WO2009126632A1 - Compositions et procédés d’utilisation d’arn polymérases t3 mutantes dans la synthèse de produits de transcription d’acide nucléique modifiés - Google Patents

Compositions et procédés d’utilisation d’arn polymérases t3 mutantes dans la synthèse de produits de transcription d’acide nucléique modifiés Download PDF

Info

Publication number
WO2009126632A1
WO2009126632A1 PCT/US2009/039780 US2009039780W WO2009126632A1 WO 2009126632 A1 WO2009126632 A1 WO 2009126632A1 US 2009039780 W US2009039780 W US 2009039780W WO 2009126632 A1 WO2009126632 A1 WO 2009126632A1
Authority
WO
WIPO (PCT)
Prior art keywords
polymerase
nucleic acid
aptamer
mutant
target
Prior art date
Application number
PCT/US2009/039780
Other languages
English (en)
Inventor
Kristin Thompson
Charles Wilson
Shuhao Zhu
Original Assignee
Archemix Corp.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Archemix Corp. filed Critical Archemix Corp.
Publication of WO2009126632A1 publication Critical patent/WO2009126632A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/127—RNA-directed RNA polymerase (2.7.7.48), i.e. RNA replicase

Definitions

  • the invention relates to materials and methods for transcribing nucleic acids, and more particularly to mutant enzymes and methods for using the mutant enzymes in template directed polymerization in order to increase the incorporation of modified nucleotides into nucleic acids.
  • the invention relates to the synthesis and use of mutated polymerases that incorporate nucleotide triphosphates (NTPs) from mixtures of different NTPs, including those with modifications at the 2'-ribose position, into a transcript.
  • NTPs nucleotide triphosphates
  • An aptamer is an isolated or purified nucleic acid that binds with high specificity and affinity to a target through interactions other than Watson-Crick base pairing.
  • a typical aptamer is 10-15 kDa in size (20-45 nucleotides), binds to its target with nanomolar to sub- nano molar affinity, and discriminates against closely related targets (e.g., aptamers will typically not bind other proteins from the same gene family).
  • An aptamer has a three dimensional structure that provides chemical contacts to specifically bind to a target. Aptamers have been generated to many targets, such as small molecules, carbohydrates, peptides and proteins, including growth factors, transcription factors, enzymes, immunoglobulins and receptors.
  • aptamers are nucleic acids, there is a fundamental difference between aptamers and other nucleic acids, such as genes and mRNA. In the latter, the nucleic acid structure encodes information through its linear base sequence and thus the sequence is important for information storage. In complete contrast, aptamer function, which is based upon specific binding to a target, is not dependent upon a conserved linear base sequence, but rather a particular secondary and/or tertiary structure. That is, aptamers are non-coding sequences. Any coding potential that an aptamer may possess is entirely fortuitous and plays no role whatsoever in the binding of an aptamer to its target. Thus, while it may be that aptamers that bind to the same target, and even to the same site on that target, share a similar linear base sequence, many, if not most, do not.
  • Aptamers must also be differentiated from the naturally occurring nucleic acids that bind to certain proteins. These latter nucleic acids are naturally occurring sequences embedded within the genome of an organism that bind to a specialized sub-group of proteins, i.e., nucleic acid binding proteins that are involved in the transcription, translation and transportation of naturally occurring nucleic acids. Aptamers, on the other hand, are short, isolated, non-naturally occurring nucleic acids. While aptamers can be identified that bind to nucleic acid binding proteins, in most cases such aptamers have little or no sequence identity to the sequences recognized by the nucleic acid binding proteins in nature.
  • aptamers can bind to virtually any type of protein, not just nucleic acid binding proteins, as well as almost any other type of target of interest, including small molecules, carbohydrates, peptides, etc.
  • a naturally occurring nucleic acid sequence to which it binds does not exist.
  • nucleic acid binding proteins such sequences will differ from aptamers as a result of the relatively low binding affinity used in nature as compared to tightly binding aptamers.
  • Aptamers are capable of specifically binding to selected targets and modulating the target's activity or binding interactions, e.g., through binding, aptamers may inhibit or stimulate the target's ability to function. Specific binding to a target is an inherent property of an aptamer. Functional activity, i.e., inhibiting or stimulating a target's function is not. An aptamer may bind to a target and have little or no effect on function of the target. [007] Aptamers are also analogous to small molecule therapeutics in that a single structural change, however seemingly minor, can dramatically affect (by several orders of magnitude) the binding and/or other activity of the aptamer. On the other hand, some structural changes will have little or no effect whatsoever.
  • an aptamer is a three dimensional structure held in a fixed conformation that provides chemical contacts to specifically bind its target. Consequently: (1) some areas or particular sequences are essential as (a) specific points of contact with the target and/or (b) sequences that position molecules in contact with the target; (2) some areas or particular sequences have a range of variability, e.g., nucleotide X must be a pyrimidine, or nucleotide Y must be a purine, or nucleotides X and Y must be complementary; and (3) some areas or particular sequences can be anything, i.e., they are essentially spacing elements, e.g., they could be any string of nucleotides of a given length or even a non-nucleotide spacer, such as a PEG molecule.
  • aptamers have been generated for hundreds of proteins, including growth factors, transcription factors, enzymes, immunoglobulins and receptors.
  • a series of structural studies have shown that aptamers are capable of using the same types of binding interactions ⁇ e.g., hydrogen bonding, electrostatic complementarities, hydrophobic contacts and steric exclusion) that drive affinity and specificity in antigen-antibody complexes.
  • Aptamers have a number of desirable characteristics for use as therapeutics and diagnostics, including high specificity and affinity, biological activity, excellent pharmacokinetic properties, stability, and good scalability and cost.
  • Modified nucleotides ⁇ e.g., 2'-modified nucleotides), including those that are inexpensive, non-toxic, and that can increase resistance to enzymatic, chemical, thermal and physical degradation, can be incorporated during the SELEX TM method, as described in U.S. Patent Application Publication No. US 20040197804, filed December 3, 2002 (herein incorporated by reference), and U.S. Patent Application Publication No. US 20050037394, filed June 21 , 2004 (herein incorporated by reference).
  • the invention relates to modified or mutant T3 RNA polymerases, as compared to the wild-type T3 RNA polymerase.
  • the polymerases may be purified, isolated and/or recombinant.
  • isolated encompasses polymerases that are recombinantly expressed in a cell or tissue, and also polymerases that are engineered into a cell or tissue.
  • purified means free or substantially free from contaminants.
  • mutant polymerase and “modified polymerase” encompass any polymerase that is changed in form and/or structure from the corresponding wild-type polymerase.
  • mutant polymerase and “modified polymerase” are used interchangeably herein.
  • nucleotide and/or amino acid sequence of a mutant polymerase has been altered from the nucleotide and/or amino acid sequence of the corresponding wild-type polymerase.
  • the alteration is, by way of non-limiting example, an amino acid substitution, deletion, addition or modification.
  • the invention describes mutant T3 RNA polymerases that have been altered by mutation of a residue within the active site of the T3 RNA polymerase that is postulated to play a role in defining nucleotide triphosphate (NTP) substrate specificity.
  • NTP nucleotide triphosphate
  • the specific mutation enables the synthesis, by transcription, of oligonucleotides with non-standard backbone compositions from mixtures of different NTPs, including those NTP's with modifications at the 2'-ribose position including, but not limited to, ribo, deoxy, fluoro and O- methyl.
  • transcripts with these modified backbones are useful because: (1) these modifications impart improved stability upon the transcripts by rendering these modified transcripts resistant to nuclease and chemical attack, (2) these modifications may improve the functional properties of the transcripts and (3) modified transcripts may be manufactured more efficiently and at less cost than RNA.
  • the invention is a mutant T3 RNA polymerase that is modified, as compared to the wild-type sequence in Table 1, by a mutation at position 640, wherein the tyrosine residue at position 640 is replaced with a phenylalanine residue.
  • this mutant T3 polymerase is referred to as either: i) "Y640F” or ii) the "T3 Single
  • the invention is a mutant T3 RNA polymerase that is modified, as compared to the wild-type sequence in Table 1, by mutations at position 640 and position 785, wherein the tyrosine residue at position 640 is replaced with a leucine residue, and the histidine residue at position 785 is replaced with an alanine residue.
  • this mutant T3 polymerase is referred to as either: i) "Y640L/H785A" or ii) the "T3 LA
  • the invention is an isolated polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 3, wherein SEQ ID NO: 2 is the amino acid sequence of the T3 Single Mutant and SEQ ID NO: 3 is the amino acid sequence of the T3 LA Mutant.
  • the invention contemplates a kit comprising a mutant T3 RNA polymerase.
  • the mutant T3 RNA polymerase in the kit is an isolated polypeptide comprising SEQ ID NO: 2.
  • the mutant T3 RNA polymerase in the kit is an isolated polypeptide comprising SEQ ID NO: 3.
  • the invention is an isolated nucleic acid encoding a mutant T3 RNA polymerase.
  • RNA polymerase a nucleic acid sequence selected from the group consisting of SEQ ID NO: 4 and SEQ ID NO: 5 is provided, wherein SEQ ID NO: 4 is the nucleic acid sequence encoding the T3 Single Mutant and SEQ ID NO: 5 is the nucleic acid sequence encoding the T3 LA Mutant.
  • a vector comprising an isolated nucleic acid sequence of the invention is provided.
  • an expression vector comprising a nucleic acid sequence of the invention that is operably linked to a promoter is provided.
  • a cell comprising the expression vector is provided.
  • a cell wherein the mutant T3 RNA polymerase of the invention is expressed by the cell is provided.
  • a kit comprising a nucleic acid sequence encoding a T3 mutant RNA polymerase of the invention is provided.
  • the invention also relates to mutant polymerases and their use in transcription, particularly their use to enhance transcript yield where 2 '-modified nucleotides are being incorporated, and more particularly where some or all of the nucleotides being incorporated are 2'-modified, e.g., 2'-OMe modified ("fully 2'-OMe" or "mRmY” or "MNA” transcripts).
  • Another embodiment of the invention is a method for transcribing a single stranded nucleic acid comprising incubating a mutant T3 RNA polymerase with a template nucleic acid under reaction conditions sufficient to result in transcription.
  • the reaction conditions sufficient to result in transcription include one or more of the following components: modified and/or unmodified nucleotide triphosphates, a nucleic acid transcription template, 2'-OH guanosine, magnesium ions, manganese ions, a non 2'-OMe guanosine non-triphosphate residue, polyalkylene glycol ⁇ e.g., polyethylene glycol), inorganic pyrophosphatase, guanosine monophosphate, guanosine diphosphate, 2'-fluoro guanosine monophosphate, 2'-fluoro guanosine diphosphate, 2'-amino guanosine monophosphate, T- amino guanosine diphosphate, 2'
  • Another embodiment of the invention is a method for transcribing a partially or fully 2'-OMe nucleic acid comprising the steps: a) incubating a transcription reaction mixture comprising a mutant T3 RNA polymerase, a nucleic acid transcription template and nucleotide triphosphates, wherein the nucleotide triphosphates are 2'-OMe modified nucleotide triphosphates, and b) transcribing the transcription template to result in a single stranded nucleic acid, wherein some or all of the nucleotides in the single stranded nucleic acids are 2'- OMe modified, except that the first nucleotide of the transcript may be 2 '-unmodified.
