WO2010013864A1

WO2010013864A1 - Use of microrna in treating or preventing solid cancers

Info

Publication number: WO2010013864A1
Application number: PCT/KR2008/005793
Authority: WO
Inventors: Duk-Soo Bae; Jeong-Won Lee; Young-Ae Park
Original assignee: Samsung Life Public Welfare Foundation Samsung Medical Center
Priority date: 2008-07-29
Filing date: 2008-10-01
Publication date: 2010-02-04
Also published as: KR20100012557A

Abstract

A niicroRNA which increases in its production level specifically in solid cancer, especially cervical cancer, is herewith provided. A method of using said microRNA for treating, preventing and diagnosing solid cancer, preferably cervical cancer, is also provided

Description

TITLE OF THE INVENTION

USE OF MICRORNA IN TREATING OR PREVENTING SOLID CANCERS

BACKGROUND OF THE INVENTION (a) Field of the Invention

A microRNA which increases in its production level specifically in solid cancer, especially cervical cancer, is provided. A method of treating, preventing and diagnosing solid cancer, preferably cervical cancer, using said microRNA is also provided.

(b) Description of the Related Art

Cervical cancer is the result of a multistep process that involves the transformation of the normal cervical epithelium to a preneoplastic cervical intraepithelial neoplasia that is subsequently transformed to invasive cervical cancer. Although high-risk human papillomaviruses are associated with cervical cancer, human papillomavirus infection alone is not sufficient to induce the malignant transformation. Therefore, other unidentified genetic alterations are likely involved. The identification of such genetic alterations would be of considerable importance for the screening and treatment of cervical cancer. MicroRNAs (miRNAs) are a recently discovered class of small noncoding

RNAs which regulate gene expression. Mature miRNAs have 18 to 25 nucleotides and are processed from hairpin precursors. MircoRNAs complimentarily binds to their target mRNAs and act as a post-transcriptional regulator. They are known to catalyze the cleavage of the mRNA, thereby inducing unstablization thereof, or to repress mRNA translation, thereby down-regulating the gene expression. The specific roles of miRNAs include the regulation of cell proliferation and metabolism, developmental timing, cell death, hematopoiesis, neuron development, human tumorigenesis, DNA methylation, and chromatin modification.

There is increasing evidence that the expression of miRNA genes is involved with oncogenesis and progress process of human cancers. A specific miRNA expression profiles have been reported in lung cancer, breast cancer, glioblastoma, hepatocellular carcinoma, papillary thyroid carcinoma, and more recently, colorectal cancer. Moreover, some studies have reported that miRNA expression signatures are associated with clinical outcomes of certain diseases. These data suggest that miRNAs play an important role in a variety of human cancers. However, molecular understanding of miRNA-mediated regulation of gene expression is still incomplete, and little has been known about the role played by miRNAs in oncogenesis as well.

SUMMARY OF THE INVENTION The object is to identify a specific miRNA capable of causing change in cell proliferation, and then, provide a technology using the miRNA to prevent or diagnose cancers.

To achieve said object, an embodiment provides a specific miRNA which is identified to increase in its production level specifically in solid cancers, preferably in cervical cancer.

Another embodiment provides a composition for treating solid cancer, preferably cervical cancer, which comprises an inhibitor against the above identified microRNA.

Still another embodiment provides a method of screening a treatment agent for solid cancer, preferably cervical cancer, which comprises the step of selecting a substance to inhibit the formation of the above identified microRNA.

Still another embodiment provides a method of diagnosing solid cancer, preferably cervical cancer, by assessing the expression level of the above identified microRNAs in a sample.

DETAILED DESCRIPTION OF THE EMBODIMENTS

The present invention relates to a technology using microRNAs to suppress proliferation of human cancer cells. More precisely, the inventors found that specific microRNAs increase in their production in cancer cells, and the proliferation of the cancer cells are suppressed by introduction of anti-miRNAs, which complimentarily bind to primary microRNA (pri-microRNA) of the microRNAs, into the cancer cells, to complete the present invention.

The current inventors identified miRNAs which exhibit significantly different levels of expression between the tissues respectively from normal cervical epithelium and early stage cervical invasive squamous cell carcinoma (ISCC), using real-time quantitative PCR assay with high sensitivity and efficiency. Among the miRNAs, the production of miR-199a was specifically observed to increase in the cervical ISCC. Thus, miR-199a is suggested as a target for cervical cancer treatments.

