WO2010022551A1

WO2010022551A1 - A method for checking insect-resistant transgenic rice

Info

Publication number: WO2010022551A1
Application number: PCT/CN2008/002012
Authority: WO
Inventors: 王永; 兰青阔; 程奕; 朱珠; 赵新
Original assignee: 天津市农业科学院中心实验室
Priority date: 2008-08-26
Filing date: 2008-12-15
Publication date: 2010-03-04
Also published as: CN101343665B; CN101343665A

Abstract

A method for checking insect-resistant transgenic rice comprises: (1) adding 4 specific primers and a DNA polymerase having chain replacement activity to amplify sample DNA template at 63~65℃; and (2) evaluating whether there is amplification reaction or not by visualizing directly the turbidity of deposit in amplification pipe or the color change of SYBR Green adding into amplification pipe.

Description

Method for detecting transgenic insect-resistant rice

The invention belongs to the technical field of molecular biology, and relates to a detection method of a transgenic product, in particular to a method for rapidly detecting transgenic insect-resistant rice, by visually observing the turbidity of the reaction tube or observing the color change or observing agar after adding 1000 X SYBR Green. Sugar gel electrophoresis was used to determine the amplification.

Background technique

Genetic engineering since its inception in ²⁰ century 70s, has made rapid development. In 1996-1999, 12 countries around the world planted genetically modified crops. The United States is the country with the largest area of GM crops, and China ranks fourth, but the planting area accounts for only 1% of the global total. At present, most of the research on genetically modified organism technology is distributed in the fields of insect resistance genetic engineering, disease resistance genetic engineering, stress resistance genetic engineering, product shield improvement genetic engineering, and control development genetic engineering. For example, the insect-resistant genetic engineering introduces the Bt gene into crops such as cotton, corn, rice, tobacco, and potatoes, and kills pests; or introduces the peptone inhibitor gene into the crop to interfere with the digestive action of the pest, leading to the death of the pest. Chinese Academy of Agricultural Sciences, China Agricultural University, Chinese Academy of Sciences, Henan Academy of Agricultural Sciences and many other research institutes and universities have introduced chitinase and glucanase bivalent genes into wheat for disease-resistant transgenic wheat, transgenic tobacco, genetically modified rice, etc. . The University of Edinburgh in the UK introduces the jellyfish luminescent gene into crops such as tobacco, celery and potatoes to obtain luminescent crops that drive off pests. In short, in terms of crop types, most of them are concentrated in seven crops of soybean, corn, cotton, rape, potato, pumpkin, papaya and zucchini.

The success of genetically modified rice began in 1986. Uchimiya and others first obtained kanamycin-resistant transgenic rice calli. Two years later, three laboratories in the world obtained transgenic rice plants. Throughout the development of genetically modified rice, the use of transgenic technology for genetic improvement of rice is mainly concentrated in the following aspects:

Insect resistance

There are three kinds of exogenous genes applied to the improvement of insect resistance in rice. One is the insecticidal crystal protein gene (Bt gene) isolated from Bacillus thuringiensis, and the other is an insect protease inhibitor isolated from plants (PI). Gene), the third is the plant lectin gene. The scientists successfully introduced the cryIA (b) and crylA (c) genes into rice by gene gun method, Agrobacterium-mediated method, electric shock method, etc., and obtained transgenic plants, which were tested for insect resistance and transgenic plants against Chilo suppressalis. Sanhua, Daphnia, and rice leaf roller have obvious lethal effects. Cornell University in the United States introduced the cowpea trypsin inhibitor gene CPT into rice in 1993 to obtain transgenic plants, which have certain resistance to stem borer and stem borer. The transgenic plants obtained by introducing a cysteine protease inhibitor gene into rice by Vain et al. reduced the hatching rate of nematodes by 55 %. Zhejiang University's application of Bt gene transformation has been approved by Zhejiang Science and Technology Department and approved in 1999. Environmental release test.