  • the first nucleotide of the transcript may be 2'-OH guanosine.
  • a partially 2'-0Me nucleic acid comprises a nucleic acid sequence in which at least 10% of the nucleotides are 2'-0Me.
  • a partially 2'-0Me nucleic acid comprises a nucleic acid sequence in which at least 10%, 25%, 35%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the nucleotides are 2'-0Me.
  • the transcription reaction mixture further comprises magnesium ions. In other embodiments, the transcription reaction mixture further comprises manganese ions. In some embodiments, the transcription reaction mixture comprises both magnesium ions and manganese ions. In another embodiment, the magnesium ions are present in the transcription reaction mixture at a concentration that is 2.0 to 5.0 times greater than the manganese ions.
  • the magnesium ions are present in the transcription reaction mixture at a concentration that is 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9 or 5.0 times greater than the manganese ions.
  • the concentration of magnesium ions is 8 mM and the concentration of manganese ions is 3.0 mM.
  • the nucleic acid transcription template is at least partially double-stranded.
  • the nucleic acid transcription template is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% double- stranded.
  • the nucleic acid transcription template is fully double- stranded, i.e., 100% double-stranded.
  • the transcription template comprises a T3 RNA polymerase promoter.
  • the transcription reaction mixture further comprises a non 2'-OMe guanosine non-triphosphate residue, particularly wherein the non 2'-OMe guanosine non-triphosphate residue is selected from the group consisting of: guanosine monophosphate, guanosine diphosphate, guanosine triphosphate, 2'-fluoro guanosine monophosphate, 2'-fluoro guanosine diphosphate, 2'-amino guanosine monophosphate, T- amino guanosine diphosphate, 2'-deoxy guanosine monophosphate and 2'-deoxy guanosine diphosphate.
  • guanosine monophosphate guanosine diphosphate
  • guanosine triphosphate guanosine monophosphate
  • 2'-fluoro guanosine monophosphate 2'-fluoro guanosine diphosphate
  • 2'-amino guanosine monophosphate 2'-a
  • the transcription reaction mixture further comprises polyethylene glycol.
  • the transcription reaction mixture comprises inorganic pyrophosphatase.
  • a method for identifying an aptamer comprises the steps: a) preparing a transcription reaction mixture comprising a mutant polymerase of the invention, nucleotide triphosphates (NTP's) and a nucleic acid transcription template, b) transcribing the template to result in a single stranded nucleic acid, wherein some or all of the nucleotides of the single stranded nucleic acids are 2 '-modified, c) contacting the single stranded nucleic acid with a target, d) partitioning the nucleic acids having an increased affinity for the target from the candidate mixture, and e) amplifying the increased affinity nucleic acids to yield an aptamer enriched mixture, whereby aptamers to the target comprise 2 '-modified nucleotides, except that the first nucleotide of the aptamers may be 2 '-unmodified
  • the amplifying step e) optionally comprises (i) dissociating the increased affinity nucleic acids from the target, ii) reverse transcribing the increased affinity nucleic acids dissociated from the nucleic acid-target complexes, iii) amplifying the reverse transcribed increased affinity nucleic acids, and (iv) preparing a transcription reaction mixture comprising the amplified reverse transcribed increased affinity nucleic acids as the transcription template and transcribing the transcription mixture.
  • all of the nucleotide triphosphates in the transcription reaction mixture are 2'-OMe modified.
  • the nucleic acid transcription template comprises a T3 RNA polymerase promoter and a leader sequence immediately 3'- to the T3 RNA polymerase promoter.
  • this method comprises repeating steps a) to e) iteratively.
  • the transcription reaction mixture used in the method comprises one or more modified nucleotide triphosphates and a mutated T3
  • the modified nucleotide triphosphate is a 2'-modified nucleotide triphosphate, particularly a 2'-OMe modified nucleotide triphosphate.
  • the transcription reaction mixture used in the method of the invention comprises magnesium and manganese ions
  • the mutated T3 RNA polymerase is a polypeptide selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 3.
  • the magnesium ions are present in the transcription reaction mixture at a concentration that is 2.0 to 5.0 times greater than the manganese ions.
  • the magnesium ions are present in the transcription reaction mixture at a concentration that is 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9 or 5.0 times greater than the manganese ions.
  • each nucleotide triphosphate is present in the transcription reaction at a final concentration of 1.5 mM, the concentration of magnesium ions is approximately 8 mM and the concentration of manganese ions is approximately 3.0 mM.
  • the transcription reaction further comprises a polyalkylene glycol, particularly polyethylene glycol.
  • the transcription reaction further comprises a guanosine residue selected from the group consisting of: guanosine monophosphate, guanosine diphosphate, 2'-fluoro guanosine monophosphate or diphosphate, 2'-amino guanosine monophosphate or diphosphate, 2'-deoxy guanosine monophosphate or diphosphate, or other modified nucleotides.
  • the transcription reaction of the invention comprises inorganic pyrophosphatase.
  • the transcription reaction mixture of the invention optionally comprises a combination from the group consisting of: buffer, detergent (e.g., Triton X-100), polyamine (e.g., spermine and/or spermidine) and reducing agent (e.g., DTT or ⁇ ME).
  • the transcription reaction comprises nucleotide triphosphates, magnesium ions, manganese ions, polyethylene glycol, guanosine monophosphate, inorganic pyrophosphatase, buffer, detergent, polyamine, DTT, one or more oligonucleotide transcription templates and a mutant T3 RNA polymerase selected from the group consisting of SEQ ID NOs.: 2 and 3.
  • the nucleic acid transcription template used in the transcription reaction is at least partially double-stranded.
  • the invention provides an oligonucleotide transcription template comprising a leader sequence.
  • the oligonucleotide transcription template comprises the nucleic acid sequence of SEQ ID NO: 6.
  • Figure 1 is a schematic representation of the in vitro aptamer selection
  • Figure 2 is an illustration depicting various PEGylation strategies.
  • Figure 3 is the nucleic acid sequence of the T3 Single Mutant (SEQ ID NO: 4).
  • Figure 4 is the nucleic acid sequence of the T3 LA Mutant (SEQ ID NO: 5).
  • SELEXTM Systematic Evolution of Ligands by Exponential Enrichment
  • Figure 1 Systematic Evolution of Ligands by Exponential Enrichment
  • the SELEXTM process is a method for the in vitro evolution of nucleic acids with highly specific binding to target molecules, and is described in, e.g., U.S. Patent No. 5,475,096 entitled “Nucleic Acid Ligands” and U.S. Patent No. 5,270,163 entitled “Nucleic Acid Ligands”.
  • SELEXTM may be used to obtain aptamers, also referred to herein as “nucleic acid ligands", with any desired level of target binding affinity.
  • the SELEX process is based on the unique insight that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures, and sufficient chemical versatility available within their monomers to act as ligands (i.e., to form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of any size or composition can serve as targets.
  • the SELEX TM process is based on the ability to bind a target. Aptamers obtained through the SELEX TM procedure will thus have the property of target binding. Mere target binding, however, provides no information on the functional effect, if any, that may be exerted on the target by the action of aptamer binding.
  • Alteration of a property of the target requires the aptamer to bind at a certain location on the target in order to effect a change in a property of the target.
  • the SELEX method may result in the identification of a large number of aptamers, wherein each aptamer binds at a different site on the target.
  • aptamer-target binding interactions often occur at one or a relatively small number of preferred binding sites on the target, which provide stable and accessible structural interfaces for the interaction.
  • the skilled person is generally not able to control the location of aptamer binding to the target.
  • the location of the aptamer binding site on the target may or may not be at or close to one of potentially several binding sites that could lead to the desired effect or any effect on the target.
  • an aptamer by virtue of its ability to bind a target, is found to have an effect, there is no way of predicting the existence of that effect or of knowing in advance what the effect will be.
  • the skilled person can only know with any certainty that aptamers, to the extent it is possible to obtain an aptamer against a target, will have the property of target binding.
  • the SELEX process relies as a starting point upon a large library or pool of single stranded oligonucleotides comprising randomized sequences.
  • the oligonucleotides can be modified or unmodified DNA, RNA or DNA/RNA hybrids.
  • the pool comprises 100% degenerate or partially degenerate oligonucleotides.
  • the pool comprises degenerate or partially degenerate oligonucleotides containing at least one fixed sequence and/or conserved sequence that is incorporated within a randomized sequence.
  • the pool comprises degenerate or partially degenerate oligonucleotides containing at least one fixed sequence and/or conserved sequence at its 5 ' and/or 3 ' end, which may comprise a sequence shared by all of the molecules of the oligonucleotide pool.
  • Fixed sequences are sequences common to oligonucleotides in the pool, which are incorporated for a preselected purpose such as, CpG motifs, hybridization sites for PCR primers, promoter sequences for RNA polymerases (e.g., T3, T4, T7, and SP6), restriction sites or homopolymeric sequences, such as poly A or poly T tracts, catalytic cores, sites for selective binding to affinity columns, leader sequences that promote transcription, and other sequences to facilitate cloning and/or sequencing of an oligonucleotide of interest.
  • conserveed sequences are sequences, other than the previously described fixed sequences, that are shared by a number of aptamers that bind to the same target.
  • the oligonucleotides of the pool preferably include a degenerate sequence portion as well as fixed sequences that are necessary for efficient amplification.
  • the oligonucleotides of the starting pool contain fixed 5' and 3' terminal sequences that flank an internal region of 30-40 random nucleotides.
  • the degenerate nucleotides can be produced in a number of ways, such as chemical synthesis and size selection from randomly cleaved cellular nucleic acids. Sequence variation in test nucleic acids can also be introduced or increased by mutagenesis before or during the selection/amplification iterations.
  • the degenerate sequence portion of the oligonucleotide can be any length and can comprise ribonucleotides and/or deoxyribonucleotides and can include modified or non- natural nucleotides or nucleotide analogs. See, e.g., U.S. Patent No. 5,958,691; U.S. Patent No. 5,660,985; U.S. Patent No. 5,958,691; U.S. Patent No. 5,698,687; U.S. Patent No. 5,817,635; U.S. Patent No. 5,672,695 and PCT Publication WO 92/07065.
  • oligonucleotides can be synthesized from phosphodiester-linked nucleotides using solid phase oligonucleotide synthesis techniques that are well known in the art. See, e.g., Froehler et al., Nucl. Acid Res. 14:5399-5467 (1986) and Froehler et al, Tet. Lett. 27:5575-5578 (1986). Random oligonucleotides can also be synthesized using solution phase methods, such as triester synthesis methods. See, e.g., Sood et al, Nucl. Acid Res. 4:2557 (1977) and Hirose et al, Tet.
  • the starting library of oligonucleotides may be generated by automated chemical synthesis on a DNA synthesizer. To synthesize degenerate sequences, mixtures of all four nucleotides are added at each nucleotide addition step during the synthesis process, allowing for stochastic incorporation of nucleotides.
