WO2009109611A1 - Comosition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures - Google Patents

Comosition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures Download PDF

Info

Publication number
WO2009109611A1
WO2009109611A1 PCT/EP2009/052575 EP2009052575W WO2009109611A1 WO 2009109611 A1 WO2009109611 A1 WO 2009109611A1 EP 2009052575 W EP2009052575 W EP 2009052575W WO 2009109611 A1 WO2009109611 A1 WO 2009109611A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotides
seq
pair
nucleic acid
acid sequence
Prior art date
Application number
PCT/EP2009/052575
Other languages
French (fr)
Inventor
Markus Schmitt
Michael Pawlita
Original Assignee
DKFZ Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by DKFZ Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts filed Critical DKFZ Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts
Priority to US12/920,095 priority Critical patent/US9034604B2/en
Priority to EP09717728.1A priority patent/EP2262908B1/en
Publication of WO2009109611A1 publication Critical patent/WO2009109611A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/702—Specific hybridization probes for retroviruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • composition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures
  • the present invention relates to a method for determining contaminations in a cell culture sample comprising the steps of (a) contacting a sample of a cell culture suspected to comprise contaminations with a composition comprising oligonucleotides under conditions which allow for amplification of polynucleotides, wherein said oligonucleotides comprise oligonucleotides of at least three different groups of oligonucleotides, and (b) determining the contaminations based on the amplified polynucleotides obtained by using the oligonucleotide groups of step (a).
  • the invention relates to a composition comprising an oligonucleotide mixture. Further encompassed by the present invention is a composition comprising a probe oligonucleotide mixture.
  • the present invention also relates to kits comprising said oligonucleotide mixtures.
  • Contamination of eukaryotic cell cultures with microbial organisms as well as with other eukaryotic cell lines remains a major problem in cell culture related research. Although the contamination of cell cultures has been known for more than 50 years now, it is still a widespread cause for erroneous research results, for a reduced reproducibility and even for unusable therapeutic products. In the worst scenario, contamination with a microbial organism or cross-contamination with other eukaryotic lines may lead to diminished cell growth and may result in the loss of cultures.
  • Mycoplasma belong to the class Mollicutes and are frequently found in cell cultures as a contaminant. About 15% to 35% of all cell lines are infected with a limited number of Mycoplasma species predominantly of human, swine or bovine origin (Uphoff et al, 2002, In Vitro Cell Dev Biol Anim. 38(2):7985). A frequent cause for Mycoplasma contaminations are contaminated cell culture medium ingredients or careless working. Due to their small cell size, Mycoplasma are difficult to detect with a conventional microscope. Mycoplasma can affect most cellular functions such as inhibition of cell proliferation and protein biosynthesis, alteration of immunological reactions, virus proliferation and microarray gene expression profiles. Therefore, specific methods are required to detect Mycoplasma in a cell culture. Mycoplasma usually do not overgrow cell cultures. However, since Mycoplasma lack a cell wall, some antibiotics (e.g. ampicillin) are not effective to suppress Mycoplasma growth in cell culture.
  • antibiotics e.g. ampicillin
  • SMRV salivarrel monkey retrovirus
  • SMRV was originally isolated from a lung tissue of the squirrel monkey Saimiri sciureus more than 30 years ago.
  • the virus belongs to the class of endogenous type D retroviruses and is classified in biological risk group 2. Infection of other organisms is not described but since contamination of numerous vertebrate cell systems were described, an infection can not be excluded. Therefore, the German Central Commission for Biological Safety (ZKBS) recommends testing of all used cell lines for SMRV. Contaminated cell lines must either be eliminated or used under conditions of biological safety level 2 or higher.
  • ZKBS German Central Commission for Biological Safety
  • HeLa cells are derived from cervical adenocarcinoma cells that are infected with the human papillomavirus 18 (HPV- 18). They are frequently used in medical research. Therefore, they are passed on from lab to lab, where practitioners did not always exercise stringent controls and/or were oblivious to cross-contamination as a problem. Moreover, since HeLa cells proved to be very robust in cell culture, they were capable of overgrowing many other cells present in the same culture.
  • Cell lines cultured from primary explants or subcultures after passage 1 can be endogenously infected with herpes, hepatitis and other viruses, as well as possible bacterial pathogens. This may represent a real and present source for human infection. Persons receiving primary or subsequent cultures of human lymphocytes, fetal cell mixtures, or hepatocytes may be obtaining human cells that contain human viruses including hepatitis and herpes viruses and even HIV. If not carefully tested by sensitive techniques contaminated cell lines pose a major threat to any personnel using it.
  • Contaminated cell cultures should never be used in research that demands a specific cell line and, therefore, should be generally discarded.
  • the problem caused by contaminated cell lines can be mainly solved by an appropriate quality control including the analysis for cell cross-contamination in every cell culture laboratory.
  • the possible sources of cell culture contamination are numerous including viral and bacterial contamination as well as inter- or intraspecies contamination between various cell lines, the contaminations are difficult to assess.
  • PCR Mycoplasma Test Kit from AppliChem
  • PCR Mycoplasma Test Kit from MD Biosciences Inc.
  • ⁇ enor®GeM-Mycoplasma Detection Kit from Minerva Biolabs and many more. All these PCR tests rely on a precise PCR program with specific annealing and elongation temperatures and the specific primer compositions to achieve maximal sensitivity and specificity. Concerning the detection of HeLa contaminations, HPV genotyping tests could be applied. Among these e.g. the Amplicor® test from Roche and the INNO-LiP A® HPV Genotyping Extra from Innogenetics apply strict PCR protocols and subsequent hybridisation to probes coupled to membranes.
  • Hepatitis B detection mostly relies on antibody detection against HBsAg, but can also be done by a variety of different tests including e.g. the real-time PCR-based artus® HBV LC
  • the technical problem underlying the present invention may be seen as the provision of means and methods for reliably determining a plurality of contaminations in cell cultures simultaneously without the drawbacks as referred to above.
  • the technical problem is solved by the embodiments characterized in the claims and herein below.
  • the present invention relates to a method for determining contaminations in a cell culture sample comprising the steps of a) contacting a sample of a cell culture suspected to comprise contaminations with a composition comprising oligonucleotides of at least three different groups of oligonucleotides, said groups being selected from aa) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by the squirrel monkey retrovirus (SMRV), wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 1 and SEQ ID NO:2 (oligonucleotides for amplification of
  • SMRV gag and ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:3 and SEQ ID NO:4 (oligonucleotides for amplification of SMRV env); and iii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i) and/or (ii), bb) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by different
  • Mycoplasma species wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:5 and SEQ ID NO:6 and (oligonucleotides for amplification of the 16S RNA gene of different Mycoplasma species, Myco I) ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 7 and SEQ ID NO: 8 and (oligonucleotides for amplification of the 16S RNA gene of different Mycoplasma species, Myco II) iii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i) and/or (ii), cc) an oligonucleotide group comprising at least one pair of oligonu
  • SEQ ID NO: 11 and SEQ ID NO: 12 (oligonucleotides for amplification of different adenovirus genotypes) and ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), ee) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by A. laidwaii wherein said at least one pair is selected the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
  • SEQ ID NO: 13 and SEQ ID NO: 14 (oligonucleotides for amplification of the 16S RNA gene of Acholeplasma) and ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), ff) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides for a mammalian globin, wherein said at least one pair is selected the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
  • SEQ ID NO: 15 and SEQ ID NO: 16 (oligonucleotides for amplification of a human globin gene) ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 17 and SEQ ID NO: 18 (oligonucleotides for amplification of a mouse globin gene) iii) a pair of oligonucleotides having a nucleic acid sequence as shown in
  • SEQ ID NO: 19 and SEQ ID NO:20 oligonucleotides for amplification of a rat globin gene
  • oligonucleotides for amplification of a rat globin gene at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii) and/or (iii), gg) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by different hepatitis B virus (HBV) strains wherein said at least one pair is selected the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
  • SEQ ID NO:21 and SEQ ID NO:22 (oligonucleotides for amplification of different HBV species), and ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), hh) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by a herpes virus wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
  • SEQ ID NO:23 and SEQ ID NO:24 (oligonucleotides for amplification of the UL42 gene of HSVl), ii) a pair of oligonucleotides having a nucleic acid sequence as shown in
  • SEQ ID NO:25 and SEQ ID NO:26 (oligonucleotides for amplification of the UL42 gene of HSV2), iii) a pair of oligonucleotides having a nucleic acid sequence as shown in
  • SEQ ID NO:27 and SEQ ID NO:28 oligonucleotides for amplification of the UL42 gene of HHV3
  • iiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:29 and SEQ ID NO:30 oligonucleotides for amplification of the UL42 gene of HHV4
  • iiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:31 and SEQ ID NO:32 oligonucleotides for amplification of the UL42 gene of HHV5
  • iiiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:33 and SEQ ID NO:34 oligonucleotides for amplification of the UL42 gene of HHV6
  • SEQ ID NO:41 and SEQ ID NO:42 oligonucleotides for amplification of a polynucleotide of the rat Y chromosome
  • iii a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:43 and SEQ ID NO:44 (oligonucleotides for amplification of a polynucleotide of the mouse chromosome)
  • oligonucleotides wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:45 and SEQ ID NO:46 (oligonucleotides for amplification ofvpl of SV40), ii) a pair of oligonucleotides having a nucleic acid sequence as shown in
  • SEQ ID NO:47 and SEQ ID NO:48 oligonucleotides for amplification of SV40 Tag
  • iii a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:49 and SEQ ID NO:50 (oligonucleotides for amplification ofvp3 of SV40)
  • iiii at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii) and/or (iii), and b) determining the contaminations in said sample based on the amplified polynucleotides obtained in step a).
  • the method of the present invention preferably, is an in vitro method. Moreover, it may comprise steps in addition to those explicitly mentioned above. For example, further steps may relate to sample pre-treatments or evaluation of the results obtained by the method.
  • the method of the present invention may be also used for confirmation of contaminations in a cell culture sample.
  • the method may be carried out manually or assisted by automation.
  • step (a) and/or (b) may in total or in part be assisted by automation, e.g., by suitable robotic and sensory equipment for the determination in step (b).
  • contamination as used herein, preferably, relates to any unwanted microorganisms or eukaryotic cells that are present in a cell culture sample.
  • a microorganism in the context of the present invention preferably, is a bacterium or a virus.
  • Bacterial contaminations are, preferably, contaminations with Mycoplasma and Acholeplasma laidlawii.
  • Contaminations with Mycoplasma are, preferably, contaminations with Mycoplasma strains M. arginini, M. fermentans, M. orale, M. hyorhinis, M. hominis, M. salivarium, M. synoviae, M. pirum, M. gallisepticum, M. pneumoniae, and Acholeplasma laidlawii.
  • Viral contaminations are, preferably, contaminations with SMRV (squirrel monkey retrovirus), contaminations with human papilomvirus 18, contaminations with a human herpes virus including herpes simplex virus 1 (HSVl), herpes simplex virus 2 (HSV2), Epstein-Barr virus (EBV), Varizella Zoster virus (VZV), Cytomegalie virus (CMV), HHV 6, 7, and/or 8 (HHV: human herpes virus), contaminations with HBV (hepatitis B virus) including genotypes A-H, contaminations with adenovirus 1, 2, 5, and/or 6, contaminations with human and simian immunodeficiency viruses HIV/SIV), and contaminations with SV40 (simian vacuolating virus 40).
  • SMRV simplex virus 1
  • HSV2 herpes simplex virus 2
  • EBV Epstein-Barr virus
  • VZV Varizella Zoster virus
  • CMV Cytomegalie virus
  • a contamination with eukaryotic cells is herein also referred to as cross contamination.
  • Contaminations with eukaryotic cells include, preferably, contaminations with any unwanted eukaryotic cells and, more preferably, with any unwanted mammalian cells. Even more preferably, such a contamination is a contamination with human cells, monkey cells (green monkey or cynomolgus monkey), mouse cells, rat cells, Chinese hamster cells, feline cells, rabbit cells, Guinean pig cells, cow cells, pig cells or canine cells.
  • a cross-contamination is by cells of a different chromosomal sex, thus male cells instead of female cells and vice versa.
  • Such a cross-contamination preferably, can be assessed by using oligonucleotides that are specific for the Y- chromosome.
  • HeLa cells are well known in the art and are frequently used in research. Said cells are human immortal cells derived from cervical cancer cells and contain the human papillomavirus 18 (HPV- 18) genome. Since HeLa cells are commonly used cell lines and since they grow very rapidly, they can outgrow other cells within the same cell culture and, thus, are a frequent contaminant in cell cultures.
  • HPV- 18 human papillomavirus 18
  • viral DNA sequences that are permanently present in a host cell.
  • intracellular viral sequences can originate from experimental introduction into cell lines either by trans fection of recombinant nucleic acids containing viral sequences such as promotors, enhancers, splice and polyadenylation signal sequences or by experimental infection using transforming viruses such as EBV or SV40 to immortalize cells in order to obtain stably growing cell lines.
  • viral sequences such as promotors, enhancers, splice and polyadenylation signal sequences
  • transforming viruses such as EBV or SV40
  • some frequently used cell lines are known to comprise DNA of viral origin, e.g.
  • HeLa cells comprise HPV- 18, HEK293T cells comprise DNA of Adenovirus 5 and SV40 (more examples can be found herein elsewhere), whereas other cell lines are free of certain virus-derived DNA. Therefore, an oligonucleotide pair capable of amplifying certain viral sequences allows differentiating whether a respective contamination is present in a cell culture sample.
  • the wanted cells may not be present at all in the cell culture that is analyzed by the method of the present invention, e.g. due to a putative mix up of the cell cultures samples in the past, or due to a contamination of the cell culture sample in the past by eukaryotic cells that outgrew the cells that were originally present in a cell culture sample.
  • contacting as used in the context of the method of the present invention is understood by the skilled person.
  • the term relates to bringing a composition of the present invention in physical contact with a sample and thereby, e.g. allowing the sample and the composition to interact.
  • cell culture sample preferably, relates to a sample of cells which are maintained in vitro in a suitable cultivation medium.
  • said cells are eukaryotic cells, more preferably mammalian cells and most preferably mouse, rat, feline, canine, bovine, rabbit, Guinean pig, pig, Chinese hamster, monkey or human cells.
  • the sample may have any volume deemed appropriate.
  • the sample may have been further processed in order to carry out the method of the present invention.
  • polynucleotides such as DNA or RNA, preferably DNA, might be extracted and/or purified from the obtained sample by methods and means known in the art (e.g., see Examples).
  • sample also may relate to polynucleotides, preferably DNA, purified and/or extracted from any sample as mentioned to above.
  • a particularly preferred method for the preparation of DNA from a cell culture is by centrifugation of a suitable volume of the cell culture, resuspending the pellet in a suitable buffer, such as phosphate-buffered saline (PBS) or an other buffer suitable for PCR amplification, incubating the cell suspension at a high temperature such as 95°C, followed by a centrifugation step in order to allow removal of the cell debris.
  • PBS phosphate-buffered saline
  • The, thus, obtained supernatant comprising extracted DNA can be analyzed in the method of the present invention.
  • said supernatant can be stored at low temperatures such as -20 0 C.
  • a sample of a cell culture suspected to comprise contaminations may be any sample of cultivated eukaryotic cells, preferably of cultivated mammalian cells. It is to be understood that said cells have been specifically prepared for cultivation or have been cultivated in vitro prior to analysing them by the method of the present invention.
  • the sample may also be a primary cell culture which can be analyzed by the method of the present invention in order to assess the cells/contaminations present in said primary cell culture.
  • the sample may comprise more than one contamination, i.e. a plurality of contaminations.
  • sample comprises at least one contamination.
  • At least one means one or more than at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or more contaminations.
  • a sample suspected to comprise contaminations may also turn out to be free of contamination, i.e. does not comprise any contamination that can be detected by applying the method of the present invention.
  • composition comprising oligonucleotides as used herein relates to a composition comprising oligonucleotide molecular species wherein all molecules of the molecular species have a specific nucleic acid sequence.
  • oligonucleotide relates to a primer for DNA amplification techniques such as PCR (whereas the term “probe oligonucleotides”, preferably, relates to probes, see herein below).
  • An oligonucleotide shall comprise a number of nucleotides being sufficient for specific binding to a sequence stretch of a target polynucleotide.
  • an oligonucleotide as meant herein has between 15 and 30 nucleotides in length, more preferably between 18 and 28 nucleotides in length, and most preferably between 23-25 nucleotides in length.
  • the sequence of the oligonucleotide is not degenerated.
  • the oligonucleotide is a single-stranded oligodesoxyribonucleotide.
  • the oligonucleotide may be partially double-stranded under certain conditions (depending on, e.g., the sequence of the oligonucleotide, the salt concentration and the temperature).
  • Particularly preferred oligonucleotides have the specific sequences and/or properties referred to herein.
  • the oligonucleotides of the present invention preferably, are used as a starting molecule for the synthesis of a polynucleotide which is sufficiently complementary to the nucleic acid strand to be copied by an appropriate amplification technique, preferably by PCR, for polynucleotides.
