WO2010007551A2

WO2010007551A2 - Method for the production of tenocytes in vitro from mesenchymal stem cells

Info

Publication number: WO2010007551A2
Application number: PCT/IB2009/052810
Authority: WO
Inventors: Paola Mariani; Stefania Violini; Fausto Cremonesi
Original assignee: Fondazione Parco Tecnologico Padano; Universita' Degli Studi Di Milano
Priority date: 2008-07-17
Filing date: 2009-06-29
Publication date: 2010-01-21
Also published as: WO2010007551A3; IT1394262B1; ITVR20080079A1; WO2010007542A2

Abstract

A method for the production in vitro of tenocytes, including the step to put in direct contact cell culture of mesenchymal stem cells, derived from mammals with an effective amount of protein BMP12 (Bone Morphogenetic protein 12). It also describes a method for the characterization of mesenchymal stem cells derived from mammals and a method for characterization of tenocytes obtained by differentiation of mesenchymal stem cells.

Description

"METHOD FOR THE PRODUCTION OF TENOCYTES IN VITRO FROM MESENCHYMAL STEM CELLS"

* * * * * Technical field

The present invention relates to a method for producing tenocytes in vitro from mesenchymal stem cells obtained from mammal .

It also covers a method for the characterization of tenocytes and a method for characterization of mesenchymal stem cells obtained from mammal.

Technological background

This invention finds its general location within the context of the treatment of mammals suffering from tendon injuries .

It is known that the injury of a tendon, such as a partial or complete tear, can seriously and permanently compromise the complete and effective mobility of a joint. This impairment is more frequent in persons or animals because of their activity subject some of their tendons to constant and important efforts, as it is common in the case of athletes or animals in competition, such as dogs or racing horses. However, to achieve high performance, they may not, in general, disregard fully efficient tendon function, so in case of injury, their sporting careers depend on the total recovery of the affected function. In the specific case of racing horses, it is well known that a tendon lesion of the limbs (including the superficial digital flexor tendon and the deep flexor tendon) is one of the most frequent and serious injuries and can lead to the killing of the animal as extreme consequence .

Injuries to tendons are not easily recoverable, and often, not even a surgical procedure ensures a full recovery of function .

In very general terms, a tendon is largely formed by fibrous connective tissue made of collagen (mainly type I, but also type III and V) , proteoglycans, elastin and fibronectin and, once torn, it does not spontaneously regenerate. The base material of fibrous connective tissue is produced by tenocytes, highly specialized cells embedded in the extracellular matrix they produce. However, also because of their high degree of specialization, tenocytes show a very limited duplication potential, therefore attempts to get their lasting and efficient in vitro reproduction have been proven unsatisfactory. The presence of tenocytes in a cell culture is typically detected by cytofluorometry analysis, or histochemical staining or immunological assays.

In recent years, with the deepening of knowledge and applications related to stem cells, several studies have been conducted on the possibility of tendon injury repairing by using mesenchymal stem cells (hereinafter, briefly, MSCs) .

These cells have the particularity to be multipotent, ie have the ability, under certain conditions, to differentiate into different types of tissues such as bone, cartilage, muscle, fat and tendon. The MSCs can be obtained by sampling from different sources among which we mention the bone marrow, cord blood, adipose tissue and fetal tissues. In particular, in some studies the injection of properly in vitro cultivated and enriched MSC, directly over the damaged tendon is accounted , so that at least some of them are induced to differentiate into tenocytes by factors produced by cells present in the surrounding microenvironment and can thus regenerate the tendon material. In fact, unlike tenocytes, the MSCs can be easily cultivated in vitro and show a good degree of proliferation . However, in this field the need to develop new methods for producing tenocytes in vitro remains, in order to develop effective protocols for the repair of injured tendons in mammals, particularly in racing horses. In this context, there is also the need to establish effective protocols for the characterization of MSCs and tenocytes.

Disclosure of the invention.

