WO2009138855A2 - Methods and systems for the production of granulosa cells - Google Patents

Abstract

The present invention concerns methods and related cultured granulosa cells, assays and kits for drug discovery, therapeutic, and diagnostic purposes based on the discovery that granulosa cells cultured as monolayers remain viable in vitro over prolonged time periods, and exhibit stem cell potential when supplemented with leukaemia-inhibiting factor (LIF), and that use of a three-dimensional culture system such as type I collagen together with the use of LIF allows for both the survival and growth of preantral human GC while supporting a significant subpopulation of GC to maintain their characteristics for prolonged time periods, such as their ability to produce follicle-stimulating hormone receptor and cytochrome P450 aromatase.

Description

METHODS AND SYSTEMS FOR THE PRODUCTION OF GRANULOSA CELLS

RELATED APPLICATION DATA

[0001] This application claims priority to United States Provisional Patent Application No. 61/052,496 filed May 12, 2008, entitled METHODS AND SYSTEMS FOR THE PRODUCTION OF GRANULOSA CELLS, the entirety of which is hereby incorporated by reference.

FIELD OF THE INVENTION

[0002] The invention relates to the field of cell biology, in particular the culturing of granulosa cells, in particular functional granulosa cells, and their differentiation as well as their use in reproductive biology and drug testing.

BACKGROUND OF RELATED TECHNOLOGY

[0003] Primordial follicles remain quiescent for decades. Once their development starts, they give rise to primary follicles, which are characterized by a slow growth of the enclosed oocyte and by low granulosa cell proliferation rates (Gougeon A., 1996). After their transformation into primary follicles, both the oocyte's growth and the proliferation of the granulosa gain momentum culminating in the rapid growth of the antral follicle, finally resulting in the development of the mature Graafian follicle destined for ovulation. Several hundreds of thousands of granulosa cells exert a multitude of specialized functions encompassing the function of the follicle, such as producing large amounts of estradiol, adapting its FSH- and luteinizing hormone-receptivity to the endocrine milieu, nursing the oocyte and communicating both with the enclosed oocyte and the surrounding thecal cells. The signal leading to ovulation results in luteinization of the tissue. Luteinized granulosa cells, which are considered to be terminally differentiated, are replaced in the midluteal phase of the menstrual cycle by small, luteinized cells originating from the surrounding theca (Niswender GD et al., 2000).

[0004] Granulosa cells constitute the great majority of follicular cells in the mammalian ovary. They are the main source of the female sex hormones estradiol and progesterone, which control the menstrual cycle of reproduction. In addition to that, they communicate via gap junctions thereby forming a syncitium with the aim to nurse the oocyte (Buccione et al., 1990). The development of granulosa cells is initially controlled by follicle-stimulating hormone (FSH) alone, later by both FSH and the luteinizing hormone (LH). FSH targets its receptor (FSHR) and induces the maturation of ovarian follicles through proliferation of granulosa cells, induction of steroidogenesis and formation of a functional syncitium (Buccione et al, 1990; Dias, 2002; Themmen et al., 2000; Drummond, 2006).

[0005] The publications and other materials including patents, used herein to illustrate the invention and, in particular, to provide additional details respecting the practice are incorporated herein by reference. For convenience the publications are referenced in the following text by author and date and are listed alphabetically by author in the list of appended references.

[0006] Present concepts of luteal function, endocrine regulation of early pregnancy and the recruitment of new ovarian follicles are all based on the cyclical renewal of the entire population of GC.

[0007] The further study and therapeutic and analytical use of granulosa cells function has been hampered by technical difficulties in culturing these cells in vitro, granulosa cells obtained from preovulatory follicles become luteinized spontaneously during culture in vitro, even in the absence of FSH and LH (Charming et al., 1975; Channing et al., 1978; Luck, 1990).

[0008] Luteinization of granulosa cells in culture affect the gene expression by decreasing mRNA and protein levels of aromatase, hormone receptors and low synthesis of collagen protein (Zhao et al., 1996). Luteinization of granulosa cells in vitro is also accompanied by changes in cell shape, such as cellular flattening (Carnegie et al., 1988). Some of these changes can be modified, if granulosa cells are kept in a supporting matrix mimicking extracellular matrix (ECM) (Carnegie et al., 1988; Wang et al., 2000).

[0009] Luteinizing granulosa cells are considered to be at the ultimate stage of their differentiation, unavoidably ending in apoptosis a few days after ovulation, thereby preventing prolonged culture in vitro of granulosa cells collected from preovulatory follicles. [0010] Instead, various researchers have attempted to use granulosa cells from granulosa tumors (Zhang et al. 2000; Nishi et al. 2001) or immortalized granulosa cells (Tajima et al., 2002) in order to build suitable granulosa cell lines for research purposes.

[0011] Prolonged cultures of human ovarian mesothelial cells, defined as cells between the stage of being a mesothelial cell and the stage prior to becoming terminally differentiated to an ovarian surface epithelial cell or a granulosa cell, were reported.

[0012] In particular, US Patent 6,927,061 (WO 01/77303) discloses a substantially pure population of human ovarian mesothelial cells and methods of isolating and culturing the ovarian mesothelial cells. By carefully manipulating the microenvironment of the ovarian mesothelial cells, multiple passages are attainable wherein the ovarian mesothelial cells are capable of becoming ovary surface epithelial cells or granulosa cells. In particular, the ovarian mesothelial cells were maintained in nutrient media under culture conditions sufficient to sustain life of said ovarian mesothelial cells and wherein the nutrient media contains nutrients consisting of insulin, transferrin, epidermal growth factor, alpha- tocopherol, recombinant human heregulin β 1, bovine serum albumin, and aprotinin.

[0013] Canadian Patent No. 1628857 describes a follicular granulosa cell anti-senescence technology, wherein animal follicular granulosa cells are employed for transplantation. The process comprises the steps of (1) placing ovarium of pig or sheep into curling, (2) culturing the follicular granulose cells, shearing ovarium into small blocks, carrying out grinding, sieving, slaking, purifying and placing into culture bottle, then charging QM- 1640 culture liquid containing AB-serum, loading into CO2 incubator for culturing, (3) the application method comprises injecting the ovarian follicle granular cells into human body muscle or waist subarachnoid cavity.

[0014] There remains a need for cultured granulosa cells, in particular functional granulosa cells, e.g., as part of a culture system or kit, in particular in the context reproductive and reconstructive biology and related fields. In particular, there is a need for granulosa cells for therapeutic applications, such as for the treatment of infertility caused, e.g., by absence or dysfunction of granulosa cells, which results in insufficient maturation of the follicles and thereby in infertility or, e.g., in replenishing the ovary after chemotherapy or radiation. There is a need for granulosa cells with steroidogenic capacity, which may serve as a feeder layer for in vitro oocyte maturation. There is also a need for a system using cultured granulosa cells as an alternative for infertility treatment and which could be used for ovarian cells transplantation.

[0015] There is also a need for in vitro models of granulosa cells. These models can be used for the development of pharmacological tools for drug testing. In particular, there is also a need for a model for elucidating pathogenesis of ovarian endometriosis and providing treatments approaches for ovarian cancer. There is also a need for a GC culture that presents a more physiological approach to the maintenance of GC and can serve as a model for GC biology studies, such studies of the mechanisms of follicular physiology and disorders.

SUMMARY OF THE INVENTION

[0016] Generally speaking, the present invention addresses some or all of the above- described problems in the art by providing methods for culturing GC and related cultured granulosa cells, assays and kits for drug discovery, therapeutic, and diagnostic purposes based on the discovery in the present invention that, for example, granulosa cells cultured as monolayers remain viable in vitro over prolonged time periods, and exhibit stem cell potential when supplemented with leukaemia-inhibiting factor (LIF), and that use of a three- dimensional culture system (for example containing type I collagen) together with the use of LIF allows for both the survival and growth of preantral human GC while supporting a significant subpopulation of GC to maintain their characteristics for prolonged time periods (for example, their ability to produce follicle-stimulating hormone receptor (FSHR) and cytochrome P450 aromatase), thus permitting the study of functional GC in an environment that mimics the ovary in vivo.

[0017] In one aspect, the present invention provides methods for prolonged culturing of granulosa cells, including: (a) collecting and isolating primary granulosa cells; and (b) culturing the primary granulosa cells in vitro with a growth factor over a prolonged time period.

[0018] In certain embodiments, the primary granulosa cells may be luteinizing granulosa cells.

[0019] In certain embodiments, the growth factor may be a cytokine. [0020] In certain embodiments, the cytokine may be leukaemia-inhibiting factor or a functional derivative thereof.

[0021] hi certain embodiments, the functional derivative of leukaemia-inhibiting factor may be selected from the group consisting of growth-stimulating fragments, basic fibroblast growth factor, epidermal growth factor, insulin-like growth factor, and functional derivatives thereof.

[0022] In certain embodiments, the leukaemia-inhibiting factor or functional derivative thereof may be provided at a concentration selected from the group consisting of 10-10000 U/ml , 100-5000 U/ml, about 200 U/ml, about 300 U/ml, about 400 U/ml, about 500 U/ml, about 600 U/ml, about 700 U/ml, about 800 U/ml, about 900 U/ml, about 1000 U/ml, about 1100 U/ml, about 1200 U/ml, about 1300 U/ml, about 1400 U/ml, about 1500 U/ml, about 2000 U/ml, about 3000 U/ml, and about 4000 U/ml.

[0023] ha certain embodiments, the concentration of the leukaemia-inhibiting factor or functional derivative thereof may be maintained over the prolonged time period.

[0024] In certain embodiments, the prolonged time period may be selected from the group consisting of at least about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 16 days, about 17 days, about 18 days, about 19 days, about 20 days, about 21 days, about 22 days, about 23 days, about 24 days, about 25 days, about 26 days, about 27 days, about 28 days, about 29 days, about 30 days; about 5 weeks; about 6 weeks, about 7 weeks, about 8 weeks, about 2 months, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 3 months, about 4 months, about 5 months, and about 6 months.

[0025] In certain embodiments, the cultured primary granulosa cells express at least one functional marker after the prolonged time period.

[0026] In certain embodiments, the one or more functional markers may be selected from the group consisting of follicle stimulating hormone receptor and P450 aromatase. [0027] In certain embodiments, the primary granulosa cells may be cultured in step (b) in a three-dimensional culture environment.

[0028] In certain embodiments, the three-dimensional culture environment includes a culture medium and one or more of a cell adhesion molecule and a three-dimensional structure.

[0029] In certain embodiments, the three-dimensional structure may be selected from the group consisting of a scaffold carrier, wherein the scaffold carrier may be of natural, synthetic or of mixed origin.

[0030] In certain embodiments, the cell adhesion molecule may be an extracellular matrix component.

[0031] In certain embodiments, the extracellular matrix component may be selected from the group consisting of collagen, fibrin, laminins, fibronectin, and heparan sulfate.

[0032] In certain embodiments, the collagen may be selected from the group consisting of type I collagen and type IV collagen.

[0033] In certain embodiments, the primary granulosa cells may be may be isolated from ovaries.

[0034] In certain embodiments, methods according to the present invention may include an additional step (c) of autologously or heterologously transplanting the cultured primary granulosa cells into an ovary or underneath skin of a human or non-human animal after the prolonged time period.

[0035] In certain embodiments, methods according to the present invention may include an additional step (d) of genetically modifying the cultured primary granulosa cells prior to autologously or heterologously transplanting the cultured primary granulosa cells into an ovary or underneath skin of a human or non-human animal after the prolonged time period. [0036] In certain embodiments, the primary granulosa cells may be transformed to express one or more of follicle-stimulating hormone receptor (FSHR) and luteinizing hormone receptor (LHR).

[0037] In certain embodiments, methods according to the present invention may further include the step of sorting the isolated primary granulosa cells in step (a) prior to culturing the primary granulosa cells in step (b).

[0038] In certain embodiments, the isolated granulosa cells may be sorted with flow cytometry.

[0039] In certain embodiments, the primary granulosa cells may be sorted based on the presence of one or more specific functional markers.

[0040] hi certain embodiments, the one or more functional markers may be selected from the group consisting of follicle stimulating hormone receptor and P450 aromatase.

[0041] In certain embodiments, methods according to the present invention may further include the step of differentiating the granulosa cells cultured in step (b) into non-follicular cells.

[0042] In certain embodiments, the non-follicular cells may be selected from the group consisting of neuronal cells, osteoblasts, and chondrocytes.

[0043] hi another aspect, the present invention is directed to methods for prolonged culturing of granulosa cells, including: (a) collecting and isolating luteinizing granulosa cells; and (b) culturing the luteinizing granulosa cells in vitro in a three-dimensional culture environment with leukaemia-inhibiting factor or a functional derivative thereof over a prolonged time period.

[0044] In certain embodiments, the cultured luteinizing granulosa cells may be both viable and able to produce one or more of follicle-stimulating hormone receptor and cytochrome P450 aromatase at least five days after culturing step (b). [0045] In certain embodiments, the three-dimensional culture environment includes type I collagen.

[0046] In certain embodiments, the present invention is directed to cultured primary granulosa cells prepared according to one or more of the methods described herein.

[0047] In certain embodiments, the present invention is directed to assays for testing contraceptive agent candidates, including the steps: (a) contacting a contraceptive agent candidate with primary granulosa cells prepared according to one or more of the methods described herein; and (b) determining if the contraceptive agent candidate modulates the activity of the primary granulosa cells.

[0048] In certain embodiments, the present invention is directed to kits for testing contraceptive agent candidates, including cultured primary granulosa cells prepared according to one or more of the methods described herein, and instructions for testing the effectiveness of the contraceptive agent candidates to modulate the activity of the primary granulosa cells.

BRIEF DESCRIPTION OF THE DRAWINGS

[0049] FIGS. IA-C show purification and long-term culture results of luteinizing GC. (A) FSHR in GC: FACS/sorting results of freshly collected GC (a, b) Pure population of GC after FACS/re-sorting of already sorted cells (c, d); Cells: all living (Rl), FSHR-positive (R2) CD3-positive (R3); (B) GC cultured in medium: after 5 days without LIF (e), after 5 days in the presence of LIF (f) after 1 month in the presence of LIF (g); (C) FACS analysis for FSHR (b and d) and isotype control (a and c) for 2 IVF patients labeled A. and B. Ml = cells negative for FSHR, M2 = cells positive for FSHR.