  • random oligonucleotides comprise entirely degenerate sequences; however, in other embodiments, degenerate oligonucleotides can comprise stretches of nonrandom or partially random sequences. Partially random sequences can be created by adding the four nucleotides in different molar ratios at each addition step.
  • RNA library In those instances where an RNA library is used as the starting library, it is typically generated by synthesizing a DNA library, optionally PCR amplifying, then transcribing the DNA library in vitro using T3 RNA polymerase or a modified T3 RNA polymerase, and purifying the transcribed library. The RNA or DNA library is then mixed with the target under conditions favorable for binding and subjected to step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity.
  • the SELEXTM method includes steps: (a) contacting the mixture with the target under conditions favorable for binding; (b) partitioning unbound nucleic acids from those nucleic acids that have bound specifically to target; (c) dissociating the nucleic acid-target complexes; (d) amplifying the nucleic acids dissociated from the nucleic acid- target complexes to yield a ligand-enriched mixture of nucleic acids; and (e) reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target.
  • the SELEX method further comprises the steps of: (i) reverse transcribing the nucleic acids dissociated from the nucleic acid-target complexes before amplification in step (d); and (ii) transcribing the amplified nucleic acids from step (d) before restarting the process.
  • a nucleic acid mixture comprising, for example, a 20 nucleotide randomized segment can have 4 candidate possibilities. Those that have higher affinity (lower dissociation constants) for the target are most likely to bind to the target.
  • a second nucleic acid mixture is generated, enriched for the higher binding affinity candidates. Additional rounds of selection progressively favor the best ligands until the resulting nucleic acid mixture is predominantly composed of only one or a few sequences. These can then be cloned, sequenced and individually tested as ligands or aptamers for: 1) target binding affinity and/or 2) ability to affect target function.
  • Cycles of selection and amplification are repeated until a desired goal is achieved. In the most general case, selection/amplification is continued until no significant improvement in binding strength is achieved on repetition of the cycle.
  • the method is typically used to sample approximately 10 14 different nucleic acid species but may be used to sample as many as about 10 different nucleic acid species.
  • nucleic acid aptamer molecules are selected in a 5 to 20 cycle procedure. In one embodiment, heterogeneity is introduced only in the initial selection stages and does not occur throughout the replicating process.
  • the selection process is so efficient at isolating those nucleic acid ligands that bind most strongly to the selected target that only one cycle of selection and amplification is required.
  • Such an efficient selection may occur, for example, in a chromatographic-type process wherein the ability of nucleic acids to associate with targets bound on a column operates in such a manner that the column is sufficiently able to allow separation and isolation of the highest affinity nucleic acid ligands. [0057] In many cases, it is not necessarily desirable to perform the iterative steps of the
  • the target-specific nucleic acid ligand solution may include a family of nucleic acid structures or motifs that have a number of conserved sequences and a number of sequences that can be substituted or added without significantly affecting the affinity of the nucleic acid ligands to the target.
  • nucleic acid primary, secondary and tertiary structures are known to exist.
  • the structures or motifs that have been shown most commonly to be involved in non- Watson-Crick type interactions are referred to as hairpin loops, symmetric and asymmetric bulges, pseudoknots and myriad combinations of the same.
  • Almost all known cases of such motifs suggest that they can be formed in a nucleic acid sequence of no more than 30 nucleotides.
  • SELEX TM procedures with contiguous randomized segments be initiated with nucleic acid sequences containing a randomized segment of between about 20 to about 50 nucleotides and in some embodiments, about 30 to about 40 nucleotides.
  • the 5'-f ⁇ xed:random:3'-fixed sequence comprises a random sequence of about 30 to about 40 nucleotides.
  • the core SELEX TM method has been modified to achieve a number of specific objectives.
  • U.S. Patent No. 5,707,796 describes the use of the SELEX TM process in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA.
  • U.S. Patent No. 5,763,177 describes SELEX TM based methods for selecting nucleic acid ligands containing photo reactive groups capable of binding and/or photo-crosslinking to and/or photo-inactivating a target molecule.
  • U.S. Patent No. 5,496,938 describes methods for obtaining improved nucleic acid ligands after the SELEX process has been performed.
  • U.S. Patent No. 5,705,337 describes methods for covalently linking a ligand to its target.
  • the SELEX TM method can also be used to obtain nucleic acid ligands that bind to more than one site on the target molecule, and to obtain nucleic acid ligands that include non- nucleic acid species that bind to specific sites on the target.
  • the SELEX TM method provides means for isolating and identifying nucleic acid ligands that bind to any envisionable target, including large and small biomolecules, such as nucleic acid-binding proteins and proteins not known to bind nucleic acids as part of their biological function, as well as cofactors and other small molecules.
  • U.S. Patent No. 5,580,737 discloses nucleic acid sequences identified through the SELEX method that are capable of binding with high affinity to caffeine and the closely related analog, theophylline.
  • the Counter-SELEX process is a method for improving the specificity of nucleic acid ligands to a target by eliminating nucleic acid ligand sequences with cross- reactivity to one or more non-target molecules.
  • the Counter-SELEX process comprises the steps: (a) preparing a candidate mixture of nucleic acids; (b) contacting the candidate mixture with the target; (c) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; (d) dissociating the increased affinity nucleic acids from the target; (e) contacting the increased affinity nucleic acids with one or more non-target molecules such that nucleic acid ligands with specific affinity for the non-target molecule(s) are removed; and (f) amplifying the nucleic acids with specific affinity only to the target molecule to yield a mixture of nucleic acids enriched for nucleic acid sequences with a relatively higher affinity and specificity for binding to the target molecule.
  • oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes, such as endonucleases and exonucleases, before the desired effect is manifest.
  • the SELEX method thus encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the sugar and/or phosphate and/or base positions.
  • SELEX -identified nucleic acid ligands containing modified nucleotides are described, e.g., in U.S. Patent No. 5,660,985, which describes oligonucleotides containing nucleotide derivatives chemically modified at the 2'-position of ribose, 5-position of pyrimidines and 8-position of purines; U.S. Patent No. 5,756,703, which describes oligonucleotides containing various 2 '-modified pyrimidines; and U.S. Patent No.
  • 5,580,737 which describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2'-amino (2'-NH 2 ), 2'-fluoro (2'-F) and/or 2'-O-methyl (2'- OMe) substituents.
  • Modifications of the nucleic acid ligands contemplated in this invention include, but are not limited to, those that provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole. Modifications to generate oligonucleotide populations that are resistant to nucleases can also include one or more substitute internucleotide linkages, altered sugars, altered bases, or combinations thereof.
  • modifications include, but are not limited to, 2 '-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5- iodo-uracil; backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, and unusual base-pairing combinations, such as the isobases isocytidine and isoguanosine.
  • Modifications can also include 3' and 5' modifications, such as capping, e.g., addition of a 3'-dT cap to increase exonuclease resistance (see, e.g., U.S. Patents Nos. 5,674,685; 5,668,264; 6,207,816 and 6,229,002; each of which is incorporated by reference herein in its entirety).
  • oligonucleotides are provided in which the P(O)O group is replaced by P(O)S ("thioate"), P(S)S ("dithioate”), P(O)NR 2 ("amidate"), P(O)R, P(O)OR', CO or CH 2 ("formacetal") or 3 '-amine (-NH-CH 2 -CH 2 -), wherein each R or R' is independently H or substituted or unsubstituted alkyl.
  • Linkage groups can be attached to adjacent nucleotides through an -O-, -N- or -S- linkage. Not all linkages in the oligonucleotide are required to be identical.
  • the oligonucleotides comprise modified sugar groups, for example, one or more of the hydroxyl groups is replaced with halogen, aliphatic groups, or functionalized as ethers or amines.
  • the 2'-position of the furanose residue is substituted by any of an O-methyl, O-alkyl, O-allyl, S-alkyl, S-allyl, or halo group.
  • modifications are known to one of ordinary skill in the art. Such modifications may be pre-SELEX TM process modifications or post-SELEX TM process modifications (modification of previously identified unmodified ligands) or may be made by incorporation into the SELEX TM process.
  • SELEX TM process yield nucleic acid ligands with both specificity for their SELEX TM target and improved stability, e.g., in vivo stability.
  • Post-SELEX process modifications ⁇ e.g., truncation, deletion, substitution or additional nucleotide modifications of previously identified ligands having nucleotides incorporated by pre-SELEX process modification) to nucleic acid ligands can result in improved stability, e.g. , in vivo stability without adversely affecting the binding capacity of the nucleic acid ligand.
  • aptamers in which modified nucleotides have been incorporated by pre-SELEX process modification can be further modified by post- SELEX process modification (z ' .e., a post-SELEX modification process after SELEX).
  • the SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. Patent No. 5,637,459 and U.S. Patent No. 5,683,867.
  • the SELEX TM method further encompasses combining selected nucleic acid ligands with lipophilic or non-immunogenic high molecular weight compounds in a diagnostic or therapeutic complex, as described, e.g., in U.S. Patent No. 6,011,020, U.S. Patent No. 6,051,698 and PCT Publication No. WO 98/18480.
  • These patents and applications teach the combination of a broad array of shapes and other properties, with the efficient amplification and replication properties of oligonucleotides, and with the desirable properties of other molecules.
  • an aptamer In order for an aptamer to be suitable for use as a therapeutic and/or for a particular types of diagnostics, it is preferably inexpensive to synthesize, safe and stable in vivo. Wild-type RNA and DNA aptamers are typically not stable in vivo because of their susceptibility to degradation by nucleases. Resistance to nuclease degradation can be greatly increased by the incorporation of modifying groups at the 2'-position of nucleotides within an aptamer.
  • Oligonucleotides containing 2'-0Me nucleotides are nuclease-resistant and inexpensive to synthesize. 2'-0Me nucleotides are ubiquitous in biological systems, thus there are no safety concerns over the recycling of 2'-0Me nucleotides into host DNA. However, natural polymerases do not accept 2'-0Me NTPs as substrates under physiological conditions. SELEXTM methods used to generate 2'-modified aptamers are described, e.g., in U.S. Patent Application Publication No. US 20040197804, filed December 3, 2003 and U.S. Patent Application Publication No. US 20050037394, filed June 21, 2004, both entitled "Method for in vitro Selection of 2'-O-methyl Substituted Nucleic Acids", each of which is herein incorporated by reference in its entirety.
  • the invention includes aptamers that bind to and modulate the function of a target and that contain modified nucleotides ⁇ e.g., nucleotides that have a modification at the 2'-position) to make the aptamer more stable than the unmodified aptamer to enzymatic, chemical, thermal and physical degradation.
  • modified nucleotides e.g., nucleotides that have a modification at the 2'-position