An embodiment provides a composition for treating and/or preventing cervical cancer, which comprises a miR-199a inhibitor as an effective ingredient. The above miR-199a may be originated from mammals, preferably from humans, and have nucleotide sequence of SEQ ID NO: 1 (5'-CCCAGUGUUCAGACUACCUGUUC-S'). Inhibition against miR-199a can be achieved by an anti-miR-199a which binds to miRNA-199a and inhibits its activity. For example, the miR-199a inhibitor may be a nucleotide complimentary to at least 10, preferably at least 15 nucleotides, which are serially located within the nucleotide sequence of SEQ ID NO: 1. More preferably, the miR-199a inhibitor may be an oligonucleotide having the nucleotide sequence of SEQ ID NO: 2 (5'-GAACAGGUAGUCUGAACACUGGG-S').

The anti-microRNA molecules described herein may be produced by a conventional DNA synthesizer and directly used, or cloned into an expression vector. The expression vector may be selected from the group consisting of a plasmid, a lentiviral vector, an adenoviral vector, and the likes, which are conventionally used for transcription and expression of mammalian cells and other types of target cells. The genes encoding the anti-microRNA described herein may be prepared and inserted into the expression vectors in conventional manners.

The composition according to the present invention may contain an anti-microRNA molecule produced as described above or cloned into an expression vector, as an active ingredient. The composition may contain the anti-microRNA molecule alone or along with pharmacologically acceptable carriers. The pharmacologically acceptable carriers may include solvents, dispersive media, coating agents, anti-microbial agents and anti-bacterial agents, isotonic agents, absorption retarders, and the like, which are suitable to pharmaceutical administration. Supplementary active materials may be further included. The anti-microRNA may be provided in a formulation suitable to a given administration route. For example, the composition may be formulated for oral administration in such forms as powders, granules, tablets, capsules, suspensions, emulsions, syrup, aerosols, and the like; or for non-oral administration in such forms as transdermal drugs, suppositories, injections and the like.

The composition may be administered through any conventional oral or non-oral administration route, for example, intravenous, intraperitoneal, intramuscular, subcutaneous, percutaneous (local) or rectal administration, or administration through inhalation or mucous membrane, but not be limited thereto. Administration regimes can follow conventional medical or pharmacological methods, safety and efficacy of which are proven. Administration of the composition can be achieved by any of conventional administration regimes in current use, for example, oral or rectal administration, or intravenous, intramuscular, subcutaneous, or intrauterine injection.

Toxicity and treatment efficacy of the composition of the present invention can be assessed by the standard pharmacological process applied in cell cultures and experiment animals, which measures LD50 (the lethal dose of a drug for 50% of the population) and ED50 (the minimum effective dose for 50% of the population). A therapeutic index is defined as the ratio between the toxicity and the efficacy, that is, LD50:ED50. For a given therapeutic agent, a high therapeutic index is preferable to a low one, and it is necessary to design a delivery system to target a site affected by the therapeutic agent, in order to minimize injuries to uninfected cells and reduce side effects. A suitable dosage of the composition according to the present invention comprising anti-microRNA depends on the expression and activity of pri-microRNAs to be regulated. In a situation where anti-microRNAs are administered to a patient, the physician (a veterinarian or a researcher) may initially apply a low amount of dose and may increase the amount until desirable response is achieved. In addition, a dose specific to a patient is determined with many factors taken into account — such as the activity of substance to be applied, the patient's age, weight, general health condition, and infection with a venereal disease and eating habit, administration frequency and times, administration routes, excretion rates, other drugs administered along with, and extent of expression and activity to be controlled.

The composition according to the present invention can be administered to mammals, preferably to humans, while dosages can be adjusted according to a subject's age and seriousness of the disease. For example, a dose can be within the range of from

0.001 to 500 mg/kg, preferably, from 0.01 to 100 mg/kg, of the effective ingredient per kg of body weight. Administration of the composition according to the present invention can be conducted by any manner of administration as commonly used. For example, oral or rectal administration, or intravenous, intramuscular, subcutaneous or intrauterine injection can be applied.