[0050] FIGS.2A and 2B show characterization of luteinizing GC and viability test results. (A) characterization of luteinizing GC, sorted with FACS and cultured in medium supplemented with LIF. (a) In contrast to LIFR, the germ cells markers vasa, stellar and nanog were not expressed. Epithelial-like (b) and fibroblast-like (c) morphology of GC after 10 days culture, (d) RT-PCR analysis shows progressive loss of FSHR/aromatase expression during prolonged culture, but not of POU5F1 (OCT4). RT+/-: negative control, M: marker, fGC-freshly collected GC, sGC-sorted GC, cultured GC after: 1-lw (week), 3-3w, etc. (e) Immunophenotyping results for GC-derived multipotent cells. The following markers of mesenchymal stem cells were detected: CD29, CD44, CD 105, CDl 17, CD 166 whereas CD73 was negative. The red line indicates the respective markers, the grey shaded area the isotype control; (B) viability test for defrozen GC positive for FSHR. For experiments mixture of GC were used. No difference observed in experiments with only defrozen or mixed population of GC.

[0051] FIGS.3A and 3B show osteogenic differentiation of GC and FSHR immunohistochemistry results. (A) osteogenic differentiation of GC after prolonged culture in medium supplemented with LIF. Staining for alizarin red (a, b and c) and BSP (d, e, and f) for 3D-cultured luteinizing GC and sections of mouse ovaries; (B) FSHR immunohistochemistry after 2 days of culture in LIF medium (a, b magnification 4Ox; c, d magnification 2Ox) (a and c) cells positive for FSHR, (b and d) negative controls.

[0052] FIGS.4A-C show osteogenic differentiation of GC and OCT4 (POU5F1) immunohistochemistry results. (A) GC cultured in monolayers in control medium exhibiting fibroblast-like cells and (a) in osteo-inductive medium after 5 days, showing epithelial-like morphology of cells (b); (B) Real time PCR results for BSP, OP and OC expression in control GC, GC after osteodifferentiation and in bone marrow stem cells (BMSC); (C) OCT4 (POU5F1) immunohistochemistry for in vitro cultured GC (a) (arrow = positive cells) and mouse ovaries (c) (magnification 1Ox). (b and d) negative controls.

[0053] FIGS.5A-C show chondrogenic differentiation of GC and RT-PCR results. (A) Chondrogenic differentiation of GC after prolonged culture in medium supplemented with LIF. Safranin-0 staining in control GC (a) and in GC after chondro-induction (b); (B) Real time PCR results for expression of COLLI, COLL2, Sox9 in control GC in regular culture medium, GC after chondroinduction and in chondrocytes; (C) RT-PCR for neurodifferentiation markers of freshly isolated GC presents only 2 genes (nestin and BIIITubulin = arrows) weakly expressed, where the NF-neurofilament gene is not expressed. RA = medium with retinoid acid; LIF = medium with LIF; RT(-) = negative control.

[0054] FIGS.6A and 6B show neurogenic differentiation of GC results after prolonged culture in medium supplemented with LIF. (A) Neuron-like morphology after neurogenic induction of GC (a, b); (B) RT-PCR results showing expression of the neuronal markers, nestin (N), B-3-tubulin (T) and neuro-3 -filament (NF). GC: GC cultured in control medium supplemented with LIF, sGC: sorted GC.

[0055] FIG.7 shows in vivo differentiation of GC results. HLA-ABC (green) staining of pellets containing GC pellets, 8 weeks after implantation (a) at 2Ox magnification and 4 weeks after implantation (b), at 1Ox magnification. Staining for BSP using immunohistochemistry, 8 weeks after transplantation (red) (c) at 2Ox magnification, BSP using immunohistofluorescence (red) (d) at 2Ox magnification, and for HLA-ABC (green) (e) at 2Ox magnification. Double staining for BSP and HLA-ABC (f) at 2Ox magnification. Staining for Safranin-O, 8 weeks after transplantation (red) (g) at 1Ox magnification and HLA-ABC (h) 10x. Double staining for Safranin-0 and HLA-ABC (i), magnification 10x.

[0056] FIGS.8A-E show clonogenic proliferation results of GC collected from mature ovarian follicles of infertile women treated with assisted reproductive technology. (A) Clonogenic proliferation of a single GC cultured for 12 days in a single well in medium supplemented with leukaemia-inhibiting factor (LIF); (B) Staining of clones of GC for alkaline phosphatase (AP); (C) Flattened appearance of GC during prolonged culture in 2D in the presence of type I collagen; (D) RT-PCR of markers typical of GC function (follicle- stimulating hormone receptor (FSHR) and P450 aromatase), in freshly collected GC (fGC), and after short (3 days; 3d) or prolonged (17 days; 17d) culture in the presence of type I collagen in either 2D or 3D culture. Lane RT+/-: RT-PCR control, lane M: DNA marker; (E) Rounded appearance of GC cultured in 3D in the presence of type I collagen.

[0057] FIGS.9A-H show immunocytochemistry results of GC cultured in 3D together with type I collagen at various time points. (A, B, C) detection of FSHR; (D₅E₅F) detection of type IV collagen; (G₅H) Patches of GC cultured in the presence of type I collagen, as stained with immunocytochemistry for FSHR (G) and Coll IV (H). Cells with FSHR are more abundant in the centre of each patch, whereas Coll IV is more abundant in cells at the periphery of each patch.

[0058] FIGS.1 OA-I show FSHR-immunocytochemistry results in GC cultured in 3D together with type I collagen. (A) after 1 week; (B) after 3 weeks; (C) the number of patches positive for FSHR was counted after one (grey column) or three (black column) weeks in culture; (D₅E₅F) FSHR visualized with immunocytofluorescence in GC after three weeks in 3D culture in the presence of type I collagen; (G₅H₅I) LHR visualized with immunocytofluorescence in GC after three weeks in 3D culture in the presence of type I collagen.

[0059] FIGS.1 IA-F show that GC cultured in 3D in the presence of type I collagen progressively form follicle-like structures, which also include rosette-like structures similar to Call-Exner bodies, as stained with Coll IV (A,B,grey arrows), Alcian blue (E, black arrows) and also containing cells with FSHR (C₅D, green arrows); (E, black arrows) Proliferation of GCs cultured in 3D in the presence of type I collagen was demonstrated with Ki-67 staining. GCs marked with Ki-67 staining are arranged in patches of cells reminiscent of ovarian follicles.

[0060] FIG.12 shows concentration results of estradiol and progesterone in the medium supernatant of GC cultured in 3D with or without type I collagen after various time periods in culture. Whereas the concentration of estradiol did not differ significantly among the groups at any time point, the concentration of progesterone was significantly lower at various time points (P<0.01₅ Mann Whitney- U test), indicating a lower degree of spontaneous luteinization in the presence of type I collagen. The asterisks indicate missing values due to the disintegration of the pellets after three weeks in culture in the absence of type I collagen. The presence of the key steroidogenic enzyme 3β-HSD, which is involved in the production of progesterone, was demonstrated by immunocytochemistry in patches of GC forming follicle- like structures.

[0061] FIGS.13A-F show the results of GC cultured for three weeks in 3D in the presence of type I collagen that were transplanted into the right ovaries of immuno-deficient mice. The contralateral ovary was left unoperated for control purposes. The animals were sacrificed 4 or 8 weeks after transplantation. (A₅B) No differences were found in gross morphology between the operated and non-operated ovaries; (C) Staining for alu sequences and (D) HLA-ABC revealed that human cells were detected mostly within the boundaries of mouse follicles. After transplantation on the backs of immuno-deficient mice, FSHR-bearing cells were still present eight weeks later, as visualized by immunocytochemistry (E, red arrows) or immunocytofluorescence (F₅ green dots). [0062] FIGS.14A and 14B show multilayered follicles founded within 3D-cultured GC after more than 2 weeks (OO = oocyte; GC = granulosa cells). FIG.14C shows post-mature oocyte found within 3D cultured GC after more than 3 weeks (black arrow = first polar body; red arrow = zone pellucida; white arrow = cytoplasm).

[0063] FIGS.15A-B show AIu-CISH staining of human cells after transplantation into immuno-defϊcient mice observed in (A) mice oviduct and (B) mouse uterus.

DETAILED DESCRIPTION OF THE INVENTION

[0064] As discussed, the development of technology allowing growth of oocytes from primordial to mature follicles in vitro is would have enormous implications for clinical practice, animal production technology and research. Cultured mammalian follicles would be well-suited not only for oocyte culture, but also for research into follicle physiology and pathology. However, primordial and preantral follicles still do not grow well after isolation from the ovarian stroma according to known methods. Luteinizing granulosa cells (GC), the most common cell type in preovulatory ovarian follicles, are considered as terminally differentiated, undergoing cell death a few days after ovulation.

[0065] As shown and discussed herein, the present invention includes the discovery that, for example, GC cultured as monolayers remain viable in vitro over prolonged time periods, and exhibit stem cell potential when supplemented with leukaemia-inhibiting factor (LIF), and that use of a three-dimensional culture system (for example containing type I collagen) together with the use of LIF allows for both the survival and growth of preantral human GC while supporting a significant subpopulation of GC to maintain their characteristics for prolonged time periods (for example, their ability to produce follicle-stimulating hormone receptor (FSHR) and cytochrome P450 aromatase), thus permitting the study of functional GC in an environment that mimics the ovary in vivo.

[0066] Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. That the present invention may be more readily understood, select terms are defined below.

[0067] The term "Granulosa Cell(s)" (herein referred to in the singular and plural as "GC") is used in the present invention, without limitation, in the following context: In the mature follicle, a mature oocyte is surrounded by several hundred thousand GC, which exert a multitude of specialized functions encompassing the function of the primary follicle, such as producing large amounts of estradiol, adapting its FSH- and luteinizing hormone-receptivity to the endocrine milieu, nursing the oocyte and communicating both with the enclosed oocyte and the surrounding thecal cells. The signal leading to ovulation results in luteinization of the tissue. Luteinizing GC, which are generally considered to be terminally differentiated and destined to undergo cell death, are replaced in the midluteal phase of the menstrual cycle by small, luteinized cells originating from the surrounding theca. In the context of the present invention luteinizing/primary GC can be collected by various means, such as, but not limited to transvaginal ultrasound-guided aspiration from infertile patients or laparoscopy.

[0068] The luteinizing GC (understood to be a type of primary GC and used herein interchangeably with "primary GC", "luteinizing/primary GC", and "primary/luteinizing GC") may optionally, subsequently be isolated (or "sorted") via one of their functional markers, such as follicle stimulating hormone (FSH) receptor (FSHR), using, e.g., FACS to reach a number of FSHR expressing cells of at least 90%, preferably at least 95%, even more preferably at least 98% or even at least 99%. Alternatively, the luteinizing/primary GC are used directly after collection, without any further isolation. Thus, the inventive method may generally include a collection step, while a subsequent isolation step is often optional. As the person skilled in the art knows, a wide variety of methods to collect and isolate luteinizing/primary GC are available. The so collected and/or isolated cells may be used freshly after collection and/or isolation. Alternatively, the cells may be first preserved by, e.g. freezing and subsequent storage in liquid nitrogen and only subsequently cultured. A mixture of freshly isolated and preserved cells (e.g. frozen cells) can also be used for culturing.

[0069] The term "Non-Follicular Cells" refers without limitation in the present invention to cells that are normally not encountered within the antrum of the ovarian follicles, such as, but not limited to, neuronal cells, osteoblasts and chondrocytes. The differentiation of luteinizing GC according to the present invention into non-follicular cells is preferably accomplished with factors that differentiate stem cells into the res cell type.

[0070] The term "Growth factor" preferably refers without limitation in the present invention to a cytokine such as, but not limited to the glycoprotein leukaemia-inhibiting factor or a functional derivative thereof, including for example, fragments of LIF that still stimulate growth, basic fibroblast growth factor (bFGF, also known as FGF-2), epidermal growth factor (EGF) and insulin-like growth factor (IGF-I) and their respective functional derivatives. [0071] The term "leukaemia inhibitory factor" (hereinafter "LIF") is known in the art and used without limitation in the present invention to be a glycoprotein with a wide range of biological actions in different tissue systems and promotes the long-term maintenance of mouse but not human embryonic stem cells by suppressing spontaneous differentiation (Daheron et al., 2004). In a number of tissue systems LIF has been shown to be important for stem cell self-renewal, such as the brain (Bauer & Patterson, 2006), the gut (Kalabis et al., 2003) and bone marrow (Jiang Y et al., 2002). LIF has been detected both in fetal and adult human ovaries (Abir R et al. 2004) and may be involved in the transition of primordial to primary follicles (Nilsson EE, 2002). LIF is present in the follicular fluid and its secretion can be enhanced by human chorionic gonadotropin (Arid et al., 1997, Coskun et al., 1998). LIF receptor activity has been detected in both oocytes and pre-implantation human embryos (Van Eijk et al., 1996), suggesting a role of genital tract LIF signaling in the process of follicular development and implantation (Arici A., 1995). The follicular basal lamina binds several growth factors (McArthur et al., 2000) among them leukaemia inhibitory factor (LIF). LIF regulates the growth and differentiation of embryonic stem cells (Williams et al., 1988; Smith et al., 1992), primordial germ cells (Matsui et al., 1991; Nilsson et al., 2002), and adult cells.

[0072] The term "Concentration" is used, for example and without limitation in the present invention, as follows: a growth factor is said to be maintained over a time period, if within that time period the concentration is adjusted to the set level and not allowed at any time to drop beneath a level that allows for cell growth to stop, generally, irreversibly. Usually, especially over extended periods of time, this involves replenishing the culture medium with an appropriate amount of growth factor that is determined, e.g., in response to a measurement taken or according to a specific schedule that might, for example, be provided as part of a kit of the present invention.

[0073] The term "Culturing", for example as used in "cell culturing" refers without limitation in the present invention to a process of growing cells in vitro under physiological or quasi physiological conditions, such as physiological temperatures and in the presence of nutrients, such as those contained in a medium such as a standard medium. Freezing and other conditions that promote long term preservation are, in the context of the present invention, not considered physiological conditions. [0074] The term "Functional markers" refers without limitation in the present invention to marker molecules associated with GC or follicles that indicate the functionality of the same and includes, but are not limited to, primary characteristics ,which include, but are not limited to, in the context of granulosa cells, expression of follicle-stimulating hormone receptor (FSHR), luteinizing hormone receptor (LHR) and steroidogenic enzyme cytochrome P450 aromatase and in the context of follicles, expression of FSHR and collage type IV.

