein the metastatic cancer comprises asis to the lymph nodes, ovary, liver or lung, or a combination thereof.

26. The use of any one of claims 23 to 25, wherein the pancreatic cancer comprises a cancer of the atic duct.

27. The use of any one of claims 23 to 26, wherein the pancreatic cancer comprises an adenocarcinoma or carcinoma, or a combination thereof.

28. The use of any one of claims 1 to 27, wherein the pancreatic cancer comprises a ductal adenocarcinoma, a mucinous adenocarcinoma, a neuroendocrine carcinoma or an acinic cell carcinoma, or a combination thereof.

29. The use of any one of claims 1 to 28, wherein the cancer is partially or completely refractory to gemcitabine treatment such as gemcitabine monotherapy.

30. The use of any one of claims 23 to 29, wherein preventing atic cancer comprises ting a recurrence of pancreatic cancer.

31. The use of any one of claims 1 to 30, wherein the patient had a surgery for pancreatic .

32. The use of any one of claims 1 to 31, wherein the patient has a precancerous pancreatic lesion, or a cerous pancreatic lesion comprising a beginning malignant histological change in the pancreatic ducts.