2. Resistance to illness

The National Agricultural Environment Institute of Japan successfully introduced the rice stripe virus coat protein gene RS V CP into rice to obtain transgenic plants. Two to three weeks after inoculation, only 2% to 3% of the transgenic plants were found, while the control was 95%. 100% of the onset.

When Chr i s tou introduced the Xa21 gene into rice, it significantly increased the resistance of rice to bacterial blight and rice blast. He Yingchun et al. introduced tobacco chitinase gene into rice to obtain high resistance to rice sheath blight and rice blast disease transgenic plantation. Sichuan Agricultural University introduced the disease-resistant and insect-resistant genes into the restorer line of hybrid rice, and obtained the transgenic double-resistant hybrid rice.

3. Herbicide resistance

In the 1980s, Monsanto Company of the United States took the lead in carrying out the research on the transfer of herbicide resistance genes and the development of resistant varieties with the advantage of its vast and efficient herbicide Roundup (glyphosate). Subsequently, Aegford Company of the United States (AgrEvo) Anti-microbial herbicide glufosinate-transgenic rice and American cyanamide-based anti-imidazolinone herbicide transgenic rice have been introduced. The Chinese herbicide-tolerant gene is mainly the PPT acetyltransferase gene, which is the anti-bas ta gene (bar), and has also been obtained against Bas t a rice.

a 4. Stress resistance

Due to the difficulty in mapping, cloning and isolating the rice stress-tolerant genes, there are few reports on the anti-reversion gene rice. The stress-resistant genes that have been introduced into rice are mainly the CM0 gene in tobacco, the betaine biosynthetic enzyme gene codA and the rice flood-tolerant genes (pdc, pdc, pdc), which are transferred to rice to obtain drought resistance. , alkali-tolerant, salt-tolerant and stain-tolerant transgenic rice plants.

5. High yield and excellent shield traits

Yield and quality are comprehensive traits controlled by multiple genes. The introduction of individual foreign genes can only increase the level of a single factor in their constituents, but has no significant effect on their comprehensive levels. The current genetic engineering for improving rice yield is to introduce phosphoenolpyruvate carboxylase (PEPC) and ribulose carboxyphosphate synthase gene (RuB pC) from high-efficiency C4 plants into rice, in rice leaves. Expression in chloroplasts to increase photosynthetic efficiency of rice and increase yield. Although Ku et al. introduced the PEPC gene into rice, and obtained transgenic rice with an increase in photosynthetic efficiency of nearly 50%, it was far from being a high-yield variety, but it brought new hope for a large increase in rice production. In terms of quality improvement, proline-rich genes, methionine-rich and lysine genes, octahydrotoxin synthase and its dehydrogenase genes, glycinin genes and high-lysine genes have been successfully The introduction of rice and the acquisition of transgenic plants are of great importance for the development of special rice products.

As a large number of GM crops are gradually coming to market, the safety of foods processed by GM crops and GM crops has begun to receive attention. Essentially, genetically modified crops There is no difference between the crop varieties that are conventionally cultivated. Conventional breeding is generally achieved by sexual hybridization, while plant genetic engineering is the introduction of exogenous recombinant DNA into the plant genome using techniques such as Agrobacterium, gene gun, electroporation, and microinjection. Although in theory, the genetic characteristics and phenotype of genetically modified organisms should be more accurately predicted and safer to apply, it is still necessary to assess the safety of genetically modified crops.

The EU first proposed the label management of genetically modified foods. In 1999, non-GM products exported to the EU were not allowed to contain 1% of GM products; in 2002, the EU reduced the minimum mark to 0.3%. Japan, Australia, and New Zealand have different regulations for the minimum content of genetically modified ingredients, with a domain value from 5°/. Not waiting.