[0075] The term "Functionality" when referring to granulosa cells refers without limitation in the present invention to a specific functionality and/or a general functionality. A GC is said to have a specific functionality, for example, if it expresses a certain functional marker and in fact displays the functionality that this functional marker indicates. For example, GC that express FSHR and LHR display a specific functionality if they, in response to FSH and LH, secret progesterone (P4) and estradiol (E2). In the context of a more general functionality, a GC is said to be functional, for example, if it has the specific functionalities or functionality desirable in the context described.

[0076] The term "phenotypical characteristic" when referring to a granulosa cell refers without limitation in the present invention to visible (including visibility aided by appropriate devices) proliferation of the granulosa cell in vitro and in vivo, and phenotypically traceable differentiation in vitro and in vivo. Another phenotypical characteristic is a prolonged culture of the GC in vitro, e.g., over a period of greater than 8 weeks.

[0077] The term "three-dimensional (3D) culture" refers without limitation in the present invention to a cell culture in which cells are maintained three-dimensionally rather then two- dimensionally (e.g., in a monolayer culture) via a carrier (See, for example, Ohtake et al., 1999, specifically incorporated herein by reference, for a description of the in vitro culture of cancerous ovarian cells in collagen gels). Any suitable carrier that can be used to accomplish this task is within the scope of the present invention. However, preferably, the 3D cell culture comprises in addition to an appropriate culture medium, e.g., cell adhesion molecules such as, but not limited to collagen, such as collagen I and collagen IV, fibrin, laminins or fibronectin, and other extracellular matrix components, i.e., heparan sulfate that may form a 3D structure, e.g., subsequent to centrifugation or a 3D structure such as, but not limited to a scaffold carrier of natural, synthetic or of mixed origin. Generally, such a 3D structure aggregates cells and thus reproduces a more physiological environment. [0078] Briefly, as shown and discussed below, luteinizing GC were isolated from the ovarian follicles of infertile patients treated with controlled ovarian hyperstimulation for assisted reproduction. The variable fertility status of single patients is thought to impact GC function, thus to reduce this potential confounding effect samples of several patients were pooled. The isolated GC were sorted with flow cytometry based upon the presence of their specific marker, the follicle stimulating hormone (FSH) receptor (FSHR), and were shown to be maintainable in culture over prolonged periods of time in the presence of the leukaemia- inhibiting factor ("LIF"; see definitions), a cytokine commonly used in culture media supporting the development and growth of stem cells (see Example 1, herein). LIF was found to promote the long-term survival of luteinizing GC, whereas cells in the absence of LIF invariably became apoptotic.

[0079] Although LIF permitted the prolonged survival of luteinizing GC, such GC progressively lost their major characteristics, such as the FSHR and aromatase. The overgrowth of the luteinizing GC by a subpopulation of other cells such as fibroblasts could be excluded by the extraction of a pure population of GC with FACS based on the FSHR. Apart perhaps from the oocyte (Meduri et al., 2002), GC are the only cell type in the female body possessing the FSHR. Through re-sorting with FACS it was demonstrated that the method provided homogeneous cell populations. The sorted GC continued to possess all hallmarks of GC over a period of at least ten days, as demonstrated by the expression of aromatase and FSHR. As follicles mature, the amount of mRNA for FSHR is known to decrease, whereas that of aromatase increases (Slomczynska et al., 2001). The presence of FSHR in sorted GC was confirmed by immunohistochemistry.

[0080] Under LIF-treatment conditions, markers of GC function such as FSHR and aromatase gradually disappeared. POU5F1 (OCT4), a typical stem cell marker, was expressed throughout the culture, but not germ line cell markers such as nanog, vasa and stellar. The progressive loss of all characteristics of GC during prolonged culture and the continued expression of POU5F1 in luteinizing GC gave rise to the hypothesis that some follicular cells might exhibit stem cell properties. The expression of POU5F1 (OCT4) has not been demonstrated in granulosa before. POU5F1 is a transcription factor considered to be a specific gene marker for the pluripotency of stem cells (Pan et al., 2002). As discussed herein, the presence of POU5F1 in GC was confirmed and oocytes using immunohistochemistry of mouse ovary.

[0081] Mesenchymal lineage markers such as CD29, CD44, CD90, CD105, CDl 17 and CD 166, but not CD73, were expressed by substantial subpopulations of GC, suggesting that during prolonged culture in the presence of LIF these cells possess many attributes of the MSC lineage. The multipotency of a subset of follicular GC was established by in vitro differentiation into other cell types, otherwise not present within ovarian follicles, such as neurons, chondrocytes and osteoblasts. Ovarian follicle-derived stem cells were also able to survive when transplanted into the back of immuno-incompetent mice, in vivo generating tissues of mesenchymal origin.

[0082] The two different morphologies of GC, epithelial and fibroblastic, found to be present in the medium during initial culture, correspond to the different intrafoUicular locations, from which the GC were removed during transvaginal ultrasound-guided follicular aspiration. GC originating from the close to the basal membrane are columnar, those originating from the middle layer are rounded and those originating from the central part of the follicle, close to oocyte, are flattened (Rodgers et al., 2001). Some authors argue that elongated GC may have lost aromatase activity, cytoplasmic changes compatible with luteinization (Gutierrez et al., 1997). When cultured in monolayers, GC invariably become luteinized and convert their epithelial morphology into a fibroblastic one, explaining why the latter morphology became dominant during prolonged culture.

[0083] Evidence was provided of the stem-like characteristics of a GC subpopulation by demonstrating their differentiation potential when cultured with specific neuroinductive, chondroinductive and osteoinductive culture media. Chondroinduction was demonstrated by real-time PCR and detection of GAG, a method commonly used for the detection of cartilage matrix (Barbero et al., 2003). Safranin-O-staining was used, because the Alcian Blue staining, commonly applied for GAG-staining, also stained Call-Exner bodies in ovarian tissue, as described previously (Van Wezel et al., 1999). Safranin-O-staining was weak, probably due to the fact that some GC died early during the chondrogenic differentiation. Expression patterns of cartilage-related genes during chondrogenic differentiation in GC and expanded primary chondrocytes control were similar. The COLLI and COLL2 genes are expressed during cartilage development. COLLI is expressed by cells first entering differentiation where COLL2 is expressed in differentiated cells (Bonaventure et al., 1994). SOX9 is a key regulator of chondrogenesis (Jenkins et al., 2005). The difference in . expression levels of the three genes could suggest that GC, under the conditions described, undergo very early chondrogenic differentiation.

[0084] Osteoblastic differentiation was demonstrated by alizarin-red-staining, a dye assessing the presence of calcium in mineralized matrices. BSP-staining was also performed and confirmed the osteoblastic differentiation of GC. BSP and OP are prominent components of bone extracellular matrix. They are expressed by differentiated osteoblastic cells and serve as indicators of osteoblastic differentiation of BMSC (Barbero et al., 2003). After 3 weeks of osteoblastic differentiation, the expression of BSP messenger RNA exhibited a 14-fold increase and OP messenger RNA a 66-fold increase as compared to GC cultured in LIF medium. OC messenger RNA showed a limited 3 -fold increase in differentiated GC. This low expression level is explained by OC starting to be expressed later during the osteoblastic differentiation process, between days 16-30 of culture, resulting in a maximal though limited expression at day 21.

[0085] Using the freshly isolated and sorted luteinizing GC, the differentiation potential of GC into other lineages was less pronounced than after prolonged culture. With freshly collected GC, only neuro-induction was achieved with the expression of only two of three neuronal markers, nestin and β-3 -tubulin, but not neurofilament. As some MSC markers were not uniformly present in the sorted GC, it was hypothesized that several subpopulations of GC in preovulatory follicles, each expressing different MSC markers according to their degree of differentiation, were present. In many organs adult tissues typically contain various cell populations, including multipotent stem, progenitor cells and terminally differentiated cells (Hochedlinger et al., 2006).

[0086] Prolonged culture of luteinizing GC in culture medium supplemented with LIF allowed the selection of less differentiated GC, which exhibited a certain degree of plasticity, as they could be differentiated in vitro into three distinct lineages: neuronal, chondrocytic and osteoblastic, all normally not found within the boundaries of the basal membrane of healthy ovarian follicles. Both the survival of GC after prolonged culture in the presence of LIF and their ability to differentiate into cells of the mesodermal lineage was also confirmed in vivo. The transplanted and differentiated human cells were surrounded by specific mouse cells differentiated into the same direction, all within mesenchymal lineage. The possibility that these findings were a result of an overgrowth of contaminating stem cells originating from blood circulation or from other tissues of the genital tract was ruled out by the observation, that LIF was essential for long term survival of the cells and by parallel experiments with bone marrow stromal cells, which were used as a positive control.

[0087] The possibility that the luteinizing GC cultured in the presence of LIF were germ cells was ruled out by the lack of expression of nanog, vasa and stellar. Evidence for the presence of stem cells in the theca of the neonatal mouse ovary was provided recently (Honda et al., 2007). A model of how GC arise from a population of stem cells and then enter different lineages before final differentiation has been discussed (Rodgers et al., 1999). It is demonstrated that some follicular cells may survive in the presence of LIF and that they manifest themselves as MSC.

[0088] The high concentration of LIF in the follicular fluid of mature follicles and the presence of LIFR in GC support the physiological relevance of the present invention. Multipotent stem cells in ovarian follicles may be involved in the early origin of some forms of ovarian cancer as well as to the origin of ovarian endometriosis, which is considered to arise from undifferentiated, metaplastic cells in the ovary. This hypothesis is supported by the abundant secretion by endometrial cells of LIF (Arici A., 1995).

[0089] As outlined above, the use of the leukaemia-inhibiting factor allowed the culture of GC for up to a few months. However, GC lost their primary characteristics, such as expression of follicle-stimulating hormone receptor (FSHR), luteinizing hormone receptor (LHR) and the steroidogenic enzyme cytochrome P450 aromatase, over time on tissue culture plastic.

[0090] Thus, as shown and described in Example 2 herein, alternative culture conditions were defined to allow the culture of fully functional GC. Cellular shape affects processes such as metabolism, attachment and migration (Folkman et al., 1978). In a two-dimensional follicle culture system, murine follicles fail to maintain their in vzvo-like architecture resulting in a diffuse morphology (Cortvrindt et al., 1996; Berkholtz et al., 2006; West et al., 2007) and no follicle growth (Abir et al., 2001). A three-dimensional (3D) follicle culture system sustains in vivo-like follicle morphology and the cell-cell and cell-matrix interactions within the tissue (Kreeger et al, 2003; Gomes et al., 1999), thereby promoting follicle growth.

[0091] Primary GC were cultured in a three-dimensional (3D) environment, simulating more closely the environment of ovary. GC cultured as 3D pellets associated with collagen type I were able to convert hormones into estradiol and progesterone, and express the GC typical genes like FSHR and cytochrome P450 aromatase. GC formed under 3D conditions specific follicle like structures which were positive for specific follicle markers such as FSHR and Collagen type IV. The inventive culture environment not only allowed the survival and growth of GC in culture, but as well the maintenance of their native phenotype and functions for prolonged periods of time. GC-specific markers were further maintained for 8 weeks when subsequently implanted subcutaneously in mice. FSHR-expressing GC organised spherical follicle-like structures in the pellet, where GC presented an epithelial phenotype, as demonstrated by their morphology and the presence of a basal lamina containing collagen type IV. Structures highly similar to follicle-specific Call-Exner bodies were also observed. The functionality of the GC was further demonstrated by production of androgens by these cells in response to FSH and LH.

[0092] The following Examples set forth various materials and methods used in the present invention and various non-limiting embodiments of the present invention which are understood to be illustrative and non-limiting.

Example 1 Prolonged Cultivation of GC and Differentiation of the Same Into Non-Follicular Cells

A. Materials and Methods

Collection of luteinizing GC

[0093] Luteinizing GC were collected by transvaginal ultrasound-guided aspiration from infertile patients treated with controlled ovarian hyperstimulation for assisted reproduction. Patients had been treated with various exogenous gonadotropin including human menopausal gonadotropins (HMG, Menopur, Ferring, Switzerland; or Merional, IBSA, Switzerland), and recombinant FSH (Gonal F, Serono, Switzerland, or Puregon, Organon, Switzerland) followed by 10000 IU of human chorionic gonadotropin (HCG, Pregnyl, Organon). After removal of the cumulus oophorus-oocyte complexes (COC), the freshly collected follicular aspirates were centrifuged for 5 min, 800 rpm. GC were separated from other cells by density gradient centrifugation on 5 ml Ficoll PLUS (Amersham Biosciences, Sweden) for 20 min, 1500 rpm. GC were clearly visible in the interphase layer, isolated by pipetting, washed twice in 10 ml Dulbecco's modified Eagle's (DMEM) culture medium and centrifuged again at 800 rpm for 5 min for final collection of the cells (Zhang et al., 2000). The purified cells were placed in freezing medium (fetal calf serum, FCS with 10% (v/v) dimethylsulphoxide (DMSO) and stored at -80 ⁰C until flow cytometry and sorting (FACS, Fluorescence Activated Cell Sorter) or kept in culture.

Cell culture

[0094] GC were cultured in DMEM containing a high concentration of glucose (4500 mg/L, Gibco, Switzerland), supplemented with 15% (v/v) fetal calf serum (Gibco). The culture medium was also supplemented with penicillin/streptomycin (50 μg/ml), L-glutamine (3 mmol/1), β-mercaptoethanol (10 mM stock solution in DMEM), recombinant FSH (100 ng/ml or 3 x 10^"4 IU/ml, Gonal F; Serono) and 1000 IU/ml of leukaemia-inhibiting factor (Gough et al., 1988) (LIF, Chemicon International, USA). As cells were highly sensitive to trypsin, a cell scraper was used for passages. Identical culture conditions were used for the incubation of bone marrow stromal cells in order to check for a potential contamination with fibroblasts.