  • aptamers generated using this method tend to contain from two to four 2'-OH residues, and stability and cost of synthesis are compromised as a result.
  • modified nucleotides into the transcription reaction that generates stabilized oligonucleotides used in oligonucleotide pools from which aptamers are selected and enriched by the SELEX method (and/or any of its variations and improvements, including those described herein)
  • the methods of the invention eliminate the need for stabilizing the selected aptamer by resynthesizing the aptamer with 2'-0Me modified nucleotides.
  • the invention provides aptamers comprising combinations of 2'-OH, 2'-F, 2'-deoxy and 2'-0Me modifications of the ATP, GTP, CTP, TTP and UTP nucleotides.
  • the invention provides aptamers comprising combinations of 2'-OH, 2'-F, 2'-deoxy, 2'-0Me, 2'-NH 2 and 2'-methoxyethyl modifications of the ATP, GTP, CTP, TTP and UTP nucleotides.
  • the invention provides aptamers comprising all or substantially all 2'-0Me modified ATP, GTP, CTP, TTP and UTP nucleotides.
  • 2'-modified aptamers of the invention are created using modified polymerases that have a rate of incorporation of modified nucleotides having bulky substituents at the furanose 2'-position that is higher than that of wild-type polymerases.
  • Embodiments of the invention provide materials and methods for increasing the transcription yield of oligonucleotides.
  • the invention provides methods and conditions for using modified T3 RNA polymerases to enzymatically incorporate modified nucleotides into oligonucleotides.
  • the use of modified T3 RNA polymerases to enzymatically incorporate modified nucleotides into oligonucleotides is performed as part of the SELEX process.
  • the modified T3 RNA polymerase used with the transcription methods does not require the presence of 2'-OH GTP.
  • the modified polymerase is a mutant T3 RNA polymerase wherein the tyrosine residue at position 640 has been changed to a phenylalanine residue
  • the modified polymerase is a mutant T3 RNA polymerase wherein having the tyrosine residue at position 640 has been changed to a leucine residue, and the histidine residue at position 785 has been changed to an alanine residue
  • the Y640F or the Y640L/H785A mutant T3 RNA polymerases are used with an MNA transcription mixture to promote fully 2'-OMe transcript yields.
  • the Y640F or the Y640L/H785A mutant T3 RNA polymerases may be used with an rRmY, dRmY, rGmH, fGmH, dGmH, dAmB, rRdY, dRdY, rRfY or rN transcription mixture.
  • mutant T3 polymerases of the present invention are also tested for their ability to promote a variety of other transcription yields by using transcription mixtures, such as a dCmD, dTmV, rTmV, rUmV or dUmV reaction mixture.
  • a transcription mixture containing only 2'-OMe A, G, C and U triphosphates is referred to as an "MNA” mixture, and aptamers selected therefrom are referred to as “MNA” aptamers, which contains only 2'-O-methyl nucleotides, with the possible exception of the 5' terminal nucleotide.
  • MNA 2'-O-methyl nucleotides
  • rRmY aptamers selected therefrom are referred to as "rRmY” aptamers.
  • a transcription mixture containing deoxy A and G, and 2'- OMe U and C is referred to as a "dRmY” mixture, and aptamers selected therefrom are referred to as “dRmY” aptamers.
  • a transcription mixture containing 2'-0Me A, C and U, and 2'-OH G is referred to as a "rGmH” mixture, and aptamers selected therefrom are referred to as "rGmH” aptamers.
  • a transcription mixture alternately containing 2'-0Me A, C, U and G, and 2'-0Me A, U and C, and 2'-F G is referred to as an "alternating mixture", and aptamers selected therefrom are referred to as "alternating mixture” aptamers.
  • a transcription mixture containing 2'-0Me A, U and C, and 2'-F G is referred to as a "fGmH” mixture, and aptamers selected therefrom are referred to as "fGmH” aptamers.
  • a transcription mixture containing 2'-0Me A, U and C, and deoxy G is referred to as a "dGmH” mixture, and aptamers selected therefrom are referred to as “dGmH” aptamers.
  • a transcription mixture containing deoxy A and 2'-0Me C, G and U is referred to as a "dAmB” mixture, and aptamers selected therefrom are referred to as "dAmB” aptamers.
  • a transcription mixture containing 2'-0H A and 2'-0Me C, G and U is referred to as a "rAmB” mixture, and aptamers selected therefrom are referred to as "rAmB” aptamers.
  • a transcription mixture containing 2'-OH adenosine triphosphate and guanosine triphosphate, and deoxy cytidine triphosphate and thymidine triphosphate is referred to as an "rRdY” mixture, and aptamers selected therefrom are referred to as “rRdY” aptamers.
  • a transcription mixture containing 2'-OH A and G, and 2'-F C and T is referred to as an "rRfY” mixture, and aptamers selected therefrom are referred to as "rRfY” aptamers.
  • a transcription mixture containing all 2'-OH nucleotides is referred to as a "rN” mixture, and aptamers selected therefrom are referred to as “rN", “rRrY” or RNA aptamers.
  • a transcription mixture containing all deoxy nucleotides is referred to as a “dN” mixture, and aptamers selected therefrom are referred to as “dN” or “dRdY” or DNA aptamers.
  • a transcription mixture containing 2'-0Me A, U or T, and G, and deoxy C is referred to as a "dCmD” mixture, and aptamers selected there from are referred to as "dCmD” aptamers.
  • a transcription mixture containing 2'-0Me A, G and C, and deoxy T is referred to as a "dTmV” mixture, and aptamers selected there from are referred to as “dTmV” aptamers.
  • a transcription mixture containing T- OMe A, C and G, and 2'-OH U is referred to as a "rUmV” mixture, and aptamers selected there from are referred to as “rUmV” aptamers.
  • a transcription mixture containing 2'-0Me A, C and G, and 2'-deoxy U is referred to as a "dUmV” mixture, and aptamers selected there from are referred to as "dUmV” aptamers.
  • 2'-modified oligonucleotides may be synthesized entirely of modified nucleotides or with a subset of modified nucleotides. All nucleotides may be modified and all may contain the same modification. Alternatively, all nucleotides may be modified yet contain different modifications, e.g., all nucleotides containing the same base may have one type of modification while nucleotides containing other bases may have different types of modification. All purine nucleotides may have one type of modification (or are unmodified) while all pyrimidine nucleotides have another, different type of modification (or are unmodified).
  • transcripts or pools of transcripts are generated using any combination of modifications, including, for example, ribonucleotides (2'-OH), deoxyribonucleotides (2'-deoxy), 2'-F and 2'-0Me modified nucleotides.
  • modified oligonucleotides may contain nucleotides bearing more than one modification simultaneously, such as a modification at the internucleotide linkage ⁇ e.g. , phosphorothioate) and at the sugar ⁇ e.g., 2'-0Me) and at the base ⁇ e.g., inosine).
  • GGGAGAGGAGAACGTTCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG GTCGATCGATCGATCATCGATG SEQ ID NO: 7
  • the DNA template of SEQ ID NO: 6 was used to synthesize oligonucleotides using MNA, rGmH and rRfY pool compositions
  • the DNA template of SEQ ID NO: 7 was used to synthesize oligonucleotides using dRmY pool compositions.
  • the invention describes transcription conditions using mutant T3 polymerases ⁇ e.g., the Y640F mutant or the Y640L/H785A mutant) that do not require 2'-OH GTP in the transcription mixture for a high yield of 2'-OMe transcription.
  • high yield means, on average, at least one transcript per input transcription template.
  • the transcription conditions in Table 2 were used to transcribe a DNA template using the following NTPs: MNA, rGmH, rRfY and dRmY, wherein the IX transcription buffer ("Tc buffer') corresponds to: 20OmM Hepes, 4OmM DTT, 2mM Spermidine and .01% Triton X-100.
  • the DNA template used was either SEQ ID NO: 6 or SEQ ID NO: 7.
  • the transcription products generated from the transcription conditions in Table 2 can then be used for input into the SELEX TM process in order to identify aptamers and/or to determine a conserved sequence that has binding specificity to a given target.
  • the resulting sequences are already stabilized, thus eliminating the need for post-SELEX TM modification and giving a more highly stabilized aptamer.
  • the mutant T3 polymerases of the invention are also tested for their ability to promote a variety of other transcription yields by using transcription mixtures, such as, for example, a dCmD, dTmV, rTmV, rUmV or dUmV reaction mixture.
  • dCmD dTmV
  • rTmV rUmV
  • dUmV aptamers The ability of the mutant T3 polymerases of the invention to promote the production of any of these aptamers is tested by varying the components used within the transcription mixture and/or by varying the concentration of components with the transcription mixture.
  • the mutant T3 polymerase is used in conjunction with one or more of the following components: modified and/or unmodified nucleotide triphosphates, a nucleic acid transcription template, T- OH guanosine, magnesium ions, manganese ions, a non 2'-OMe guanosine non-triphosphate residue, polyalkylene glycol (e.g., polyethylene glycol), inorganic pyrophosphatase, guanosine monophosphate, guanosine diphosphate, 2'-fluoro guanosine monophosphate, 2'-fluoro guanosine diphosphate, 2 '-amino guanosine monophosphate, 2 '-amino guanosine diphosphate, 2'-deoxy guanosine monophosphate, 2'-deoxy guanosine diphosphate, buffer, detergent (e.g., Triton X-IOO), polyamine (e.g., spermine or
  • useful yields of transcripts fully incorporating T- substituted nucleotides can be obtained under conditions other than the conditions described in Table 2 above.
  • variations to the above transcription conditions may include the following.
  • the HEPES buffer concentration can range from 0 to 1 M.
  • the invention also contemplates the use of other buffering agents having a pKa between 5 and 10 including, for example, Tris-hydroxymethyl-aminomethane.
  • the DTT concentration can range from 0 to 400 mM. It is also contemplated that other reducing agents could be used, including, for example, mercaptoethanol.
  • the spermidine and/or spermine concentration can range from 0 to 20 mM.
  • the PEG-8000 concentration can range from 0 to 50% (w/v). It is also contemplated that other hydrophilic polymers including, for example, other molecular weight PEGs or other polyalkylene glycols could be used.
  • the Triton X-100 concentration can range from 0 to 0.1% (w/v). It is also contemplated that other non-ionic detergents including, for example, other detergents, such as other Triton-X detergents could be used.
  • the MgCl 2 concentration can range from 0.5 mM to 50 mM. In some embodiments, it is contemplated that the MnCl 2 concentration can range from 0.15 mM to 15 mM.
  • each NTP can range from 5 ⁇ M to 5 mM.
  • the 2'-OH GTP concentration can range from 0 ⁇ M to 300 ⁇ M.
  • the concentration of 2'-OH GMP, guanosine or other 2'-OH G substituted at a position other than the 2 '-sugar position can range from 0 to 5 mM, where 2'-OH GTP is not included in the reaction, 2'-OH GMP is required and may range from 5 ⁇ M to 5 mM.
  • the DNA template concentration can range from 5 nM to 5 ⁇ M.
  • the mutant polymerase concentration can range from 2nM to 20 ⁇ M.
  • the inorganic pyrophosphatase can range from 0 to 100 units/ml.
  • the pH can range from pH 6 to pH
  • the methods of the invention can be practiced within the pH range of activity of most polymerases that incorporate modified nucleotides.
  • the transcription reaction may be allowed to occur from one hour to weeks, preferably from 1 to 24 hours.
  • the optional use of other chelating agents in the transcription reaction mixture are contemplated, for example, EDTA, EGTA and DTT.
  • aptamers that bind to a desired target are identified, several techniques may be optionally performed in order to further increase binding and/or functional characteristics of the identified aptamer sequences.
  • Aptamers that bind to a desired target may be truncated in order to obtain the minimal aptamer sequence (also referred to herein as "minimized construct” or “minimized aptamer”) having the desired binding and/or functional characteristics.
  • minimal aptamer sequence also referred to herein as "minimized construct” or “minimized aptamer”
  • One method of accomplishing this is by using folding programs and sequence analysis, e.g., aligning clone sequences resulting from a selection to look for conserved motifs and/or covariation to inform the design of minimized constructs.
  • Biochemical probing experiments can also be performed to determine the 5' and 3' boundaries of an aptamer sequence to inform the design of minimized constructs.