The problem at the base of the present invention is to provide a method for producing in vitro tenocytes, designed to meet the above mentioned need. As part of this problem, one of the aims of the invention is also to establish a method for the characterization of mesenchymal stem cells obtained from mammal and a method for the characterization of tenocytes. This problem is solved and these aims are achieved by this invention through a method for the production in vitro of tenocytes, and through their respective methods for the characterization of mesenchymal stem cells and tenocytes made in accordance with the attached claims.

Brief description of drawings Characteristics and advantages of the invention will be better described by the detailed description of a preferred example of realization, illustrated indicatively and not limiting with respect to the annexed drawings in which: - figure 1 is a collection of photographs showing the results of one Reverse Transcriptase - Polymerase

Chain Reaction (hereinafter, briefly, RT-PCR) analysis performed to identify the presence or not of the expression of certain genes in a cell culture of MSCs;

- figure 2 is a collection of photographs showing the results of one RT-PCR analysis performed to identify the presence or not of the expression of certain genes in a tenocyte cell culture obtained by differentiation of MSCs.

Preferred way of realization of the invention

In a first aspect, the method for the production of tenocytes in vitro according to the present invention includes the steps of obtaining a cell culture of mesenchymal stem cells, taken from mammal, and place it in direct contact with an effective amount of protein morphogenetic bone 12, (hereinafter, briefly, BMP12 - bone morphogenetic protein 12) . MSCs can be obtained from adult or from fetal mammalian tissues and in particular it is preferred that they are taken from bone marrow or umbilical cord. In both cases, MSCs must be first properly isolated from other cells forming the taken tissues and then placed in culture medium suitable for their rapid proliferation.

MSCs are identified as such by a method of characterization, which is a second aspect of this invention, in which it is planned a RT-PCR analysis of one sample of cells to identify in them the presence of the expression products of specific genes, in particular of one or more genes chosen among SOX2, OCT-4 and NANOG. The products of gene expression of interest will also be identified in the text that follows as "markers". The above genes do express the respective transcription factors that are considered to be essential for the maintenance of undifferentiated cells and the presence of markers expressed by these genes it is considered a clear indication of sternness. It has to be noted, however, that the expression of genes OCT-4 and NANOG is typically characteristic of stem cells of embryonic type, but, surprisingly, it is also present in MSCs taken from adults. Preferably, it is also anticipated that the RT- PCR analysis is carried out to detect the presence of the CD34 gene expression product. Unlike the previous genes, CD34 expresses a glycoprotein typically present in the bone marrow and cord blood but not in the MSCs. The analysis on the presence of the expression product of this gene thus represents a negative control, and the absence of CD34 in the sample of the analyzed cells is used to confirm that the operation of isolation of MSCs from bone marrow or umbilical cord has been properly conducted.

As indicated above, the analysis is carried out by RT-PCR, comprising a first step of transformation into complementary DNA (hereinafter, briefly, cDNA) of messenger RNA (hereinafter, briefly, mRNA) isolated from the cell sample and from a following phase of amplification through Polymerase Chain Reaction (hereinafter, briefly, PCR) of the cDNA obtained in the first phase.

This way, it is possible to determine whether the genes of interest actually express their respective protein or whether, on the contrary, they, even if present in the cellular DNA, are silent.

Preferably, according to a further aspect of the present invention, the amplification phase by PCR is carried out using some of the primer pairs specified in Table 1. In particular, for the SOX2 gene the primer pair, sense and antisense respectively, defined by nucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 was used; for the gene OCT-4 the primer pair, sense and antisense respectively, defined by nucleotide sequences SEQ ID NO: 3 and SEQ ID NO: 4 was used; for the NANOG gene the primer pair, sense and antisense respectively, defined by nucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6 was used; whereas, finally, for the gene CD34 the pair of primers, sense and antisense respectively, defined by nucleotide sequences SEQ ID NO: 7 and SEQ ID NO: 8 was used. Once the desired degree of proliferation is reached, the MSCs are placed in direct contact with an effective amount of BMP12. This protein is a member of the family of bone morphogenetic proteins, which are themselves a subset of the transforming growth factor TGFβ super family and are known for their ability to promote the ectopic bone and cartilage formation.