Identification of the luteinizing GC using FACS and sorting

[0095] GC were identified by the presence of FSHR and subsequently sorted using FACS. GC identification and sorting was performed by a dual labeling technique, where GC were identified as CD3 -negative cells, distinguishing them from CD3 -positive leukocytes (anti- CD3-APC monoclonal mouse antibodies - Becton Dickinson) (De Neubourg D et al., 1998). GC were kept frozen at -80°C and were thawed on the day of performing FACS. The first polyclonal goat antibody, raised against a peptide mapping near N-terminus of the FSHR of human origin (Santa-Cruz Biotechnology), was added for 30 min, kept on ice in the dark. The second donkey anti-goat IgG antibody labelled with fluorescence isothiocyanate (FITC) (Santa-Cruz Biotechnology) was used incubating for 30 min on ice in the dark. Isotype controls were used. Isolated populations of FSHR-positive cells, considered to be pure GC, were used for prolonged culture. As GC were cultured either immediately after their aspiration from ovarian follicles or after thawing, their viability was tested using propidium iodide (pi) exclusion and calcein tests (Live/Dead Kit, Invitrogen). Fluorescence-Activated Cell Sorting (FAGS^') Analysis

[0096] Cell suspensions were incubated for 30 min at 4°C with fluorochrome-conjugated antibodies against the indicated protein or an isotype control. All antibodies were purchased from Becton Dickinson except the one against CD 105 (Serotec) and FSHR (Santa-Cruz Biotechnology). Cells were washed, re-suspended in PBS and analyzed with FACSCalibur (Becton Dickinson).

RT-PCR

[0097] Total RNA was extracted from GC using a RNeasy Total RNA kit from Qiagen (Germany). The quantity of RNA was measured by optical density at A260 nm (ND- 1000 Spectrophotometer, NanoDrop Technologies, USA). Total RNA (1 μg) was reverse transcribed into single strand cDNA using the cDNA synthesis kit (Boehringer Mannheim, Mannheim, Germany). Primers were synthesized by Microsynth, Switzerland: FSHR F (forward) 5'TGGGCTGGATTTTTGCTTTTG (SEQ ID NO:1), R (reversed) 5'CCTTGGATGGGTGTTGTGGAC (SEQ ID NO:2) (annealing temperature 55°C, DNA product size 529 bp); Aromatase FS'CAAGTGGCTGAGGCAT (SEQ ID NO:3), R5'GAGAATAGTCGGTGAA (SEQ ID NO:4) (55°C, 429 bp); POU5F1 (OCT-4); stellar; vasa; nanog; LIFR; nestin; neurofilament (NF); B-3-tubulin (Abdel-Rahman et al., 1995; Ezeh et al., 2005; Abir et al., 2004; Scintu et al., 2006; Dozier et al., 2003). cDNA amplification primers for POU5F1 (OCT-4), FSHR and the LIF-receptor (LIFR) were designed to span introns as to eliminate genomic DNA contamination. The β-actin PCR product was used as internal control (Rapid Scan). The single strand cDNA was subjected to 35 cycles of PCR amplification using one of the primer sets. The amplified products were separated on 1 or 2% agarose gels. The RT-PCR products were analyzed by DNA sequencing (ABI, PE Applied Biosystems, USA), mRN A from bone marrow was used as a positive control for POU5F1 (Pochampally et al., 2004).

Immunohistochemistrv

[0098] For the morphological examination of freshly collected or frozen/thawed GC were fixed in 1% paraformaldehyde overnight at 4⁰C, stained with haematoxylin/eosin (H&E) and observed microscopically at various magnifications (Leitz, Dialux 20, Germany). The presence of FSHR and POU5F1 in GC was demonstrated with immunohistochemistry using an antibody against human FSHR (Santa-Cruz Biotechnology) and POU5F1 (Abeam), respectively, following standard protocols. The secondary antibody against FSHR consisted of FITC-labelled donkey anti-goat antibodies (Santa-Cruz Biotechnology). The secondary antibodies against POU5F1 consisted of biotin-conjugated rabbit anti-goat antibodies (DAKO, Denmark AJS). Staining for immunohistochemistry were performed by incubation with the ABC-alkaline phosphatase complex kit (Dako, Glostrup, Denmark), counterstained with H&E and mounted. As positive controls for the detection of POU5F1 sections of mouse ovaries were used.

Differentiation in vitro

[0099] The multilineage differentiation capacity of the sorted luteinizing GC was evaluated by their differentiation into cell types, normally not encountered within the antrum of ovarian follicles, such as neuronal cells, osteoblasts and chondrocytes. Freshly collected and sorted GC were cultured in neuro-inductive medium for 10 days. For differentiation of GC after long-term culture in vitro, GC were first incubated in medium supplemented with LIF for two weeks, then three weeks in one of the three specific differentiation media described below. After five weeks, the pellets were harvested for histological examination and gene expression analysis.

[0100] Differentiation towards the neurogenic lineage was induced by DMEM supplemented with 10% FCS and 30 μmol/L transretinoic acid (Sigma) (Portmann-Lanz et al, 2006). Differentiation towards the chondrogenic lineage was induced in DMEM culture medium supplemented with 10% FCS, ITS-I (Insulin, Transferrin, Selenium; Sigma), 0.1 mM ascorbic acid 2-phosphate, 10 ng/ml TGFβl and 10^"7 M dexamethasone (Barbero A et al., 2003). Osteogenic differentiation was induced in DMEM culture medium supplemented with 10% FCS, 0.1 mM ascorbic acid 2-phosphate, 10^"2M β-glycerophosphate and 10^'8M dexamethasone (Barbero A et al., 2003). Neuro-differentiation was performed in monolayers. Chondro-differentiation was performed in three-dimensional (3D) cell cultures (Barbero et al., 2003), osteo-differentiation in both. For the 3D-cell culture approximately 3.5xlO⁵ cells were cultured in pellets within conical microtubes (Sarstedt) on an orbital shaker. The media were changed three times weekly. For histological examination pellets were fixed in 4% formalin overnight at 4°C, paraffin embedded and sectioned (7 μm thickness). The sections collected from the osteogenic culture medium and the respective controls were stained with H&E or incubated for 10 minutes with alizarin red, washed extensively with water and observed microscopically (Leitz, Dialux 20, Germany). An alternative procedure consisted of staining with an antibody against bone sialoprotein (anti-BSP, Immundiagnostik AG, Germany). Decalcification of osteo-differentiated pellets was performed with Osteodec (Bio- Optica, Italy). The sections after chondroinduction were stained with Safranin-0 or Alcian Blue.

Quantitative real-time PCR

[0101] Primers for real-time PCR were synthesized by Microsynth: COLLI, COLL2, OC (Barbero et al, 2003), OP F5'CTCAGGCCAGTTGCAGCC,

R5'CAAAAGCAAATCACTGCAATTCTC or synthesized by Roche: BSP (Barbero et al., 2003), SOX9 F5'CCCGCACTTGCACAACG, R5TCCACGAAGGGCCGCT. Power SYBR Green PCR Master Mix (AB Applied Biosystems) for real-time PCR and TaqMan GAPDH Control Reagent (PE Applied Biosystems) was used as internal control. cDNA was subjected to 40 cycles of amplification using ABI PRISM 7000 Sequence Detector System (AB Applied Biosystems). Expression of the different genes was presented as percentage of expression of GAPDH, a house-keeping gene, by using the formula: l/2^ΛCt. Where ΔCt = gene - GAPDH, ΔCtq = control gene - GAPDH, ΔΔCt = ΔCt-ΔCtq and Delta-Delta CT Method, fold change, was presented using the formula: 2^{~ ΔΔ} '.

Differentiation in vivo

[0102] The multilineage differentiation capacity of GC was assessed by implantation into the back of immuno-incompetent mice. For that purpose GC were cultured in vitro for three weeks in 3D and transplanted in nude mice (CD-I nu/nu, 1 -month old; Charles River Laboratories, Wilmington, MA, http://www.criver.com) in accordance with institutional guidelines. Four to eight weeks after implantation, the mice were sacrificed. The constructs were harvested and fixed overnight in 1% paraformaldehyde, paraffin embedded and sectioned. Sections were then stained by H&E and observed microscopically. Immunohistochemistry for BSP was performed with a BSP-biotin conjugated antibody (Cedarlane labs) followed by incubation with ABC-alkaline phosphatase complex (Dako, Glostrup, Denmark), counterstained with H&E and mounted. For immunohistofluorescence of BSP, polyclonal rabbit-anti-human BSP antibodies from Alexis Biochemicals with secondary goat anti-rabbit PE antibodies from Becton Dickinson were used. To distinguish human from murine cells immunohistofluorescence was carried out with anti-human monoclonal HLA-ABC-biotin conjugated antibody with avidin-FITC secondary antibodies from Becton Dickinson. Some sections were also stained with Safranin O to assess the formation of cartilage.

B. Results

[0103] The cellular content of follicular fluid aspirated during oocyte collection for assisted reproduction consisted of a mixture of luteinizing GC, both single and in clumps, erythrocytes and large epithelial cells, probably also arising from the vaginal epithelium. Most of the erythrocytes were excluded during the Ficoll density gradient purification. With FACS a subpopulation of FSHR bearing cells from the follicular aspirates was consistently identified. This process permitted the separation of FSHR bearing cells from contaminant cells such as vaginal epithelial cells, leukocytes and erythrocytes. The relative number of cells with FSHR among the entire population of cells in the unsorted follicular aspirates ranged between 5% and 70%. This broad range corresponds to the individual characteristics of infertile women, from whom the GC were collected, and to the technical variabilities of transvaginal, ultrasound-guided aspiration of ovarian follices. However, after sorting, the number of FSHR cells consistently reached 99% (see FIG. IA and FIG.1C for isotype control). The sorted cells were identified as luteinizing GC through the expression of both FSHR and aromatase. These purified luteinizing GC were then used for prolonged culture.

[0104] In order to have an appropriate number of GC available for each experiment, but also to minimize the variability of the characteristics of GC collected from individual women, GC from individual patients were stored frozen and later pooled. Most experiments were performed with frozen/thawed GC, but occasionally also with a mixture of both freshly collected and frozen/thawed GC. However, no difference in viability testing in either freshly collected or frozen/thawed GC was detected (FIG.2B).

[0105] In order to evaluate the effect of LIF on the prolonged survival of GC in vitro, sorted luteinizing GC were split into two groups and cultured separately. One group was cultured in DMEM medium supplemented with LIF, while another group in culture medium without LIF. The luteinizing GC cultured without LIF consistently died within two weeks (FIG. IB), whereas those cultured in medium supplemented with LIF remained viable up to four months and could be passaged. The expression of LIFR in sorted luteinizing GC was confirmed (FIG.2A). As visualized with light microscopy, cultured luteinizing GC exhibited two distinct morphologies: epithelial (between 5% and 35% of all cells) or fibroblastic (FIGS.2B and 2C). The epithelial-like cells disappeared after about 3 weeks in culture, whereas the remaining cells retained their fibroblastic morphology. The overgrowth of the GC culture by other cells such as contaminating fibroblasts was ruled out by the observation that no cells survived in the absence of LIF. Furthermore, in another set of experiments bone marrow stromal cells were cultured in the same medium either supplemented or not supplemented with LIF. Under those conditions the bone marrow stromal cells also remained viable over prolonged time periods in both media. Those cells did not express FSHR nor OCT-4 (POU5F1) (data not shown).

[0106] The expression of FSHR, aromatase and POU5F1 (POU domain, class 5, homeobox 1, also denominated OCT4) was examined on sorted luteinizing GC cultured in the presence of LIF at various time intervals (after 1, 3, 4 and 8 weeks) and compared with freshly collected sorted and unsorted luteinizing GC (FIG.2D). After approximately 7 days the luteinizing GC progressively lost their ability to express FSHR, after 8 weeks also that of aromatase. POU5F1 was expressed in the freshly collected luteinizing GC and remained expressed in the luteinizing GC throughout their culture in medium supplemented with LIF (FIG.2D). The presence of FSHR and POU5F1 were confirmed by immunohistochemistry after the same incubation periods (FIG.3 and FIG.4C). The immunostaining of POU5F1 of both oocytes and GC in antral follicles of mouse ovaries was used as a positive control.

[0107] As the transcription factor POU5F1, a marker for the pluripotency of stem cells, remained expressed throughout the prolonged culture, other markers of pluripotency, characteristic for germ cells, were examined, such as nanog, stellar and vasa (FIG.2A). All specific markers of germ cells, however, were negative. AU PCR products yielded the expected fragment sizes. There was no contamination of genomic DNA in any of the samples tested and all negative controls (RT±) processed without reverse transcriptase yielded no amplification product (FIGS.2A and 2D).

[0108] As GC originates from the mesoderm, the mesenchymal cells characteristic of the freshly collected GC using various markers of mesenchymal stem cells (MSC) were examined. Cells were positive for markers: CD29, CD44, CD90 CD105, CDl 17 and CD166, but not CD73 (FIG.2E). CDl 17 was positive in only 4.5% (+/- 3%) of GC (mean +/- standard deviation, 10 different donors). The typical marker for hematopoietic cells, CD45, was present only in freshly isolated GC probably due to a contamination with blood cells, although CD34 was not expressed (data not shown).

[0109] The multipotency of a subpopulation of cells in the follicular aspirates was demonstrated by the induction of neuronal differentiation of a small subset of cells among freshly collected and sorted luteinizing GC (FIG.5 C). The multilineage differentiation capacity of the sorted luteinizing GC cultured became stronger after they being cultured over prolonged time intervals. Subsequently, the cells were differentiated in vitro to osteoblastic, chondrogenic and neuronal lineages respectively under conditions known to direct the differentiation of MSC. A clonal analysis of GC was attempted, but failed probably due to the deleterious effect of trypsin and the increased general sensitivity of passaged GC.

[0110] The osteoblastic differentiation potential of cultured luteinizing GC was examined by alizarin red, BSP-staining and gene expression of various osteoblastic markers, such as BSP, osteocalcin (OC) and osteopontin (OP). As GC cultured as monolayers in osteoinductive medium exhibited typical changes in their cellular morphology (FIG.4A), but were too sensitive and became detached from the culture plate, a 3D-culture system was introduced. Under those conditions and in the presence of an osteo-inductive medium, previously luteinizing GC were stained positively with alizarin red and marked with anti-BSP antibodies, whereas the same cells cultured in medium supplemented with LIF or sections of mouse ovaries remained negative (FIG.3). The matrix of osteo-differentiated cell pellets was demonstrated to be mineralized, as documented by rapid dissolution of crystallized structures by treatment with an acidic decalcification buffer, Osteodec^® (data not shown). Real-time PCR showed that expression of BSP was increased 14-fold, OP 66-fold and OC 3-fold in osteo-differentiated tissue pellets, when compared to control cells cultured with medium supplemented with LIF (FIG.4B). When compared with bone marrow-derived cells (BMSC) cultured as a monolayer in a similar osteoinductive medium during the same time (Frank O, 2002), BSP was found to be expressed 8 times more in BMSC than in osteo-differentiated GC pellets, but both OP and OC were expressed more in the GC pellets (5 and 1.5-fold respectively).