  • Minimized constructs can then be chemically synthesized and tested for binding and functional characteristics as compared to the non-minimized sequence from which they were derived.
  • Variants of an aptamer sequence containing a series of 5', 3' and/or internal deletions may also be directly chemically synthesized and tested for binding and/or functional characteristics as compared to the non-minimized aptamer sequence from which they were derived.
  • doped reselections may be used to explore the sequence requirements within a single active aptamer sequence or a single minimized aptamer sequence. Doped reselections are performed using a synthetic, degenerate pool that has been designed based on the single sequence of interest. The level of degeneracy usually varies 70% to 85% from the wild type nucleotide, i.e., the single sequence of interest. In general, sequences with neutral mutations are identified through the doped reselection process, but in some cases sequence changes can result in improvements in affinity. The composite sequence information from clones identified using doped reselections can then be used to identify the minimal binding motif and aid in Medicinal Chemistry efforts.
  • Aptamer sequences and/or minimized aptamer sequences may also be modified post-SELEX TM selection using Aptamer Medicinal Chemistry to perform random or directed mutagenesis of the sequence in order to increase binding affinity and/or functional characteristics, or alternatively to determine which positions in the sequence are essential for binding activity and/or functional characteristics.
  • Aptamer Medicinal Chemistry is an aptamer improvement technique in which sets of variant aptamers are chemically synthesized. These sets of variants typically differ from the parent aptamer by the introduction of a single substituent, and differ from each other by the location of this substituent. These variants are then compared to each other and to the parent. Improvements in characteristics may be profound enough that the inclusion of a single substituent may be all that is necessary to achieve a particular therapeutic criterion. [00112] Alternatively, the information gleaned from the set of single variants may be used to design further sets of variants in which more than one substituent is introduced simultaneously.
  • all of the single substituent variants are ranked, the top 4 are chosen and all possible double (6), triple (4) and quadruple (1) combinations of these 4 single substituent variants are synthesized and assayed.
  • the best single substituent variant is considered to be the new parent and all possible double substituent variants that include this highest-ranked single substituent variant are synthesized and assayed.
  • Other strategies may be used, and these strategies may be applied repeatedly such that the number of substituents is gradually increased while continuing to identify further-improved variants.
  • Aptamer Medicinal Chemistry may be used particularly as a method to explore the local, rather than the global, introduction of substituents. Because aptamers are discovered within libraries that are generated by transcription, any substituents that are introduced during the SELEX process must be introduced globally. For example, if it is desired to introduce phosphorothioate linkages between nucleotides then they can only be introduced at every A (or every G, C, T, U, etc.) if globally substituted. Aptamers that require phosphorothioates at some As (or some G, C, T, U, etc.) (locally substituted) but can not tolerate it at other As (or some G, C, T, U, etc.) can not be readily discovered by this process.
  • Aptamer Medicinal Chemistry schemes may include substituents that introduce steric bulk, hydrophobicity, hydrophilicity, lipophilicity, lipophobicity, positive charge, negative charge, neutral charge, zwitterions, polarizability, nuclease-resistance, conformational rigidity, conformational flexibility, protein-binding characteristics, mass, etc.
  • Aptamer Medicinal Chemistry schemes may include base-modifications, sugar-modifications or phosphodiester linkage-modifications.
  • Substituents already present in the body e.g., 2'-deoxy, 2'-ribo, 2'-O-methyl purines or pyrimidines, or 5-methyl cytosine.
  • the aptamers of the invention include aptamers developed through Aptamer Medicinal Chemistry as described herein.
  • Target binding affinity of the aptamers can be assessed through a series of binding reactions between the aptamer and the target (e.g., a protein) in which trace 32 P-labeled aptamer is incubated with a dilution series of the target in a buffered medium and then analyzed by nitrocellulose filtration using a vacuum filtration manifold.
  • the dot blot binding assay uses a three layer filtration medium consisting (from top to bottom) of nitrocellulose, nylon filter and gel blot paper. RNA that is bound to the target is captured on the nitrocellulose filter whereas the non-target bound RNA is captured on the nylon filter.
  • the gel blot paper is included as a supporting medium for the other filters. Following filtration, the filter layers are separated, dried and exposed on a phosphor screen and quantified using a phosphorimaging system. The quantified results can be used to generate aptamer binding curves from which dissociation constants (K D ) can be calculated.
  • the buffered medium used to perform the binding reactions is IX Dulbecco's PBS (with Ca ++ and Mg ++ ) plus 0.1 mg/mL BSA.
  • the ability of an aptamer to modulate the functional activity of a target i.e., the functional activity of the aptamer
  • the aptamers of the invention may inhibit a known biological function of the target.
  • the aptamers of the invention may stimulate a known biological function of the target.
  • the functional activity of aptamers can be assessed using in vitro and in vivo models designed to measure a known function of the aptamer target.
  • the aptamers of the invention may be routinely adapted for diagnostic purposes according to any number of techniques employed by those skilled in the art.
  • Diagnostic utilization may include both in vivo or in vitro diagnostic applications. Diagnostic agents need only be able to allow the user to identify the presence of a given target at a particular locale or concentration. The ability to form binding pairs with the target may be sufficient to trigger a positive signal for diagnostic purposes. Those skilled in the art would also be able to adapt any aptamer by procedures known in the art to incorporate a labeling tag in order to track the presence of such ligand. Such a tag could be used in a number of diagnostic procedures.
  • TLR 9 Toll-like receptor 9
  • ODN unmethylated oligodeoxynucleotide
  • CpG ODNs can provide protection against infectious diseases, function as immuno-adjuvants or cancer therapeutics (monotherapy or in combination with a mAb or other therapies), and can decrease asthma and allergic responses.
  • Aptamers of the invention may comprise one or more CpG or other immunostimulatory sequences.
  • Such aptamers can be identified or generated by a variety of strategies using, e.g., the SELEX TM process described herein. In general, the strategies can be divided into two groups. In group one, the strategies are directed to identifying or generating aptamers comprising both a CpG motif (or other immunostimulatory sequence) as well as a binding site for a target, where the target (hereinafter "non-CpG target”) is a target other than one known to recognize CpG motifs (or other immunostimulatory sequences) and known to stimulates an immune response upon binding to a CpG motif.
  • non-CpG target is a target other than one known to recognize CpG motifs (or other immunostimulatory sequences) and known to stimulates an immune response upon binding to a CpG motif.
  • the first strategy of this group comprises the steps of performing SELEX to obtain an aptamer to a specific non-CpG target using an oligonucleotide pool wherein a CpG motif has been incorporated into each member of the pool as, or as part of, a fixed region, e.g., in some embodiments the randomized region of the pool members comprises a fixed region having a CpG motif incorporated therein, and identifying an aptamer comprising a CpG motif.
  • the second strategy of this group comprises the steps of performing SELEX TM to obtain an aptamer to a specific non-CpG target, and appending a CpG motif to the 5' and/or 3' end or engineering a CpG motif into a region, preferably a non-essential region, of the aptamer.
  • the third strategy of this group comprises the steps of performing SELEX TM to obtain an aptamer to a specific non-CpG target, wherein during synthesis of the pool the molar ratio of the various nucleotides is biased in one or more nucleotide addition steps so that the randomized region of each member of the pool is enriched in CpG motifs, and identifying an aptamer comprising a CpG motif.
  • the fourth strategy of this group comprises the steps of performing SELEX to obtain an aptamer to a specific non-CpG target, and identifying an aptamer comprising a CpG motif.
  • the fifth strategy of this group comprises the steps of performing SELEX to obtain an aptamer to a specific non-CpG target, and identifying an aptamer which, upon binding, stimulates an immune response but that does not comprise a CpG motif.
  • the strategies are directed to identifying or generating aptamers comprising a CpG motif and/or other sequences that are bound by the receptors for the CpG motifs (e.g., TLR9 or the other Toll-like receptors) and upon binding stimulate an immune response.
  • CpG motifs e.g., TLR9 or the other Toll-like receptors
  • the first strategy of this group comprises the steps of performing SELEX TM to obtain an aptamer to a target known to bind to CpG motifs (or other immunostimulatory sequences) and upon binding stimulate an immune response, using an oligonucleotide pool wherein a CpG motif has been incorporated into each member of the pool as, or as part of, a fixed region, e.g., in some embodiments the randomized region of the pool members comprise a fixed region having a CpG motif incorporated therein, and identifying an aptamer comprising a CpG motif.
  • the second strategy of this group comprises the steps of performing SELEX to obtain an aptamer to a target known to bind to CpG motifs (or other immunostimulatory sequences) and upon binding stimulate an immune response, and then appending a CpG motif to the 5' and/or 3' end or engineering a CpG motif into a region, preferably a non-essential region, of the aptamer.
  • the third strategy of this group comprises the steps of performing SELEX to obtain an aptamer to a target known to bind to CpG motifs (or other immunostimulatory sequences) and upon binding stimulate an immune response, wherein during synthesis of the pool, the molar ratio of the various nucleotides is biased in one or more nucleotide addition steps so that the randomized region of each member of the pool is enriched in CpG motifs, and identifying an aptamer comprising a CpG motif.
  • the fourth strategy of this group comprises the steps of performing SELEX TM to obtain an aptamer to a target known to bind to CpG motifs (or other immunostimulatory sequences) and upon binding stimulate an immune response, and identifying an aptamer comprising a CpG motif.
  • the fifth strategy of this group comprises the steps of performing SELEX to obtain an aptamer to a target known to bind to CpG motifs (or other immunostimulatory sequences), and identifying an aptamer that upon binding stimulates an immune response but that does not comprise a CpG motif.
  • CpG motifs A variety of different classes of CpG motifs have been identified, each resulting in a different cascade of events, release of cytokines and other molecules, and activation of certain cell types. See, e.g., CpG Motifs in Bacterial DNA and Their Immune Effects, Annu.
  • aptamers The choice of aptamers is dependent upon the disease or disorder to be treated.
  • Preferred immunostimulatory motifs are as follows (shown 5' to 3' left to right) wherein “r” designates a purine, “y” designates a pyrimidine, and "X” designates any nucleotide: AACGTTCGAG (SEQ ID NO: 8); AACGTT; ACGT, rCGy; rrCGyy, XCGX, XXCGXX, and XiX 2 CGYiY 2 wherein Xi is G or A, X 2 is not C, Yi is not G and Y 2 is preferably T.
  • the CpG is preferably located in a non-essential region of the aptamer.
  • Non-essential regions of aptamers can be identified by site-directed mutagenesis, deletion analyses and/or substitution analyses. However, any location that does not significantly interfere with the ability of the aptamer to bind to the non-CpG target may be used.