The amount of BMP12 placed in the cell culture to induce the differentiation of MSCs in tenocytes ranges between 30 and 70 ng/ml and, preferably, is preferably 50 ng/ml . Direct exposure of MSCs to BMP12 is maintained for a period of 14-21 days. According to a further aspect of the present invention, the presence of tenocytes within the MSCs treated with BMP12 is highlighted by genetic characterization, by analyzing a sample of the treated cells by RT-PCR to detect the presence of the expression products of specific genes.

In particular, the analysis by RT-PCR is carried out in such a way to detect the presence of the expression products of genes coding for a protein chosen between tenomodulin and decorin. These proteins play an important role in the formation and maintenance of connective tissue of the tendon, whereas they are completely absent in the originally undifferentiated cells. Preferably, the RT-PCR analysis is carried out in such a way to detect the presence of both proteins mentioned above, and, furthermore, is carried out to verify whether in the cell sample exposed to BMP12 it is present the expression product of the gene coding for lipocalin P19. This protein is present in various tissues of mesenchymal origin, such as uterine and endometrial tissue, but it is not present in tendons, so its absence confirms the high selectivity of the differentiation of MSCs obtained by the method of this invention.

Preferably, according to a further aspect of the present invention, the phase of amplification by PCR for tenocytes characterization is carried out using some of the primer pairs specified in Table 1.

In particular, for the gene coding for tenomodulin the primer pair, sense and antisense respectively, defined by nucleotide sequences SEQ ID NO: 9 and SEQ ID NO: 10 was used; for the gene coding for decorin the primer pair, sense and antisense respectively, defined by nucleotide sequences SEQ ID NO: 11 and SEQ ID NO: 12 was used and for the gene coding for P19 lipocalin the primer pair, sense and antisense respectively, defined by nucleotide sequences SEQ ID NO: 13 and SEQ ID NO: 14 was used. Both in the characterization of MSCs and tenocytes, the RT- PCR analysis was conducted to verify the presence of the expression product of the gene encoding GAPDH (gliceraldeide-3-phosphate dehydrogenase) as well. This "marker" is certainly present in both types of examined cells, therefore its presence is a positive control for the correctness of the RT-PCR analysis. The primer pair, sense and antisense respectively, used for the amplification of the GAPDH gene is defined by the sequences SEQ ID NO: 15 and SEQ ID NO: 16. The oligonucleotide sequences of the primers identified in this description by SEQ ID NO: 1 up to SEQ ID NO: 16, are shown in Table 1 at the end of the description and format conform to international standards established by the WIPO (World Organization for Intellectual Property) . Example

Collection and isolation of MSCs

Samples of sternal bone marrow were collected using 11 gauge needle from a eight year old mare, of the Dutch Warmblood breed, collected into two 20 ml syringes containing 30,000 units of heparin sodium, and maintained at low temperature with ice.

30 ml of harvested bone marrow were placed onto Hystopaque® 1077 (Sigma Aldrich) and centrifuged for 20 minutes at 4°C at an acceleration of 40Og. The layer formed by a cell rich population of MSCs was aspirated and washed in PBS solution without calcium and magnesium, and subjected to further centrifugation at 26Og for 5 minutes at 4°C.

The cell pellets were then resuspended in 10 ml of DMEM (Dulbecco' s Modified Eagle's culture medium) added with 10% FCS (fetal calf serum), 100 U/ml penicillin, 100 mg /L streptomycin (P/S) and 1% non-essential amino acids (NEAA), and then seeded in 24-well plates.

The cells were monitored for 3-4 days, afterwards the medium was replaced with fresh medium, similar to the previous one but with further addition of 50 ng/ml of EGF (epidermal growth factor) . In the following two weeks, the cells were then trypsinized, counted, seeded in culture flasks of 25 cm² (4xlO⁵ cells per flask) or in 24-well plates (2xlO⁵ cells/ml) and incubated at 37°C, 5% CO₂.