[0111] The chondrogenic differentiation potential of luteinizing GC cultured over prolonged periods of time was demonstrated by the presence of glycosaminoglycan (GAG) in GC pellets cultured in 3D in chondro-inductive medium using Safranin-O-staining (FIG.5A). After chondrogenic differentiation, the tissue sections were weakly positive for Safranin-O- staining, whereas GC cultured in medium supplemented with LIF were negative. Sections of mouse ovary were also negative for GAG-staining (data not shown). With real-time PCR the expression of various genes specific for chondrogenic differentiation was upregulated in GC cultured in chondrogenic differentiation medium, when compared to GC cultured with control medium with LIF: collagen 1 (Colli) 4.5-fold, collagen 2 (Coll2) 6.5-fold and Sox9 12.5-fold (FIG.5B). These values were also compared with expanded primary chondrocytes cultured as a monolayer in the same chondrogenic medium during the same period (Barbero et al., 2003). Expression of Coll2 and Sox9 was higher in chondrocytes (2.5-fold and 1.9- fold respectively), but that of Colli was higher in chondro-induced GC (1.6-fold).

[0112] Finally, the capacity of luteinizing GC to undergo neurogenic differentiation after prolonged culture in medium supplemented with LIF was examined as well. After five days GC cultured as monolayers in medium containing retinoic acid developed neuron-like structures. After 8 days of culture approximately 15% of all cells displayed the distinct morphology suggestive of neurons (FIG.6A). Various neuronal markers, such as nestin, neurofilament and β-3-tubulin, were found to be expressed in GC cultured in retinoic acid- enriched medium but not in the control medium supplemented with LIF (FIG.6B). Neuronal markers for neurodifferentiation of freshly isolated GC were examined. Two neuronal markers, nestin and β-3 -tubulin, were weakly expressed in freshly collected GC, whereas another, neurofilament, was not found to be expressed in freshly collected GC (FIG.5C). All experiments were performed in triplicate. Brain tissue was used as a positive control and the expression of all markers was confirmed by sequencing (data not shown).

[0113] The capacity of GC cultured in medium supplemented with LIF to survive and differentiate in vivo into other, distinct tissue types was examined through subcutaneous transplantation into the back of immuno-incompetent, nude mice. The implants were harvested either four weeks or eight weeks after transplantation. After eight weeks the implanted cell pellets appeared to be more integrated within the murine tissue than after 4 weeks (FIGS.7A and 7B) and expression of BSP was detected (FIGS.7C, 7D, and 7F). Those cells were always surrounded by murine cells also showing expression of BSP (FIGS.7E and 7F). The distinct origin of both cell types was tested by HLA- ABC-staining, which is specific for human tissue. Eight weeks after transplantation some GAG deposition was also detected as demonstrated through the Safranin 0 staining (FIGS.7G, 7H, and 71).

Example 2 GC in 3D Culture

[0114] As shown in Example 1, GC cultured as monolayers remain viable in vitro over prolonged time periods, and exhibit stem cell potential when supplemented with leukaemia- inhibiting factor (LIF). However, under such conditions, it was found that GC rapidly lose their main characteristics, such as production of follicle-stimulating hormone receptor (FSHR) and cytochrome P450 aromatase. Accordingly, a three-dimensional culture system containing type I collagen was developed in the present invention, which, together with LIF, allowed not only the survival and growth of preantral human GC, but supported a significant subpopulation of GC to maintain their characteristics for prolonged time periods.

A. Materials and Methods

Collection of luteinizing GC

[0115] Luteinizing GC were collected as previously described (Kossowska-Tomaszczuk et al., 2009). The freshly collected follicular aspirates were centrifuged for 5 min at 11Og and GC were separated by density gradient centrifugation on Ficoll PLUS (Amersham Biosciences, Sweden) for 20 min at 390g. The purified cells were placed in freezing medium (FCS with 10% (v/v) dimethylsulphoxide (DMSO)) and stored at -80 ⁰C until culture. All experiments outlined above were approved by the Ethics Committee of Basel, Switzerland, and patients provided signed informed consent.

Cell culture

[0116] All experiments were performed in triplicate with pooled cells from different patients in order to reduce inter-individual differences between single patients. GC were cultured either as monolayers or in 3D with DMEM-high glucose (4.5 g/L glucose, Gibco, Switzerland), supplemented with 15% fetal calf serum (Gibco), 50 mg/ml penicillin/streptomycin (Gibco), 3 mM L-glutamine, 10 mM b-mercaptoethanol, 3x10^'4 IU/ml recombinant FSH (Gonal-f; Serono), 200 ng/ml recombinant human LH (Luveris, Serono) and 1,000 IU/ml leukaemia-inhibiting factor (LIF, Chemicon International, Temecula, CA, http://www.chemicon.com). For the 3D culture, approximately 3.5xlO⁵ GC were suspended in a 2.5 mg/ml type I rat collagen suspension (BD Biosciences), incubated for 15 min in 37⁰C₅ and centrifuged for 3 min at 39Og, to obtain 3D pellets. Pellets were then cultured in corneal microtubes (Sarstedt) on an orbital shaker.

Clonal density cultures and Cell Sorting

[0117] GC were identified and sorted by the presence of FSHR (Santa-Cruz Biotechnology) (Kossowska-Tomaszczuk et al., 2009) Twith FACSCalibur (Becton Dickinson). Single FSHR-bearing GC were plated at clonal density (1 cell/well) in 96-well plates. At day 17 of culture, alkaline phosphatase (AP) staining was performed, following the instructions provided by the manufacturer, (AP kit, Sigma-Aldrich).

RT-PCR

[0118] Total RNA extraction, cDNA transcription and amplification were performed as described previously (Kossowska-Tomaszczuk et al., 2009). Primers were synthesized by Microsynth, Switzerland: FSHR F (forward) 5TGGGCTGGATTTTTGCTTTTG (SEQ ID NO: 1), R (reverse) 5'CCTTGGATGGGTGTTGTGGAC (SEQ ID NO:2) (annealing temperature 55°C, DNA product size 529 bp); Aromatase FS'CAAGTGGCTGAGGCAT (SEQ ID NO:3), R5OAGAATAGTCGGTGAA (SEQ ID NO:4) (55°C, 429 bp); OCT-4 (Abdel-Rahman et al., 1995); Stellar, Vasa, Nanog (Ezeh et al., 2005); LIFR (Abir R, et al., 2004). The β-actin PCR product was used as an internal control (Rapid Scan). The amplified products were separated on 1% or 2% agarose gels. RT-PCR products were analyzed by DNA sequencing (ABI, PE Applied Biosystems, USA).

Immunohistochemistry and immunohistofluorescence [0119] For histological examination, GC pellets were fixed overnight in 1% paraformaldehyde at 4°C, paraffin-embedded and sectioned (7 mm thick sections). Sections were stained with haematoxylin/eosin (H&E) and observed microscopically. Immunohistochemistry or immunohistofluorescence were performed using antibodies against human FSHR (Santa-Cruz Biotechnology), human LHR (Santa-Cruz Biotechnology), human Coll rV (DAKO, Denmark A/S), 3b-HSD (Santa-Cruz Biotechnology) and Ki-67 (Abeam), following the instructions provided by each manufacturer. Secondary antibodies against FSHR were donkey anti-goat FITC (Santa-Cruz Biotechnology) or rabbit anti-goat biotin- conjugated (DAKO, Denmark A/S) antibodies. LHR was detected with anti-rabbit mouse PE (Santa-Cruz Biotechnology) secondary antibodies, and for Coll IV goat anti-mouse biotin- conjugated (DAKO, Denmark A/S) secondary antibodies were used. Staining for immunohistochemistry was followed by incubation with an ABC-alkaline phosphatase complex kit (Dako, Glostrup, Denmark), counterstaining with hematoxylin and mounting. Some sections were also stained with Alcian Blue to identify Call-Exner-like bodies (Van Wezel et al, 1999).

Measurements of estradiol and progesterone

[0120] Secretion of estradiol and progesterone into the culture supernatant by GC was measured using Elecsys Estradiol II and Progesterone II assays (Roche Diagnostics) following the procedure provided by the manufacturer. The experiment was repeated four times.

In vivo implantation in irnmuno-deficient mice

[0121] GC were cultured in vitro for three weeks under the 3D conditions described above. The pellets were then transplanted unilaterally into the right ovary of eight NCr nude mice (Taconic, USA) in accordance with institutional guidelines. The cells were transplanted under the bursa within the capsule of the mouse ovary. GC transplantation was always performed in the right ovary, the left ovary remained unoperated. Four to five weeks after implantation, the mice were sacrificed, and the constructs harvested. To distinguish human (donor) from murine (recipient) cells, immunohistofluorescence was carried out with anti-human monoclonal HLA-ABC-biotin-conjugated antibodies (Cedarlane Laboratories Ltd), with avidin-FITC secondary antibodies (Becton Dickinson).

[0122] Additionally, chromogenic in situ hybridization (CISH, Zytovision kit) for the detection of human AIu sequences was performed (Roy-Engel et al., 2001).

[0123] Alternatively, 3 -week pellets were implanted subcutaneously ectopically into the back of nude mice (CD-I nu/nu, 1 -month old; Charles River Laboratories, Wilmington, MA, http://www.criver.com) in accordance with institutional guidelines. Four and eight weeks after implantation, the mice were sacrificed, and the constructs harvested and analyzed as described. B. Results

[0124] As shown and discussed herein, GC were organised progressively into spherical follicle-like structures exhibiting steroidogenic capacity, as demonstrated by the presence of both P450 aromatase and 3b-hydroxysteroid dehydrogenase as well as steroid production. After transplantation into the ovaries of immuno-deficient mice, the GC became concentrated within follicles and the prolonged expression of FSHR was confirmed. The present invention therefore presents optimization of culture conditions that create an environment closely mimicking the ovary in vivo.

Culture of GC in monolayers, and clonally expanded population of GC [0125] When selected from a large cohort of GC based on FSHR expression, and cultured as a single cell in a single well, GC were able to undergo clonogenic growth resulting in multicellular colonies (FIG.8A) staining for alkaline phosphatase (AP) (FIG.8B). When GC were cultured as monolayers (2D), cells adhered and adopted a fibroblast-like shape (FIG.8C) while losing the critical characteristics of GC. In particular, expression of FSHR became undetectable after 17 days of 2D culture (FIG.8D).

Three-dimensional culture of GC

[0126] When GC were cultured as 3D pellets, they maintained their round-spherical shape with clumping of cells (FIG.8E), and FSHR continued to be expressed (FIG.8D). Cytochrome P450 aromatase was expressed in both culture systems (FIG.8D). The presence of FSHR in GC in 3D culture was also demonstrated at the protein level after 21 days, as visualized by immunocytochemistry using an anti-FSHR polyclonal antibody (FIGS.9 and 10). In the 3D pellets, patches of GC were stained with FSHR, suggestive of the spatial organization of GC relative to the basal membrane in ovarian preantral follicles (FIG.9G). To further substantiate this, the organised structures were stained with antibodies against Coll IV, a marker typical of the basal membrane in ovarian follicles (Timpl and Dziadek, 1986; Rodgers et al, 1999). Expression and organization of FSHR-expressing cells and type IV collagen in 3D pellets were analyzed by immunocytochemistry (FIG.9). After two days of culture, Coll IV was expressed by GC distributed randomly throughout the pellet. At day 7, spherical structures composed of several GC were observed. At day 21, organised GC structures expressing FSHR and containing laminar structures with coll IV were visible, some of which were large (several hundreds of micrometers), suggestive of the organization of a genuine ovarian follicle (Irving-Rodgers HF and Rodgers RJ, 2005). Coll IV was expressed more in the outer layers of the organised structures, whereas staining for FSHR-positive GC, was visible mostly in the inner part of the structures (FIGS.9G and 9H). The number of GC patches in the 3D pellets increased significantly with time (FIGS.1OA, 1OB, and 10C).

Expression of LH receptor

[0127] Using immunocytofluorescence, the presence of LHR in patches of GC growing in 3D was also demonstrated (FIG.10). The expression of LHR required concomitant expression of FSHR. Two distinct staining patterns of LHR and FSHR were encountered. The first comprised cells negative for LHR but positive for FSHR (FIGS.10D, 1OE, and 10F); the second was positive for both LHR and FSHR (FIGS.10G,10H, and 101).

[0128] It was not possible to quantify precisely the proportion of cells with FSHR alone and those with both receptors within the 3D-pellets because the patches differed in size and it was not possible to distinguish single cells inside the patches with a sufficient degree of accuracy. All negative controls, performed without first antibodies, presented minimal background staining (data not shown).

Proliferative status of GC in 3D culture

[0129] Observing 3D pellets at higher magnification revealed spherical clumps of GC surrounding a central cavity, resembling a rosette-like structure, within the patches stained for FSHR (FIGS.1 IA-E). The connective tissue surrounding these rosettes contained Coll IV, whereas their central cavity was stained by Alcian Blue, i.e. a staining pattern typical of the Call-Exner bodies that are also present in ovarian follicles (Van Wezel et al., 1999). The proliferation status of the cells, another marker of GC functionality (Bullwinkel et al., 2006), was verified with Ki-67 staining (FIG.1 IE). Around half of the cells in the follicle-like structures were positive for Ki-67. A few cells staining for Ki-67 were also found outside the patches of cells staining for FSHR, but most were found in close vicinity.

Endocrine function of GC in 3D pellets

[0130] The endocrine function of GC cultured in 3D, as characterized by their steroidogenic capacity, was also verified. Concentrations of progesterone and estradiol in the medium supernatant were measured at various time intervals during culture of GC with or without type I collagen (FIGS.12A and 12B) in four independent experiments. Significantly lower concentrations of progesterone were measured in the medium supernatant of GC cultured in 3D together with type I collagen (pO.Ol), whereas estradiol concentrations were similar. In addition to aromatase - a characteristic GC function - the presence of another steroidogenic enzyme, namely 3b-hydroxysteroid dehydrogenase (3b-HSD), was tested by immunohistochemistry (FIG.12C). Most cells staining positively for 3b-HSD were found inside the patches of cells staining for FSHR.