  • the CpG motif may be appended to either or both of the 5' and 3' ends or otherwise attached to the aptamer. Any location or means of attachment may be used so long as the ability of the aptamer to bind to the non-CpG target is not significantly interfered with.
  • stimulation of an immune response can mean either (1) the induction of a specific response (e.g., induction of a ThI response) or the production of certain molecules or (2) the inhibition or suppression of a specific response (e.g., inhibition or suppression of the Th2 response) or of certain molecules.
  • aptamers Modulation of Pharmacokinetics and Biodistribution of Aptamer Therapeutics
  • aptamers While aptamers directed against extracellular targets do not suffer from difficulties associated with intracellular delivery (as is the case with antisense and RNAi-based therapeutics), such aptamers must still be able to be distributed to target organs and tissues, and remain in the body (unmodified) for a period of time consistent with the desired dosing regimen.
  • the invention provides materials and methods to affect the pharmacokinetics of aptamer compositions, and, in particular, the ability to tune aptamer pharmacokinetics.
  • the tunability of (i.e., the ability to modulate) aptamer pharmacokinetics is achieved through conjugation of modifying moieties (e.g., PEG polymers) to the aptamer and/or the incorporation of modified nucleotides (e.g., 2'-fluoro or 2'-O-methyl) to alter the chemical composition of the nucleic acid.
  • modifying moieties e.g., PEG polymers
  • modified nucleotides e.g., 2'-fluoro or 2'-O-methyl
  • aptamers in the circulation it is desirable to decrease the residence times of aptamers in the circulation.
  • maintenance therapies where systemic circulation of a therapeutic is desired, it may be desirable to increase the residence times of aptamers in circulation.
  • the tunability of aptamer pharmacokinetics is used to modify the biodistribution of an aptamer therapeutic in a subject.
  • the aptamer therapeutic preferentially accumulates in a specific tissue or organ(s).
  • PEGylation of an aptamer therapeutic e.g. , PEGylation with a 20 kDa PEG polymer
  • PEGylation of an aptamer therapeutic is used to target inflamed tissues, such that the PEGylated aptamer therapeutic preferentially accumulates in inflamed tissue.
  • aptamer therapeutics e.g., aptamer conjugates or aptamers having altered chemistries, such as modified nucleotides
  • parameters include, for example, the half- life (ti/2), the plasma clearance (Cl), the volume of distribution (Vss), the area under the concentration-time curve (AUC), maximum observed serum or plasma concentration (C max ), and the mean residence time (MRT) of an aptamer composition.
  • the term "AUC" refers to the area under the plot of the plasma concentration of an aptamer therapeutic versus the time after aptamer administration.
  • the AUC value is used to estimate the bioavailability (i.e., the percentage of administered aptamer therapeutic in the circulation after aptamer administration) and/or total clearance (Cl) (i.e., the rate at which the aptamer therapeutic is removed from circulation) of a given aptamer therapeutic.
  • the volume of distribution relates the plasma concentration of an aptamer therapeutic to the amount of aptamer present in the body. The larger the Vss, the more an aptamer is found outside of the plasma (i.e., the more extravasation).
  • the invention provides materials and methods to modulate, in a controlled manner, the pharmacokinetics and biodistribution of stabilized aptamer compositions in vivo by conjugating an aptamer to a modulating moiety, such as a small molecule, peptide, or polymer terminal group, or by incorporating modified nucleotides into an aptamer.
  • a modulating moiety such as a small molecule, peptide, or polymer terminal group
  • conjugation of a modifying moiety and/or altering nucleotide(s) chemical composition alters fundamental aspects of aptamer residence time in the circulation and distribution to tissues.
  • oligonucleotide therapeutics are subject to elimination via renal filtration.
  • a nuclease-resistant oligonucleotide administered intravenously typically exhibits an in vivo half-life of ⁇ 10 min, unless filtration can be blocked. This can be accomplished by either facilitating rapid distribution out of the blood and into tissues, or by increasing the apparent molecular weight of the oligonucleotide above the effective size cut-off for the glomerulus. Conjugation of small therapeutics to a PEG polymer (PEGylation) can dramatically lengthen residence times of aptamers in the circulation, thereby decreasing dosing frequency and enhancing effectiveness against vascular targets.
  • PEGylation PEGylation
  • Aptamers can be conjugated to a variety of modifying moieties, such as high molecular weight polymers, e.g., PEG; peptides, e.g., Tat (a 13-amino acid fragment of the HIV Tat protein (Vives, et al. (1997), J. Biol. Chem. 272(25): 16010-7)), Ant (a 16-amino acid sequence derived from the third helix of the Drosophila antennapedia homeotic protein (Pietersz, et al.
  • modifying moieties such as high molecular weight polymers, e.g., PEG; peptides, e.g., Tat (a 13-amino acid fragment of the HIV Tat protein (Vives, et al. (1997), J. Biol. Chem. 272(25): 16010-7)), Ant (a 16-amino acid sequence derived from the third helix of the Drosophila antennapedia homeotic protein (Pietersz
  • Arg 7 a short, positively charged cell-permeating peptides composed of polyarginine (Arg 7 ) (Rothbard, et al. (2000), Nat. Med. 6(11): 1253-7; Rothbard, J et al. (2002), J. Med. Chem. 45(17): 3612-8)); and small molecules, e.g., lipophilic compounds, such as cholesterol.
  • Arg 7 polyarginine
  • small molecules e.g., lipophilic compounds, such as cholesterol.
  • complexation of a mixed 2'-F and 2'-0Me modified aptamer therapeutic with a 20 kDa PEG polymer hinders renal filtration and promotes aptamer distribution to both healthy and inflamed tissues.
  • the 20 kDa PEG polymer-aptamer conjugate proves nearly as effective as a 40 kDa PEG polymer in preventing renal filtration of aptamers. While one effect of PEGylation is on aptamer clearance, the prolonged systemic exposure afforded by presence of the 20 kDa moiety also facilitates distribution of aptamer to tissues, particularly those of highly perfused organs and those at the site of inflammation.
  • the aptamer-20 kDa PEG polymer conjugate directs aptamer distribution to the site of inflammation, such that the PEGylated aptamer preferentially accumulates in inflamed tissue.
  • the 20 kDa PEGylated aptamer conjugate is able to access the interior of cells, such as, for example, kidney cells.
  • Modified nucleotides can also be used to modulate the plasma clearance of aptamers.
  • an unconjugated aptamer that incorporates both 2'-F and 2'-0Me stabilizing chemistries which exhibits a high degree of nuclease stability in vitro and in vivo, displays rapid loss from plasma ⁇ i.e., rapid plasma clearance) and a rapid distribution into tissues, primarily into the kidney, when compared to unmodified aptamer.
  • nucleic acids with high molecular weight non-immunogenic polymers has the potential to alter the pharmacokinetic and pharmacodynamic properties of nucleic acids and make them more effective therapeutic agents.
  • Favorable changes in activity can include increased resistance to degradation by nucleases, decreased filtration through the kidneys, decreased exposure to the immune system, and altered distribution of the therapeutic throughout the body.
  • the aptamer compositions may be derivatized with polyalkylene glycol
  • PAG PAG-derivatized nucleic acids
  • PEG polyethylene glycol
  • PEO polyethylene oxide
  • PEG polyethylene glycol
  • PEO polyethylene oxide
  • PEG polypropylene glycol
  • random or block copolymers of different alkylene oxides ⁇ e.g., ethylene oxide and propylene oxide
  • a polyalkylene glycol such as PEG
  • PEG is a linear polymer terminated at each end with hydroxyl groups: HO-CH 2 CH 2 O-(CH 2 CH 2 O) n -CH 2 CH 2 -OH.
  • This polymer, alpha-, omega-dihydroxylpolyethylene glycol, can also be represented as HO-PEG-OH, where it is understood that the -PEG- symbol represents the following structural unit: -CH 2 CH 2 O- (CH 2 CH 2 O) n -CH 2 CH 2 -, where n typically ranges from about 4 to about 10,000.
  • the PEG molecule is di-functional and is sometimes referred to as
  • PEG diol The terminal portions of the PEG molecule are relatively non-reactive hydroxyl moieties, the -OH groups, that can be activated or converted to functional moieties for attachment of the PEG to other compounds at reactive sites on the compound.
  • activated PEG diols are referred to herein as bi-activated PEGs.
  • the terminal moieties of PEG diol have been functionalized as active carbonate ester for selective reaction with amino moieties by substitution of the relatively non-reactive hydroxyl moieties, with succinimidyl active ester moieties from N-hydroxy succinimide.
  • PEG molecule on one end it is desirable to cap the PEG molecule on one end with an essentially non-reactive moiety so that the PEG molecule is mono-functional (or mono- activated).
  • bi-functional activated PEGs lead to extensive cross-linking, yielding poorly functional aggregates.
  • mono-activated PEGs one hydroxyl moiety on the terminus of the PEG diol molecule is typically substituted with a non-reactive methoxy end moiety, -OCH3.
  • the other, un-capped terminus of the PEG molecule is typically converted to a reactive end moiety that can be activated for attachment at a reactive site on a surface or a molecule, such as a protein.
  • PAGs are polymers that typically have the properties of solubility in water and in many organic solvents, lack of toxicity, and lack of immunogenicity.
  • One use of PAGs is to covalently attach the polymer to insoluble molecules to make the resulting PAG-molecule "conjugate" soluble.
  • the water-insoluble drug paclitaxel when coupled to PEG, becomes water-soluble. Greenwald, et al, J. Org. Chem., 60:331-336 (1995).
  • PAG conjugates are often used not only to enhance solubility and stability, but also to prolong the blood circulation half-life of molecules.
  • Polyalkylated compounds of the invention are typically between 5 and 80 kDa in size, however any size can be used, the choice dependent on the aptamer and application.
  • Other PAG compounds of the invention are between 10 and 80 kDa in size.
  • Still other PAG compounds of the invention are between 10 and 60 kDa in size.
  • a PAG polymer may be at least 10, 20, 30, 40, 50, 60, 70 or 80 kDa in size.
  • Such polymers can be linear or branched.
  • the polymers are PEG.
  • nucleic acid therapeutics are typically chemically synthesized from activated monomer nucleotides.
  • PEG- nucleic acid conjugates may be prepared by incorporating the PEG using the same iterative monomer synthesis.
  • PEGs activated by conversion to a phosphoramidite form can be incorporated into solid-phase oligonucleotide synthesis.
  • oligonucleotide synthesis can be completed with site-specific incorporation of a reactive PEG attachment site. Most commonly this has been accomplished by addition of a free primary amine at the 5'- terminus (incorporated using a modifier phosphoramidite in the last coupling step of solid phase synthesis).
  • a reactive PEG e.g., one which is activated so that it will react and form a bond with an amine
  • the coupling reaction is carried out in solution.
  • the ability of PEG conjugation to alter the biodistribution of a therapeutic is related to a number of factors, including the apparent size (e.g., as measured in terms of hydrodynamic radius) of the conjugate. Larger conjugates (>1 OkDa) are known to more effectively block filtration via the kidney and to consequently increase the serum half-life of small macromolecules (e.g., peptides, antisense oligonucleotides). The ability of PEG conjugates to block filtration has been shown to increase with PEG size, up to approximately 50 kDa (further increases have minimal beneficial effect as half life becomes defined by macrophage-mediated metabolism rather than elimination via the kidneys).
  • small macromolecules e.g., peptides, antisense oligonucleotides
  • Branched activated PEGs will have more than two termini, and in cases where two or more termini have been activated, such activated higher molecular weight PEG molecules are referred to herein as, multi-activated PEGs. In some cases, not all termini in a branched PEG molecule are activated. In cases where any two termini of a branched PEG molecule are activated, such PEG molecules are referred to as bi-activated PEGs. In some cases where only one terminus in a branched PEG molecule is activated, such PEG molecules are referred to as mono-activated.