  • the oligonucleotides of the present invention may be labelled or contain other modifications which allow a detection and/or analysis of an amplification product and/or the binding to a carrier. Labelling can be done by various techniques well known in the art and depending of the label to be used. Particularly, the oligonucleotides may be biotinylated in order to enable the binding of the amplification products to a streptavidin surface or fluorescent conjugate. Moreover, labels to be used in the context of the present invention may be, but are not limited to, fluorescent labels comprising, inter alia, fluorochromes such as R-phycoerythrin, Cy3, Cy5, fluorescein, rhodamin, Alexa, or Texas Red.
  • fluorochromes such as R-phycoerythrin, Cy3, Cy5, fluorescein, rhodamin, Alexa, or Texas Red.
  • the label may also be an enzyme or an antibody. It is envisaged that an enzyme to be used as a label will generate a detectable signal by reacting with a substrate. Suitable enzymes, substrates and techniques are well known in the art.
  • An antibody to be used as label may specifically recognize a target molecule which can be detected directly (e.g., a target molecule which is itself fluorescent) or indirectly (e.g., a target molecule which generates a detectable signal, such as an enzyme).
  • the oligonucleotides of the present invention may also contain 5 ' restriction sites, locked nucleic acid molecules (LNA) or be part of a peptide nucleotide acid molecule (PNA). Such PNA can be, in principle, detected via the peptide part by, e. g., antibodies.
  • composition comprising oligonucleotides relates to a mixture of different oligonucleotide molecular species, preferably of oligonucleotide groups as specified elsewhere in this application.
  • a composition may comprise further components other than the oligonucleotides, e.g. components for the amplification of polynucleotides of polynucleotides, preferably by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • Such components may be, but are not limited to, an aqueous buffer, a water soluble magnesium salt, deoxythymidine triphosphate (dTTP), deoxyadenosine triphosphate (dATP), deoxycitidine triphosphate (dCTP) and deoxyguanosine triphosphate, (dGTP) and a DNA polymerase, e.g. the thermostable DNA polymerase from Thermus aquaticus.
  • dTTP deoxythymidine triphosphate
  • dATP deoxyadenosine triphosphate
  • dCTP deoxycitidine triphosphate
  • dGTP deoxyguanosine triphosphate
  • a DNA polymerase e.g. the thermostable DNA polymerase from Thermus aquaticus.
  • oligonucleotide group as used herein, preferably, relates to a composition comprising a plurality of oligonucleotide pairs. However, it is also contemplated that an oligonucleotide group may only comprise one oligonucleotide pair. Preferably, an oligonucleotide group is specific for one type of contamination (belonging to the same phylogenetic tree), e.g. for a contamination with Mycoplasma or a contamination with HHV species, different Mycoplasma species or various adenoviral species.
  • oligonucleotide groups preferably, relates to three or more than three oligonucleotide groups, thus at least three, four, five, six, seven, eight, nine oligonucleotide groups or more.
  • oligonucleotides pair preferably, relates to two olignucleotides capable of amplifying polynucleotides that are specific for a contamination.
  • sequences of the oligonucleotides as well as the corresponding targets and probe oligonucleotides are shown also shown in table 1.
  • the pair of oligonucleotides have a nucleic acid sequence as shown in SEQ ID NO: 1 and SEQ ID NO:2 (i.e. said pairs comprises an oligonucleotide having a nucleic acid sequence as shown in SEQ ID NO: 1, and an oligonucleotide having a nucleic acid sequence as shown in SEQ ID NO:2) (oligonucleotides for amplification of SMRV gag), and for (ii) the oligonucleotides have a nucleic acid sequence as shown in SEQ ID NO:3 and SEQ ID NO:4 (oligonucleotides for amplification of SMRV env).
  • the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs, thus the pairs mentioned in (i) or (ii).
  • the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO: 7 and SEQ ID NO: 8 (oligonucleotides for amplification of the 16S RNA gene of different Mycoplasma species, Myco I), and for (ii) a pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:5 and SEQ ID NO :6 (oligonucleotides for amplification of the 16S RNA gene of different Mycoplasma species Myco II).
  • the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs, thus the pairs mentioned in (i) or (ii).
  • the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO: 13 and SEQ ID NO: 14 (oligonucleotides for amplification of the 16S RNA gene of Acholeplasma).
  • the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pair.
  • the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:9 and SEQ ID NO:10 (oligonucleotides for amplification of the E7 gene of HPV-18, HeIa).
  • the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pair.
  • the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO: 1 1 and SEQ ID NO: 12 (oligonucleotides for amplification of different adenovirus genotypes).
  • the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs.
  • said pair of oligonucleotides has a nucleic acid sequence as shown in (i) SEQ ID NO: 15 and SEQ ID NO: 16 for the human globin (oligonucleotides for amplification of a human globin gene), (ii) in SEQ ID NO: 17 and SEQ ID NO : 18 for mouse globin (oligonucleotides for amplification of a mouse globin gene), or (iii) in SEQ ID NO: 19 and SEQ ID NO:20 for rat globin (oligonucleotides for amplification of a rat globin gene).
  • the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs.
  • a eukaryotic host cell line known to comprise HBV DNA preferably, is the liver cancer cell line Alexander (IFO50069).
  • the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:21 and SEQ ID NO:22 (oligonucleotides for amplification of different HBV species).
  • the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs, thus the pairs mentioned in (i).
  • said polynucleotide may be stably present in a eukaryotic cell line.
  • Eukaryotic host cell lines known to comprise EBV HHV4
  • HHV4 preferably, are Namalwa, P3HR1, or B95-8.
  • the pair of oligonucleotides for HSVl has a nucleic acid sequence as shown in SEQ ID NO :23 and SEQ ID NO :24 (oligonucleotides for amplification of the UL42 gene of HSVl), for HSV2 a nucleic acid sequence as shown in SEQ ID NO:25 and SEQ ID NO:26 (oligonucleotides for amplification of the UL42 gene of HSV2), for HHV3 a nucleic acid sequence as shown in SEQ ID NO:27 and SEQ ID NO:28 (oligonucleotides for amplification of the UL42 gene of HSV3), for HHV4 a nucleic acid sequence as shown in SEQ ID NO:29 and SEQ ID NO:30 (oligonucleotides for amplification of the UL42 gene of HSV4), for HHV5 a nucleic acid sequence as shown in SEQ ID NO:31 and SEQ ID NO:32 (oligonucleotides for
  • said pair of oligoucleo tides has a nucleic acid sequence as shown in SEQ ID NO:39 and SEQ ID NO:40 for (i), and SEQ ID NO:41 and SEQ ID NO:42 for (ii), and SEQ ID NO:43 and SEQ ID NO:44 for (iii).
  • the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs.
  • the term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by SV40 (simian virus 40)" preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide derived from SV40 (J02400) encoding (i) the vpl gene, (ii) the T-antigen, and (iii) the vp3 gene, respectively. It is to be understood that said polynucleotide may be stably integrated into the genomic DNA of a eukaryotic host cell line. Eukaryotic host cell lines known to comprise SV40 DNA, preferably, are HEK293T or cos7.
  • HEK293T cells are known to contain vpl and T-antigen sequences, while vpl, T- antigen and vp3 sequences are found in Cos7.
  • many DNA vectors that are used to transfect cell lines contain SV40 elements, such as the poly- A signal found in vpl or splice sites found in the T-antigen. Therefore, a detection of vpl and/or T-antigen may also be due to a transfection with such vectors or due to the contamination with a cell line transfected with one of these vectors.
  • the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:45 and SEQ ID NO:46 (oligonucleotides for amplification of vpl of SV40).
  • the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:47 and SEQ ID NO:48 (oligonucleotides for amplification of SV40tag).
  • the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:49 and SEQ ID NO:50 (oligonucleotides for amplification of the vp3 of S V40).
  • the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs.
  • the amount and/or the concentration of the oligonucleotides may be any amount or concentration deemed appropriate.
  • the amounts and/or concentrations of the individual oligonucleotides of the invention may differ and, thus, a solution comprising said oligonucleotides may not be equimolar with respect to the oligonucleotides.
  • Preferred concentrations of the oligonucleotides in a solution suitable for the amplification of polynucleotides can be found in the Examples.
  • a particularly preferred concentration of each oligonucleotide is between 0.5 and 5 ⁇ M, more preferably 1 and 4 ⁇ M, most preferable 2 and 3 ⁇ M.
  • the person skilled in the art is able to adjust the concentrations of the oligonucleotides of the invention in order to optimize the amplification of specific polynucleotides as referred to herein and, thus, to optimize the detection of contaminations in a cell culture without further ado.
  • concentrations of the oligonucleotides of the invention in order to optimize the amplification of specific polynucleotides as referred to herein and, thus, to optimize the detection of contaminations in a cell culture without further ado.
  • the term "under conditions which allow for amplification of polynucleotides" as used herein is understood by the skilled person.
  • the term relates to a template-dependent process which results in an increase of the amount of a nucleic acid molecule relative to its initial amount.
  • the amplification of a polynucleotide of interest shall allow its detection by any method deemed appropriate and/or, e.g., described herein below.
  • the amplification of a polynucleotide of interest may be carried out by well-known methods, preferably by polymerase chain reaction (PCR), but also by reverse transcriptase PCR, real-time PCR, reverse transcriptase real-time PCR, Templex-PCR, nucleic-acid sequence based amplification (NASBA), and isothermal amplification methods using polymerases and specific oligonucleotides as primers.
  • PCR polymerase chain reaction
  • NASBA nucleic-acid sequence based amplification
  • isothermal amplification methods using polymerases and specific oligonucleotides as primers.
  • Preferred embodiments of a PCR in the context of the present invention are described in the Examples.
  • determining contaminations relates to assessing the presence or absence of certain contaminating cells as referred to herein in a cell culture sample.
  • the contaminations are determined, and thus detected, simultaneously.
  • the determination of contaminations is done by identifying amplified polynucleotides that are specific for the contaminations to be detected.
  • the amplification of polynucleotides that are specific for the respective contaminations is done in only one container, thus, in the same container.
  • a preferred container is a reaction tube.
  • Such reaction tubes well known in the art and, e.g., are commonly as referred to as PCR tubes. It is to be understood that the form of these tubes may depend on the PCR apparatus used for the amplification of contamination-specific oligonucleotides.
  • the determination of the contaminations is based on the amplified polynucleotides, and relates to identifying amplified polynucleotides that are specific for the various, individual contaminations. Preferably, this will be achieved by detecting the presence or absence of amplified polynucleotides that are specific for the contaminations to be detected. Methods of determining if an amplified polynucleotide is present or absent are well known in the art and preferably rely on the comparison of the amount and/or identity of the amplified polynucleotides to suitable controls, as exemplified in Example 10. Based on the determination contaminations can be identified.
  • an amplified polynucleotide that is specific for an individual contamination is present, then the respective contamination is present in the cell culture sample. If there is no amplification product for a polynucleotide that is specific for a certain contamination and, thus, if an amplified polynucleotide is absent, the respective contamination is not present in the tested cell culture sample.
  • the amplification of certain polynucleotides also may indicate that a cell line comprises wanted cells. E.g. if cell culture samples are tested that should comprise human cells, an amplification of a human globin polynucleotide would indicate that said cell culture samples, indeed, comprise human cells.
  • the detection/ identification of a plurality of amplified polynucleotides and, thus, of a plurality of contaminations can be done because of sequence variation between the amplified polynucleotides.
  • Determining the contaminations based on the amplified polynucleotides is, preferably, done by using suitable probe oligonucleotides.
  • the determination of the various amplified polynucleotides preferably, comprises the step of hybridizing the amplified polynucleotides with probe polynucleotides that specifically bind to the amplified polynucleotides.
  • a probe oligonucleotide in the context of the present invention preferably, is single-stranded nucleic acid molecule that is specific for a polynucleotide that can be amplified by using the oligonucleotides according to the invention.
  • a probe oligonucleotide comprises a stretch of nucleotides that specifically hybridize with the target, thus, is complementary to the target polynucleotide.
  • Said stretch of nucleotides is, preferably, 85%, 90%, 95%, 99% or more preferably 100% identical to a sequence region comprised by a target polynucleotide.
  • the degree of identity (percentage, %) between two or more nucleic acid sequences is, preferably, determined by the algorithms of Needleman and Wunsch or Smith and Waterman. To carry out the sequence alignments, the program PiIeUp (J. MoI. Evolution., 25, 351-360, 1987, Higgins 1989, CABIOS, 5: 151-153) or the programs Gap and BestFit (Needleman 1970, J. MoI. Biol. 48; 443-453 and Smith 1981, Adv. Appl. Math. 2; 482- 489), which are part of the GCG software packet (Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711, vers. 1991), are to be used.
  • sequence identity values recited above in percent (%) are to be determined, preferably, using the program GAP over the entire sequence region with the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10.000 and Average Mismatch: 0.000, which, unless otherwise specified, shall always be used as standard settings for sequence alignments.
  • a probe oligonucleotide as meant herein is between 15 and 30 nucleotides in length, more preferably between 15 and 28 nucleotides in length, and most preferably between 18-23 nucleotides in length.
  • the probe oligonucleotides are bound to a carrier providing a solid surface.
  • said carrier is a small particle or bead.
  • the overall size of a small particle or bead may be in the micrometer or nanometer range.
  • said beads and particles may be stained with a specific dye, more preferably with a specific fluorescent dye.
  • the carries can be distinguished from each other.
  • a carrier with a specific dye for a specific probe oligonucleotide for a specific probe oligonucleotide (thus, a nucleic acid that targets the amplified polynucleotides of a specific contamination)
  • said carrier is distinguishable from other carriers comprising different dyes.
  • commercially available Luminex microspheres Luminex Corp., Austin, Texas, USA are used.
  • the contamination-specific probes are coupled to fluorescence- labelled polystyrene beads (Luminex suspension array technology) which are hybridized with the amplification products under suitable, preferably, stringent conditions.
  • the amplification products may be identified by use of microarrays, Reverse-Line Blots (RLB), Dot blots or similar technologies which contain contamination specific probe oligonucleotides linked to a suitable carrier.
  • one or more antisense oligonucleotide(s) to one or more oligonucleotide(s) is (are) comprised in the hybridisation assay.
  • the antisense oligonucleotide preferably, is an oligonucleotide with properties as specified above with the ability to specifically hybridize to an oligonucleotide. More preferably, the antisense oligonucleotide is an oligonucleotide with properties as specified above comprising the complementary sequence of an oligonucleotide.
  • antisense oligonucleotides are oligonucleotides with properties as specified above comprising nucleic acid sequences as shown in SEQ ID No: 157 to 165.
  • the probe oligonucleotides that specifically bind to the amplified polynucleotides are selected from the group consisting of probe oligonucleotides comprising a nucleic acid sequence as shown in SED ID NO: 78 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma orale and, thus, of Mycoplasma orale), SED ID NO: 79 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma hyorhinis and, thus, of Mycoplasma hyorhinis), SED ID NO: 80 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma arginini, and, thus of Mycoplasma arginini), SED ID NO:
  • SED ID NO: 90 (allows detection of the 16 S ribosomal RNA gene of A. laidlawii, and, thus, of A. laidlawii), SED ID NO:91 (allows detection of the 16 S ribosomal RNA gene of A. granularum, and, thus, of A.
  • SEQ ID NO:92 (allows detection of the E7 gene of HPVl 8 and, thus, of HeLa cells), SEQ ID NO:93 (allows detection of the rat beta globin gene and, thus, of rat cells), SEQ ID NO:94 (allows detection of the mouse beta globin major gene, and, thus, of mouse cells), SEQ ID NO:95 (allows detection of the cynomolgus beta globin chain gene, and, thus, of cynomolgus cells), SEQ ID NO:96 (allows detection of the human beta globin chain gene, and, thus of human cells ), SEQ ID NO:97 (allows detection of human and monkey beta globin chain gene, and, thus, of human and monkey cells.), SEQ ID NO:98 (allows detection of the PoI-A gene of different mammalian and vertebrate cells (see above), SEQ ID NO:99 (allows detection of the ElA gene of Adenovirus 1 and 2, and, thus of Adenovirus
  • the probe oligonucleotides that specifically bind to the amplified polynucleotides are, preferably, selected from the group consisting of probe oligonucleotides comprising a nucleic acid sequence as shown in SED ID NO: 78 to SEQ ID 144.
  • the probe oligonucleotides that specifically bind to the amplified polynucleotides are selected from the group consisting of probe oligonucleotides comprising a nucleic acid sequence as shown in SED ID NO: (SEQ ID No. 78 to 119, and SEQ ID No. 121 to 134, and SEQ ID No.145 to 148).
  • nucleic acid sequences of the probe oligonucleotides as well as the contaminants / cells that are detected by using said probe oligonucleotides are listed in table 1. Also shown in table 1 are the corresponding amplified polynucleotides as well as the oligonucleotide pairs that amplify these polynucleotides.
  • the amplification products are identified by other methods known in the art.
  • the identification may be done by sequencing amplification product(s) and or by RFLP (restriction fragment length polymorphism) analysis.