Nursing function and in vivo functional validation of GC

[0131] To further examine their functionality, 3D pellets with human GC were transplanted into the ovaries of eight immuno-deficient mice. Four mice were sacrificed 4 weeks after transplantation, whereas another four mice were sacrificed after 8 weeks. In each animal the contralateral non-operated ovary was used as a control. To evaluate possible differences between operated and non-operated ovaries, H&E staining of whole ovaries was performed (FIGS.13A and 13B). The presence of human cells within ovarian tissue was then established using two specific stainings: CISH for AIu sequences (FIG.13C) and immunohistofluorescence for HLA-ABC (FIG.13D). Both methods confirmed the presence of cells of human origin almost exclusively within the boundaries of mouse antral follicles.

[0132] To demonstrate maintenance of the human GC phenotype after in vivo transplantation, cultured pellets were implanted (ectopically) into the backs of nude mice. At 4 and 8 weeks after implantation, FSHR was still found to be present within the explanted tissue (FIGS.13E and 13F), as observed by both immunohistochemistry and immunohistofluorescence.

Follicle growth

[0133] Additional proof of the utility of the 3D system and of its relevance arose from its ability to promote the development of preantral follicles (FIGS.14A and 14B). Previous anecdotal observational studies have demonstrated that follicular aspirates of infertile patients treated with IVF or ICSI may contain primordial follicles, which are usually not identified during routine workup of the aspirates for oocyte collection (Heng et al., 2005). By chance, three preantral ovarian follicles with multiple layers of GC, each with an enclosed oocyte, were detected in the 3D pellets after approximately 14 days of culture (FIG.14C).

Spreading from the ovary [0134] After transplantation into the immuno-deficient mice, human cells were also found in the mice oviduct and uterus (FIG.15), as indicated by AIu-CISH.

C. Discussion

3D culture of GC

[0135] Within a few days in culture, rat, ovine and human GC plated on culture dishes invariably undergo spontaneous luteinization followed by apoptosis within a few days (Aharoni et al, 1997; Hwang et al, 2000; Huet et al., 2001). As shown and discussed in Example 1 herein, from GC collected from infertile women treated with assisted reproduction, a subpopulation containing multipotent stem cells can be identified, which can be cultured over prolonged time periods in vitro in the presence of LIF; however, these GC progressively lose all their major characteristics, such as P450 aromatase and FSHR (Kossowska-Tomaszczuk et al., 2009). In this Example, proof of the existence of such stem- like cells was reinforced by the demonstration of clonally expanded GC giving rise to 3D colonies staining positively for AP in the presence of LIF. Given the beneficial role of 3D culture in the endocrine properties of cells (Berkholtz et al., 2006; Carnegie et al., 1988; Gomes et al., 1999; Aten et al., 1995; Vigo et al., 2005), the culture system was improved by incubating GC in 3D instead of in monolayers. Initially, GC were cultured in 3D without type

1 collagen. However, under those conditions the pellets progressively disaggregated within 1-

2 weeks. Therefore, type I collagen, a normal constituent of ovarian tissue, was added as a sealant to support the stability of the pellet, and GC cultured as monolayers in the absence of type I collagen were used as controls. Moreover, in a 3D culture system with intact murine follicles, type I collagen promoted an increase in size of two-layered follicles but had no effect on multilayered follicles (Berkholtz et al., 2006). The functionality of these 3D- cultured GC was then studied.

Maintenance of GC phenotvpe and organization in 3D culture

[0136] The 3D culture of GC not only extended cellular survival in vitro but also allowed maintenance of many morphological and functional characteristics. Specifically, 3D-cultured GC retained key features such as FSHR, LHR and P450 aromatase, which otherwise disappeared progressively during monolayer culture. During follicular development in vivo, FSHR density rises progressively until a few days before ovulation, whereas LHR is expressed only towards the final stages of follicular development. Therefore, expression of LHR is thought of as a hallmark of the later stages of GC differentiation (O'Shaughnessy et al., 1997). The presence of LHR in a subset of GC cultured in 3D, but not in 2D₅ at both the mRNA level and the protein level was demonstrated, evidencing that the 3D model allows a higher degree of maturation of GC compared to previously described models.

[0137] Moreover, inside the pellet, GC were organised into a 3D epithelial structure made of FSHR-expressing GC lying on a basal membrane containing Coll IV. The demonstration of both FSHR and Coll IV in GC cultured in 3D over a period of 3 weeks was highly reproducible and suggests that this culture system mimics physiological ovarian follicular development. This is in accordance with the observation that, in preantral follicles, Coll IV is localized specifically in the basal membrane (Amsterdam et al., 1975), whereas in preovulatory follicles Coll IV is also detected in more central layers of the granulosa (Yamada et al., 1999). The basal membrane influences GC proliferation and differentiation (Andersen et al., 1976; Amsterdam et al., 1989; Van Wezel et al., 1998a; Richardson et al., 1992; Luck MR, 1994), and present observations confirm previous results (Irving-Rodgers HF and Rodgers RJ, 2006) demonstrating that Coll IV, a major component of the basal membrane and of the ECM, is produced by GC themselves. Others have made similar observations when culturing whole ovarian follicles in vitro (Berkholtz et al., 2006; Amsterdam et al., 1989; Ben-Ze'ev A and Amsterdam A, 1986; Ben-Rafael et al., 1988; Mauchamp et al., 1998; Richardson et al., 2000).

Proliferation capacity of GC in 3D culture

[0138] In many species, including humans, the granulosa of ovarian preantral and antral follicles contains Call-Exner bodies. These consist of round globular sets of GC (so-called rosettes), containing chains of Coll IV (Rodgers et al., 1998), surrounding a small cavity with a fluid reminiscent of follicular fluid. Call-Exner bodies are found only in healthy follicles (Van Wezel et al., 1999; Rodgers et al., 1999) and their presence seems to correlate with GC proliferation and differentiation (Assoian R.K., 1997; Correia et al., 1998; Lee et al., 1996). Call-Exner bodies can be demonstrated in follicular sections either with Alcian Blue staining or with specific antibodies against Coll IV (Van Wezel et al., 1999). Using both methods, structures similar to Call-Exner bodies were observed within patches of GC cultured in 3D. The presence of Call-Exner bodies in ovarian follicles has been used as an index of GC proliferation (Gomes et al., 1999; Miller et al., 1997). Using Ki-67 (Bullwinkel et al., 2006; Schonk et al., 1989), the occurrence of proliferation in 3D-cultured GC was demonstrated. Interestingly, during prolonged culture, most proliferating cells progressively became organised in structures reminiscent of ovarian follicles with cells staining for FSHR and LHR and surrounded by Coll IV (Rodgers et al., 1999; Gomes et al., 1999; Vigo et al., 2005; Rodgers et al., 2001).

Generation of preantral-like follicles

[0139] Present observations of follicle-like structures derived from in vitro proliferating GC are consistent with previous studies on the oligoclonal origin of GC. An in vivo study by van Deerlin and colleagues (Van Deerlin et al., 1997) suggested that the cohort of GC in a human preovulatory follicle is derived from a small number (three) of precursor cells, and that the follicles are constructed by the radial proliferation of GC clones across the follicle wall (Boland NI and Gosden RG, 1994). The oligoclonal interpretation is consistent with the results of an in vivo study on the clonality of murine GC in the ovary, where the population of precursor cells ultimately giving rise to the GC complement of a given follicle was determined to be oligoclonal (from only five ancestral cells) (Boland NI and Gosden RG, 1994; Telfer et al., 1988).

[0140] The in vitro generated follicle-like structures are at the preantral stage of folliculogenesis. The preantral to antral follicle transition is a striking and important step in ovarian follicle development, and antrum formation physically divides the former preantral GC into mural and cumulus GC populations. However, recent studies confirmed that oocyte- derived factors and cumulus-oocyte complex development are crucial to promote the ability of the follicle to undergo expansion, differentiation of preantral GC into cumulus cells and to promote antrum formation (Diaz et al., 2007).

Functionality of GC in 3D culture - Endocrine function

[0141] Steroidogenesis was evaluated as another important feature of GC. In all experiments, both recombinant FSH and LH were supplemented to the culture medium in order to maintain and stimulate steroidogenesis. Through the presence of cytochrome P450 aromatase, intact GC are able to produce significant amounts of estradiol (Okamura et al., 2003; Rodgers et al., 2001). The concentrations of estradiol were similar in the medium supernatant of GC cultured in 3D in the presence of type I collagen as compared to GC cultured as pellets without type I collagen (FIG.12). In contrast, the concentration of progesterone was significantly lower in the supernatant of GC cultured in 3D together with type I collagen as compared to GC cultured in pellets without type I collagen (p<0.01), suggesting that spontaneous luteinization is less pronounced in the presence of type I collagen. In addition to the secretion of progesterone and estradiol, and P450 aromatase expression, the presence of 3b-HSD, a key enzyme in steroidogenesis involved primarily in the synthesis of progesterone, was also observed in 3D-grown GC (Frindik J.P., 2008; Fanjul et al., 1984); and only functional GC are able to express this enzyme (Wang et al., 1995; Richards J.S., 1994).

Functionality of GC in 3D culture - Oocyte nursing function

[0142] In order to further establish the robustness of functionality of GC after prolonged 3D culture, human GC could have been cultured with human oocytes to assess their nursing capacities. However, human primordial follicles were not available for experimental purposes. A more indirect approach was thus used, with 3D-cultured GC transplanted orthotopically into the ovaries of immuno-deficient mice. Human GC were found to be located predominantly within the boundaries of mouse follicles and, to a much lesser extent, between individual mouse follicles (Hatano et al., 1999). The human cells were grouped in patches suggestive of localized proliferation. Transplanted cells migrated towards the centre of follicles and were found in the close vicinity of mouse oocytes, where they retained the typical epithelial morphology of GC surrounding an oocyte. As no specific anti-human FSHR-antibody was available to differentiate human from mouse FSHR, pellets with 3D- cultured GC were also transplanted ectopically into the back of immuno-deficient mice. With this approach the continued expression of FSHR by GC up to 8 weeks after their transplantation into this environment was further demonstrated.

[0143] Human cells were also found in the mice oviduct and uterus. The presence of those cells suggested that, after ovulation, GC may nest outside the ovary. This may not cause any problem; however, it could be an underlying cause of different pathologies like ovarian cancer or endometriosis (Okamura et al., 2003).

Follicle growth in the 3D system

[0144] Follicular aspirates are potentially an abundant source of immature ovarian follicles (Wu et al., 1998). Attempts to culture primordial follicles in vitro to increase the yield of viable mature oocytes for fertility treatments have not yet met with success (Heng et al., 2005). In the present invention, three preantral ovarian follicles with multiple layers of GC and one metaphase I oocyte were detected by chance in the 3D pellets, further validating the high potential of the 3D culture model presented here to support the growth of ovarian follicles in general.

[0145] hi female mammals, the normal and physiological production of good quality gametes relies upon the highly controlled growth and differentiation of the surrounding ovarian follicle. GC proliferation is maintained throughout folliculogenesis, providing not only a specialized micro-environment but also nutrients for oocytes growth. For decades, the inability to culture these GC over prolonged time periods has been a major factor contributing to the current lack of knowledge about their functionality. In vitro maturation (IVM) and in vitro fertilization (IVF) of oocytes is now an intriguing challenge in human and veterinary reproductive biotechnology. Improved culture conditions, which promote germ cell survival, meiosis, differentiation, and proliferation, are essential for in vitro oogenesis and spermatogenesis, and the artificial generation of gametes would be the ultimate solution in infertility treatment (Parks et al., 2003; Gilchrist RB and Thompson JG, 2006; Daley GQ, 2007; Nagy et al., 2008; Picton et al., 2008). The discovery of GC multipotency and the use of granulosa stem cells in the novel 3D in vitro culture system presented represents a promising technical tool for IVM but also for drug targeting purposes, as it provides an environment in which GC preserve their functional properties.

[0146] The reorganization of 3D-cultured granulosa stem cells into follicles in vivo might also suggest the possibility of treatment of infertility by transplantation of 3D-expanded GC, which might support the growth of healthy follicles in vivo. Such GC transplantation into the ovary could also restore proper ovarian endocrine function in women suffering from premature ovarian failure or in women with malignant diseases that can be treated only with chemotherapy leading to premature menopause.

[0147] Once given the above disclosure, many other features, modifications, and improvements will become apparent to the skilled artisan. Such features, modifications, and improvements are therefore considered to be part of this invention, without limitation imposed by the example embodiments described herein. Moreover, any word, term, phrase, feature, example, embodiment, or part or combination thereof, as used to describe or exemplify embodiments herein, unless unequivocally set forth as expressly uniquely defined or otherwise unequivocally set forth as limiting, is not intended to impart a narrowing scope to the invention in contravention of the ordinary meaning of the claim terms by which the scope of the patent property rights shall otherwise be determined. All references discussed and disclosed herein are hereby incorporated by reference in their entirety.

References

Abdel-Rahman B, Fiddler M, Rappolee D et al. Expression of transcription regulating genes in human preimplantation embryos. Hum. Reprod. 1995; 10:2787-2792.

Abir R, et al (2001) Morphological study of fully and partially isolated early human follicles. Fertil. Steril. 75:141-146.

Abir R₅ et al. (2004) Immunocytochemical detection and RT-PCR expression of leukaemia inhibitory factor and its receptor in human fetal and adult ovaries. MoI. Hum. Reprod. 10:313-319.

Aharoni D, Meiri I, Atzmon R, Vlodavsky I, Amsterdam A (1997) Differential effect of components of the extracellular matrix on differentiation and apoptosis. Curr. Biol. 7:43-51.

Amsterdam A, Koch Y, Lieberman ME, Lindner HR (1975) Distribution of binding sites for human chorionic gonadotropin in the preovulatory follicle of the rat. J Cell Biol. 67:894- 900.

Amsterdam A, Rotmensch S, Furman A, Venter EA, Vlodavsky I (1989) Synergistic effect of human chronic gonadotrophin and extracellular matrix on in vitro differentiation of human granulosa cells: progesterone production and gap junction formation. Endocrinology 124:1956-1964.

Amsterdam A, Rotmensch S. Structure-function relationship during granulosa cell differentiation. Endocr. Rev. 1987,8:309-337.

Andersen MM, Kroll J, Byskov AG, Faber M (1976) Protein composition in the fluid of individual bovine follicles. J. Reprod. Fertil. 48:109-118.

Arici A, Engin O, Attar E et al. Modulation of leukaemia inhibitory factor gene expression and protein biosynthesis in human endometrium. J CHn. Endocrinol. Metab. 1995;80:1908- 1915.

Arici A, Oral E, Bahtiyar O et al. Leukaemia inhibitory factor expression in human follicular fluid and ovarian cells. Hum. Reprod. 1997;12:1233-1239.