  • the invention provides another cost effective route to the synthesis of high molecular weight PEG-nucleic acid (preferably, aptamer) conjugates, including multiply PEGylated nucleic acids.
  • PEG-nucleic acid preferably, aptamer
  • the invention also encompasses PEG-linked multimeric oligonucleotides, e.g., dimerized aptamers.
  • the invention also relates to high molecular weight compositions where a PEG stabilizing moiety is a linker that separates different portions of an aptamer, e.g. , the PEG is conjugated within a single aptamer sequence such that the linear arrangement of the high molecular weight aptamer composition is, e.g., nucleic acid-PEG- nucleic acid (-PEG-nucleic acid) n , where n is greater than or equal to 1.
  • High molecular weight compositions of the invention include those having a molecular weight of at least 10 kDa. Compositions typically have a molecular weight between 10 and 80 kDa in size. High molecular weight compositions of the invention are at least 10, 20, 30, 40, 50, 60, 70 or 80 kDa in size.
  • a stabilizing moiety is a molecule or portion of a molecule that improves pharmacokinetic and pharmacodynamic properties of the high molecular weight aptamer compositions of the invention.
  • a stabilizing moiety is a molecule or portion of a molecule that brings two or more aptamers or aptamer domains into proximity, or provides decreased overall rotational freedom of the high molecular weight aptamer compositions of the invention.
  • a stabilizing moiety can be a polyalkylene glycol, such a polyethylene glycol, which can be linear or branched, a homopolymer or a heteropolymer.
  • Other stabilizing moieties include polymers, such as peptide nucleic acids (PNA).
  • Oligonucleotides can also be stabilizing moieties, such oligonucleotides can include modified nucleotides, and/or modified linkages, such as phosphorothioates.
  • a stabilizing moiety can be an integral part of an aptamer composition, i.e., it is covalently bonded to the aptamer.
  • compositions of the invention include high molecular weight aptamer compositions in which two or more nucleic acid moieties are covalently conjugated to at least one polyalkylene glycol moiety.
  • the polyalkylene glycol moieties serve as stabilizing moieties.
  • the primary structure of the covalent molecule includes the linear arrangement nucleic acid-PAG- nucleic acid.
  • One example is a composition having the primary structure nucleic acid-PEG- nucleic acid.
  • Another example is a linear arrangement of: nucleic acid-PEG-nucleic acid-PEG- nucleic acid.
  • the nucleic acid is originally synthesized such that it bears a single reactive site (e.g., it is mono-activated).
  • this reactive site is an amino group introduced at the 5 '-terminus by the addition of a modifier phosphoramidite as the last step in solid phase synthesis of the oligonucleotide.
  • a modifier phosphoramidite as the last step in solid phase synthesis of the oligonucleotide.
  • the concentration of oligonucleotide is 1 mM and the reconstituted solution contains 200 mM NaHCOs buffer, pH 8.3.
  • Synthesis of the conjugate is initiated by slow, step-wise addition of highly purified bi-functional PEG.
  • the PEG diol is activated at both ends (bi-activated) by derivatization with succinimidyl propionate.
  • the PEG-nucleic acid conjugate is purified by gel electrophoresis or liquid chromatography to separate fully-, partially- and un-conjugated species.
  • Multiple PAG molecules concatenated as random or block copolymers or smaller PAG chains can be linked to achieve various lengths (or molecular weights).
  • Non-PAG linkers can be used between PAG chains of varying lengths.
  • the 2'-O-methyl, 2'-fluoro and other modified nucleotide modifications stabilize the aptamer against nucleases and increase its half life in vivo.
  • the 3'-dT cap also increases exonuclease resistance. See, e.g., U.S. Patents Nos. 5,674,685; 5,668,264; 6,207,816 and 6,229,002; each of which is incorporated by reference herein in its entirety.
  • High molecular weight PAG-nucleic acid-PAG conjugates can be prepared by reaction of a mono-functional activated PEG with a nucleic acid containing more than one reactive site.
  • the nucleic acid is bi-reactive, or bi-activated, and contains two reactive sites: a 5 '-amino group and a 3 '-amino group introduced into the oligonucleotide through conventional phosphoramidite synthesis, for example: 3'-5'-di-PEGylation, as illustrated in Figure 2.
  • reactive sites can be introduced at internal positions, using for example, the 5-position of pyrimidines, the 8-position of purines, or the T- position of ribose as sites for attachment of primary amines.
  • the nucleic acid can have several activated or reactive sites and is said to be multiply activated.
  • the modified oligonucleotide is combined with the mono-activated PEG under conditions that promote selective reaction with the oligonucleotide reactive sites while minimizing spontaneous hydrolysis.
  • monomethoxy-PEG is activated with succinimidyl propionate and the coupled reaction is carried out at pH 8.3.
  • the linking domains can also have one or more polyalkylene glycol moieties attached thereto.
  • PAGs can be of varying lengths and may be used in appropriate combinations to achieve the desired molecular weight of the composition.
  • the effect of a particular linker can be influenced by both its chemical composition and length.
  • a linker that is too long, too short, or forms unfavorable steric and/or ionic interactions with the target will preclude the formation of a complex between the aptamer and the target.
  • a linker, which is longer than necessary to span the distance between nucleic acids, may reduce binding stability by diminishing the effective concentration of the ligand. Thus, it is often necessary to optimize linker compositions and lengths in order to maximize the affinity of an aptamer to a target.
  • T3 RNA polymerases for use in the methods of the invention were prepared as follows. i) Preparation and Amplification of T3
  • T3 bacteriophage ATCC #BAA-1O25-B1
  • T3 was then amplified via polymerase chain reaction ("PCR") using the following T3-5 'primer: CW339.122.A (BamHI site underline) TCA CCA TCA CGG ATC CAT GAA CAT CAT CGA AAA CAT CGA AAA G (SEQ ID NO: 9) and T3-3 'primer: CW339.122.B (Hindlll site underlined) TCA GCT AAT TAA GCT TGT TAT GCA AAG GCA AAG TCA GAC TTG (SEQ ID NO: 10).
  • PCR polymerase chain reaction
  • T3 LA Mutant Polymerase was screened by sequencing and the product was then subcloned into T3 RNAP expression vector (via BamHl/Hindlll site). The clones produced from this reaction were transformed into BL21(DE3) competent cells (Stratagene, CA).
  • T3 Single Mutant Polymerase Expression Vector [00155] In order to produce the T3 Single Mutant from T3 produced according to the teaching in Section i) above, a mutation was introduced using: i) the forward primer: GGTCATGACGCTGGCTTTCGGTTCCAAGGAGTTCG (SEQ ID NO: 13) and ii) the reverse primer: CGAACTCCTTGGAACCGAAAGCCAGCGTCATGACC (SEQ ID NO: 14). The clones produced from this reaction were transformed into BL21 (DE3) competent cells (Stratagene, CA). iv) Expression and Production of Mutant T3 Polymerases
  • the expression vector comprising the mutant T3 polymerase nucleic acid sequences (e.g., the T3 LA Mutant or the T3 Single Mutant) was transformed into BL21 (DE3) competent cells as described above, these cells were incubated on ice for 20 minutes. Heat shock was then performed by putting the cell containing tubes in a 42 0 C water bath for 2 minutes. After performing heat shock, these tubes were returned to ice for 1 minute. 1 ml of L broth ("LB”) was added to each tube and the tubes were then incubated at 37 0 C, with shaking, for 45 minutes. 100 ⁇ l of culture liquid from each tube was plated onto LB+Amp agar plates and incubated at 37 0 C overnight.
  • LB L broth
  • LB-Amp+ (150ug/ml) and then maintained at 37 0 C overnight.
  • two 4-liter flasks containing 2 liters of pre-warmed LB+Amp were inoculated with 50 ml of overnight culture and grown at 37 0 C until the OD600 reached between 0.6-0.8.
  • 200 ⁇ l of IM IPTG was then added to each 2L cell culture with a final concentration of 100 ⁇ M and grown for another 3 hours at 37°C. The cells were then pelleted by spinning at 5000 rpm for 10 minutes.
  • Cells were then resuspended in a 200 ml lysis buffer (50 mM Tris-Cl, pH 8.0, 100 mM NaCl, 5% Glycerol, 1 mM imidazole, betamercaptoethanol (“BME”) 5mM) and divided into 6 conical 50 ml tubes. The cells were sonicated and then bacterial debris was spun down at 11,000 rpm for 60 minutes.
  • a 200 ml lysis buffer 50 mM Tris-Cl, pH 8.0, 100 mM NaCl, 5% Glycerol, 1 mM imidazole, betamercaptoethanol (“BME”) 5mM
  • the resulting supernatant was then filtered through a 0.22 ⁇ M filter. Imidazole was then added to the filtrate to a final concentration of 10 mM. The filtrate was then loaded onto a 5 ml Ni-NTA column (GE Healthcare Bio-Sciences, NJ) with sample pump. The column was washed with 10 column volumes ("CVs") of Buffer A (50 mM Tris-Cl, pH 8.0, 100 mM NaCl, 5% Glycerol, 10 mM imidazole, BME 10 mM) containing 20 mM imidazole. The column was then washed with 10 CVs of buffer with a linear gradient of imidazole concentration from 40 mM to 70 mM in buffer A.
  • Buffer A 50 mM Tris-Cl, pH 8.0, 100 mM NaCl, 5% Glycerol, 10 mM imidazole, BME 10 mM
  • the protein was then eluted with 6 CVs of Buffer B (50 mM Tris-Cl, pH 8.0, 100 mM NaCl, 5% Glycerol, 250 mM imidazole, BMElO mM). [00159] After checking the collection fractions with 5 ⁇ l of sample on 4-12% SDS-
  • N indicates a degenerate position with an approximately equal probability of being any one of: adenine (A), thymidine (T), guanine (G) or cytosine (C). All sequences are listed in the 5' to 3' direction.
  • GGGAGAGGAGAACGTTCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG GTCGATCGATCGATCATCGATG (SEQ ID NO: 7) 5 ' -primer (KMT .172.141.K) : TAATACGACTCACTATAGGGAGAGGAGAACGTTCACT (SEQ ID NO: 17)
  • % indicates a partially degenerate position with an approximately 85% probability of this position being the nucleotide indicated to the right of the "%” and approximately 5% probability of this position being each of the remaining three possible nucleotides (ex., %A ⁇ 85% A, 5% C, 5% G, 5% T). AU sequences are listed in the 5' to 3' direction.
  • the resultant double-stranded transcription template was then used to program a transcription mixture with the T3 polymerase construct Y640F (6 ⁇ g/mL) and the rRfY composition of NTPs to generate a SELEX pool.
  • the transcription mixture was incubated at 37°C for -16 hours. After incubation, the mixtures were precipitated with ethanol.
  • the resultant pellet was dissolved and purified using denaturing PAGE (10% acrylamide).
  • the transcription sample was visualized using UV shadow and the gel pieces that contained the transcript were removed with a razor blade. The transcription was eluted from the gel, ethanol precipitated, and resuspended for use in SELEX experiments.
  • SELEX experiments were carried out by first immobilizing the protein target
  • the resulting DNA strand was then used to program a polymerase chain reaction, with the appropriate 5'- and 3 '-primers, to generate a double-stranded transcription template.
  • the resultant double-stranded transcription template was then used to program a transcription mixture with the T3 polymerase construct Y640F (6 ⁇ g/mL) and the rRfY composition of NTPs to generate a SELEX pool enriched for target-binding aptamers for use in the next round of selection.
  • the transcription reactions were carried out at either 37°C or 32°C and purified using denaturing PAGE, as above. Four selection rounds were carried out against ⁇ v ⁇ 3, with a selection round consisting of one cycle of binding reaction, reverse transcription, polymerase chain reaction, and transcription with T3 polymerase mutant Y640F.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L’invention concerne des matériaux et des procédés de production, avec des polymérases mutantes, d’aptamères ayant des nucléotides triphosphates modifiés.
PCT/US2009/039780 2008-04-08 2009-04-07 Compositions et procédés d’utilisation d’arn polymérases t3 mutantes dans la synthèse de produits de transcription d’acide nucléique modifiés WO2009126632A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US12350008P 2008-04-08 2008-04-08
US61/123,500 2008-04-08