Another embodiment of the present invention provides a method of diagnosing cervical cancer, which determines the cervical cancer by the increased level of miR-199a. More precisely, said method for diagnosing cervical cancer comprises the steps of: measuring the level of miR-199a in the test sample obtained from a subject; comparing the measured level of miR-199a in the test sample with the level of miR-199a in a normal sample; and determining the subject as a cervical cancer patient when the level of miR-199a in the test sample is higher than that in the normal sample.

Said subject may be a mammal, preferably a human, but is not limited thereto. Said test sample may be cells or tissues isolated from the patient, preferably cervical epithelium cells or tissues. In addition, said normal sample may refer to cells or tissues of a woman who had no previous history of cervical cancer and otherwise related diseases. For an embodiment, it is possible to use cervical epithelium cells or tissues from a woman who has no previous history of cervical cancer and otherwise related diseases and had hysterectomy due to a benign gynecologic disease (e.g. uterine myoma).

The level of miR-199a may be measured by any type of RNA quantification methods as known in the art to which the present invention belongs, for example, real-time quantitative PCR, northern blotting, microarray method, and the like. An embodiment provides a screening method for an agent for treating cervical cancer, using a miR-199a as a target. The screening method can comprise the steps of: contacting a candidate compound with a test sample; comparing the level of miR-199a in the test sample which is contacted with the candidate compound with the level of miR-199a in a sample where the candidate compound is not contacted; and selecting the candidate compound as an agent for treating cervical cancer when the level of miR-199a in the test sample contacted with the candidate compound is decreased, compared to that in the sample where the candidate compound is not contacted.

The above candidate compound can be an oligonucleotide of 15 to 30bp, preferably 18 to 15 bp, in length. The extent of miR-199a can be measured by any type of RNA quantification methods as known in the art to which the present invention belongs, for example, real-time quantitative PCR, northern blotting, microarray method and the like.

Tissue-specific pattern of miRNA expression has recently been reported and is viewed to reflect an aspect of embryologic development. According to a few reports, over- or under-expression of certain miRNAs is specifically observed in specific tumor types. The present inventors discovered that overexpression of specific miRNAs — rather than their underexpression — is predominantly found in ISCC (invasive squamous cell carcinoma) cases, compared to normal cervical epithelium (cervical epithelium) tissues. Overexpression of miRNAs in cervical cancer has not been reported. The results obtained by the present inventors can be explained by tissue-specificity of miRNA expression, as shown through large-scale profiling studies using a variety of tissue types of tumors.

Most of the human miRNAs are expressed from the introns of protein-coding genes, and approximately 1/3 of them are located within the introns of annotated mRNAs. Those intron mRNAs, generally having the same direction with the pre-mRNAs, can be regulated by the promoter that controls the mRNA precursors. Until now, more than 90 of intron miRNAs have been identified by biological informatics approaches, but for most of them, their functions remain not disclosed. Intron miRNAs generally have an identical manner of expression with their host gene's mRNAs. The present inventors found by biological informatics analysis that DNM2 intron 16 is the host gene of miR-199a intron 16 and that miRNAs of DNM2 is expressed along with the intron mRNAs (See Fig. 1 ). Knock-down of over-expressed miRNAs or silent (silent) miRNA expression in cancer cells can lead to apoptosis of the cancer cells. Recently, 'antagomirs', a novel type of chemically synthesized olygonucelotides, are reported to can effectively silence endogenous miRNA in vivo. In an embodiment of the present invention, it was confirmed that anti-miR-199a reduces the growth of the cervical cancer cells (SiHa and ME-180), and increases cisplatin-induced cell toxicity (see Fig. 2). DNA injuries induced by cisplatin can increase the ability of anti-miR-199a to suppress the growth.

In summary, it was confirmed through the present invention that anti-miR-199a inhibits cell growth and promotes chemotherapeutic reactions (in vitro), thus presenting that miR-199a can be a potential target of cervical cancer treatment. MicroRNAs as described above can be used for cancer treatment, and an application for diagnosis of cancer cell proliferation is possible by measuring the extent of microRNA expression.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 shows a result of real-time quantitative PCR analysis for DNM2 intron

16, the host gene of MiR- 199, and indicates that mRNA level is significantly higher in ISCC (P 0.0001).