On May 9, 2001, China promulgated and implemented the Regulations on the Safety Management of Agricultural Genetically Modified Organisms. On January 5, 2002, China announced the three supporting management methods for the safety evaluation, identification and import safety management of agricultural genetically modified organisms. The catalogue of agricultural genetically modified organisms managed by the label was implemented in batches and officially implemented on March 20, 2002.

The detection of genetically modified crops is mainly to test whether the sample contains foreign proteins (gene expression products) and whether it contains foreign genes (DNA). Exogenous proteins in transgenic crops can be detected by enzyme-linked immunosorbent assay (ELISA), test strip detection, Wes tern hybridization, etc. based on immunological principles, and the matrix containing the protein of interest is extracted from the sample to be tested according to a certain procedure. The specific binding of the antibody to the protein of interest (antigen) is utilized to generate a detectable signal by coupling the antibody to the antigen-antibody complex. There are two main methods for nucleic acid detection in transgenic crops: nucleic acid hybridization (SBR), PCR detection. At present, PCR detection methods are the most important and most accurate methods for detecting transgenic crops, including qualitative PCR methods, complex PCR methods, nested PCR methods, competitive quantitative PCR methods, and fluorescent quantitative PCR methods.

Qualitative PCR and real-time quantitative PCR detection methods are widely used at home and abroad.

Summary of the invention

The object of the present invention is to disclose a method for rapidly detecting transgenic insect-resistant rice and designing a set of primers according to the sequence of the junction between the foreign gene and the endogenous gene to amplify the turbidity or observe the color after adding SYBR Green. The change or observation of agarose gel electrophoresis results to determine the amplification.

The invention provides a transgenic insect-resistant rice detecting method capable of quickly and accurately detecting transgenic rice components in a sample. Compared with conventional qualitative and quantitative PCR methods, it has the advantages of simple operation, high specificity and high sensitivity.

The technical solution of the present invention is as follows:

a specific primer for detecting transgenic insect-resistant rice,

Wherein the outer primer forward sequence: 5, - AGGATTCACTGGTGGAGA-3, ,

External primer reverse sequence: 5, -GATTATCCAAGGAGGTAGCT-3 ';

Intrinsic positive sequence: 5, - TGGGAAGTGAATTGGAACTTCAATACCTCGTTAGACTCAACAGC-3', internal primer reverse sequence:

5, -TCTACCAGATATAGAGTTCGTGTGAGAAGATGGATGAATTACCCCAA-3'. Each primer was prepared as a mother liquor at a concentration of ΙΟΟμιηοΙ/L, then 1 μΐ each of the outer primers, 8 L each of the inner primers, and 2 L of deionized water were sterilized and mixed thoroughly to obtain a primer mixture.

The method for detecting transgenic insect-resistant rice using the above set of primers of the present invention is characterized in that the following steps are included:

(1) using the four specific 'primers' and one of the 匪A polymerases having strand displacement activity according to claim 1, adding template DNA, at 63-65 ° C for 45-60 min, and at 8 GX for 2 min, 4 °C preservation;

The amplification reaction system: The total volume of the amplification reaction is 25 μί, and its various components are: 10 ThermoPol Buffer 2.5 μ L, 4 mol/L saponin 6 · 25 μ L, 0.2 mol/L MgS040.25 L, mixed primer l^L, 10 μmol/L dNTPs 3.5 μL, 8000 U/L Bst DNA polymerase large fragment 1-5 wL, template DNA 1-5 μί, supplemented with sterile deionized water to 25 μ L;

(2) At the end of the amplification reaction, take the system solution 3-25 yL, and judge the amplification by different methods, including: directly adding the fluorescent dye SYBR Green to the amplification tube, and observe whether there is amplification reaction through color change; or evaluation The amount of the white precipitate of magnesium pyrophosphate as a by-product was amplified to observe the presence or absence of an amplification reaction; or the amplification result was judged by observing an agarose gel electrophoresis band.