Publications (1)

Publication Number Publication Date
WO2009126632A1 true WO2009126632A1 (fr) 2009-10-15

Family

ID=41162221

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/039780 WO2009126632A1 (fr) 2008-04-08 2009-04-07 Compositions et procédés d’utilisation d’arn polymérases t3 mutantes dans la synthèse de produits de transcription d’acide nucléique modifiés

Country Status (1)

Country Link
WO (1) WO2009126632A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012169916A3 (fr) * 2011-06-08 2013-03-07 Międzynarodowy Instytut Biologii Molekularnej I Komórkowej Ribunucléase h issue du génie génétique à spécificité de séquence et procédé pour déterminer la préférence de séquence de protéine de liaison d'hybride adn-arn
US20130224793A1 (en) * 2012-02-24 2013-08-29 University Of Massachusetts Modified t7-related rna polymerases and methods of use thereof
WO2019057835A1 (fr) * 2017-09-20 2019-03-28 Institut Pasteur Mutants d'adn polymérase thêta, méthodes de production de ces mutants et leurs utilisations

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030165976A1 (en) * 1996-09-13 2003-09-04 Rui Sousa Methods for using mutant RNA polymerases with reduced discrimination between non-canonical and canonical nucleoside triphosphates
US20070117112A1 (en) * 2005-06-30 2007-05-24 Diener John L Materials and methods for the generation of fully 2'-modified nucleic acid transcripts

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030165976A1 (en) * 1996-09-13 2003-09-04 Rui Sousa Methods for using mutant RNA polymerases with reduced discrimination between non-canonical and canonical nucleoside triphosphates
US20070117112A1 (en) * 2005-06-30 2007-05-24 Diener John L Materials and methods for the generation of fully 2'-modified nucleic acid transcripts

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] March 2005 (2005-03-01), XP003025549, retrieved from http://www.ncbi.nlm.nih.gov/nuccore/61846736 accession no. NCBI Database accession no. CS038864 *
DATABASE PROTEIN [online] May 2005 (2005-05-01), XP003025548, retrieved from http://www.ncbi.nlm.nih.gov/protein/75093396 accession no. NCBI Database accession no. Q778M8 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012169916A3 (fr) * 2011-06-08 2013-03-07 Międzynarodowy Instytut Biologii Molekularnej I Komórkowej Ribunucléase h issue du génie génétique à spécificité de séquence et procédé pour déterminer la préférence de séquence de protéine de liaison d'hybride adn-arn
EP2857506A3 (fr) * 2011-06-08 2015-04-29 Miedzynarodowy Instytut Biologii Molekularnej I Komorkowej Ribonuclease H modifiée à sequence spécifique et méthode pour déterminer la préference de séquence de protéines de liaison d'hybride ADN-ARN
US9353358B2 (en) 2011-06-08 2016-05-31 Miedzynarodowy Instytut Biologii Molekularnej I Komorkowej Sequence-specific engineered ribonuclease H and the method for determining the sequence preference of DNA-RNA hybrid binding proteins
US20130224793A1 (en) * 2012-02-24 2013-08-29 University Of Massachusetts Modified t7-related rna polymerases and methods of use thereof
US9045740B2 (en) * 2012-02-24 2015-06-02 University Of Massachusetts Modified T7-related RNA polymerases and methods of use thereof
WO2019057835A1 (fr) * 2017-09-20 2019-03-28 Institut Pasteur Mutants d'adn polymérase thêta, méthodes de production de ces mutants et leurs utilisations
US11384345B2 (en) 2017-09-20 2022-07-12 Institut Pasteur DNA polymerase theta mutants, methods of producing these mutants, and their uses

Similar Documents

Publication Publication Date Title
AU2006265896B2 (en) Materials and methods for the generation of fully 2'-modified nucleic acid transcripts
AU2007337810B2 (en) Materials and methods for the generation of transcripts comprising modified nucleotides
US8101385B2 (en) Materials and methods for the generation of transcripts comprising modified nucleotides
EP1737879B1 (fr) Delivrance intracellulaire oligonucleotides therapeutiques mediee par des aptameres
CA2578046A1 (fr) Chimie medicale utilisant des aptameres
JP2006508688A (ja) ２’−置換核酸のインビトロ選択のための方法
AU2005220910A1 (en) Aptamers to the human IL-12 cytokine family and their use as autoimmune disease therapeutics
US20080214489A1 (en) Aptamer-mediated intracellular delivery of oligonucleotides
US20090081679A1 (en) Compositions and methods for in vivo SELEX
WO2005052121A2 (fr) Aptameres multivalents
US7579450B2 (en) Nucleic acid ligands specific to immunoglobulin E and their use as atopic disease therapeutics
WO2009126632A1 (fr) Compositions et procédés d’utilisation d’arn polymérases t3 mutantes dans la synthèse de produits de transcription d’acide nucléique modifiés
AU2005245793A1 (en) Nucleic acid ligands specific to immunoglobulin e and their use as atopic disease therapeutics
JP5349323B2 (ja) 修飾ヌクレオチドを含む転写物を生成させるための材料および方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09729568

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09729568

Country of ref document: EP

Kind code of ref document: A1