Figs. 2 A to 2E show the suppression of cell growth by anti-miR-199a oligonucleotides in cervical squamous cell carcinoma, wherein Fig. 2 A shows the relative expressions of miR-199a in cervical squamous cell carcinoma tissues and normal cervical squamous epithelial cells, as measured by TaqMan real-time PCR (p O.0001),

Fig. 2B shows the suppression of the miR-199a expression by anti-miR-199 in squamous cells in the cervix (ME-180 and SiHa), Fig. 2C shows the cell growth inhibited by anti-miR -199a, and

Figs. 2D and 2E show the cell growth inhibited with increasing amounts of cisplatin when cisplatin is administered along with anti-miR-199a (Columns, the average value of three independent experiments; bars , SE (*, p <0.05; **, p O.01)).

EXAMPLES

The present invention is further explained in more detail with reference to the following examples. These examples, however, should not be interpreted as limiting the scope of the present invention in any manner.

Example 1: Tissue specimens

Fresh frozen tumor biopsy specimens (n=10) from patients with primary ISCC (International Federation of Gynecology and Obstetrics stage of IB to HA) were obtained at the time of surgery. A radical hysterectomy with pelvic lymph node dissection was done at the Department of Obstetrics and Gynecology, Samsung Medical Center, between January 2002 and October 2003. Tumor specimens were immediately snap-frozen at -80 ^°C . Only specimens containing >90% tumor cells, which were examined by a single gynecologic pathologist using H&E staining, were used in the analysis. Table 1 summarizes the patient characteristics.

* Lymph node metastasis

+ Paramesial invasion

% Resection margin involvement

As a control, normal cervical tissues (n=10) were obtained from patients undergoing hysterectomy for benign gynecologic disease. Fresh cervical biopsies (5-8 mm³) were obtained before undertaking any surgical procedures. Dispase II (2.4 units/mL; Roche) was used to obtain the normal epithelial tissues alone from the entire cervical tissues including the stroma. These biopsies were washed in sterile PBS for a few minutes and incubated for 1 hour in dispase II at 37 ^°C, with the stromal side down. The epithelial sheets were then gently removed from the stromal layers and then washed twice in sterile PBS before extracting the total RNA.

Example 2: RNA extraction and reverse transcription Total RNA was extracted from the ISCC and normal epithelial tissues using an easy-spin (genomic DNA-free) Total RNA Extraction Kit (iNtRON Biotechnology). The concentration was quantified using the NanoDrop ND- 1000 Spectrophotometer (Nano-Drop Technologies). cDNA was synthesized from total RNA using stem-loop reverse transcription primers (provided from ABI) according to the TaqMan MicroRNA Assay protocol (PE Applied Biosystems; ref. 38).

Example 3: miRNA expression profiling using TaqMan MicroRNA assay

Real time PCR for miRNA expression profiling was done using a 7900HT Sequence Detection system (Applied Biosystems). The expression levels of the 157 human mature miRNAs were measured using the Human Panel Early Access Kit (PN 4365381; Applied Biosystems). Data normalizations were done using let-7a as the endogenous control according to the manufacturer's suggestions, miR-16 as a positive control, or cel-lin-4, ath-miR159a, and cel-miR-2 as the negative controls: mature miRNA hsa-let-7a (UGAGGUAGUAGGUUGUAUAGUU, SEQ IS NO: 3) mature miRNA hsa-miR-16 (UAGC AGC ACGU AAAUAUUGGCG, SEQ IS NO: 4) mature miRNA cel-lin-4 (UCCCUGAGACCUCAAGUGUGA, SEQ IS NO: 5) mature miRNA ath-miR159a (UUUGGAUUGAAGGGAGCUCUA, SEQ IS O: 6) mature miRNA cel-miR-2 (UAUCACAGCCAGCUUUGAUGUGC, SEQ IS NO: 7)

Relative quantification of miRNA expression was calculated by the 2^~AΔCT method (Livak KJ, SchmittgenTD. Analysis of relative gene expression data using real-time quantitative PCR and the 2^"ΔΔCT method. Methods 2001;25:402-8). The relative expression values were multiplied by 10⁶ in order to simplify the presentation of the data.