The detection method according to the present invention, wherein the strand displacement active DNA polymerase is a large fragment of 8000 U/L Bst DNA polymerase.

The fluorescent dye of the present invention is 1000 times SYBR Green in an amount of 1 - 2 L. In the detection method of the present invention, the template A refers to the genome hidden from the sample to be tested.

In order to more clearly illustrate the measurement method of the present invention, the test method of the present invention will now be described in detail.

Principle

The method uses a novel nucleic acid amplification method, which uses four specific primers and a DNA polymerase with strand displacement activity to amplify nucleic acids at 63Ό-65°C, and the amplification efficiency can be short-time. Up to 10 ⁹ - 10" copies. Highly specific, efficient, fast, easy and so on.

2. Primer design

In this study, four primers were designed based on the sequence of the foreign gene of transgenic insect-resistant rice and the endogenous gene. Primers were synthesized by Dalian Bao Biotech.

Table 1 The primer sequence is as follows: Primer name base number sequence (5' to 3')

External primer forward sequence 18 AGGATTCACTGGTGGAGA External primer reverse sequence 20 GATTATCCAAGGAGGTAGCT

Inner primer forward sequence 44 TGGGAAGTGAATTGGAACTTCAATACCTCGTTAGACTCAACAGC Internal primer forward sequence 47 TCTACCAGATATAGAGTTCGTGTGAGAAGATGGATGAATTACCCCAA

3. Reaction conditions

Reactive reagents require strand displacement DNA polymerase, dNTPs, transgenic insect-resistant rice-specific primers, betaine, MgSO ₄ and reaction buffer. The reaction is carried out under constant temperature conditions, and the reaction time varies depending on the efficiency of the primer and the mass of the template DNA, and is generally 1 h or less. The addition template should be A, 45-6 Omin at 63-65 °C, and terminated at 80 °C for 2 min.

The advantage of this technology is that no thermal cycling is required. Since the amplification is carried out under constant temperature conditions, only a constant temperature water bath or a metal heating block is required to maintain the reaction temperature, and an expensive instrument such as a PCR machine is not required.

Materials and Methods:

(1) Reagents: large fragment of Bst MA polymerase produced by BioLabs (NEW ENGLAND) and 10 times ThermoPolBuffer solution; specific primer; betaine solution; MgS0 ₄ solution; dNTPs;

(2) Amplification reaction system: The total volume of the amplification reaction is 25 L, and its various components and final concentrations are: lO x ThermoPol Buffer 2.5 μΐ, 4 mol/L betaine 6, 25 μί, 0.2 mol/L MgS0 ₄ 0· 25 μί, Primer Mix Ι μί, ΙΟμπιοΙ/L dNTPs 3. 5 μΐ, 8000U/L Bst DNA polymerase large fragment l-2 L, template MA b 5 μί, supplemented with sterile deionized water 25 yL.

(3) Amplification reaction process: 45-60 min at 63-65 °C, and kept at 80 °C for 2 min, stored at 4 °C;

(4) At the end of the amplification reaction, take the system solution 3-25 to determine whether the amplification is performed by different detection methods.

4. Observation of amplification results

There are three observation methods that are suitable for different situations.

1) Using a 2% agarose gel, adding EB stain, electrophoresis at 100 V for 50 min, observed under UV light. Since the reaction produces an amplification product of the stem-loop structure of various fragment lengths, it is shown in the electropherogram as a dispersion and a step-like band phenomenon from the spotting hole. Results are shown in Figure L

2) Since the reaction forms a large amount of double-stranded DNA product, the fluorescent dye SYBR Green can be directly added to the amplification tube, and the reaction tube without amplification reaction is orange under the ultraviolet lamp or the naked eye. Will turn green. The results are shown in Figure 2. 3) The detection can also be judged by evaluating the amount of white precipitate of the amplification by-product magnesium pyrophosphate. In the reaction, when a large amount of DNA is synthesized, a by-product, magnesium pyrophosphate, is precipitated, and the amplification or not can be judged by visual observation or by measuring the turbidity of the precipitate in the reaction tube.