  • the determination of contaminations can also be done by conducting microarray assays, southern blot assays, dot blot assays, or by membrane-based reverse line blot.
  • the composition comprising oligonucleotides further comprises oligonucleotides capable of amplifying a fragment of the polymerase A (PoIA) polynucleotide, wherein said oligonucleotides bind to highly conserved regions of the PolA-polynucleotide.
  • PoIA polymerase A
  • the polA polynucleotide encodes for polymerase alpha (Ultraconserved Elements in the Human Genome, Bejerano et al, 2004)
  • the polA polynucleotide is highly conserved between mammals and other vertebrates (e.g. in chicken and frog).
  • oligonucleotides capable of amplifying a fragment of the polymerase A (PolA) polynucleotide preferably, allow for specifically amplifying a fragment or part of the polA polynucleotide of mammals, and more preferably, of the human, chimpanzee, mouse, rat, canine and feline polA polynucleotide.
  • the amplification of the polA polynucleotide, or of a fragment or part thereof, preferably, serves as an internal positive control. Therefore, the amplification of the polA polynucleotide allows for assessing errors that occurred, e.g., when preparing the template DNA for the analysis or when setting up the PCR reaction. Efficient amplification of the polA polynucleotide, preferably, indicates that the amplification reaction was successful and that the DNA is of sufficient quality, whereas inefficient amplification, preferably, indicates that an amplification reaction was not successful, e.g., due to an inappropriate sample or errors in the PCR setup.
  • a PCR reaction may have to be repeated, e.g., with a freshly obtained sample and/or freshly purified DNA.
  • oligonucleotides that specifically amplify the polA polynucleotide preferably, prevents false-negative results.
  • the oligonucleotides capable of amplifying a fragment of the polymerase A (PoIA) polynucleotide have a nucleic acid sequence as shown in SEQ ID NO:51 and SEQ ID NO:52 (oligonucleotides for amplification of the polA gene of different mammalian vertebrate cells).
  • the composition comprising oligonucleotides further comprises an oligonucleotide group that comprises at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by the mitochondrial DNA of various mammals, wherein said at least one pair is selected from the group of oligonucleotide group consisting of an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by a mitochondrial DNA of various mammals wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:53 and SEQ ID NO:54 (thus, oligonucleotides for the detection of Chinese hamster cells), ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:53 and
  • SEQ ID NO:57 and SEQ ID NO:58 (thus, oligonucleotides for the detection of feline cells), iv) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:59 and SEQ ID NO:60 (thus, oligonucleotides for the detection of Green monkey cells), v) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO :61 and SEQ ID NO:62 (thus, oligonucleotides for the detection of mouse cells), vi) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO :63 and SEQ ID NO:64 (thus, oligonucleotides for the detection of rat cells), and vii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 65 and SEQ ID NO: 66 (th
  • the term "pair of oligonucleotides capable of specifically amplifying polynucleotides for a mitochondrial DNA preferably relates to pairs of oligonucleotides capable of amplifying a polynucleotide encoding a 16S ribosomal RNA gene of different species, preferably of a rat, mouse, Chinese hamster, canine, feline, green monkey, cynomolgus monkey, rabbit, Guinean pig, and pig 16S ribosomal RNA gene.
  • said pairs of oligonucleotides have a nucleic acid sequence as shown in (i) SEQ ID NO: 63 and SEQ ID NO: 64 for the rat 16S ribosomal RNA gene, (ii) in SEQ ID NO:61 and SEQ ID NO:62 for the mouse 16S ribosomal RNA gene , (iii) in SEQ ID NO:53 and SEQ ID NO:54 for Chinese hamster 16S ribosomal RNA gene, (iv) in SEQ ID NO:55 and SEQ ID NO:56 for canine 16S ribosomal RNA gene, (v) in SEQ ID NO:57 and SEQ ID NO:58 for feline 16S ribosomal RNA gene, (vi) in SEQ ID NO:59 and SEQ ID NO:60 for green monkey 16S ribosomal RNA gene, (vii) in SEQ ID NO: 65 and SEQ ID NO: 66 for cynomolgus monkey 16S ribosomal
  • composition comprising oligonucleotides further comprises an oligonucleotide group that comprises at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by various HIV (human immunodeficiency virus) and SIV (simian immunodeficiency virus) strains, wherein said at least one pair is selected from the group of oligonucleotide group consisting of, i) a pair of oligonucleotides having a nucleic acid sequence as shown in
  • SEQ ID NO:67 and SEQ ID NO:68 oligonucleotides for amplification of HIVl gag
  • ii a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 69 and SEQ ID NO:71
  • iii a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:70 and SEQ ID NO:71
  • oligonucleotides for amplification ofHIVlpol iiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 72 and SEQ ID NO: 73 (oligonucleotides for amplification of HIV gag), iiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 74 and SEQ ID NO: 75 (oligonugonucleotides for amplification of HIV gag)
  • HIV positive cell lines are, e.g.
  • said pair of oligonucleotides have a nucleic acid sequence as shown in SEQ ID NO:67 and SEQ ID NO:68 for (i), and SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71 (one forward primer and two backward primers, thus, two oligonucleotide pairs a) SEQ ID NO:69 and SEQ ID NO:71, b) SEQ ID NO:70 and SEQ ID NO:71) for (ii), SEQ ID NO:72 and SEQ ID NO:73 for (iii), and SEQ ID NO:74 and SEQ ID NO:75 for (iiii), and SEQ ID NO:76 and SEQ ID NO:77 for (iiiii).
  • the term also relates to pairs of oligon
  • determining contaminations in a cell culture sample comprising the steps of contacting a cell culture sample with a composition comprising an oligonucleotides as referred to herein and detecting contaminations based on the amplified polynucleotides by applying said compositions is required for sufficient detection of contaminations in a cell culture sample.
  • the method of the present invention is more reliable than the prior art since it allows the simultaneous determination of contaminations which can be microbial contaminations or cross-contamination with unwanted eukaryotic cell lines.
  • the prior art does not teach the combined determination of contaminants as referred to herein.
  • the method of the present invention if applied, will be beneficial for basic research as well as for the commercial application of cell cultures since it allows a cost-effective and reliable determination of the most frequent contaminants of cell cultures. Moreover, by applying the method of the present invention it is possible to detect contaminants that are present in a cell culture sample to a very low extent. Therefore, the method of the present invention provides a very sensitive determination of various contaminants. Particularly, it was shown that SMRV was detected with less than 10 plasmid copy numbers, and that cell culture contaminations of less than 1 to 3 cells in a background of 6,000 cells per PCR reaction can be detected even if multiple contaminations are simultaneously present and tested for (Example 7).
  • oligonucleotides that are capable of amplifying a fragment of the PoIA polynucleotide.
  • the use of said oligonucleotides e.g. may serve as a control of the quality of the template PCR as well as a control for assessing mistakes during the set-up of a PCR reaction.
  • the present invention also relates to a composition comprising oligonucleotides as referred to above.
  • composition comprising an oligonucleotide mixture
  • composition comprising oligonucleotides preferably, further comprises oligonucleotides as referred to herein, e.g. a pair of oligonucleotides capable of amplifying a fragment of the polymerase A (PoIA) polynucleotide.
  • said composition may further comprise oligonucleotides as referred to above, e.g. oligonucleotides that are capable of amplifying polynucleotides for mitochondrial DNA of various species (see above).
  • the present invention relates a composition comprising probe oligonucleotides, wherein said composition comprises at least five probe oligonucleotides selected from the group of probe oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 78 to 148. At least five means five or more than five and, thus, at least six, at least seven, at least eight, at least ten, at least thirteen, at least fifteen, at least twenty or more.
  • composition is herein also referred to as "composition comprising a probe oligonucleotide mixture".
  • the present invention also relates to the use of a composition of the present invention (thus, of a composition comprising an oligonucleotide mixture and/or a composition comprising a probe oligonucleotide mixture as specified above) for determining contaminations in a cell culture sample.
  • said contaminations are detected simultaneously.
  • Said contaminations are selected from the group consisting of SMRV (squirrel monkey retrovirus), Mycoplasma including M. arginini, M. fermentans, M. orale, M. hyorhinis, M. hominis, M. salivarium, M. synoviae, M. pirum, M. gallisepticum, M. pneumoniae, A.
  • eukaryotic host cells comprising adenovirus 1, 2, 5 or 6 DNA, HeLa cells, human cells, rat cells, mouse cells, Chinese hamster cells, canine cells, feline cells, monkey cells, Guinean pig cells, rabbit cells, bovine cells, pig cells, male host cells, eukaryotic host cells comprising a herpes virus including HHV 1 to 8, human host cells comprising hepatitis B virus DNA including genotypes A to H , eukaryotic host cells comprising SV40 DNA, and eukaryotic host cells transfected with DNA vectors containing elements of SV40 (VPl or T-Antigen). Other preferred contaminations are referred to elsewhere in this specification.
  • the present invention relates to a kit, preferably adapted for carrying out the method of the present invention, comprising the composition comprising an oligonucleotide mixture and/or the composition comprising a probe oligonucleotide mixture as specified herein and an instruction manual.
  • said kit further comprises the composition comprising a probe oligonucleotide mixture.
  • kit refers to a collection of the aforementioned means, e.g., means for contacting a sample under conditions which allow for amplification of polynucleotides and for determining contaminations based on the amplified polynucleotides, preferably, provided separately or within a single container.
  • the container also preferably, comprises instructions for carrying out the method of the present invention.
  • the components of the kit are provided, preferably, in a "ready-to-use" manner, e.g., concentrations are adjusted accordingly, etc..
  • accession numbers of the various targets of the multiplex cell culture contamination PCR are listed in Table 1. All nucleotide sequences were obtained from the National
  • NCBI National Center for Biotechnology Information
  • oligonucleotide probe sequences were chosen within polymorphic sequences amplified by primers mentioned above. Oligonucleotide probes were selected to be highly specific for the gene or organism of interest. All probe sequences were tested for unspecific hybridisation to biotinylated oligonucleotide primers by Fast-PCR and in Luminex hybridisation experiments.
  • Target Probe oligonucleotide sequence Probe Region Accession Primer name Primer sequence 5 'to 3 ' Primer SE ⁇
  • HPV 18 CAGACGACCTTCGAGCAT 92 E7 NC 001357.1 HPV_18_f GACCTTCTATGTCACGAGCAATTA 9 HPV 18 b TGCACACCACGGACACACAAAG 10
  • Mammal IC GTACATCTGATTACTGAAGTAC polymerase alpha e.g. NW 927700.1 POLA f TCAGAAATAGTTCTTGATCGGGTTTG 51
  • Adenovirus 1 2 TCCTAAATTGGTGCCTGCT 99 ElA AY490817 1, Adeno f GTGTCTGAACCTGAGCCTGAGCC J01917.1
  • Adenovirus 5 GCCGTCCTAAAATGGCGCC 100 ElA AY339865 1 Adeno b GAGGTGTGTTAGAAGGACCGGAGT 12 Adenovirus 6 CCTGTGTCCAGAGAATG 101 ElA AY490818 1 Adenovirus 1,2,5,6 GCAATAGTAGTACGGATAGC 102 ElA
  • Dog/Canine AAGTCAAAATACAACATCA 15 16S ⁇ bosomal RNA gene AY729880 1 Dog_f CCGAGTGATTAAAATTTAGACCC 55 Dog b TTGTTCCGTTGATCAAAAATTAT 56
  • SV40 VP1 ACCACAGTGCTTCTTGAT 123 VPl J02400.1
  • SV40 VP I GAACCTACACAGGTGGGGAAAATGT 45
  • SV40 VP1 b CAAGGGCCCAACACCCTGCTCAT 46
  • HSVl (HHVl) TGTTCACCACGAGTACCTG 128 UL42 NC 001806.1 HSVl f ACGAGGCCGCAGCTCACCAAGGT 23
  • HSV2 (HHV2) TGTTTAACGCGCGCACCTG 129 UL42 NC 001798.1 HSV2_f ACGAAGCCCCAGCTCACGAAGGT 25
  • VZV (HHV3) TGCACGGGTGCGGAACGTT 130 orthologue of HHV-I NC 001348 1 VZV f CATCCTTCACAGATTCCATGTTCG 27
  • VZV b TCCCCCATGGTTGGATTGTATATC 28
  • HHV8 b AAACAAAAGAGGACCAAACGGTGA 38 .
  • HIV2 2U/B GTGGTCAAAAGACAACA 144 Env AY530889 1/ HIV2/SIV env b GTCCCCCAGACGGTCAGYCGCAACA 77 U27200 1
  • DNA was extracted from various cell cultures possibly infected with Mycoplasma, A. laidlawii or SMRV. An amount of 1 ml of cell suspensions, containing 10 5 to 10 6 cells, was transferred to a microcentrifuge tube and collected by centrifugation at 2600 rpm, 5 min in a tabletop centrifuge. The pellet was resuspended in PBS. The mixture was incubated for 15 minutes at 95 0 C. Subsequently, cell debris was pelleted and the supernatant was transferred into new microcentrifuge tubes and stored at - 20 0 C.
  • Oligonucleotide primers that met requirements of Example 1 were used for subsequent amplification of cloned DNA or DNA extracted as mentioned above.
  • One primer of each pair was biotinylated at the 5' terminus for labelling the target strand of the amplified product.
  • the different target genes were amplified in a single multiplex PCR.
  • singleplex PCR, for each individual primer pair were performed under same conditions.
  • the 50 ⁇ l reactions comprised Ix QIAGEN Multiplex PCR Master Mix (containing 3 mM MgCl 2 , dNTP mix, 0.5 x Q-solution and HotStarTaq DNA polymerase), 0.2 ⁇ M each primer, and 1-2 ⁇ L of template DNA.
  • PCR products were amplified by incubation at 95°C for 15 minutes to activate the enzyme, followed by 40 cycles of denaturation at 94°C for 30 seconds, annealing at 61 0 C for 90 seconds, and extension at 72°C for 60 seconds. Final extension was performed at 72°C for 10 minutes and reactions were stored at 4°C.
  • Probes were coupled to carboxylated beads by a carbodiimide-based coupling procedure.
  • xMAP carboxylated beads
  • MES 2-(N-morpholino)ethanesulfonic acid
  • Probe oligonucleotides 400 pmol
  • 200 ⁇ g of N-(3-dimethylaminopropyl)-N-ethylcarbodiimide (EDC) were added and thoroughly mixed with the beads.
  • Incubation was performed in the dark under agitation for 30 min and was interrupted by a thorough mixing step after 15 min.
  • the addition of EDC and incubation steps were repeated and the coupled beads were finally washed once with 0.5 ml of 0.2 g/liter Tween-20 and once with 0.5 ml of 1.0 g/liter sodium dodecyl sulfate before being stored in 100 ⁇ l of TE buffer at 4°C in the dark.
  • Example 5 Development of multiplex cell culture contamination hybridisation method.
  • PCR products were denatured and hybridized to bead-coupled target-specific oligonucleotide probes in 96-well plates, allowing PCR products from 96 individual cell cultures to be processed in parallel. After transfer into wash plates with filter bottoms, unhybridized DNA was removed. Subsequently, biotinylated PCR products were stained by Strep-PE conjugate. After further washing steps, beads were analyzed in the Luminex reader, which contains two lasers to identify the bead set by the internal bead color and to quantify the reporter fluorescence on the bead.
  • TMAC tetramethylammonium chloride
  • the mixture was heated to 95°C for 10 min in a laboratory oven, immediately placed on ice for 1 min, and then transferred to a thermomixer. Hybridization was performed at 41 0 C for 30 min under agitation.
  • the samples were transferred to a 96-well wash plate (Millipore, Bedford, MA), pre- equilibrated with washing buffer (phosphate-buffered saline, 0.02% Tween). Subsequently, the beads were washed once with 100 ⁇ l of washing buffer on a vacuum wash station (Millipore).
  • the median reporter fluorescence intensity (MFI) of at least 100 beads was computed for each bead set in the sample.
  • target-specific probes were coupled individually to defined bead sets and hybridized to 10 ⁇ l (100 to 300 ng DNA) of PCR products derived from single- and multiplex PCRs on crudely purified DNA from cell cultures (different species, cell lines with markers) or highly purified plasmid DNAs (SMRV, SV40). Detection of all targets was highly specific and no cross-hybridisation was observed even for highly related target genes, such as the 16S ribosomal RNA gene that was used for the detection of different species. More importantly, the SMRV detection by gag and env probes was not affected by endogenous retroviruses or HIV.
  • SMRV signal was detected showing a high specificity of the SMRV detection.
  • presence of other human endogenous retroviruses does not cause false-positives.
  • DNA extracts of 10 6 HeLa cells were prepared as described in Example 2, followed by a 10-fold dilution series in water. After multiplex PCR and detection with the multiplex hybridisation mixture, including the HPV-18 type-specific oligonucleotide probe, less than 5 HeLa genome equivalents were specifically detected.
  • the co-amplification and co-detection of human beta-globin and PoIA resulted in detection limits of less than 5 and less than 50 genome equivalents, respectively.