Example 4: Real-time quantitative reverse transcription-PCR analysis for DNM2 ITiRNA expression

DNM2, as an overlapping transcript of miR-199, and glyceraldehyde-3 -phosphate dehydrogenase (GAPDH), as an endogenous control gene, were used in the same PCR reaction for real-time quantitative reverse transcription-PCR. In order to avoid amplification of the genomic DNA, the primers and probe for amplifying DNM2 and GAPDH were chosen to hybridize at the junction between the two exons as follows:

DNM2 (Hs00191900, Applied Biosystems; NM_001005362, exon boundary 13-14, probe 5'-CATCCCCAATCAGGTGATCCGCAGG-B', SEQ ID NO: 8), and

GAPDH (4310884E, Applied Biosystems).

[PCR Conditions]

Thermal Cycling Parameters

The gene expression ΔCT value of DNM2 from each sample was calculated by normalization with GAPDH and relative quantification values were plotted ((XiY,

Shalgi R, FodstadO, PilpelY, JuJ. Differentially regulated microRNAs and actively translated messenger RNA transcripts by tumor suppressor p53 in colon cancer. Clin Cancer Res 2006; 12:2014-24)).

Example 5: Cell lines and transfection of anti-miR-199a All cell culture reagents were purchased from Invitrogen Life Technologies.

The human cervical cancer cell lines, SiHa and ME- 180, were obtained from the American Type Culture Collection. SiHa cells were grown at 37 "C in 5% CO₂ in MEM supplemented with 10% fetal bovine serum, penicillin (100 units/mL), and streptomycin (100 Ag/mL). ME-180 cells were maintained in McCoy's 5A and RPMI 1640.

Cells were transfected with 100 nmol/L of anti -miR-199a (Ambion) or negative control using siPort Neo-FX (Ambion). Three days later, total RNA from the cells was isolated to examine the expression level of miR-199a using the RNA-spin total extraction Kit (Intron Biotech).

Example 6: Cell viability determined by

[3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazoliumbromide] assay

Cervical cancer cells (SiHa and ME-180) were plated in a 96-well plate at 4,000 cells/well and then were allowed to grow for 3 days before the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazoliumbromide] assay. For the MTT assay, 1 mg/mL of MTT solution (1 mL of 10 mg/mL MTT in PBS added to 9 mL of serum-free medium) was added to each well. Then, the cells were incubated for 3 h in the dark. The formazan grain was then dissolved in DMSO (Sigma), and absorbance was read at 570 run using an ELISA plate reader (Bio-Rad). To further assess the effect of anti-miR-199a on cell growth, the transfected cells were treated with 1.5 and 3 μg/mL of cisplatin for 2 days.

SPSS software (version 10.0, SPSS Inc.) was used to perform statistical analysis. The Mann- Whitney U test was used to evaluate the significance between the gene expression of tumor and nonmalignant tissue samples. Additionally, unsupervised hierarchical clustering was done on the PCR data to investigate the relationships among genes and among samples. Each miRNA raw data CT were median-centered for all samples before clustering. Hierarchical average-linkage clustering was done by means of the GeneSpring GX software (version 7.3.1, Agilent Technologies), using log-transformed, median-centered gene expression values and the Pearson correlation as similarity metrics.

Experimental Example 1: Comparison of miRNA expression in ISCCs and normal cervical epithelial tissues Expression profiles of the 157 miRNAs analyzed in the ISCCs and normal epithelial tissues was compared. As the results, there was a significant difference in the expression of 70 miRNAs in comparisons between the ISCCs and normal epithelial tissues (P < 0.05), 68 were up-regulated and 2 were down-regulated (Supplementary Table Sl). Among these, 10 miRNAs that were the most significantly overexpressed in ISCCs with fold changes of nearly > 100 and a P < 0.0001, were as follows: miR-199-s, miR-9, miR-199a*, miR-199a, miR-199b, miR-145, miR-133a, miR-133b, miR-214, and miR-127. By contrast, only two of the miRNAs, miR-149 (2.974-fold change) and miR-203 (3.704-fold change), showed significant down-regulation.