Characterization of MSCs

The total RNA of a cell culture sample was isolated using the RNeasy Kit (Qiagen) , dissolved in 30 μl of ribonuclease-free water and kept at a temperature of -80⁰C. 0.5 mg of RNA were then converted into cDNA using reverse transcriptase (Revert Aid H minusM-MLV RT from Fermentas Int, USA) and 2 μl of the cDNA obtained was amplified in IX PCR solution using 5U of Taq polymerase Gold (Applied Biosystem, USA) and 0.5 μM of each primer (sense and antisense) able to anneal the ends of the gene segments of interest. In particular, the PCR analysis is set up to amplify the cDNA of the genes coding for SOX2, OCT-4, NANOG, CD34 and GAPDH. The primer pairs used for this purpose are identified respectively by the sequences: SEQ ID NO: 1, SEQ ID NO: 2 ; SEQ ID NO: 3, SEQ ID NO: 4 ; SEQ ID NO: 5, SEQ ID NO: 6; SEQ ID NO: 7, SEQ ID NO: 8 ; SEQ ID NO: 15, SEQ ID NO: 16.

It has to be noted that the primer pairs for the amplification of the genes SOX2, OCT-4, NANOG and CD34 were specifically designed ex novo, because, for the horse, the respective gene sequences are unknown.

The oligonucleotide sequences were derived from studies of alignment with known gene sequences of other mammals, including human and mouse. The PCR analysis was carried out as follows: after an initial heating cycle at 95°C for 10 minutes, 35 cycles of work were performed, each including 45 seconds at 95°C, 30 seconds at 58°C, 30 seconds at 72°C and a final cycle of 5 minutes at 72°C. The products obtained by PCR were subjected to 2% agarose gel electrophoresis, visualized with ethidium bromide and photographed under UV light (Bio-Rad, USA) . The photos produced are collected, for each gene, in figure 1.

It has to be noted that the analysis clearly indicates the presence of the genes coding for GAPDH, SOX2, OCT-4 and NANOG, which implies that, in the total cellular RNA analyzed, mRNA encoded by these genes was present, and accordingly the product of their gene expression. On the contrary, the CD34 gene product is absent which implies that this gene is not expressed.

As described above, the products of SOX2, OCT-4 and NANOG gene expression revealed the presence of MSC, whereas the absence of the CD34 "marker" confirms the mesenchymal nature of the bone marrow original cells.

Differentiation in tenocytes Samples of MSC cell culture at the fifth passage, at

70% confluence, were seeded in culture flasks and maintained for 14-21 days in a growth medium added with 50 ng/ml BMP12 (Tebu-Bio, Italy) and replaced every other day. Characterization of tenocytes

At the end of the exposure period, the cell culture exposed to BMP12 was subjected to RT-PCR analysis to verify the complete differentiation of MSCs in tenocytes.

Therefore, as in the previous case, the total RNA of a cell culture sample was isolated using the RNeasy Kit (Qiagen) , dissolved in 30 μl of ribonuclease-free water and kept at a temperature of -80 ⁰C.

0.5 mg of RNA were then converted into cDNA using reverse transcriptase (RevertAid H minusM-MLV RT from Fermentas Int, USA) and 2 μl of the obtained cDNA was were amplified in IX PCR solution, using 5U of polymerase Taq Gold (Applied Biosystem, USA) and 0.5 μM of each primer (sense and antisense) able to anneal the ends of the gene segments of interest. In particular, the phase of amplification through PCR is set up to demonstrate the presence in the cDNA obtained by retro-transcription of the mRNA of the genes coding for tenomodulin, decorin, P19 lipocalin and GAPDH. The primer pairs used to this purpose are identified respectively by the sequences:

SEQ ID NO: 9, SEQ ID NO: 10; SEQ ID NO: 11, SEQ ID NO: 12; SEQ ID NO: 13, SEQ ID NO: 14; SEQ ID NO: 15, SEQ ID NO: 16. The PCR analysis was carried out as follows: an initial heating cycle at 95°C for 10 minutes was followed by 35 cycles each consisting of 45 seconds at 95°C, 30 seconds at 58°C, 30 seconds at 72°C and a final cycle of 5 minutes at 72°C.