  • Example 7 Determination of the detection limits for the simultaneous detection of various contaminations in cell cultures
  • PCR products were simultaneously detected using specific oligonucleotide probes coupled to Luminex beads (Table 1, SEQ ID 78 to 134, 145 and 148).
  • Luminex beads Table 1, SEQ ID 78 to 134, 145 and 148.
  • the multiplex PCR with subsequent Luminex analysis used for the detection of cell culture contaminations proved to be very sensitive.
  • the detection limit for detecting "contaminating" HeLa cells was below 3 ( ⁇ 0.1 %) cells in a background of 6,000 cells of the parent cell line. Less than 1 contaminating cell ( ⁇ 0.1 %) among 6,000 cells was sufficient to detect cross-species contaminations (Table 3).
  • HEK 293T (Adenovirus 5) ⁇ 3 ⁇ 0.06
  • SW480 human Y-chromosome
  • the Multiplex PCR was performed as described in Example 3 with all primers indicated in Table 1 (SEQ ID 1 to 66). Subsequently, PCR products were simultaneously detected using specific oligonucleotide probes coupled to Luminex beads (Table 1, SEQ ID 78 to 120, 122 to 134, 145).
  • the Venor®GeM kit Upon gel electrophoresis, the Venor®GeM kit allowed the detection of the Mycoplasma genus in up to 1, 300-fold diluted DNA extracts, while the internal PCR control was positive for all reactions.
  • the multiplex PCR assay with subsequent Luminex detection showed a six- fold increased sensitivity allowing the detection and typing of Mycoplasma in 7, 800-fold diluted DNA extracts. More remarkably, this increased sensitivity was observed despite the co-detection of POLA, human ⁇ -globin, human Y-chromosome, adenoviral and EBV DNA that was present in the DNA extract.
  • McCT To determine the ability of McCT to detect multiple targets at the same time, an artificial mixture was generated from several positive controls. In total, 34 different lysates and positive controls were mixed to obtain a sample positive for all PCR targets. For pig DNA and some Mycoplasma species no suitable control DNA was available.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method for determining contaminations in a cell culture sample comprising the steps of :a) contacting a sample of a cell culture suspected to comprise contaminations with a composition comprising oligonucleotides under conditions which allow for amplification of polynucleotides, wherein said oligonucleotidescomprise oligonucleotides of at least three different groups of oligonucleotides, and b) determining the contaminations based on the amplified polynucleotides obtained by using the oligonucleotide groups of step (a). Moreover, the invention relates to a composition comprising an oligonucleotide mixture. Further encompassed by the present invention is a composition comprising a probe oligonucleotide mixture. Finally, the present invention also relates to kits comprising said oligonucleotide mixtures.

Description

Composition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures
The present invention relates to a method for determining contaminations in a cell culture sample comprising the steps of (a) contacting a sample of a cell culture suspected to comprise contaminations with a composition comprising oligonucleotides under conditions which allow for amplification of polynucleotides, wherein said oligonucleotides comprise oligonucleotides of at least three different groups of oligonucleotides, and (b) determining the contaminations based on the amplified polynucleotides obtained by using the oligonucleotide groups of step (a). Moreover, the invention relates to a composition comprising an oligonucleotide mixture. Further encompassed by the present invention is a composition comprising a probe oligonucleotide mixture. Finally, the present invention also relates to kits comprising said oligonucleotide mixtures.
Contamination of eukaryotic cell cultures with microbial organisms as well as with other eukaryotic cell lines remains a major problem in cell culture related research. Although the contamination of cell cultures has been known for more than 50 years now, it is still a widespread cause for erroneous research results, for a reduced reproducibility and even for unusable therapeutic products. In the worst scenario, contamination with a microbial organism or cross-contamination with other eukaryotic lines may lead to diminished cell growth and may result in the loss of cultures.
Mycoplasma belong to the class Mollicutes and are frequently found in cell cultures as a contaminant. About 15% to 35% of all cell lines are infected with a limited number of Mycoplasma species predominantly of human, swine or bovine origin (Uphoff et al, 2002, In Vitro Cell Dev Biol Anim. 38(2):7985). A frequent cause for Mycoplasma contaminations are contaminated cell culture medium ingredients or careless working. Due to their small cell size, Mycoplasma are difficult to detect with a conventional microscope. Mycoplasma can affect most cellular functions such as inhibition of cell proliferation and protein biosynthesis, alteration of immunological reactions, virus proliferation and microarray gene expression profiles. Therefore, specific methods are required to detect Mycoplasma in a cell culture. Mycoplasma usually do not overgrow cell cultures. However, since Mycoplasma lack a cell wall, some antibiotics (e.g. ampicillin) are not effective to suppress Mycoplasma growth in cell culture.
Recently, SMRV (squirrel monkey retrovirus) was found to be a widespread cause for cell contamination. E.g., it was found that cells used for commercial production of interferon were contaminated with SMRV. SMRV was originally isolated from a lung tissue of the squirrel monkey Saimiri sciureus more than 30 years ago. The virus belongs to the class of endogenous type D retroviruses and is classified in biological risk group 2. Infection of other organisms is not described but since contamination of numerous vertebrate cell systems were described, an infection can not be excluded. Therefore, the German Central Commission for Biological Safety (ZKBS) recommends testing of all used cell lines for SMRV. Contaminated cell lines must either be eliminated or used under conditions of biological safety level 2 or higher.
Cross-contamination of cell cultures with other permanent cell lines cultivated in parallel is not infrequent. One of the known most frequent causes of such cross-contamination of cell cultures is contamination with HeLa cells. HeLa cells are derived from cervical adenocarcinoma cells that are infected with the human papillomavirus 18 (HPV- 18). They are frequently used in medical research. Therefore, they are passed on from lab to lab, where practitioners did not always exercise stringent controls and/or were oblivious to cross-contamination as a problem. Moreover, since HeLa cells proved to be very robust in cell culture, they were capable of overgrowing many other cells present in the same culture.
Cell lines cultured from primary explants or subcultures after passage 1 can be endogenously infected with herpes, hepatitis and other viruses, as well as possible bacterial pathogens. This may represent a real and present source for human infection. Persons receiving primary or subsequent cultures of human lymphocytes, fetal cell mixtures, or hepatocytes may be obtaining human cells that contain human viruses including hepatitis and herpes viruses and even HIV. If not carefully tested by sensitive techniques contaminated cell lines pose a major threat to any personnel using it.
Contaminated cell cultures should never be used in research that demands a specific cell line and, therefore, should be generally discarded. The problem caused by contaminated cell lines can be mainly solved by an appropriate quality control including the analysis for cell cross-contamination in every cell culture laboratory. However, since the possible sources of cell culture contamination are numerous including viral and bacterial contamination as well as inter- or intraspecies contamination between various cell lines, the contaminations are difficult to assess.
A number of different methods for detecting contaminants in cell cultures have already been described and include, e.g. PCR, RNA hybridization, microscopic analysis and microbiological colony assay. However, the assays established for cell culture testing usually only detect a single source for cell contamination such as Mycoplasma or HeLa cells. Specifically, several commercial kits exist in the market to detect Mycoplasma. These tests are based not only on PCR amplification and subsequent read-out by e.g. gel electrophoresis but also on culturing cells in different media, DAPI staining, DNA hybridisation, and antibodies for specific Mycoplasma species. Among the PCR tests, several kits exist including e.g. the PCR Mycoplasma Test Kit from AppliChem, the PCR Mycoplasma Test Kit from MD Biosciences Inc., the \enor®GeM-Mycoplasma Detection Kit from Minerva Biolabs and many more. All these PCR tests rely on a precise PCR program with specific annealing and elongation temperatures and the specific primer compositions to achieve maximal sensitivity and specificity. Concerning the detection of HeLa contaminations, HPV genotyping tests could be applied. Among these e.g. the Amplicor® test from Roche and the INNO-LiP A® HPV Genotyping Extra from Innogenetics apply strict PCR protocols and subsequent hybridisation to probes coupled to membranes.
Hepatitis B detection mostly relies on antibody detection against HBsAg, but can also be done by a variety of different tests including e.g. the real-time PCR-based artus® HBV LC
PCR Kit from Qiagen, the COBAS® AmpliScreen HBV Test from Roche, and the INNO- LiPA HBV Genotyping kit from Innogenetics. As for Mycoplasma and HBV detection, these tests rely on precise PCR protocols.
No human herpes virus kit is commercially available to genotype all HHVl to 8. For SMRV and SV40 (VPl, Tag, VP3) detection, no commercial kits are yet available. Inter- species cross-contamination can be analysed by isoenzyme analysis or mitochondrial cytocrome b PCR-RFLP, but no commercial kit is available. Thus, while enabling to detect specific contaminations, known assays fail to assess numerous other possible contaminants simultaneously.
Thus, the technical problem underlying the present invention may be seen as the provision of means and methods for reliably determining a plurality of contaminations in cell cultures simultaneously without the drawbacks as referred to above. The technical problem is solved by the embodiments characterized in the claims and herein below.
Accordingly, the present invention relates to a method for determining contaminations in a cell culture sample comprising the steps of a) contacting a sample of a cell culture suspected to comprise contaminations with a composition comprising oligonucleotides of at least three different groups of oligonucleotides, said groups being selected from aa) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by the squirrel monkey retrovirus (SMRV), wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 1 and SEQ ID NO:2 (oligonucleotides for amplification of
SMRV gag), and ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:3 and SEQ ID NO:4 (oligonucleotides for amplification of SMRV env); and iii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i) and/or (ii), bb) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by different
Mycoplasma species, wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:5 and SEQ ID NO:6 and (oligonucleotides for amplification of the 16S RNA gene of different Mycoplasma species, Myco I) ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 7 and SEQ ID NO: 8 and (oligonucleotides for amplification of the 16S RNA gene of different Mycoplasma species, Myco II) iii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i) and/or (ii), cc) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by HeLa cells wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:9 and SEQ ID NO: 10 (oligonucleotides for amplification of the E7 gene of HPV- 18, HeIa) ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), dd) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by adenovirus, wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO: 11 and SEQ ID NO: 12 (oligonucleotides for amplification of different adenovirus genotypes) and ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), ee) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by A. laidwaii wherein said at least one pair is selected the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO: 13 and SEQ ID NO: 14 (oligonucleotides for amplification of the 16S RNA gene of Acholeplasma) and ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), ff) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides for a mammalian globin, wherein said at least one pair is selected the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO: 15 and SEQ ID NO: 16 (oligonucleotides for amplification of a human globin gene) ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 17 and SEQ ID NO: 18 (oligonucleotides for amplification of a mouse globin gene) iii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO: 19 and SEQ ID NO:20 (oligonucleotides for amplification of a rat globin gene); and iiii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii) and/or (iii), gg) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by different hepatitis B virus (HBV) strains wherein said at least one pair is selected the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:21 and SEQ ID NO:22 (oligonucleotides for amplification of different HBV species), and ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), hh) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by a herpes virus wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:23 and SEQ ID NO:24 (oligonucleotides for amplification of the UL42 gene of HSVl), ii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:25 and SEQ ID NO:26 (oligonucleotides for amplification of the UL42 gene of HSV2), iii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:27 and SEQ ID NO:28 (oligonucleotides for amplification of the UL42 gene of HHV3), iiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:29 and SEQ ID NO:30 (oligonucleotides for amplification of the UL42 gene of HHV4), iiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:31 and SEQ ID NO:32 (oligonucleotides for amplification of the UL42 gene of HHV5), iiiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:33 and SEQ ID NO:34 (oligonucleotides for amplification of the UL42 gene of HHV6), iiiiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:35 and SEQ ID NO:36 (oligonucleotides for amplification of the Pp41 gene of HHV7), and iiiiiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO :37 and SEQ ID NO:38 (oligonucleotides for amplification of the UL42 gene of HHV8), and iiiiiiiii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii), (iii), (iiii), (iiiii), (iiiiϋ), (iiiiiii) and/or (iiiiiiii), jj) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by a mammalian Y chromosome wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:39 and SEQ ID NO:40 (oligonucleotides for amplification of a polynucleotide of the human Y chromosome), ii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:41 and SEQ ID NO:42 (oligonucleotides for amplification of a polynucleotide of the rat Y chromosome), iii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:43 and SEQ ID NO:44 (oligonucleotides for amplification of a polynucleotide of the mouse Y chromosome), and iiii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii) and/or (iii), and kk) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by SV40
(simian virus 40), wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:45 and SEQ ID NO:46 (oligonucleotides for amplification ofvpl of SV40), ii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:47 and SEQ ID NO:48 (oligonucleotides for amplification of SV40 Tag), iii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:49 and SEQ ID NO:50 (oligonucleotides for amplification ofvp3 of SV40), and iiii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii) and/or (iii), and b) determining the contaminations in said sample based on the amplified polynucleotides obtained in step a).
The method of the present invention, preferably, is an in vitro method. Moreover, it may comprise steps in addition to those explicitly mentioned above. For example, further steps may relate to sample pre-treatments or evaluation of the results obtained by the method.
The method of the present invention may be also used for confirmation of contaminations in a cell culture sample. The method may be carried out manually or assisted by automation. Preferably, step (a) and/or (b) may in total or in part be assisted by automation, e.g., by suitable robotic and sensory equipment for the determination in step (b).
The term "contamination" as used herein, preferably, relates to any unwanted microorganisms or eukaryotic cells that are present in a cell culture sample. A microorganism in the context of the present invention, preferably, is a bacterium or a virus. Bacterial contaminations are, preferably, contaminations with Mycoplasma and Acholeplasma laidlawii. Contaminations with Mycoplasma are, preferably, contaminations with Mycoplasma strains M. arginini, M. fermentans, M. orale, M. hyorhinis, M. hominis, M. salivarium, M. synoviae, M. pirum, M. gallisepticum, M. pneumoniae, and Acholeplasma laidlawii. Viral contaminations are, preferably, contaminations with SMRV (squirrel monkey retrovirus), contaminations with human papilomvirus 18, contaminations with a human herpes virus including herpes simplex virus 1 (HSVl), herpes simplex virus 2 (HSV2), Epstein-Barr virus (EBV), Varizella Zoster virus (VZV), Cytomegalie virus (CMV), HHV 6, 7, and/or 8 (HHV: human herpes virus), contaminations with HBV (hepatitis B virus) including genotypes A-H, contaminations with adenovirus 1, 2, 5, and/or 6, contaminations with human and simian immunodeficiency viruses HIV/SIV), and contaminations with SV40 (simian vacuolating virus 40).
A contamination with eukaryotic cells is herein also referred to as cross contamination. Contaminations with eukaryotic cells include, preferably, contaminations with any unwanted eukaryotic cells and, more preferably, with any unwanted mammalian cells. Even more preferably, such a contamination is a contamination with human cells, monkey cells (green monkey or cynomolgus monkey), mouse cells, rat cells, Chinese hamster cells, feline cells, rabbit cells, Guinean pig cells, cow cells, pig cells or canine cells. Moreover, it is also contemplated that a cross-contamination is by cells of a different chromosomal sex, thus male cells instead of female cells and vice versa. Such a cross-contamination, preferably, can be assessed by using oligonucleotides that are specific for the Y- chromosome.
Also contemplated by the present invention is a contamination with HeLa cells. HeLa cells are well known in the art and are frequently used in research. Said cells are human immortal cells derived from cervical cancer cells and contain the human papillomavirus 18 (HPV- 18) genome. Since HeLa cells are commonly used cell lines and since they grow very rapidly, they can outgrow other cells within the same cell culture and, thus, are a frequent contaminant in cell cultures.
Other contaminations, preferably, can be assessed by detecting specific viral DNA sequences that are permanently present in a host cell. In addition to natural infection, such intracellular viral sequences can originate from experimental introduction into cell lines either by trans fection of recombinant nucleic acids containing viral sequences such as promotors, enhancers, splice and polyadenylation signal sequences or by experimental infection using transforming viruses such as EBV or SV40 to immortalize cells in order to obtain stably growing cell lines. Specifically, some frequently used cell lines are known to comprise DNA of viral origin, e.g. as already mentioned above HeLa cells comprise HPV- 18, HEK293T cells comprise DNA of Adenovirus 5 and SV40 (more examples can be found herein elsewhere), whereas other cell lines are free of certain virus-derived DNA. Therefore, an oligonucleotide pair capable of amplifying certain viral sequences allows differentiating whether a respective contamination is present in a cell culture sample.
It is to be understood that in case of cross-contamination the wanted cells may not be present at all in the cell culture that is analyzed by the method of the present invention, e.g. due to a putative mix up of the cell cultures samples in the past, or due to a contamination of the cell culture sample in the past by eukaryotic cells that outgrew the cells that were originally present in a cell culture sample.
The term "contacting" as used in the context of the method of the present invention is understood by the skilled person. Preferably, the term relates to bringing a composition of the present invention in physical contact with a sample and thereby, e.g. allowing the sample and the composition to interact.