Unsupervised hierarchical clustering was used to classify the samples without using any information on the identity of the samples (Fig. 1). Fig. 1 shows the results of Real-time quantitative PCR analysis of the mRNA level of DNM2 intron 16, which is the host gene of miR-199a, wherein the number of X axis means random serial number of the samples. The expression level of mRNA isolated from fresh frozen tumor biopsy specimens (n=10) from patients with primary ISCC (International Federation of Gynecology and Obstetrics stage of IB to HA) (see Table 1) and normal cervical tissues (n=10) from patients undergoing hysterectomy for benign gynecologic disease as a control, was analyzed. The mRNA level of DMM2 intron 16 was significantly higher in ISCCs (P < 0.0001). This procedure resulted in the classification of cancer samples into two major classes based on similarities in miRNA expression. Of interest was the observation of a difference in the LN metastasis between the two clusters (P = 0.052 using Pearson x² test). Experimental Example 2: Investigation of host gene of miR-199a

In this experimental example, it was confirmed that miR-199a is an intronic miRNA located in host gene, DNM2 intron 16. The nucleotide sequence of the overlapping transcripts of the significantly expressed 70 miRNAs in ISCC was analyzed using Sanger miRNA registry (http://microrna.sanger.ac.ukV The chromosomal locations of overlapping transcripts were divided into 40 introns, 22 intergenic, 6 3 '-untranslated regions, and 2 exons. The gene lists of overlapping transcripts for the top 10 miRNAs are DNM, Clorfόl, C20orfl66, RPl 1-771D21.2, and RTLl.

DNM2 mRNA was identified as an overlapping transcript of miR-199-s, miR-199a*, and miR-199a. It was found that the nucleotide sequence at DNM2 intron 16 was complementary to the sequences of miR-199a* and miR-199a (see Table 2). Because intronic miRNAs are coordinately expressed with their host gene's mRNA, the mRNA level of DNM2 in the same tissues was evaluated using real-time quantitative PCR. It was found that the mRNA level was significantly increased in the ISCCs compared with the normal tissues (P < 0.0001; Fig. 1). Therefore, these findings suggest that miR-199a* and miR-199a are intronic miRNAs from the host mRNA, DNM2 intron 16.

[Table 2] Sequence of Mature hsa-mir-199

Experimental Example 3: Inhibition of cervical cancer cell growth by anti-miR-199a

In order to evaluate the role of specific miRNAs in cervical carcinogenesis, miR-199a, which is one of the most up-regulated ISCCs was selected (Fig. 2A). The TaqMan real-time PCR revealed that anti-miR-199a significantly reduced the expression of miR-199a in cervical cancer cells, suggesting that anti-miR-199a is efficiently introduced into the cells and acts to knock down miR-199a (Fig. 2B). In addition, it was found that this inhibitor reduced cell growth (Fig. 2C). Furthermore, anti-miR-199a -mediated cell growth inhibition was increased in cisplatin-treated cells in a dose-dependent fashion (Fig. 2D and 2E).

Claims

WHAT IS CLAIMED IS;

1. A composition for the treatment or prevention of cervical cancer, comprising an oligonucleotide having the nucleotide sequence complimentary to at least 15 nucleotides which are serially located within miR-199 having the nucleotide sequence of SEQ ID NO: 1 , as an active ingredient.

2. The composition for the treatment or prevention of cervical cancer according to Claim 1 , wherein the oligonucleotide has the nucleotide sequence of SEQ ID NO: 2.

3. A method of diagnosing cervical cancer, comprising the steps of: measuring the level of miR-199a in a test sample obtained from a subject; and comparing the measured level of miR-199a of the test sample with the level of miR-199a of normal sample; and determining the subject as a cervical cancer patient when the level of miR-199a in the test sample is higher than that in the normal sample.

4. The method of diagnosing cervical cancer according to Claim 3, wherein the subject is a mammal, and the test sample is cervical epithelial tissues or cells.

5. A method of screening for an agent for treating cervical cancer, comprising the steps of: contacting a candidate compound with a test sample; comparing the level of miR-199a in the test sample which is contacted with the candidate compound with the level of miR-199a in a sample where the candidate compound is not contacted; and selecting the candidate compound as an agent for treating cervical cancer when the level of miR-199a in the test sample contacted with the candidate compound is decreased, compared to that in the sample where the candidate compound is not contacted.

6. The method of screening an agent for treating cervical cancer according to Claim 5, wherein the candidate compound is an oligonucleotide of 15 to 30bp in length.