The amplification method of the invention for detecting transgenic insect-resistant rice has the following advantages:

1) Easy to operate: No thermal cycling step is required, and only a constant temperature is required to react.

2) High specificity'. This technique amplifies 6 segments of the 耙 sequence by 4 primers and is therefore highly specific.

3) Fast and efficient: the whole amplification can be completed in less than lh, and the output can reach 10 ⁹ -10 ^lfl copies;

4) High sensitivity: The amplification template can be only 10 copies or less.

5) Identification of the cartridge: The turbidity of the precipitate in the reaction tube can be directly observed with the naked eye or passed

SYBR Green color change judges whether amplification or not.

DRAWINGS

Figure 1 shows the electrophoresis analysis of the amplified product; Marker, negative control, negative sample 1, negative sample 2, positive control and positive sample from left to right.

Figure 2 is a graph showing the results of adding SYBR Green to the amplified product; the left is a positive control and the right is a negative control.

Figure 3 is a graph showing the results of adding SYBR Green to the amplified product; from the left side, it is a positive control, a sample to be tested, and a negative control.

Figure 4 is a graph showing the results of adding SYBR Green to the amplified product; from left to right, the negative control, the sample to be tested, the positive control, and the sample to be tested ² .

Figure 5 is an electrophoresis analysis map of the amplified product. From left to right: DL2000 DNA Marker, sample to be tested 1, sample to be tested 2, negative control, positive control.

Figure 6 is an agarose gel electrophoresis analysis of Example 4, using the method of the present invention, observed under ultraviolet light, wherein M, DL2000 DNA, Marker; 1, 5%; 2, 1%; 3, 0. 5%; 4, 0. 1%; 5, 0. 05%; 6, 0. 01%; 7, 0. 005%; 8, negative control.

Figure 7 is an agarose gel electrophoresis analysis of the amplified product of Example 4, a conventionally defined PCR method, and observed under an ultraviolet lamp. Wherein M, DL2000 DNA Marker; 1, 5%; 2, 1%; 3, 0. 5%; 4, 0.1%; 5, 0. 05%; 6, 0. 01%; 7, 0. 005 %; 8, negative control.

In order to more clearly illustrate the method of the present invention, the test method of the present invention will be described in detail below. It should be noted that the primer sequences of the present invention are shown in Table 1.

Example 1

(1) Reagents: Bioss (New ENGLAND) Bs t DNA polymerase large fragment and 10 times ThermoPol Buffer solution; specific primer mixture; 4 mol / L betaine solution; 0. 2mol / L MgS04 solution;

(2) Amplification reaction system: The total volume of the amplification reaction is 25 y L, and its various components are: 10 X ThermoPol Buffer 2. 5 w L, 4 mol / L betaine 6. 25 μ L, 0. 2 mol /L MgS040.25 μΐ, mixed primer 1μ 10 μmol/L dNTPs 3.5 μL, 8000U/LBst DNA polymerase large fragment lyL, template DNA l L, supplemented with sterile deionized water to 25 μL, mixed uniformly and centrifuged ;

(3) Amplification reaction procedure: 60 ° C for 60 min, and kept at 80 ° C for 2 min, 4 ° C, and stored;

(4) At the end of the amplification reaction, the system solution ΙΟμί was taken, and the fluorescent dye l L 1000 xSYBR Green was directly added to the amplification tube, and the mixture was shaken and observed by the naked eye. The reaction tube without amplification reaction is orange-yellow, and the reaction tube with amplification reaction will turn green. The results are shown in Fig. 3. As can be seen from the figure, the sample to be tested is a positive sample containing the transgenic insect-resistant rice component.