The term "cell culture sample", preferably, relates to a sample of cells which are maintained in vitro in a suitable cultivation medium. Preferably, said cells are eukaryotic cells, more preferably mammalian cells and most preferably mouse, rat, feline, canine, bovine, rabbit, Guinean pig, pig, Chinese hamster, monkey or human cells. Preferably, the sample may have any volume deemed appropriate. Moreover, the sample may have been further processed in order to carry out the method of the present invention. Particularly, polynucleotides such as DNA or RNA, preferably DNA, might be extracted and/or purified from the obtained sample by methods and means known in the art (e.g., see Examples). Thus, the term sample also may relate to polynucleotides, preferably DNA, purified and/or extracted from any sample as mentioned to above. A particularly preferred method for the preparation of DNA from a cell culture is by centrifugation of a suitable volume of the cell culture, resuspending the pellet in a suitable buffer, such as phosphate-buffered saline (PBS) or an other buffer suitable for PCR amplification, incubating the cell suspension at a high temperature such as 95°C, followed by a centrifugation step in order to allow removal of the cell debris. The, thus, obtained supernatant comprising extracted DNA can be analyzed in the method of the present invention. Moreover, prior to the analysis said supernatant can be stored at low temperatures such as -200C.
A sample of a cell culture suspected to comprise contaminations may be any sample of cultivated eukaryotic cells, preferably of cultivated mammalian cells. It is to be understood that said cells have been specifically prepared for cultivation or have been cultivated in vitro prior to analysing them by the method of the present invention. Thus, the sample may also be a primary cell culture which can be analyzed by the method of the present invention in order to assess the cells/contaminations present in said primary cell culture.
The sample may comprise more than one contamination, i.e. a plurality of contaminations. Preferably, sample comprises at least one contamination. At least one means one or more than at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or more contaminations. However, a sample suspected to comprise contaminations may also turn out to be free of contamination, i.e. does not comprise any contamination that can be detected by applying the method of the present invention.
The term "composition comprising oligonucleotides" as used herein relates to a composition comprising oligonucleotide molecular species wherein all molecules of the molecular species have a specific nucleic acid sequence. Preferably, the term "oligonucleotide" relates to a primer for DNA amplification techniques such as PCR (whereas the term "probe oligonucleotides", preferably, relates to probes, see herein below). An oligonucleotide shall comprise a number of nucleotides being sufficient for specific binding to a sequence stretch of a target polynucleotide. Preferably, an oligonucleotide as meant herein has between 15 and 30 nucleotides in length, more preferably between 18 and 28 nucleotides in length, and most preferably between 23-25 nucleotides in length. Preferably, the sequence of the oligonucleotide is not degenerated. Preferably, the oligonucleotide is a single-stranded oligodesoxyribonucleotide. However, due to self-complementarity the oligonucleotide may be partially double-stranded under certain conditions (depending on, e.g., the sequence of the oligonucleotide, the salt concentration and the temperature). Particularly preferred oligonucleotides have the specific sequences and/or properties referred to herein.
The oligonucleotides of the present invention, preferably, are used as a starting molecule for the synthesis of a polynucleotide which is sufficiently complementary to the nucleic acid strand to be copied by an appropriate amplification technique, preferably by PCR, for polynucleotides.
The oligonucleotides of the present invention may be labelled or contain other modifications which allow a detection and/or analysis of an amplification product and/or the binding to a carrier. Labelling can be done by various techniques well known in the art and depending of the label to be used. Particularly, the oligonucleotides may be biotinylated in order to enable the binding of the amplification products to a streptavidin surface or fluorescent conjugate. Moreover, labels to be used in the context of the present invention may be, but are not limited to, fluorescent labels comprising, inter alia, fluorochromes such as R-phycoerythrin, Cy3, Cy5, fluorescein, rhodamin, Alexa, or Texas Red. However, the label may also be an enzyme or an antibody. It is envisaged that an enzyme to be used as a label will generate a detectable signal by reacting with a substrate. Suitable enzymes, substrates and techniques are well known in the art. An antibody to be used as label may specifically recognize a target molecule which can be detected directly (e.g., a target molecule which is itself fluorescent) or indirectly (e.g., a target molecule which generates a detectable signal, such as an enzyme). The oligonucleotides of the present invention may also contain 5 ' restriction sites, locked nucleic acid molecules (LNA) or be part of a peptide nucleotide acid molecule (PNA). Such PNA can be, in principle, detected via the peptide part by, e. g., antibodies.
The term "composition comprising oligonucleotides" as meant herein relates to a mixture of different oligonucleotide molecular species, preferably of oligonucleotide groups as specified elsewhere in this application. In addition, a composition may comprise further components other than the oligonucleotides, e.g. components for the amplification of polynucleotides of polynucleotides, preferably by polymerase chain reaction (PCR). Such components may be, but are not limited to, an aqueous buffer, a water soluble magnesium salt, deoxythymidine triphosphate (dTTP), deoxyadenosine triphosphate (dATP), deoxycitidine triphosphate (dCTP) and deoxyguanosine triphosphate, (dGTP) and a DNA polymerase, e.g. the thermostable DNA polymerase from Thermus aquaticus.
The term "oligonucleotide group" as used herein, preferably, relates to a composition comprising a plurality of oligonucleotide pairs. However, it is also contemplated that an oligonucleotide group may only comprise one oligonucleotide pair. Preferably, an oligonucleotide group is specific for one type of contamination (belonging to the same phylogenetic tree), e.g. for a contamination with Mycoplasma or a contamination with HHV species, different Mycoplasma species or various adenoviral species.
The term "at least three oligonucleotide groups", preferably, relates to three or more than three oligonucleotide groups, thus at least three, four, five, six, seven, eight, nine oligonucleotide groups or more.
The term "oligonucleotides pair", preferably, relates to two olignucleotides capable of amplifying polynucleotides that are specific for a contamination. The sequences of the oligonucleotides as well as the corresponding targets and probe oligonucleotides are shown also shown in table 1.
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by the squirrel monkey retrovirus (SMRV)", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide encoding (i) the gag gene (GenBank Accession Number NC 001514.1) of SMRV or (ii) the env gene (GenBank Accession Number NC 001514.1) of SMRV. It is to be understood, that in the context of the method of the present invention also parts of the respective genes may be amplified. Preferably, for (i) the pair of oligonucleotides have a nucleic acid sequence as shown in SEQ ID NO: 1 and SEQ ID NO:2 (i.e. said pairs comprises an oligonucleotide having a nucleic acid sequence as shown in SEQ ID NO: 1, and an oligonucleotide having a nucleic acid sequence as shown in SEQ ID NO:2) (oligonucleotides for amplification of SMRV gag), and for (ii) the oligonucleotides have a nucleic acid sequence as shown in SEQ ID NO:3 and SEQ ID NO:4 (oligonucleotides for amplification of SMRV env). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs, thus the pairs mentioned in (i) or (ii).
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by different Mycoplasma", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide encoding (i) the 16S ribosomal RNA gene of the following Mycoplasma species M. arginini (GenBank Accession Number U15794.1), M. fermentans (GenBank Accession Number M24289.1), M. orale (GenBank Accession Number AY796060.1), M. hyorhinis (GenBank Accession Number AF412982.1), M. hominis (GenBank Accession Number M96660.1), M. salivarium (GenBank Accession Number AF125583.1), M. synoviae (GenBank Accession Number X52083.1), M. gallisepticum (GenBank Accession Number NC 004829.1), or (ii) the 16S ribosomal RNA gene of the following Mycoplasma species M. pirum (GenBank Accession Number M23940.1) and M. pneumoniae (GenBank Accession Number AF132741.1), or parts thereof. Preferably, for (i) the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO: 7 and SEQ ID NO: 8 (oligonucleotides for amplification of the 16S RNA gene of different Mycoplasma species, Myco I), and for (ii) a pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:5 and SEQ ID NO :6 (oligonucleotides for amplification of the 16S RNA gene of different Mycoplasma species Myco II). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs, thus the pairs mentioned in (i) or (ii).
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by A. laidwaii", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide encoding the 16S ribosomal RNA gene (GenBank Accession Number AY740437.1) of A. laidwaii. Preferably, the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO: 13 and SEQ ID NO: 14 (oligonucleotides for amplification of the 16S RNA gene of Acholeplasma). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pair.
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by HeLa cells", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide that is originally derived from HPVl 8 (human papillomavirus) which is stably integrated into the genome of HeLa cells. Preferably, the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:9 and SEQ ID NO:10 (oligonucleotides for amplification of the E7 gene of HPV-18, HeIa). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pair.
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by adenovirus", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide derived from adenovirus 1, 2, 5 or 6 encoding the ElA gene. It is to be understood that said polynucleotide may be stably integrated into the genomic DNA of a eukaryotic host cell line. Eukaryotic host cell lines known to comprise adenoviral 5 DNA, preferably, are HEK293 and HEK293T. Preferably, the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO: 1 1 and SEQ ID NO: 12 (oligonucleotides for amplification of different adenovirus genotypes). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs.
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides for a globin gene", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide comprised by a beta-globin gene, preferably of a mammalian globin gene and, more preferably, of a rat, human and mouse globin gene. Preferably, said pair of oligonucleotides has a nucleic acid sequence as shown in (i) SEQ ID NO: 15 and SEQ ID NO: 16 for the human globin (oligonucleotides for amplification of a human globin gene), (ii) in SEQ ID NO: 17 and SEQ ID NO : 18 for mouse globin (oligonucleotides for amplification of a mouse globin gene), or (iii) in SEQ ID NO: 19 and SEQ ID NO:20 for rat globin (oligonucleotides for amplification of a rat globin gene). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs.
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by hepatitis B virus (HBV) strains", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide derived from various hepatitis B virus strains/genotypes encoding the protein S gene. It is well known in the art that the genomic region comprising said polynucleotide is highly conserved. Therefore, said pair of polynucleotides allows the detection of various HBV strains including genotypes A to G. It is to be understood that said polynucleotide may be stably integrated into the genomic DNA of a eukaryotic host cell line. A eukaryotic host cell line known to comprise HBV DNA, preferably, is the liver cancer cell line Alexander (IFO50069). Preferably, for (i) the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:21 and SEQ ID NO:22 (oligonucleotides for amplification of different HBV species). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs, thus the pairs mentioned in (i).
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by a herpes virus", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide derived from human herpes virus 1, 2, 3, 4, 5, 6, 7 and 8, respectively (Human herpes simplex virus 1, HSVl, frequently also referred to as HHVl, Human herpes simplex virus 2, HSV2, frequently also referred to as HHV2, Varicella Zoster Virus, VZV, frequently also referred to as HHV3, Epstein Barr virus, EBV, frequently also referred to as HHV4, Cytomegalovirus, CMV, frequently also referred to as HHV5, HHV6, HHV7 and HHV8 frequently also referred to as Kaposi's sarcoma- associated herpesvirus, encoding a gene of the UL42 or UL44 families. It is to be understood that said polynucleotide may be stably present in a eukaryotic cell line. Eukaryotic host cell lines known to comprise EBV (HHV4), preferably, are Namalwa, P3HR1, or B95-8. Preferably, the pair of oligonucleotides for HSVl has a nucleic acid sequence as shown in SEQ ID NO :23 and SEQ ID NO :24 (oligonucleotides for amplification of the UL42 gene of HSVl), for HSV2 a nucleic acid sequence as shown in SEQ ID NO:25 and SEQ ID NO:26 (oligonucleotides for amplification of the UL42 gene of HSV2), for HHV3 a nucleic acid sequence as shown in SEQ ID NO:27 and SEQ ID NO:28 (oligonucleotides for amplification of the UL42 gene of HSV3), for HHV4 a nucleic acid sequence as shown in SEQ ID NO:29 and SEQ ID NO:30 (oligonucleotides for amplification of the UL42 gene of HSV4), for HHV5 a nucleic acid sequence as shown in SEQ ID NO:31 and SEQ ID NO:32 (oligonucleotides for amplification of the UL42 gene of HSV5), for HHV6 a nucleic acid sequence as shown in SEQ ID NO:33 and SEQ ID NO:34 (oligonucleotides for amplification of the UL42 gene of HSV6), for HHV7 a nucleic acid sequence as shown in SEQ ID NO:35 and SEQ ID NO:36 (oligonucleotides for amplification of the UL42 gene of HSV7), and for HHV8 a nucleic acid sequence as shown in SEQ ID NO:37 and SEQ ID NO:38 (oligonucleotides for amplification of the UL42 gene of HSV8). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs.
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by a mammalian Y chromosome", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide comprised by a mammalian Y chromosome, preferably of the (i) human, (ii) rat and (iii) mouse sex determining region of Y chromosome (Sry), respectively. Preferably, said pair of oligoucleo tides has a nucleic acid sequence as shown in SEQ ID NO:39 and SEQ ID NO:40 for (i), and SEQ ID NO:41 and SEQ ID NO:42 for (ii), and SEQ ID NO:43 and SEQ ID NO:44 for (iii). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs. The term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by SV40 (simian virus 40)", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide derived from SV40 (J02400) encoding (i) the vpl gene, (ii) the T-antigen, and (iii) the vp3 gene, respectively. It is to be understood that said polynucleotide may be stably integrated into the genomic DNA of a eukaryotic host cell line. Eukaryotic host cell lines known to comprise SV40 DNA, preferably, are HEK293T or cos7. HEK293T cells are known to contain vpl and T-antigen sequences, while vpl, T- antigen and vp3 sequences are found in Cos7. Moreover, many DNA vectors that are used to transfect cell lines contain SV40 elements, such as the poly- A signal found in vpl or splice sites found in the T-antigen. Therefore, a detection of vpl and/or T-antigen may also be due to a transfection with such vectors or due to the contamination with a cell line transfected with one of these vectors. Preferably, for (i) the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:45 and SEQ ID NO:46 (oligonucleotides for amplification of vpl of SV40). Preferably, for (ii) the pair of oligonucleotides has a nucleic acid sequence as shown in SEQ ID NO:47 and SEQ ID NO:48 (oligonucleotides for amplification of SV40tag). Preferably, for (iii) the pair of oligonucleotides (vp3) has a nucleic acid sequence as shown in SEQ ID NO:49 and SEQ ID NO:50 (oligonucleotides for amplification of the vp3 of S V40). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs.
The amount and/or the concentration of the oligonucleotides may be any amount or concentration deemed appropriate. The amounts and/or concentrations of the individual oligonucleotides of the invention may differ and, thus, a solution comprising said oligonucleotides may not be equimolar with respect to the oligonucleotides. Preferred concentrations of the oligonucleotides in a solution suitable for the amplification of polynucleotides can be found in the Examples. A particularly preferred concentration of each oligonucleotide is between 0.5 and 5 μM, more preferably 1 and 4 μM, most preferable 2 and 3 μM. Moreover, it is to be understood that the person skilled in the art is able to adjust the concentrations of the oligonucleotides of the invention in order to optimize the amplification of specific polynucleotides as referred to herein and, thus, to optimize the detection of contaminations in a cell culture without further ado. The term "under conditions which allow for amplification of polynucleotides" as used herein is understood by the skilled person. The term relates to a template-dependent process which results in an increase of the amount of a nucleic acid molecule relative to its initial amount. In accordance with the present invention the amplification of a polynucleotide of interest shall allow its detection by any method deemed appropriate and/or, e.g., described herein below. The amplification of a polynucleotide of interest may be carried out by well-known methods, preferably by polymerase chain reaction (PCR), but also by reverse transcriptase PCR, real-time PCR, reverse transcriptase real-time PCR, Templex-PCR, nucleic-acid sequence based amplification (NASBA), and isothermal amplification methods using polymerases and specific oligonucleotides as primers. The aforementioned amplification methods are well known in the art. Preferred embodiments of a PCR in the context of the present invention are described in the Examples.
The term "determining contaminations" as used herein relates to assessing the presence or absence of certain contaminating cells as referred to herein in a cell culture sample. Preferably, the contaminations are determined, and thus detected, simultaneously. The determination of contaminations is done by identifying amplified polynucleotides that are specific for the contaminations to be detected. Preferably, the amplification of polynucleotides that are specific for the respective contaminations is done in only one container, thus, in the same container. A preferred container is a reaction tube. Such reaction tubes well known in the art and, e.g., are commonly as referred to as PCR tubes. It is to be understood that the form of these tubes may depend on the PCR apparatus used for the amplification of contamination-specific oligonucleotides.
The determination of the contaminations is based on the amplified polynucleotides, and relates to identifying amplified polynucleotides that are specific for the various, individual contaminations. Preferably, this will be achieved by detecting the presence or absence of amplified polynucleotides that are specific for the contaminations to be detected. Methods of determining if an amplified polynucleotide is present or absent are well known in the art and preferably rely on the comparison of the amount and/or identity of the amplified polynucleotides to suitable controls, as exemplified in Example 10. Based on the determination contaminations can be identified. If an amplified polynucleotide that is specific for an individual contamination is present, then the respective contamination is present in the cell culture sample. If there is no amplification product for a polynucleotide that is specific for a certain contamination and, thus, if an amplified polynucleotide is absent, the respective contamination is not present in the tested cell culture sample. However, it is also to be understood that the amplification of certain polynucleotides also may indicate that a cell line comprises wanted cells. E.g. if cell culture samples are tested that should comprise human cells, an amplification of a human globin polynucleotide would indicate that said cell culture samples, indeed, comprise human cells.