The products obtained by PCR were subjected to 2% agarose gel electrophoresis, visualized with ethidium bromide and photographed under UV light (Bio-Rad, USA) . The photos produced are collected for each gene in figure 2.

It has to be noted that cDNA amplification analysis clearly indicates the presence of gene expression products of the gene coding for GAPDH, tenomodulin and decorin, whereas the gene for the P19 lipocalin is not expressed.

As described above, the presence in cultured cells of the expression products of the genes coding for tenomodulin and decorin indicates the presence of tenocytes, whereas the absence of the expression products of the gene coding for P19 lipocalin confirms that the process of differentiation induced by BMP12 on MSCs did not give rise to a cell type other than tenocytes thus resulting very specific and selective. In fact, a microscopic analysis of the cells confirmed that the differentiation induced by BMP12 did not give rise to osteoblasts.

SEQ ID NO :8 R: AATTCGGTATCAGCCACCAC

Tenomodulin SEQ ID NO :9 F: GATCTTCACTTCCCTACCAACG

SEQ ID R: CTCATCCAGCATGGGGTC NO: 10

Decorin SEQ ID F: GAATGAGATCACCAAGCTGC NO: 11

SEQ ID R: TGAGATGCGAATGTATGAGAGA NO:12

Lipocalin SEQ ID F: TTCTTCATCCACAAGATCCAG P19 NO: 13

SEQ ID R: AGTTGGGACACACATACCTCTT NO: 14

GADPH SEQ ID F: CAACGAATTTGGCTACAGCA NO: 15

SEQ ID R: CTGTGAGGAGGGGAGATTCA NO: 16

SEQUENCE LIST

<110> FONDAZIONE PARCO TECNOLOGICO PADANO UNIVERSITA DEGLI STUDI DI MILANO

<120> Method for in vitro production of tenocytes

<130> demo

<150> VR2008A000079

<151> 2008-07-17

<160> 16 <170> Patentln version 3.5

<210> 1

<211> 22 <212> DNA

<213> Artificial

<220>

<223> artificial

<400> 1 tggttacctc ttcctcccac ct

22

<210> 2

<211> 18

<212> DNA

<213> Artificial

<220>

<223> artificial

<400> 2 gggcagtgtg ccgttaat 18

<210> 3 <211> 23 <212> DNA <213> Artificial

<220>

<223> artificial

<400> 3 tcccaggaca tcaaagctgc aga

23

<210> 4 <211> 27 <212> DNA <213> Artificial

<220>

<223> artificial

<400> 4 gtcaaactta cgtaccctct cgggtct 27

<210> 5 <211> 20

<212> DNA

<213> Artificial

<220> <223> artificial <400 > 5 tacctcagcc tccagcagat

20

<210> 6

<211> 20

<212> DNA

<213> Artificial

<220>

<223> artificial

<400> 6 cattggtttt tctgccacct 20

<210> 7 <211> 20

<212> DNA

<213> Artificial

<220> <223> artificial

<400> 7 attacacgga aaacggtgga 20 <210> 8

<211> 20

<212> DNA

<213> Artificial

<220>

<223> artificial

<400> 8 aattcggtat cagccaccac 20

<210> 9 <211> 22

<212> DNA

<213> Artificial

<220> <223> Artificial

<400> 9 gatcttcact tccctaccaa eg 22

<210> 10

<211> 18

<212> DNA <213> Artificial <220 >

<223> artificial

<400> 10 ctcatccagc atggggtc 18

<210> 11 <211> 20

<212> DNA

<213> Artificial

<220> <223> artificial

<400> 11 gaatgagatc accaagctgc 20

<210> 12

<211> 21

<212> DNA <213> Artificial

<220>

<223> artificial

<400> 12 ttcttcatcc acaagatcca g 21

<210> 13 <211> 20

<212> DNA

<213> Artificial

<220> <223> artificial

<400> 13 ttcttcatcc acaagatcca 20

<210> 14

<211> 22

<212> DNA <213> Artificial

<220>

<223> artificial

<400> 14 agttgggaca cacatacctc tt 22

<210> 15 <211> 20 <212 > DNA

<213> Artificial

<220> <223> artificial

<400> 15 caacgaattt ggctacagca 20

<210> 16

<211> 20

<212> DNA <213> Artificial

<220>

<223> artificial

<400> 16 ctgtgaggag gggagattca 20

Claims

"METHOD FOR THE PRODUCTION OF TENOCYTES IN VITRO FROM MESENCHYMAL STEM CELLS"CLAIMS