Assoian RK (1997) Anchorage-dependent cell cycle progression. J Cell Biol. 136:1-4.

Aten RF, Kolodecik TR, Behrman HR (1995) A cell adhesion receptor antiserum abolishes, whereas laminin and fibronectin glycoprotein components of extracellular matrix promote, luteinization of cultured rat granulosa cells. Endocrinology 136:1753-1758.

Bachvariva R, Baran MM, Tejblum A. Development of naked growing mouse oocytes in vitro. J. Exp. Zool. 1980; 211: 159-169.

Barbero A, Ploegert S, Heberer M et al. Plasticity of clonal populations of dedifferentiated adult human articular chondrocytes. Arthritis. Rheum. 2003; 48:1315-1325.

Bauer S, Patterson PH. Leukaemia inhibitory factor promotes neural stem cell self-renewal in the adult brain. J. Neurosci. 2006;26:12089-12099. Ben-Rafael Z₅ et al. (1988) Collagen matrix influences the morphologic features and steroid secretion ofhuman granulosa cells. Am. J. Obstet. Gynecol. 159:1570-1574.

Ben-Ze'ev A, Amsterdam A (1986) Regulation of cytoskeletal proteins involved in cell contact formation during differentiation of granulosa cells on extracellular matrix. Proc. Natl. Acad. Sci. USA 83:2894-2898.

Berkholtz CB₅ Shea LD₅ Woodruff TK (2006) Extracellular matrix function in follicle maturation. Semin. Reprod. Med. 24:262-269.

Boland NI₅ Gosden RG (1994) Clonal analysis of chimaeric mouse ovaries using DNA in situ hybridization. J. Reprod. Fertil. 100:203-210.

Bonaventure J, Kadhom N₅ Cohen-Solal L et al. Reexpression of cartilage-specific genes by dedifferentiated human articular chondrocytes cultured in alginate beads. Exp. Cell. Res. 1994,212:97-104.

Buccione R₅ Schroeder AC₅ Eppig JJ (1990) Interactions between somatic cells and germ cells throughout mammalian oogenesis. Biol. Reprod. 43: 543-547.

Bukovsky A., Svetlikova M., Caudle M. Oogenesis in cultures derived from adult human ovaries. Reprod. Biol. Endocrinol. 2005; 3:17-30.

Bullwinkel J, et al. (2006) Ki-67 protein is associated with ribosomal RNA transcription in quiescent and proliferating cells. J Cell. Physiol. 206:624-35.

Carnegie JA₅ Byard R₅ Dardick I₅ Tsang BK (1988) Culture of granulosa cells in collagen gels: the influence of cell shape of steroidogenesis. Biol. Reprod. 38:881-890.

Cecconi S, Rossi G (2001) Mouse antral oocytes regulate preantral granulosa cell ability to stimulate oocyte growth in vitro. Dev. Biol. 233: 186-191

Charming CP₅ Hillensjo T₅ Schaerf FE (1978) Hormonal control of oocyte meiosis, ovulation and luteinization in mammals. Clin. Endocrinol. Metab. 7:601-624.

Charming CP₅ Ledwitz-Rigby F (1975) Methods for assessing hormone-mediated differentiation of ovarian cells in culture and in short-term incubations. Methods Enzymol. 39:1833-230.

Correia SC₅ Gomes JE₅ Almeida E₅ Cidada AC₅ Plancha CE (1998) Use of proliferation/apoptosis ratio in the granulosa cell compartment to evaluate ovarian follicle culture conditions. Hum. Reprod. 13:148-149.

Cortvrindt R, Smitz J₅ Van Steirteghem AC (1996) In-vitro maturation, fertilization and embryo development of immature oocytes from early preantral follicles from prepuberal mice in a simplified culture system. Hum. Reprod. 11:2656-2666.

Coskun S, Uzumcu M, Jaroudi K al. Presence of leukaemia inhibitory factor and interleukin- 12 in human follicular fluid during follicular growth. Am. J. Reprod. Immunol. 1998;40:13- 18. Dalieron L, Opitz SL, Zaehres H et al. LIF/STAT3 signaling fails to maintain self-renewal of human embryonic stem cells. Stem Cells 2004; 22:770-778.

Daley GQ (2007) Gametes from embryonic stem cells: a cup half empty or half full? Science 316:409-10.

De Neubourg D, Robins A, Fishel S et al. Quantification of insulin-like growth factor I receptors on granulosa cells with flow cytometry after follicular stimulation. Hum. Reprod. 1998; 13:161-164.

Dias JA (2002) Molecular, structural and cellular biology of follitropin and follitropin receptor. Vitam. Horm. βA-.lA^'ill.

Diaz FJ, Wigglesworth K, Eppig JJ (2007) Oocytes are required for the preantral granulosa cell to cumulus cell transition in mice. Dev. Biol. 305:300-311.

Dozier JH, Hiser L, Davis JA et al. B class II tubulin predominates in normal and tumor breast tissues. Breast Cancer Res. 2003; 5:157-169.

Drummond AE (2006) The role of steroids in follicular growth. Reprod. Biol. Endocrinol. 4:16-27.

Ezeh UI, Turek PJ, Reijo RA, Clark AT (2005) Human embryonic stem cell genes OCT4, NANOG, STELLAR, and GDF3 are expressed in both seminoma and breast carcinoma. Cancer 104:2255-2265.

Fanjul LF, Ruiz de Galarreta CM, Hsueh AJ (1984) Estrogen regulation of progestin biosynthetic enzymes in cultured rat granulosa cells. Biol. Reprod. 30:903-912.

Folkman J, Moscona A. Role of cell shape in growth control. Nature 1978; 273:345-349

Frank O, Heim M, Jakob M et al. Real time quantitative RT-PCR analysis of human bone marrow stromal cells during osteogenic differentiation in vitro. J. Cell. Biochem. 2002; 85:737-746

Frindik JP (2008) 3-Beta-Hydroxysteroid Dehydrogenase deficiency. E-medicine http://emedicine.medscape.com/article/920621-overview Updated: Sep 18, 2008.

Gilchrist RB, Thompson JG (2006) Oocyte maturation: emerging concepts and technologies to improve developmental potential in vitro. Theriogenology 67:6-15.

Gomes JE, Correia SC, Gouveia-Oliveria A, Citadao AJ, Plancha CE (1999) Three dimensional environments preserve extracellular matrix compartments of ovarian follicles and increase FSHdependent growth. MoI. Reprod. Dev. 54:163-172.

Goudet G, Belin F, Bezard J et al. Intrafollicular content of luteinizing hormone receptor alpha-mhibin and aromatase in relation to follicular growth, estrous cycle stage, and oocyte competence for in vitro maturation in the mare. Biol. Reprod. 1999; 60:1120-1127.

Gougeon A. Regulation of ovarian follicular development in primates: facts and hypotheses. Endocr. Rev. 1996; 17:121-155. GoughNM, Gearing DP₅ King JA et al. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukaemia-inhibitory factor. Proc. Natl. Acad. Sci. 1988; 85:2623-2627.

Gutierrez CG, Glazyrin AN₅ Robertson GW et al. Ultra-structural characteristics of bovine granulosa cells associated with maintenance of oestradiol production in vitro. MoI. Cell. Endocrinol. 1997; 134:51-58.

Hatano H, et al. (1999) Origin of bone-forming cells in human osteosarcomas transplanted into nude mice - which cells produce bone, human or mouse? J. Pathol. 185: 204-211.

Heng BC, Cao T, Bested SM₅ Tong GQ₅ NG SC (2005) Waste follicular aspirate from fertility treatment - a potential source of human germline stem cells? Stem Cells Dev. 14:11- 14.

Hirshfield AN. Theca cells may be present at the outset of follicular growth. Biol. Reprod. 1991; 44:1157-1162.

Hochedlinger K₅ Jaenisch R. Nuclear reprogramming and pluripotency. Nature 2006; 441:1061-1067.

Honda, A., Hirose, M., Hara, K. et al. Isolation, characterization, and in vitro and in vivo differentiation of putative thecal stem cells. Proc. Natl. Acad. Sci. USA 2007; 104:12389- 12394.

Hosokawa K, Dantes A, Schere-Levy C et al. Induction of Ad4BP/SFl, steroidogenic acute regulatory protein, and cytochrome P450scc enzyme system expression in newly established human granulosa cell lines. Endocrinology 1998; 139:4679-4687.

Huet C, Pisselet C, Mandon-Pepin B₅ Monget P, Monniaux D (2001) Extracellular matrix regulates ovine granulosa cell survival, proliferation and steroidogenesis: relationships between cell shape and function. J. Endocrinol. 169:347-360.

Hwang DH, et al. (2000) Role of reconstituted basement membrane in human granulosa cell culture. J Endocrinol. 47:177-183.

Hynes RO (1992). Integrins: versatility, modulation, and signalling in cell adhesion. Cell 69:11-25.

Irving-Rodgers H₅ Rodgers R (2005) Extracellular matrix in ovarian follicular development and disease. Cell Tissue Res. 322:89-98.

Irving-Rodgers HF, Rodgers RJ (2006) Extracellular matrix of the developing ovarian follicle. Semin. Reprod. Med. 24:195-203.

Jenkins E, Moss JB₅ Pace JM et al. The new collagen gene COL27A1 contains SOX9- responsive enhancer elements. Matrix Biol. 2005,24(3): 177-184

Jiang Y, Vaessen B, Lenvik T et al. Multipotent progenitor cells can be isolated from postnatal murine bone marrow, muscle, and brain. Exp. Hematol. 2002;30:896-904. Johnson J, Canning J, Kaneko T et al. Germline stem cells and follicular renewal in the postnatal mammalian ovary. Nature 2004;428:145-150.

Kalabis J, Patterson MJ, Enders GH et al. Stimulation of human colonic epithelial cells by leukaemia inhibitory factor is dependent on collagen-embedded fibroblasts in organotypic culture. FASEB J. 2003;17:l 115-1117.

Kossowska-Tomaszczuk K, et al. (2009) The multipotency of luteinizing granulosa cells collected from mature ovarian follicle. Stem Cells 27:210-219.

Kreeger PK₅ Woodruff TK, Shea LD. Murine granulosa cell morphology and function are regulated by a synthetic Arg-Gly-Asp matrix. MoI. Cell Endocrinol. 2003; 205: 1-10.

Lavranos TC, O'Leary PC, Roders RJ. Effect of insulin-like growth factors and binding protein- 1 on bovine granulosa cell division in anchorage-independent culture. J. Reprod. Fertil 1996; 106:221-228.

Le Bellego F, Pisselet C, Huet C et al. Laminin-alpha6betal integrin interaction enhances survival and proliferation and modulates steroidogenesis of ovine granulosa cells. J. Endocrinol. 2002 Jan;172(l):45-59.

Lee VH, Britt JH, Dunbar BS (1996) Localization of laminin proteins during early follicular development in pig and rabbit ovaries. J. Reprod. Fertil. 108:115-122.

Lie BL, Leung E, Leung PCK et al. Long term growth and steroidogenic potential of human granulosa-lutein cells immortalized with SV40 large T antigen. MoI. Cell. Endocrinol. 1996; 120:169-176.

Lind AK, Weijdegard B, Dahm-Kahler P et al. Collagens in the human ovary and their changes in the perifollicular stroma during ovulation. Acta Obstet. Gynecol. Scand. 2006;85(12): 1476-84

Luck MR (1990) Cholinergic stimulation, through muscarinic receptors, of oxytocin and progesterone secretion from bovine granulosa cells undergoing spontaneous luteinization in serum-free culture. Endocrinology 126:1256-1263.

Luck MR (1994) The gonadal extracellular matrix. Oxford Rev. Reprod. Biol. 16:33-85

Mauchamp J, Mirrione A, Alquier C, Andre F (1998) Follicle-like structure and polarized monolayer: role of the extracellular matrix on thyroid cell organization in primary culture. Biol. Cell 90:369-380.

McArthur ME, Irving-Rodgers HF, Byers S et al. Identification and immunolocalization of decorin, versican, perlecan, nidogen, and chondroitin sulfate proteoglycans in bovine small- antral ovarian follicles. Biol. Reprod. 2000; 63:913-924.

Meduri G, Charnaux N, Driancourt MA et al. Follicle-stimulating hormone receptors in oocytes? J Clin. Endocrinol. Metab. 2002; 87:2266-2276.

Miller BE, et al. (1997) Prognostic factors in adult granulosa cell tumor of the ovary. Cancer 79:1951-1955. Nagy ZP, Kerkis I, Chang CC (2008) Development of artificial gametes. Reprod. Biomed. Online 16:539-44.

Nakano K, Naito I, Momota R et al. The distribution of type IV collagen alpha chains in the mouse ovary and its correlation with follicular development. Arch. Histol. Cytol 2007; 70:243-53.

Nilsson EE, Kezele P, Skinner MK. Leukaemia inhibitory factor (LIF) promotes the primordial to primary follicle transition in rat ovaries. MoI. Cell. Endocrinol. 2002; 25;188:65-73.

Nishi Y, Yanase T, Mu Y et al. Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN that expresses functional follicle - stimulating hormone receptor. Endocrinology 2001; 142:437-445.

Niswender GD, Juengel JL, Silva PJ et al. Mechanisms controlling the function and the life span of the corpus luteum. Pysiol. Rev. 2000; 80:1-24.

O'Shaughnessy PJ, Dudley K, Rajapaksha WR. Expression of follicle stimulating hormone- receptor mRNA during gonadal development. MoI. Cell Endocrinol. 1996; 125:169-75.

O'Shea JD. Heterogeneous cell types in the corpus luteum of sheep, goats and cattle. J. Reprod. Fertil. Dev. 1987;8:71-85.

Ohtake H, M.D., Katabuchi H, M.D., Matsuura K, M.D., and Okamura H, M.D. A novel in vitro experimental model for ovarian endometriosis: the threedimensional culture of human ovarian surface epithelial cells in collagen gels Fertility and Sterility: Vol. 71, NO. 1, January 1999

Okamura H, Katabuchi H, Ohba T (2003) What we have learned from isolated cells from human ovary? MoI. Cell. Endocrinol. 202:37-45.

O'Shaughnessy A, Muneyyirci-Delale O, Nacharaju VL, Baker A, Benfer K (1997) 11 beta- Hydroxysteroid dehydrogenase enzyme activity in granulosa cells derived from ovarian follicles of in vitro fertilization patients. Early Pregnancy 3:183-9.