The detection/ identification of a plurality of amplified polynucleotides and, thus, of a plurality of contaminations can be done because of sequence variation between the amplified polynucleotides. Determining the contaminations based on the amplified polynucleotides is, preferably, done by using suitable probe oligonucleotides. Thus, the determination of the various amplified polynucleotides, preferably, comprises the step of hybridizing the amplified polynucleotides with probe polynucleotides that specifically bind to the amplified polynucleotides. A probe oligonucleotide in the context of the present invention, preferably, is single-stranded nucleic acid molecule that is specific for a polynucleotide that can be amplified by using the oligonucleotides according to the invention. The skilled person knows that a probe oligonucleotide comprises a stretch of nucleotides that specifically hybridize with the target, thus, is complementary to the target polynucleotide. Said stretch of nucleotides is, preferably, 85%, 90%, 95%, 99% or more preferably 100% identical to a sequence region comprised by a target polynucleotide. The degree of identity (percentage, %) between two or more nucleic acid sequences is, preferably, determined by the algorithms of Needleman and Wunsch or Smith and Waterman. To carry out the sequence alignments, the program PiIeUp (J. MoI. Evolution., 25, 351-360, 1987, Higgins 1989, CABIOS, 5: 151-153) or the programs Gap and BestFit (Needleman 1970, J. MoI. Biol. 48; 443-453 and Smith 1981, Adv. Appl. Math. 2; 482- 489), which are part of the GCG software packet (Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711, vers. 1991), are to be used. The sequence identity values recited above in percent (%) are to be determined, preferably, using the program GAP over the entire sequence region with the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10.000 and Average Mismatch: 0.000, which, unless otherwise specified, shall always be used as standard settings for sequence alignments. Preferably, a probe oligonucleotide as meant herein is between 15 and 30 nucleotides in length, more preferably between 15 and 28 nucleotides in length, and most preferably between 18-23 nucleotides in length. Preferably, the probe oligonucleotides are bound to a carrier providing a solid surface. Preferably, said carrier is a small particle or bead. The overall size of a small particle or bead, preferably, may be in the micrometer or nanometer range. Preferably, said beads and particles may be stained with a specific dye, more preferably with a specific fluorescent dye. Preferably, by staining various carriers with various dyes, the carries can be distinguished from each other. By using a carrier with a specific dye for a specific probe oligonucleotide (thus, a nucleic acid that targets the amplified polynucleotides of a specific contamination), said carrier is distinguishable from other carriers comprising different dyes. In one preferred embodiment commercially available Luminex microspheres (Luminex Corp., Austin, Texas, USA) are used. Thus, for determining contaminations the contamination-specific probes are coupled to fluorescence- labelled polystyrene beads (Luminex suspension array technology) which are hybridized with the amplification products under suitable, preferably, stringent conditions. Moreover, the amplification products may be identified by use of microarrays, Reverse-Line Blots (RLB), Dot blots or similar technologies which contain contamination specific probe oligonucleotides linked to a suitable carrier.
In another preferred embodiment of the current invention, one or more antisense oligonucleotide(s) to one or more oligonucleotide(s) is (are) comprised in the hybridisation assay. The antisense oligonucleotide, preferably, is an oligonucleotide with properties as specified above with the ability to specifically hybridize to an oligonucleotide. More preferably, the antisense oligonucleotide is an oligonucleotide with properties as specified above comprising the complementary sequence of an oligonucleotide. Methods to determine complementarity of nucleic acid sequences are well known in the art and rely on Watson-Crick rules for base pairing in nucleic acids. Most preferably, antisense oligonucleotides are oligonucleotides with properties as specified above comprising nucleic acid sequences as shown in SEQ ID No: 157 to 165. Preferably, the probe oligonucleotides that specifically bind to the amplified polynucleotides are selected from the group consisting of probe oligonucleotides comprising a nucleic acid sequence as shown in SED ID NO: 78 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma orale and, thus, of Mycoplasma orale), SED ID NO: 79 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma hyorhinis and, thus, of Mycoplasma hyorhinis), SED ID NO: 80 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma arginini, and, thus of Mycoplasma arginini), SED ID NO: 81 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma fermentans, and, thus, of Mycoplasma fermentans) SED ID NO: 82 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma salivarium, and, thus, of Mycoplasma salivarium), SED ID NO: 83 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma hominis and, thus, of Mycoplasma hominis), SED ID NO: 84 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma synoviae, and, thus, of Mycoplasma synoviae), SED ID NO: 85 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma gallisepticum, and, thus of Mycoplasma gallisepticum), SED ID NO: 86 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma orale, Mycoplasma hyorhinis, Mycoplasma arginini, Mycoplasma fermentans, Mycoplasma salivarium, Mycoplasma hominis, Mycoplasma synoviae, and Mycoplasma gallisepticum) SED ID NO: 87 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma pneumoniae and, thus, of Mycoplasma pneumoniae), SED ID NO: 88 (allows detection of the 16 S ribosomal RNA gene of Mycoplasma pirum, and, thus, of Mycoplasma pirum), SED ID NO: 89 (allows detection of the 16 S ribosomal RNA gene of M. pirum and M. pneumoniae, and, thus, of M. pirum and M. pneumoniae), SED ID NO: 90 (allows detection of the 16 S ribosomal RNA gene of A. laidlawii, and, thus, of A. laidlawii), SED ID NO:91 (allows detection of the 16 S ribosomal RNA gene of A. granularum, and, thus, of A. granularum), SEQ ID NO:92 (allows detection of the E7 gene of HPVl 8 and, thus, of HeLa cells), SEQ ID NO:93 (allows detection of the rat beta globin gene and, thus, of rat cells), SEQ ID NO:94 (allows detection of the mouse beta globin major gene, and, thus, of mouse cells), SEQ ID NO:95 (allows detection of the cynomolgus beta globin chain gene, and, thus, of cynomolgus cells), SEQ ID NO:96 (allows detection of the human beta globin chain gene, and, thus of human cells ), SEQ ID NO:97 (allows detection of human and monkey beta globin chain gene, and, thus, of human and monkey cells.), SEQ ID NO:98 (allows detection of the PoI-A gene of different mammalian and vertebrate cells (see above), SEQ ID NO:99 (allows detection of the ElA gene of Adenovirus 1 and 2, and, thus of Adenovirus 1 and 2), SEQ ID NO: 100 (allows detection of the ElA gene of Adenovirus 5, and, thus of Adenovirus 5), SEQ ID NO: 101 (allows detection of the ElA gene of Adenovirus 6, and, thus of Adenovirus 6), SEQ ID NO:102 (allows detection of the ElA gene of Adenovirus 1, 2, 5 and 6, and, thus of Adenovirus 1, 2, 5 and 6), SEQ ID NO:103 (allows detection of the gag gene of SMRV and, thus, of SMRV), SEQ ID NO: 104 (allows detection of the env gene of SMRV and, thus, of SMRV), SEQ ID NO:105 (allows detection of the protein S gene of HBV A, and, thus of HBV A), SEQ ID NO: 106 (allows detection of the protein S gene of HBV A and B, and, thus of HBV A and B), SEQ ID NO: 108 (allows detection of the protein S gene of HBV C, and, thus of HBV C), SEQ ID NO:109 (allows detection of the protein S gene of HBV D, and, thus of HBV D), SEQ ID NO:110 (allows detection of the protein S gene of HBV E, and, thus of HBV E), SEQ ID NO:111 (allows detection of the protein S gene of HBV F, and, thus of HBV F), SEQ ID NO:112 (allows detection of the protein S gene of HBV G, and, thus of HBV G), SEQ ID NO:113 (allows detection of the protein S gene of HBV H, and, thus of HBV H), SEQ ID NO: 114 (allows detection of the 16 S ribosomal gene of Chinese hamster cells, and, thus, of Chinese hamster cells), SEQ ID NO: 115 (allows detection of the 16 S ribosomal gene of canine cells, and, thus, of canine cells), SEQ ID NO: 116 (allows detection of the 16 S ribosomal gene of feline cells, and, thus, of feline cells), SEQ ID NO: 117 (allows detection of the 16 S ribosomal gene of Green monkey cells, and, thus, of Green monkey cells), SEQ ID NO: 118 (allows detection of the 16 S ribosomal gene of mouse cells, and, thus, of mouse cells), SEQ ID NO: 119 (allows detection of the 16 S ribosomal gene of rat cells, and, thus, of rat cells), SEQ ID NO:120 (allows detection of the 16 S ribosomal gene of cynomolgus monkey cells, and, thus, of cynomolgus monkey cells), SEQ ID NO: 121 (allows detection of the 16 S ribosomal gene of Guinean pig cells, and, thus, of Guinean pig cells), SEQ ID NO: 148 (allows detection of the 16 S ribosomal gene of rabbit cells, and, thus, of rabbit cells), SEQ ID NO: 146 (allows detection of the 16 S ribosomal gene of pig cells, and, thus, of pig cells), SEQ ID NO: 147 (allows detection of the 16 S ribosomal gene of bovine cells, and, thus, of bovine cells), SEQ ID NO: 122 (allows detection of the T-Antigen of SV40, and, thus, of SV40), SEQ ID NO: 123 (allows detection of the VPl gene of SV40, and, thus, of SV40), SEQ ID NO: 124 (allows detection of the VP3 gene of SV40, and, thus, of SV40), SEQ ID NO: 125 (allows detection of the Y chromosome of mouse cells, and, thus of male mouse cells), SEQ ID NO: 126 (allows detection of the Y chromosome of human and monkey cells, and, thus of male human and monkey cells), SEQ ID NO: 127 (allows detection of the Y chromosome of rat cells, and, thus of male rat cells), SEQ ID NO: 128 (allows detection of the UL42 gene of HHVl, and, thus, of HHVl (or cells comprising HHVl)), SEQ ID NO: 129 (allows detection of the UL42 gene of HHV2, and, thus, of HHV2), SEQ ID NO: 130 (allows detection of the UL42 gene of HHV3, and, thus, of HHV3), SEQ ID NO: 145 (allows detection of the UL42 gene of HHV4, and, thus, of HHV4), SEQ ID NO: 131 (allows detection of the UL42 gene of HHV5, and, thus, of HHV5), SEQ ID NO: 132 (allows detection of the pp41 gene of HHV6, and, thus, of HHV6), SEQ ID NO :133 (allows detection of the UL42 gene of HHV7, and, thus, of HHV7), SEQ ID NO: 134 (allows detection of the UL42 gene of HHV8, and, thus, of HHV8), SEQ ID NO: 135 (allows detection of the gag gene of HIV 1 group M and N, and, thus, of HIV 1 group M and N), SEQ ID NO:136 (allows detection of the pol gene of HIV 1 group M, and, thus, of HIV 1 group M), SEQ ID NO: 137 (allows detection of the pol gene of HIV 1 group O, and, thus, of HIV 1 group O)SEQ ID NO: 138 (allows detection of the pol gene of HIV 1 group N, and, thus, of HIV 1 group N), SEQ ID NO: 139 (allows detection of the gag gene of HIV 1 group N, and, thus, of HIV 1 group N), SEQ ID NO: 140 (allows detection of the gag gene of HIV 1 group O, and, thus, of HIV 1 group O), SEQ ID NO: 141 (allows detection of the pol gene of HIV 2, and, thus, of HIV 2), SEQ ID NO: 142 (allows detection of the pol gene of SIV, and, thus, of SIV), SEQ ID NO: 143 (allows detection of the env gene of HIV group 2A and SIV, and, thus, of HIV group 2A and SIV), and SEQ ID NO: 144 (allows detection of the env gene of HIV group 2U and 2B, and, thus, of HIV group 2U and 2B). Thus, the probe oligonucleotides that specifically bind to the amplified polynucleotides are, preferably, selected from the group consisting of probe oligonucleotides comprising a nucleic acid sequence as shown in SED ID NO: 78 to SEQ ID 144. Preferably, the probe oligonucleotides that specifically bind to the amplified polynucleotides are selected from the group consisting of probe oligonucleotides comprising a nucleic acid sequence as shown in SED ID NO: (SEQ ID No. 78 to 119, and SEQ ID No. 121 to 134, and SEQ ID No.145 to 148). The nucleic acid sequences of the probe oligonucleotides as well as the contaminants / cells that are detected by using said probe oligonucleotides are listed in table 1. Also shown in table 1 are the corresponding amplified polynucleotides as well as the oligonucleotide pairs that amplify these polynucleotides.
However, it is also contemplated by the present invention that the amplification products are identified by other methods known in the art. The identification may be done by sequencing amplification product(s) and or by RFLP (restriction fragment length polymorphism) analysis. The determination of contaminations can also be done by conducting microarray assays, southern blot assays, dot blot assays, or by membrane-based reverse line blot.
In a specific embodiment of the method of the present invention, the composition comprising oligonucleotides further comprises oligonucleotides capable of amplifying a fragment of the polymerase A (PoIA) polynucleotide, wherein said oligonucleotides bind to highly conserved regions of the PolA-polynucleotide.
The polA polynucleotide encodes for polymerase alpha (Ultraconserved Elements in the Human Genome, Bejerano et al, 2004) The polA polynucleotide is highly conserved between mammals and other vertebrates (e.g. in chicken and frog). Preferably, oligonucleotides capable of amplifying a fragment of the polymerase A (PolA) polynucleotide, preferably, allow for specifically amplifying a fragment or part of the polA polynucleotide of mammals, and more preferably, of the human, chimpanzee, mouse, rat, canine and feline polA polynucleotide.
The amplification of the polA polynucleotide, or of a fragment or part thereof, preferably, serves as an internal positive control. Therefore, the amplification of the polA polynucleotide allows for assessing errors that occurred, e.g., when preparing the template DNA for the analysis or when setting up the PCR reaction. Efficient amplification of the polA polynucleotide, preferably, indicates that the amplification reaction was successful and that the DNA is of sufficient quality, whereas inefficient amplification, preferably, indicates that an amplification reaction was not successful, e.g., due to an inappropriate sample or errors in the PCR setup. In the latter case, a PCR reaction may have to be repeated, e.g., with a freshly obtained sample and/or freshly purified DNA. Thus, the use of oligonucleotides that specifically amplify the polA polynucleotide, preferably, prevents false-negative results.
Preferably, the oligonucleotides capable of amplifying a fragment of the polymerase A (PoIA) polynucleotide have a nucleic acid sequence as shown in SEQ ID NO:51 and SEQ ID NO:52 (oligonucleotides for amplification of the polA gene of different mammalian vertebrate cells).
In another preferred embodiments of the method of the present invention, the composition comprising oligonucleotides further comprises an oligonucleotide group that comprises at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by the mitochondrial DNA of various mammals, wherein said at least one pair is selected from the group of oligonucleotide group consisting of an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by a mitochondrial DNA of various mammals wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:53 and SEQ ID NO:54 (thus, oligonucleotides for the detection of Chinese hamster cells), ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:55 and SEQ ID NO:56 (thus, oligonucleotides for the detection of canine cells), iii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:57 and SEQ ID NO:58 (thus, oligonucleotides for the detection of feline cells), iv) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:59 and SEQ ID NO:60 (thus, oligonucleotides for the detection of Green monkey cells), v) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO :61 and SEQ ID NO:62 (thus, oligonucleotides for the detection of mouse cells), vi) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO :63 and SEQ ID NO:64 (thus, oligonucleotides for the detection of rat cells), and vii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 65 and SEQ ID NO: 66 (thus, oligonucleotides for the detection of cynomolgus monkey cells), viii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 149 and SEQ ID NO: 150 (thus, oligonucleotides for the detection of rabbit cells), ix) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 151 and SEQ ID NO: 152 (thus, oligonucleotides for the detection of Guinean pig cells), x) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 153 and SEQ ID NO: 154 (thus, oligonucleotides for the detection of pig cells), and xi) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 155 and SEQ ID NO: 156 (thus, oligonucleotides for the detection of bovine cells), and xii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii), (iii), (iv), (v), (vi), (vii), (viii), (ix), (x) and/or (xi).
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides for a mitochondrial DNA", preferably relates to pairs of oligonucleotides capable of amplifying a polynucleotide encoding a 16S ribosomal RNA gene of different species, preferably of a rat, mouse, Chinese hamster, canine, feline, green monkey, cynomolgus monkey, rabbit, Guinean pig, and pig 16S ribosomal RNA gene. Preferably, said pairs of oligonucleotides have a nucleic acid sequence as shown in (i) SEQ ID NO: 63 and SEQ ID NO: 64 for the rat 16S ribosomal RNA gene, (ii) in SEQ ID NO:61 and SEQ ID NO:62 for the mouse 16S ribosomal RNA gene , (iii) in SEQ ID NO:53 and SEQ ID NO:54 for Chinese hamster 16S ribosomal RNA gene, (iv) in SEQ ID NO:55 and SEQ ID NO:56 for canine 16S ribosomal RNA gene, (v) in SEQ ID NO:57 and SEQ ID NO:58 for feline 16S ribosomal RNA gene, (vi) in SEQ ID NO:59 and SEQ ID NO:60 for green monkey 16S ribosomal RNA gene, (vii) in SEQ ID NO: 65 and SEQ ID NO: 66 for cynomolgus monkey 16S ribosomal RNA gene, or (viii) in SEQ ID NO: 149 and SEQ ID NO: 150 for rabbit 16S ribosomal RNA gene, (ix) in SEQ ID NO: 151 and SEQ ID NO: 152 for Guinean pigl6S ribosomal RNA gene, (x) in SEQ ID NO: 153 and SEQ ID NO: 154 for pig ribosomal RNA gene, or (xi) in SEQ ID NO: 155 and SEQ ID NO: 156 for the bovine 16S ribosomal RNA gene. Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs.