1. Method for the production in vitro of tenocytes, including the phase of putting cell culture of mesenchymal stem cells, derived from the mammal, in direct contact with an effective amount of protein BMP12 (bone morphogenetic protein 12) .

2. Method according to claim 1, in which that BMP12 is introduced into the cell culture of mesenchymal stem cells at a concentration ranging between 30 and 70 ng/ml .

3. Method according to claim 2, in which that BMP12 is introduced into the mesenchymal stem cell culture at a concentration of 50 ng/ml for a period of 14-21 days.

4. Method according to one of the previous claims, in which the mesenchymal stem cells are derived from horse.

5. Method for the characterization of mesenchymal stem cells derived from mammal, comprising the step of carrying out a RT-PCR analysis (Reverse Transcriptase Polymerase Chain Reaction) on a sample of these cells to detect the presence of the expression product of one or more gene selected from SOX2, OCT-4 and NANOG.

6. Method according to claim 5, in which the PCR analysis is carried out to detect the presence of genes SOX2, OCT-4 and NANOG.

7. Method according to claim 5 or 6, in which the RT-PCR analysis includes the use of primers whose nucleotide sequence contains one or more sequences defined in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO : 5 and SEQ I D NO : 6 .

8. Method according to claim 5, 6 or 7, in which these mesenchymal stem cells are derived from bone marrow of adult mammal.

9. Method according to claim 8, in which the RT-PCR analysis is further carried out to identify the absence of gene CD34 expression product.

10. Method according to claim 9, in which the RT-PCR analysis includes the use of primers whose nucleotide sequence contains one or more sequences defined in SEQ ID NO: 7 and SEQ ID NO: 8.

11. Method according to one of claims 5 to 10, where the mammal is a horse.

12. Oligonucleotide sequence as defined in SEQ: 1 or SEQ: 2.

13. Oligonucleotide sequence as defined in SEQ: 3 or SEQ: 4.

14. Oligonucleotide sequence as defined in SEQ: 5 or SEQ: 6.

15. Use of one oligonucleotide sequence according to one of claims 12 to 14 as a primer for PCR analysis.

16. Method for the characterization of tenocytes obtained by differentiation of mesenchymal stem cells from mammal, including the stage of conducting a RT-PCR analysis (Reverse Transcriptase-Polymerase Chain Reaction) on a sample of cells obtained by this differentiation in order to detect the presence of expression products of specific genes coding for a protein chosen between tenomodulin and decorin .

17. Method according to claim 16, in which the RT-PCR analysis is carried out to detect the presence of the expression products of genes coding for both the protein tenomodulin and the protein decorin.

18. Method according to claim 16 or 17, in which the RT- PCR analysis includes the use of primers whose nucleotide sequence comprises one or more of the sequences defined in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12.

19. Method according to one of claims 16 to 18, in which the PCR analysis is conducted to detect the absence of expression products for genes encoding lipocalin P19.

20. Method according to claim 19, in which the RT-PCR analysis includes the use of primers whose nucleotide sequence comprises one or more of the sequences defined in SEQ ID NO: 13 and SEQ ID NO: 14.