Ozcakir HT, Levi R, Tavmergen E, et al. Premature luteinization defined as progesterone estradiol ratio >1 on hCG administration day seems to adversely affect clinical outcome in long gonadotropin-releasing hormone agonist cycles. J. Obstet. Gynaecol. Res. 2004;30:100- 104

Pan GJ, Chang ZY, Schδler HR et al. Stem cell pluripotency and transcription factor OCT4. Cell Res. 2002;12:321-329.

Parks JE, Lee DR, Huang S, Kaproth MT (2003) Prospects for spermatogenesis in vitro. Theriogenology 59:73-86.

Picton HM, Harris SE, Muruvi W, Chambers EL (2008) The in vitro growth and maturation of follicles. Reproduction 136:703-715. Pochampally RR, Smith JR, Ylostalo J et al. Serum deprivation of human marrow stromal cells (hMSCs) selects for a subpopulation of early progenitor cells with enhanced expression of OCT-4 and other embryonic genes. Blood 2004; 103:1647-1652.

Portmann-Lanz CB, Schoeberlein A, Huber A et al. Placental mesenchymal stem cells as potential autologous graft for pre- and perinatal neuroregeneration. Am. J. Obstet. Gynecol. 2006; 194:664-673.

Richards JS (1994) Hormonal control of gene expression in the ovary. Endocr. Rev. 15:725- 751.

Richardson MC, et al. (1992) Cultured human granulosa cells as a model for corpus luteum function: relative roles of gonadotrophin and low density lipoprotein studied under defined culture conditions. Hum. Reprod. 7:12-18.

Richardson MC, Slack C, Stewart IJ (2000) Rearrangement of extracellular matrix during cluster formation by human luteinising granulosa cells in culture. J. Anat. 196:243-248.

Rodgers HF, et al. (1998) Distribution of the alfal to alfa6 chains of type IV collagen in bovine follicles. Biol. Reprod. 59:1334-1341.

Rodgers RF, Lavranos TC, Vella CA et al. Basal lamina and other extracellular matrix produced by bovine granulosa cells in anchorage-independent culture. Cell Tissue Res. 1995a; 282:463-471.

Rodgers RJ, Irving-Rodgers HF, van Wezel IL, Krupa M, Lavranson TC (2001) Dynamics of the membrana granulosa during expansion of the ovarian follicular antrum. MoI. Cell Endocrinol. 171:41-48.

Rodgers RJ, Lavranos TC, van Wezel IL, Irving-Rodgers HF (1999) Development of the ovarian follicular epithelium. MoI. Cell. Endocrinol. 151:171-179.

Rodgers RJ, Vella CA, Rodgers HF, et al. Production of extracellular matrix, fibronectin, and stereogenic enzymes and growth factors of bovine granulosa cells in anchorage-independent culture. Reprod. Fertil. Dev. 1996; 8:249-257.

Roy-Engel A et al. (2001) AIu insertion polymorphisms for the study of human genomic diversity. Genetics 159: 279-290.

Schonk DM, et al. (1989) Assignment of the gene(s) involved in the expression of the proliferation-related Ki-67 antigen to human chromosome 10. Hum. Genet. 83:297-9.

Scintu F, Reali C, Pillali R et al. Differentiation of human bone marrow stem cells into cell with a neural phenotype: diverse effects of two specific treatments. BMC Neurosci. 2006; 7:14-27.

Seifer DB, Charland C, Berlinsky D, Penzias AS, Haning Jr. RV, Naftolin F, Barker BE. (1993) Proliferative index of human luteinized granulosa cells varies as a function of ovarian reserve. Am. J. Obstet. Gynecol. 169: 1531-1535 Sites CK, Kessel B, LaBarera AR. Adhesion proteins increase cellular attachment, follicle- stimulating hormone receptors, and progesterone production in cultured porcine granulosa cells. Pr oc. Soc. Exp. Biol. Med. 1996; 212:78-83.

Slomczynska M, Duda M, SlezakK. The expression of androgen receptor, cytochrome P450, aromatase and FSH receptor niRNA in the porcine ovary. Folia Histochem Cytobiol 2001; 39: 9-13.

Stem Cell Information. The National Institutes of Health recourse of stem cell research. Available at http://stemcells.nih.gov/.

Tajima K, Hosokawa K, Yoshida Y et al. Establishment of FSH-responsive cell lines by transfection of pre-ovulatory human granulosa cells with mutated p53 (p53vall35) and Haras genes. MoI Hum. Reprod. 2002;8:48-57.

Telfer E, Ansell JD, Taylor H, Gosden RG (1988) The number of clonal precursors of the follicular epithelium in the mouse ovary. J. Reprod. Fertil. 84:105-110.

Themmen APN, Huhtaniemi IT (2000) Mutations of gonadotropins and gonadotropin receptors: elucidating the physiology and pathophysiology of pituitary-gonadal function. Endocr. Rev. 21:551-583.

Thomas FH, Ethier J-F, Shimasaki S, Vanderhyden BC (2005) Follicle-stimulating hormone regulates oocyte growth by modulation of expression of oocyte and granulosa cell factors. Endocrinology 146: 941-949.

Timpl R, Dziadek M (1986) Structure, development and molecular pathology of basement membranes. Int. Rev. Exp. Pathol. 29:1-12.

Van Deerlin PG, Cekleniak N, Coutifaris C, Boyd J, Strauss JF (1997) Evidence for the oligoclonal origin of the granulosa cell population of the mature human follicle. J. Clin. Endocrinol. Metab. 82:3019-3024.

Van Eijk MJ, Mandelbaum J, Salat-Baroux J et al. Expression of leukaemia inhibitory factor receptor subunits LIFR beta and gpl30 in human oocytes and preimplantation embryos. MoI. Hum. Reprod. 1996;2:355-360.

Van Wezel IL, Irving-Rodgers HF, Sado Y, Ninomiya Y, Rodgers RJ (1999) Ultrastructure and composition of Call-Exner bodies in bovine follicles. Cell Tissue Res. 296:385-394.

Van Wezel IL, Rodgers HF, Rodgers RJ (1998a) Differential localisation of laminin chains in the bovine follicle. J. Reprod. Fertil 112:267-278.

Vigo D, et al. (2005) Follicle like model by granulosa cell encapsulation in a barium alginateprotamine membrane. Tissue Eng. 11:709-714.

Wang LJ, Brannstrom M, Pascoe V, Norman RJ (1995) Cellular composition of primary cultures of human granulosa-lutein cells and the effect of cytokines on cell proliferation. Reprod. Fertil. Dev. 7:21 - 26.

Wang X, Otsu K₅ Saito H, Hiroi M₃ Ishikawa K (2000) Sandwich configuration of type I collagen suppresses progesterone production in primary cultured porcine granulosa cells by reducing gene expression of cytochrome P450 cholesterol side-chain cleavage enzyme. Arch. Biochem. Biophys. 376:117-123.

West ER, Shea LD, Woodruff TK (2007). Engineering the follicle microenvironment. Semin. Reprod. Med. 25:287-300.

Wu J, Zhang L, Liu P (1998) A new source of human oocytes: preliminary report on the identification and maturation of human preantral follicles from follicular aspirates. Hum. Reprod. 13:2561-2563.

Xu M, Kreeger PK, Shea LD, Woodruff TK. Tissue-engineered follicles produce live, fertile offspring. Tissue Eng. 2006; 12:2739-46.

Yamada S, et al. (1999) Human granulosa cells express integrin L2 and collagen IV: possible involvement of collagen type IV in granulosa cells luteinization. MoI. Hum. Reprod. 5:607- 617.

Young HE, Duplaa C, Katz R et al. Adult-derived stem cells and their potential for use in tissue repair and molecular medicine. J. Cell. MoI. Med. 2005;9:753-769.

Zhang H, Vollmer M, De Geyter M et al. Characterization of an immortalized human granulosa cell line (COV434). MoI. Hum. Reprod. 2000;6:146-153.

Zhao Y, Luck MR (1996) Bovine granulosa cells express extracellular matrix proteins and their regulators during luteinization in culture. Reprod. Fertil. Dev. 8:259-266.

Claims

What is claimed is:

1. A method for prolonged culturing of granulosa cells, comprising: a. collecting and isolating primary granulosa cells; and b. culturing said primary granulosa cells in vitro with a growth factor over a prolonged time period.

2. A method for prolonged culturing of granulosa cells according to claim 1 , wherein said primary granulosa cells are luteinizing granulosa cells.

3. A method for prolonged culturing of granulosa cells according to claim 1 , wherein said growth factor is a cytokine.

4. A method for prolonged culturing of granulosa cells according to claim 3, wherein said cytokine is leukaemia-inhibiting factor or a functional derivative thereof.

5. A method for prolonged culturing of granulosa cells according to claim 4, wherein said functional derivative of leukaemia-inhibiting factor is selected from the group consisting of growth-stimulating fragments, basic fibroblast growth factor, epidermal growth factor, insulin-like growth factor, and functional derivatives thereof.

6. A method for prolonged culturing of granulosa cells according to claim 4, wherein said leukaemia-inhibiting factor or functional derivative thereof is provided at a concentration selected from the group consisting of 10-10000 U/ml , 100-5000 U/ml, about 200 U/ml, about 300 U/ml, about 400 U/ml, about 500 U/ml, about 600 U/ml, about 700 U/ml, about 800 U/ml, about 900 U/ml, about 1000 U/ml, about 1100 U/ml, about 1200 U/ml, about 1300 U/ml, about 1400 U/ml, about 1500 U/ml, about 2000 U/ml, about 3000 U/ml, and about 4000 U/ml.

7. A method for prolonged culturing of granulosa cells according to claim 6, wherein said concentration of said leukaemia-inhibiting factor or functional derivative thereof is maintained over said prolonged time period.

8. A method for prolonged culturing of granulosa cells according to claim 1, wherein said prolonged time period is selected from the group consisting of at least about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 16 days, about 17 days, about 18 days, about 19 days, about 20 days, about 21 days, about 22 days, about 23 days, about 24 days, about 25 days, about 26 days, about 27 days, about 28 days, about 29 days, about 30 days; about 5 weeks; about 6 weeks, about 7 weeks, about 8 weeks, about 2 months, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 3 months, about 4 months, about 5 months, and about 6 months.

9. A method for prolonged culturing of granulosa cells according to claim 8, wherein said cultured primary granulosa cells express at least one functional marker after said prolonged time period.

10. A method for prolonged culturing of granulosa cells according to claim 9, wherein said one or more functional markers is selected from the group consisting of follicle stimulating hormone receptor and P450 aromatase.

11. A method for prolonged culturing of granulosa cells according to claim 1 , wherein said primary granulosa cells are cultured in step (b) in a three-dimensional culture environment.

12. A method for prolonged culturing of granulosa cells according to claim 11 , wherein said three-dimensional culture environment comprises a culture medium and one or more of a cell adhesion molecule and a three-dimensional structure.

13. A method for prolonged culturing of granulosa cells according to claim 12, wherein said three-dimensional structure is selected from the group consisting of a scaffold carrier, wherein said scaffold carrier is of natural, synthetic or of mixed origin.

14. A method for prolonged culturing of granulosa cells according to claim 12, wherein said cell adhesion molecule is an extracellular matrix component.

15. A method for prolonged culturing of granulosa cells according to claim 14, wherein said extracellular matrix component is selected from the group consisting of collagen, fibrin, laminins, fibronectin, and heparan sulfate.

16. A method for prolonged culturing of granulosa cells according to claim 15, wherein said collagen is selected from the group consisting of type I collagen and type IV collagen.

17. A method for prolonged culturing of granulosa cells according to claim 1 , wherein said primary granulosa cells are isolated from ovaries.

18. A method for prolonged culturing of granulosa cells according to claim 1 , further comprising the step (c) of autologously or heterologously transplanting said cultured primary granulosa cells into an ovary or underneath skin of a human or non-human animal after said prolonged time period.

19. A method for prolonged culturing of granulosa cells according to claim 18, further comprising the step (d) of genetically modifying said cultured primary granulosa cells prior to autologously or heterologously transplanting said cultured primary granulosa cells into an ovary or underneath skin of a human or non-human animal after said prolonged time period.

20. A method for prolonged culturing of granulosa cells according to claim 19, wherein said primary granulosa cells are transformed to express one or more of follicle-stimulating hormone receptor (FSHR) and luteinizing hormone receptor (LHR).

21. A method for prolonged culturing of granulosa cells according to claim 1 , further comprising the step of sorting said isolated primary granulosa cells in step (a) prior to culturing said primary granulosa cells in step (b).

22. A method for prolonged culturing of granulosa cells according to claim 21 , wherein said isolated granulosa cells are sorted with flow cytometry.

23. A method for prolonged culturing of granulosa cells according to claim 21 , wherein said primary granulosa cells are sorted based on the presence of one or more specific functional markers.

24. A method for prolonged culturing of granulosa cells according to claim 23, wherein said one or more functional markers is selected from the group consisting of follicle stimulating hormone receptor and P450 aromatase.

25. A method for prolonged culturing of granulosa cells according to claim I₅ further comprising the step of differentiating said granulosa cells cultured in step (b) into non- foUicular cells.

26. A method for prolonged culturing of granulosa cells according to claim 25, wherein said non-follicular cells are selected from the group consisting of neuronal cells, osteoblasts, and chondrocytes.

27. A method for prolonged culturing of granulosa cells, comprising: a. collecting and isolating luteinizing granulosa cells; b. culturing said luteinizing granulosa cells in vitro in a three-dimensional culture environment with leukaemia-inhibiting factor or a functional derivative thereof over a prolonged time period.

28. A method for prolonged culturing of granulosa cells according to claim 27, wherein said cultured luteinizing granulosa cells are both viable and able to produce one or more of follicle-stimulating hormone receptor and cytochrome P450 aromatase at least five days after culturing step (b).

29. A method for prolonged culturing of granulosa cells according to claim 27, wherein said three-dimensional culture environment comprises type I collagen.

30. Cultured primary granulosa cells prepared by a method according to one or more of claims 1-29.

31. An assay for testing a contraceptive agent candidate, comprising the steps:

(a) contacting a contraceptive agent candidate with primary granulosa cells cultured according to one or more of claims 1-29; and (b) determining if said contraceptive agent candidate modulates the activity of said primary granulosa cells.

32. A kit for testing a contraceptive agent candidate, comprising cultured primary granulosa cells prepared by a method according to one or more of claims 1-29 and instructions for testing the effectiveness of said contraceptive agent candidate to modulate the activity of said primary granulosa cells.