Example 2:

(1) Reagents: Bst 丽 A polymerase large fragment and 10 times ThermoPol Buffer solution produced by BioLabs (NEW ENGLAND); specific primer mixture; 4 mol/L betaine solution; 0.2 mol/L MgS04 solution;

(2) Amplification reaction system: The total volume of the amplification reaction is 25 μί, and its various components are: 10 X ThermoPol Buffer 2.5 μ ΐ 4 mol/L betaine 6.25 μL, 0.2 mol/L

MgS04 0.25 uL, primer mix ΙμΙ^, 10 μmol/L dNTPs 3.5 μΐ, 8000 U/L Bst DNA polymerase large fragment 2 L, template DNA 2 μΐ, supplemented with sterile deionized water to 25 ixl, mixed evenly After centrifugation;

(3) Amplification reaction procedure: 45 ° C for 45 min, and kept at 80 ° C for 2 min, 4 ° C, preservation;

(4) At the end of the amplification reaction, 15 L of the system solution was taken, and the fluorescent dye 2yL lOOOxSYBR Green was directly added to the amplification tube, and the mixture was shaken and observed by the naked eye. The reaction tube without amplification reaction is orange-yellow, and the reaction tube with amplification reaction will turn green. The results are shown in Fig. 4. As can be seen from the figure, the sample to be tested 1 is a negative sample, does not contain the transgenic insect-resistant rice component, and the sample 2 contains the transgenic insect-resistant rice component.

Example 3:

(1) Reagents: Bst MA polymerase large fragment produced by BioLabs (NEW ENGLAND) and 10 times ThermoPol Buffer solution; specific primer mixture; 4 mol/L betaine solution; 0.2 mol/L MgS04 solution;

(2) Amplification reaction system: The total volume of the amplification reaction is 25 μί, and its various components are: 10 X ThermoPol Buffer 2.5 μί, 1⁄2ol/L betaine 6 · 25 μ L, 0.2 mol/L MgS04 0.25 nl , Primer mixture Ιμίί , 10 μmol/L dNTPs 3.5 μΐ, 8000 U/L Bst DNA polymerase large fragment 2 μί, template DNA 5 μΐ, supplemented with sterile deionized water to 25 μΐ, mixed uniformly and centrifuged;

(3) Amplification reaction procedure: carried out at 63 ° C for 60 min, and kept at 80 ° C for 2 min, 4 ° C, and stored; (4) At the end of the amplification reaction, the system solution was analyzed by electrophoresis on a 2% agarose gel after electrophoresis at 25 μM. There is no obvious band in the reaction tube without amplification reaction, and a stepped band appears in the reaction tube with amplification reaction. The results are shown in Figure 5. The sample does not contain transgenic insect-resistant rice components.

Example 4:

Comparative experiment: Qualitative PCR assay of transgenic insect-resistant rice and comparison with the assay method of the present invention:

(1) Reagents of the method of the present invention: large fragment of Bst DNA polymerase produced by BioLabs (NEW ENGLAND) and 10 times of ThernioPol Buffer solution; specific primer mixture; 1⁄2ol/L betaine solution; 0.2 mol/L MgS04 solution; DNA template Includes samples containing 5%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001% of transgenic insect-resistant rice ingredients.

(2) The amplification reaction system of the present invention: The total volume of the amplification reaction is 25 L, and its various components are: 10 ThermoPol Buffer 2.5 μΐ, 4 mol/L betaine 6.25 μΐ, 0.2 mol/L MgS04 0.25 L, primer Mixture Ι μί, 10 μmol/L dNTPs 3.5 μΐ, 8000U/LBst DNA polymerase large fragment 2μ1^, template DNA 5 L, supplemented with sterile deionized water to 25μί;

(3) The amplification reaction procedure of the present invention is carried out at 63 ° C for 60 min, and kept at 80 ° C for 2 min, 4 ° C, and stored;

(4) The amplification reaction of the present invention was completed, and 3 μί of the system solution was taken, and analyzed by 2% agarose gel electrophoresis, and the result was observed under an ultraviolet lamp. There is no obvious band in the reaction tube without amplification reaction, and a stepped band appears in the reaction tube with amplification reaction. The results are shown in Figure 6: Μ, DL2000 DNA, Marker; 1, 5%; 2, 1%; 3, 0.5%; 4, 0.1°/. 5, 0.05%; 6, 0.01%; 7, 0.005°/. ; 8, negative control.