In another preferred embodiments of the method of the present invention, composition comprising oligonucleotides further comprises an oligonucleotide group that comprises at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by various HIV (human immunodeficiency virus) and SIV (simian immunodeficiency virus) strains, wherein said at least one pair is selected from the group of oligonucleotide group consisting of, i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:67 and SEQ ID NO:68 (oligonucleotides for amplification of HIVl gag), ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 69 and SEQ ID NO:71 (oligonucleotides for amplification of HIVl pol), iii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:70 and SEQ ID NO:71 (oligonucleotides for amplification ofHIVlpol), iiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 72 and SEQ ID NO: 73 (oligonucleotides for amplification of HIV gag), iiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 74 and SEQ ID NO: 75 (oligonucleotides for amplification ofHIV and SIV pol), iiiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 76 and SEQ ID NO: 77 (oligonucleotides for amplification of HIV/SIV env), and iiiiiii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii), (iii), (iiii), (iiiϋ), and/or (iiiiii).
The term "pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by various HIV and SIV strains", preferably relates to a pair of oligonucleotides capable of amplifying a polynucleotide comprised by the genome of various HIV strains, preferably of the (i) gag gene of HIV 1 group M and N, (ii) pol gene of HIV 1 group M, N, O, (iii) gag gene of HIV 1 group N and O, (iiii) pol gene of HIV 2 and SIV, and (iiiii) eng gene of HIV2 and SIV, respectively. Examples for HIV positive cell lines are, e.g. the T lymphoblastoid cell line 8E5 (NIH, ATCC 8993) or the T lymphoblastoid cell line H9/HTLV-IIIB (ATCC, CRL-8543). Preferably, said pair of oligonucleotides have a nucleic acid sequence as shown in SEQ ID NO:67 and SEQ ID NO:68 for (i), and SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71 (one forward primer and two backward primers, thus, two oligonucleotide pairs a) SEQ ID NO:69 and SEQ ID NO:71, b) SEQ ID NO:70 and SEQ ID NO:71) for (ii), SEQ ID NO:72 and SEQ ID NO:73 for (iii), and SEQ ID NO:74 and SEQ ID NO:75 for (iiii), and SEQ ID NO:76 and SEQ ID NO:77 for (iiiii). Preferably, the term also relates to pairs of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the aforementioned oligonucleotide pairs.
Advantageously, it was shown in the studies underlying the present invention that determining contaminations in a cell culture sample comprising the steps of contacting a cell culture sample with a composition comprising an oligonucleotides as referred to herein and detecting contaminations based on the amplified polynucleotides by applying said compositions is required for sufficient detection of contaminations in a cell culture sample. The method of the present invention is more reliable than the prior art since it allows the simultaneous determination of contaminations which can be microbial contaminations or cross-contamination with unwanted eukaryotic cell lines. The prior art does not teach the combined determination of contaminants as referred to herein. The method of the present invention, if applied, will be beneficial for basic research as well as for the commercial application of cell cultures since it allows a cost-effective and reliable determination of the most frequent contaminants of cell cultures. Moreover, by applying the method of the present invention it is possible to detect contaminants that are present in a cell culture sample to a very low extent. Therefore, the method of the present invention provides a very sensitive determination of various contaminants. Particularly, it was shown that SMRV was detected with less than 10 plasmid copy numbers, and that cell culture contaminations of less than 1 to 3 cells in a background of 6,000 cells per PCR reaction can be detected even if multiple contaminations are simultaneously present and tested for (Example 7). Moreover, it was demonstrated that multiple contaminations (Example 7) and all contaminations (Example 10) can be detected simultaneously. In artificial contamination simulation experiments it was shown that more than 16 PCR products (Example 7) and more than 40 PCR products (Figure 10) can be detected at the same time. It has to be understood that under natural conditions this number of contaminations is very unlikely to occur, however, suggests that the method can detect even more targets simultaneously and this without competition effects. Furthermore, and also advantageous is the use of oligonucleotides that are capable of amplifying a fragment of the PoIA polynucleotide. The use of said oligonucleotides, e.g. may serve as a control of the quality of the template PCR as well as a control for assessing mistakes during the set-up of a PCR reaction.
The definitions made above apply mutatis mutandis to the following:
Moreover, the present invention also relates to a composition comprising oligonucleotides as referred to above.
The aforementioned composition is herein also referred to as "composition comprising an oligonucleotide mixture", or "composition comprising oligonucleotides" Moreover, the aforementioned composition, preferably, further comprises oligonucleotides as referred to herein, e.g. a pair of oligonucleotides capable of amplifying a fragment of the polymerase A (PoIA) polynucleotide. Moreover, said composition may further comprise oligonucleotides as referred to above, e.g. oligonucleotides that are capable of amplifying polynucleotides for mitochondrial DNA of various species (see above).
Furthermore, the present invention relates a composition comprising probe oligonucleotides, wherein said composition comprises at least five probe oligonucleotides selected from the group of probe oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 78 to 148. At least five means five or more than five and, thus, at least six, at least seven, at least eight, at least ten, at least thirteen, at least fifteen, at least twenty or more. The aforementioned composition is herein also referred to as "composition comprising a probe oligonucleotide mixture".
Furthermore, the present invention also relates to the use of a composition of the present invention (thus, of a composition comprising an oligonucleotide mixture and/or a composition comprising a probe oligonucleotide mixture as specified above) for determining contaminations in a cell culture sample. Preferably, said contaminations are detected simultaneously. Said contaminations, preferably, are selected from the group consisting of SMRV (squirrel monkey retrovirus), Mycoplasma including M. arginini, M. fermentans, M. orale, M. hyorhinis, M. hominis, M. salivarium, M. synoviae, M. pirum, M. gallisepticum, M. pneumoniae, A. laidlawii, eukaryotic host cells comprising adenovirus 1, 2, 5 or 6 DNA, HeLa cells, human cells, rat cells, mouse cells, Chinese hamster cells, canine cells, feline cells, monkey cells, Guinean pig cells, rabbit cells, bovine cells, pig cells, male host cells, eukaryotic host cells comprising a herpes virus including HHV 1 to 8, human host cells comprising hepatitis B virus DNA including genotypes A to H , eukaryotic host cells comprising SV40 DNA, and eukaryotic host cells transfected with DNA vectors containing elements of SV40 (VPl or T-Antigen). Other preferred contaminations are referred to elsewhere in this specification.
Finally, the present invention relates to a kit, preferably adapted for carrying out the method of the present invention, comprising the composition comprising an oligonucleotide mixture and/or the composition comprising a probe oligonucleotide mixture as specified herein and an instruction manual. Preferably, said kit further comprises the composition comprising a probe oligonucleotide mixture.
The term "kit" as used herein refers to a collection of the aforementioned means, e.g., means for contacting a sample under conditions which allow for amplification of polynucleotides and for determining contaminations based on the amplified polynucleotides, preferably, provided separately or within a single container. The container, also preferably, comprises instructions for carrying out the method of the present invention. The components of the kit are provided, preferably, in a "ready-to-use" manner, e.g., concentrations are adjusted accordingly, etc..
All references cited in this specification are herewith incorporated by reference with respect to their entire disclosure content and the disclosure content specifically mentioned in this specification.
The following Examples shall merely illustrate the invention. They shall not be construed, whatsoever, to limit the scope of the invention.
Example 1.
Multiplex primer and probe design
The accession numbers of the various targets of the multiplex cell culture contamination PCR are listed in Table 1. All nucleotide sequences were obtained from the National
Center for Biotechnology Information (NCBI) nucleotide sequence database (GenBank).
The 16s RNA region of Mycoplasma orale, M. hyorhinis, M. arginini, M. fermentans, M. salivarium, M. hominis, M. pneumoniae, M. synoviae, M.pirum, M. gallisepticum,
Acholeplasma laidlawii; the ElA region of Adenovirus 1, 2, 5, 6; and species-specific beta-globin genes were aligned with T-COFFEE (Notredame et al., 2000), respectively, in order to identify conserved sequences flanking inner polymorphic regions for primer design. Pools of oligonucleotides rather than the addition of degenerate base sites in the primer sequences were preferred to avoid synthesis variation in the primer sequence. In general, backward oligonucleotide primers were biotinylated for detection by hybridisation; exception: forward oligonucleotide primers SV40_VP3_f_and HIVl_O/N_gag_f_were biotinylated.
All primer sequences were assessed for primer-dimers formation and for unspecific annealing of biotinylated primers to oligonucleotide probes by using Fast-PCR (Kalendar, 2007, FastPCR: a PCR primer and probe design and repeat sequence searching software with additional tools for the manipulation and analysis of DNA and protein, www.biocenter.helsinki.fi/bi/programs/fastpcr.htm). All primers were tested in single- and multiplex PCR and subsequent gel electrophoresis or Luminex hybridisation (see Examples 2 and 10).
For each target gene and organism oligonucleotide probe sequences were chosen within polymorphic sequences amplified by primers mentioned above. Oligonucleotide probes were selected to be highly specific for the gene or organism of interest. All probe sequences were tested for unspecific hybridisation to biotinylated oligonucleotide primers by Fast-PCR and in Luminex hybridisation experiments.
P-792
- 35 -
Table 1. Probes polynucleotides and oligonucleotides (primer) overview
Target Probe oligonucleotide sequence Probe Region Accession Primer name Primer sequence 5 'to 3 ' Primer SEς
(contaminating 5'to 3' number NO:
SEQ ID NO: (F, forward; organism)/Probe b, backward) name
M pneumoniae GGCGATCCCCTCGGTAGTGA 87 16S πbosomal RNA gene AF132741 1 Myco fl TGGGGAGCAAATAGGATTAGATACC 5
M pirum GGTAAACGCCTCGGTGTCGT 16S πbosomal RNA gene M23940 1 Myco bl GTACCGTCGAATTAAGCAACATGCT 6
Myco-uni 2 TACATTCGCAAGAATGAAACTT 16S ribosomal RNA gene
M. orale TCGGTGGAAAACTACTGACG 78 16S ribosomal RNA gene AY796060 1 Myco f2 TGGGGAGCAAACAGGATTAGATACC 7
M. hyorhims GGAATAATTTCACTAACGCA 79 16S ribosomal RNA gene AF412982.1 Myco b2 TATCTTCAAATTAAACCACATGCTC 8
M. argimni GTGGAGAGTTCACTGACGCA 80 16S ribosomal RNA gene Ul 5794 1
M. fermentans CTGATGGGGAACTCATCGGC 81 16S ribosomal RNA gene M24289.1
M. sahvaπum TCGGCAGAGAACTGTTGACG 82 16S ribosomal RNA gene AF125583.1
M. hominis CGGTGGAGAATCACTGACGC 83 16S ribosomal RNA gene M96660.1
M. synoviae TTGATAGAAACCATCGACGC 84 16S πbosomal RNA gene X52083 1
M. galhsepticum TGTCGGAGCGAAT ACTTCG 85 16S πbosomal RNA gene NC 004829.1
Myco-um 1 GATCCGCCTGAGTAGTATG 86 16S πbosomal RNA gene
A. laidlawii ACTCAAACAAGTAACCACATA 90 16S ribosomal RNA gene AY740437 1 Acholeplasma f GGGGATGG ATCACCTCCTTTCT AA 13
A. granularum GTACACTCAAACCTCATAAT 91 16S ribosomal RNA gene DQ400428 1 Aclioleplasma b CAAGCGAGTGCTCT AACC AACTGA 14
HPV 18 CAGACGACCTTCGAGCAT 92 E7 NC 001357.1 HPV_18_f GACCTTCTATGTCACGAGCAATTA 9 HPV 18 b TGCACACCACGGACACACAAAG 10
:
Rat beta globin ATATAAAGCAGAACAGAACC 93 beta globin X06701 1 rat f AGCCTGTACCATAGCCACCCTGAG 19
P-792
- 36 -
Bg_rat_b CCTGAGGTTGCGAGTCAACACAACAG 20
Mouse beta globin ATATAAGGTGAGGTAGGATC 94 beta-globin major gene J00413 1 Bg mouse f GCTGAGACGTCCTAAGCCAGTGAGT 17 Bg mouse b TCTGGGGTTGTGAGTCAACACAACTA 18 cynomolgus beta CAAGGCAATAACCATACA 95 beta globin chain gene X05665 1 Bg human/monkey f TGACCAAATCAGGGTAATTTTGCATT 15 globin
Human beta globin CAGGGCAATAATGATACA 96 beta globin chain gene AY260740 1 Bg human/monkey b AG AAT GGTGCAAAG AGGCATGAT ACA 16
Human/monkey beta CTAATACTTTCCCTAATCTCT 97 beta globin chain gene globin
Mammal IC GTACATCTGATTACTGAAGTAC polymerase alpha (POLA) e.g. NW 927700.1 POLA f TCAGAAATAGTTCTTGATCGGGTTTG 51
POLA b TAAATGCAGCTGCCTCTTTCAATGC 52
Adenovirus 1,2 TCCTAAATTGGTGCCTGCT 99 ElA AY490817 1, Adeno f GTGTCTGAACCTGAGCCTGAGCC J01917.1
Adenovirus 5 GCCGTCCTAAAATGGCGCC 100 ElA AY339865 1 Adeno b GAGGTGTGTTAGAAGGACCGGAGT 12 Adenovirus 6 CCTGTGTCCAGAGAATG 101 ElA AY490818 1 Adenovirus 1,2,5,6 GCAATAGTAGTACGGATAGC 102 ElA
SMRV GGCCCTTGTAGAGAGTCTTAGT 103 Gag NC 001514.1 Smrv gag f TCAGAGCCCACCGAGCCTACCTAC GAA
Smrv gag b CAGCGCAGCACGAGACAAGAAAA
TGCTTGATATTCTGTCAGCCAC 104 Env NC 001514.1 Smrv env f GGCGGACCCCAAGATGCTGTG CCA
Smrv env b TGGGCTAGGCTGGGGTTGGAGATA
HBV A TTGTCCTGGTTATCGCTG, 105 Protein S gene V00866 1 HBV f GGTGGACTTCTCTCAATTTTCTAGG 21
GTCCTCCAATTTGTCCTGG 106
P-792
- 37 -
HBV B TTGTCCTGGTTATCGCTG 107 Protein S gene M54923 1 HBV b ATGATAAAACGCCGCAGACACATC 22 HBV C GTCCTCCAATTTGTCCTGG 108 Protein S gene X75665 1 HBV D TTGTCCTGGTTATCGCTG 109 Protein S gene X80924 1 HBV E GTCCTCCAATTTGTCCTGG 1 10 Protein S gene X75657 1 HBV F CAACTTGTCCTGGCTATCG 1 1 1 Protein S gene X75658 1 HBV G CAACTTGTCCTGGCTATCG 1 12 Protein S gene AF160501 1 HBV H CAACTTGTCCTGGCTATCG 1 13 Protein S gene AY090454 1
Chinese hamster AAAGCACCTATAATCTTAT 1 14 16S πbosomal RNA gene DQ334846 1 CH f CCGAATGATTATAGCTAAGGCAC 53 CH b CTTGGTCCGTTGATCAAATATGT 54
Dog/Canine AAGTCAAAATACAACATCA 1 15 16S πbosomal RNA gene AY729880 1 Dog_f CCGAGTGATTAAAATTTAGACCC 55 Dog b TTGTTCCGTTGATCAAAAATTAT 56
Cat/Feline CAGTCGAAAGTACTACATC 1 16 16S πbosomal RNA gene U20753 1 Cat _f CCGAGTGATTTAAATCTAGACTA 57 Cat b CTTGTTCCGTTGATCAAGGTTTT 58
Green monkey ACTAATACTTGCAATTGAC 1 17 16S πbosomal RNA gene AY863426 1 Gree mo f CGAACAATCCATGCTAAGACTAC 59 Gree mo b ACTTGTTCCATTGATCAAATTATT 60
Mouse AAGTAAAATCAACATATCTTA 1 18 16S πbosomal RNA gene V00711 1 mouse f CCGAATGATTATAACCTAGACTT 61 mouse b TGGTCCGTTGATCAAAATATATC 62
Rat ATACTTACACACACTAATTC 1 19 16S πbosomal RNA gene DQ673917 1 Rat_f AATAAACAACTACAATCACTTAAC 63
Rat b TATAGATTAGCCCAATTTGTGATA 64
Cynomolgus ACTAACACCCATAATTGAT 120 16S πbosomal RNA gene AF420036 1 Cyno f CGAATAACACATGCCAAGACTAC 65 monkey
Cyno b ACTTGTTCCGTTGATCAAATAATT 66
P-792
- 38 -
rabbit ATTATAATCATAAATTGAC 148 16S πbosomal RNA gene AJOO 15 S 8 1 rabbit f CGAATGATTTTAGCCTAGACCCA 149 rabbit b ACTTGTTCCGTTGATCAAATTATT 150
Guinean pig CGAAGTTTAAATCACCAAT 121 16S πbosomal RNA gene AJ222767.1 G. pig f CGAATGATATTAGCCTAGATCCA 151 G. pig _b TTGGTCCGTTGATCAAAAGGAATT 152 pig/sus AAATTACCATAACATCACT 146 16S πbosomal RNA gene AJ002189.1 Pig_f CCGAGTGATTTTAATCTAGACAA 153 pig_b AACTTGTTCCGTTGATCAAAATT 154
Cow/bovine TCACTCTATCGCTCATTGA 147 16S πbosoπial RNA gene AY526085 1 bovine f GAGCGATTTTAAAGACTAGACCC 155 bovine b TAACTTGTTCCGTTGATCAAGTT 156
SV40 TAg CTCAACATTCTACTCCTCC 122 T-antigen J02400 1 SV40 Tag _f AACCTGTTTTGCTCAGAAGAAATGC 47 SV40 Tag b GAAGGAAAGTCCTTGGGGTCTTCTA 48
SV40 VP1 ACCACAGTGCTTCTTGAT 123 VPl J02400.1 SV40 VP I f GAACCTACACAGGTGGGGAAAATGT 45 SV40 VP1 b CAAGGGCCCAACACCCTGCTCAT 46
SV40 VP3 CCCTGGACAACTTCCTTT 124 VP3 J02400.1 SV40 VP3_f_bio AAGCTTATGAAGATGGCCCCAACA 49
SV40 VP3 b ATTCCTCCTTTTATGACGAGCTTTG 50
Y- chromosome, ACCAACAGCAGCAGCAGTT 125 sex determming region of NM O 1 1564.1 Y mouse f TCCATGACCACCACCAGCAGAAGCA 43 mouse Chr Y (Sry)
Y mouse b CTGGGGGTGGTCATGGAACTGAT 44
Y- chromosome, CAGCTAGGCCACTTACCGC 126 sex determming region of NM 003140.1 Y hum/mon f GTACGAAAGCCACACACTCAAGAA 39 human/monkey Chr Y (Sry)
Y hum/mon b TTGTCCTACAGCTTTGTCCAGTGG 40
Y chromosome, rat AGAAGGGCTTACTACATAC 127 sex determming region of AF274872.1 Y rat f GGAGGAGACCAAAATGTGTGTAAGG 41
Chr Y (Sry)
P-792
- 39 -
Y rat b CATCGATTAAATGCCATAAGAATGC 42
HSVl (HHVl) TGTTCACCACGAGTACCTG 128 UL42 NC 001806.1 HSVl f ACGAGGCCGCAGCTCACCAAGGT 23
HSVl b CGCCCTCCTCGCGGGCAGCAAA 24
HSV2 (HHV2) TGTTTAACGCGCGCACCTG 129 UL42 NC 001798.1 HSV2_f ACGAAGCCCCAGCTCACGAAGGT 25
HSV2 b CGCCCTCCTCGCGGGCGGCAAA 26
VZV (HHV3) TGCACGGGTGCGGAACGTT 130 orthologue of HHV-I NC 001348 1 VZV f CATCCTTCACAGATTCCATGTTCG 27
UL42
VZV b TCCCCCATGGTTGGATTGTATATC 28
EBV (HHV4) AGATAAAAGTCCCCGGGTG 145 UL42 family NC 009334 1 EBV f TTATTTAACCACGCCTCCGAAGAG 29
EBV b TGAAGGAGATGGACTGACCGTATG 30
CMV (HHV5) ACAGACCGTTGCGGCTGGC 131 orthologue of HHV 1 NC 006273.1 CMV f GTTCCCGACGTAATTTTTGTCGAA 31
UL42
CMV b GCACGTTGCGTATAGTTACGGAGC 32
HHV6 GCACTTCCGTCGTCGTTCT 132 Pp41 NC 001664.1 HHV6_f AAATAAGCTAGAGCCCGCAGTTCC 33
HHV6 b ACGAATGGGTAAACAAGATGACGG 34
HHV7 GCCAACGTCATTTCATTTT 133 UL42 NC 001716.1 HHV7_f TGAAACACAACTTTCCCGCTATGA 35
HHV7 b CGGTCACAAAGAACAAACGCAGTA 36
HHV8 ATGTCACGATCGACAGCGT 134 UL42 NC 009333.1 HHV8_f GACTTCTTCCCCTTCAGACCATCC 37
HHV8 b AAACAAAAGAGGACCAAACGGTGA 38 .