(5) Qualitative PCR method: PCR reaction primers are amplified by a foreign primer in the reaction of the present invention. The PCR reaction was 25 systems, 10 x PCRbuffer (Promega) 2.5 μΐ, 10 mM dNTPs (Promega) 0.5 μΐ, upstream and downstream primers (10 mM) each 0.5 μΐ, Taq enzyme (5 U/μΐ, Promega) 0.5 μΐ, MA template Ιμί, sterilized deionized water 19.5 μΙ _α reaction procedure pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 30 s, 35 cycles; extension at 72 °C Min. The PCR product was electrophoresed on a 2% agarose gel at 40 V for 40 min and observed by a gel imaging analyzer. The results are shown in Figure 7: M, DL2000 DNA, Marker; 1, 5%; 2, 1 %; 3, 0.5%; 4, 0.1%; 5, 0.05%; 6, 0.01%; 7.0.005%; 8, negative control.

As can be seen from the comparison of the two methods, the sensitivity of the method of the present invention is significantly higher than that of the PCR method, and the sample having a lower transgenic rice resistance can be detected.

Claims

Claim 1 - Specific primer for detecting transgenic insect-resistant rice, comprising: an outer primer forward sequence: 5, -AGGATTCACTGGTGGAGA-3', external primer reverse sequence: 5, -GATTATCCAAGGAGGTAGCT-3 '; internal primer Forward sequence: 5, -TGGGAAGTGAATTGGAACTTCAATACCTCGTTAGACTCAACAGC-3', internal primer reverse sequence: 5, - TCTACCAGATATAGAGTTCGTGTGAGAAGATGGATGAATTACCCCAA-3. 2. A method for detecting transgenic insect-resistant rice using the specific primer of claim 1, which comprises the steps of:

(1) using the four specific primers of claim 1 and a DNA polymerase having strand displacement activity, adding template DNA, at 63-65 ° C for 45-60 min, and at 80

°C for 2min, stored at 4°C;

The amplification reaction system: The total volume of the amplification reaction is 25μί, and its various components are: lOxThermoPol Buffer 2.5 μ L, 4mol/L betaine 6.25 μί, Ο.2mol/L MgS040.25 μΐ, primer mixture ΙμΙ^, 10 μ mol/L dNTPs 3.5 μ L, 8000 U/L

Bst DNA polymerase large fragment 1-2 μL, template ship 1 5 μ with sterile deionized water to 25 μΐ^

(2) At the end of the amplification reaction, the system solution is 3-25 μί, and the amplification can be judged by different methods, including: directly adding the fluorescent dye SYBR Green to the amplification tube, and observing the presence or absence of the amplification reaction by color change; The amount of the amplification by-product magnesium pyrophosphate white precipitate was evaluated to observe the presence or absence of the amplification reaction'; or the amplification result was judged by observing the agarose gel electrophoresis band.

The detection method according to claim 2, wherein the primer mixture refers to preparing the synthesized primer powder into a mother liquor having a concentration of 100 μmol/L, and then taking 1 ML of the external primer, the inner primer. 8 μL each, add 2 μί of sterile deionized water, and mix well to prepare a primer mixture.

The detection method according to claim 1, wherein the fluorescent dye SYBR Green has a concentration of 1000 times and is added in an amount of from 1 to 2 μί.

The detection method according to claim 2, wherein the strand displacement active DNA polymerase is 8000 U/L Bst DNA polymerase large fragment 1 - 2μ.