HIVl _M,N ATCTATAAAAGATGGATAATC 135 Gas AF004885.1 HIVl gag f GGAAGTGAYATAGCWGGAACTACYA 67 C G
HIVl gag _b ACAGGGCTATACATTCTTACTAT 68
P-792
- 40 -
HIVl M CTGTCATGGGTACCAGCACAC 136 Pol AF004885 1 HIVl_M,0_pol_f ATAGTRACAGAYTCACARTATGCA 69
AA
HIVl O CTTACATGGGTTCCTGCCCA 137 Pol L20587 1
HIVl N CTCTCTTGGGTACCTGCACA 138 Pol AJ006022 1 HTVl_N_pol_f ATAGTCACTGACTCTCAGTATGCT 70
HIVl_M,N,0_pol_b ATTTATCT ACTTGTTCATTTCCTCC 71
HIVl N GTTGCTATTATGTCTAT 139 Gag AJ006022 1 HTV1_O/N_gag_f_bio GGGATTGGGGGGTACACTGCAGG 72 HIVl O GATGCTAATATGTCTAT 140 Gag L20587 1 HTV1_O/N_gag_b CTGCTGTCTCTGTAATARACCCGAA 73
HIV2 AAGAAATACAATTCCTCCA 141 Pol AY509259 1 HIV2/SIV_pol_f GAAGGGGAGGAATAGGGGATATGAC 74 SIV AAGAAATACAATTTCAACA 142 Pol M83293 1 HIV2/SIV_pol_b TCTGCCTTCTCTGWAATAGACCCG 75
HIV2 2A/SIV GTGGTCAAGAGACAACA 143 Env AY509259 1/ HIV2/SIV env f ACGTTGTCGGCTCAGTCYCGGACTTTA 76 M83293 1
HIV2 2U/B GTGGTCAAAAGACAACA 144 Env AY530889 1/ HIV2/SIV env b GTCCCCCAGACGGTCAGYCGCAACA 77 U27200 1
Example 2:
Extraction of DNA from cell culture
DNA was extracted from various cell cultures possibly infected with Mycoplasma, A. laidlawii or SMRV. An amount of 1 ml of cell suspensions, containing 105 to 106 cells, was transferred to a microcentrifuge tube and collected by centrifugation at 2600 rpm, 5 min in a tabletop centrifuge. The pellet was resuspended in PBS. The mixture was incubated for 15 minutes at 95 0C. Subsequently, cell debris was pelleted and the supernatant was transferred into new microcentrifuge tubes and stored at - 200C.
Importantly, for Mycoplasma testing alone, 1 to 2 μl of cell culture medium could also be used.
Example 3:
Development of the multiplex cell culture contamination PCR
Oligonucleotide primers that met requirements of Example 1 were used for subsequent amplification of cloned DNA or DNA extracted as mentioned above. One primer of each pair was biotinylated at the 5' terminus for labelling the target strand of the amplified product. The different target genes were amplified in a single multiplex PCR. For initial validation of primers, singleplex PCR, for each individual primer pair, were performed under same conditions. The 50 μl reactions comprised Ix QIAGEN Multiplex PCR Master Mix (containing 3 mM MgCl2, dNTP mix, 0.5 x Q-solution and HotStarTaq DNA polymerase), 0.2 μM each primer, and 1-2 μL of template DNA. Using a Mastercycler (Eppendorf, Germany) PCR products were amplified by incubation at 95°C for 15 minutes to activate the enzyme, followed by 40 cycles of denaturation at 94°C for 30 seconds, annealing at 610C for 90 seconds, and extension at 72°C for 60 seconds. Final extension was performed at 72°C for 10 minutes and reactions were stored at 4°C.
Example 4:
Coupling of oligonucleotide probes.
The sequences of 5 'amino-modified C-12-linked oligonucleotide probes (purchased from MWG-Biotech) are shown in Table 1. Probes were coupled to carboxylated beads by a carbodiimide-based coupling procedure. For each combination of probe and bead set, 2.5 million carboxylated beads (xMAP; Luminex Corp., Austin, TX) were suspended in 25 μl of 0.1 M 2-(N-morpholino)ethanesulfonic acid, pH 4.5 (MES). Probe oligonucleotides (400 pmol) and 200 μg of N-(3-dimethylaminopropyl)-N-ethylcarbodiimide (EDC) were added and thoroughly mixed with the beads. Incubation was performed in the dark under agitation for 30 min and was interrupted by a thorough mixing step after 15 min. The addition of EDC and incubation steps were repeated and the coupled beads were finally washed once with 0.5 ml of 0.2 g/liter Tween-20 and once with 0.5 ml of 1.0 g/liter sodium dodecyl sulfate before being stored in 100 μl of TE buffer at 4°C in the dark. Coupling efficiency of new bead batches compared to old ones was verified by hybridization to 1.0 to 4.0 μl of biotinylated PCR product of the respective target. New coupling batches showing a coefficient of variation (CV) below 15% were used for further analyses (data not shown).
Example 5: Development of multiplex cell culture contamination hybridisation method.
Multiplex PCR products were denatured and hybridized to bead-coupled target-specific oligonucleotide probes in 96-well plates, allowing PCR products from 96 individual cell cultures to be processed in parallel. After transfer into wash plates with filter bottoms, unhybridized DNA was removed. Subsequently, biotinylated PCR products were stained by Strep-PE conjugate. After further washing steps, beads were analyzed in the Luminex reader, which contains two lasers to identify the bead set by the internal bead color and to quantify the reporter fluorescence on the bead.
Following multiplex PCR amplification, 10 μl of each reaction mixture were transferred to 96-well plates containing 33 μl of tetramethylammonium chloride (TMAC) hybridization solution (0.15 M TMAC, 75 mM Tris-HCl, 6 mM EDTA, 1.5 g/liter Sarkosyl, pH 8.0), 7.0 μl of 1 x TE, 0.2 to 1.2 μM of each antisense oligonucleotide (Seq ID NR. 157 to 165) and a mixture of 2,000 probe-coupled beads of each set. Antisense oligonucleotides were used to suppress hybridization of some primers to probes. The mixture was heated to 95°C for 10 min in a laboratory oven, immediately placed on ice for 1 min, and then transferred to a thermomixer. Hybridization was performed at 410C for 30 min under agitation. The samples were transferred to a 96-well wash plate (Millipore, Bedford, MA), pre- equilibrated with washing buffer (phosphate-buffered saline, 0.02% Tween). Subsequently, the beads were washed once with 100 μl of washing buffer on a vacuum wash station (Millipore). On a horizontal shaker at room temperature, beads were resuspended for 20 min in 50 μl of streptavidin-R-phycoerythrin (Strep-PE; Molecular Probes, Eugene, OR) diluted 1 :1,600 in 2.0 M TMAC, 75 mM Tris-HCl, 6 mM EDTA, 1.5 g/liter Sarkosyl, pH 8.0. Beads were then washed three times with 100 μl washing buffer and finally resuspended in 100 μl washing buffer for 5 min on a shaker. Beads were analyzed for internal bead color and R-phycoerythrin reporter fluorescence on a Luminex 100 analyzer. The median reporter fluorescence intensity (MFI) of at least 100 beads was computed for each bead set in the sample. In order to determine the specificity of the hybridisation, target- specific probes were coupled individually to defined bead sets and hybridized to 10 μl (100 to 300 ng DNA) of PCR products derived from single- and multiplex PCRs on crudely purified DNA from cell cultures (different species, cell lines with markers) or highly purified plasmid DNAs (SMRV, SV40). Detection of all targets was highly specific and no cross-hybridisation was observed even for highly related target genes, such as the 16S ribosomal RNA gene that was used for the detection of different species. More importantly, the SMRV detection by gag and env probes was not affected by endogenous retroviruses or HIV.
Example 6:
Determination of the detection limit of SMRV, HPV-18 (HeLa), human beta globin and PoIA
Analytic sensitivity of multiplex PCR, containing specific primers for gag and env of SMRV, was determined for plasmid clone SMRV (ATCC Nr. 45034). The plasmid preparation was quantified using NanoDrop® ND- 1000 (NanoDrop Technologies,
Wilmington, Delaware, USA). The copy numbers was determined on the basis of the molecular weight of the plasmid. 10-fold endpoint dilution series were prepared in 100 ng/μL of human placenta (HP-) DNA in a total volume of 30 μL. Two to three replicates were assayed independently by the multiplex PCR and subsequent hybridisation to the multiplex hybridisation mixture, containing also gag and env specific oligonucleotide probes. Despite the co-amplification and co-detection of human beta-globin and PoIA, both probes detected as little as 10 copies of SMRV. Using 100 μL of HP-DNA alone, no
SMRV signal was detected showing a high specificity of the SMRV detection. Thus, presence of other human endogenous retroviruses does not cause false-positives.
Next, we aimed at determining the sensitivity of the multiplex PCR for the detection of HPV-18 positive HeLa cells. DNA extracts of 106 HeLa cells were prepared as described in Example 2, followed by a 10-fold dilution series in water. After multiplex PCR and detection with the multiplex hybridisation mixture, including the HPV-18 type-specific oligonucleotide probe, less than 5 HeLa genome equivalents were specifically detected. The co-amplification and co-detection of human beta-globin and PoIA resulted in detection limits of less than 5 and less than 50 genome equivalents, respectively.
Example 7: Determination of the detection limits for the simultaneous detection of various contaminations in cell cultures
We aimed at determining the sensitivity of the multiplex PCR for the simultaneous detection of multiple contaminations present in the same sample. To this end we mixed 106 cells of 10 different cell lines (Table 2, 1 to 10) and conducted a combined 3-fold dilution series in 106 human (11) and mouse background cells (12). DNA extracts of cell mixtures were prepared as described in Example 2. The Multiplex PCR was performed as described in Example 3 with primers indicated in Table 1 (SEQ ID 1 to 66, 149-152). Each cell line (1 to 10) was titrated down from 300 to 0.01 cells in 6,000 background cells per PCR reaction. Subsequently, PCR products were simultaneously detected using specific oligonucleotide probes coupled to Luminex beads (Table 1, SEQ ID 78 to 134, 145 and 148). Despite the presence of 70 primers in a single PCR reaction and simultaneous co- amplification of 16 PCR products, the multiplex PCR with subsequent Luminex analysis used for the detection of cell culture contaminations proved to be very sensitive. As such, the detection limit for detecting "contaminating" HeLa cells was below 3 (< 0.1 %) cells in a background of 6,000 cells of the parent cell line. Less than 1 contaminating cell (< 0.1 %) among 6,000 cells was sufficient to detect cross-species contaminations (Table 3).
Table 2. Overview cell lines used for example 7
Cell line Species Sex Infection/Contamination
1 HeLa Human female HPVl 8
2 HEK 293T Human female Adenovirus 5, SV40
3 Namalwa Human female EBV
4 SW480 Human male
5 CHO Chinese Hamster female
6 MDCK II Canine unknown
7 NIH3T3 Mouse female
8 Ratte a-tag R4 Rat/Mouse hybrid female
9 Alexander Human female HBV 10 CEM Human female M. fermentans
11 BJA-B Human female M. hyorhinis, M. arginini
12 Sp2/0 - Ag8 Mouse female
Table 3. Detection limits for markers of contaminating cell lines
DL for contaminating cells in a background of 6,000 cells/PCR cell line (marker) cell # %
HEK 293T (SV40 TAg) < 10 < 0.2
HEK 293T (SV40 VPl) < 10 < 0.2
HEK 293T (Adenovirus 5) < 3 < 0.06
HeLa (HPV 18) < 3 < 0.06
Namalva (EBV) < 100 < 2.0
Alexander (HBV) < 1 < 0.02
CEM (human) < 1 < 0.02
NIH3T3 (mouse) < 1 < 0.02 a-tag R4 (rat) < 1 < 0.02
CHO (chinese hamster) < 1 < 0.02
MDCK II (canine) < 1 < 0.02
SW480 (human Y-chromosome ) < 100 < 2.0
Example 8:
Commercial tests for the detection of Mycoplasma are widely used. One of the most frequently used in Germany is the Venor®GeM from Minerva Bio labs that can detect between 2 and 5 copies of Mycoplasma upon PCR and gel electrophoresis but cannot genotype the respective species.
In order to validate the novel multiplex PCR to this well-validated Mycoplasma test, we performed six- fold dilution series of a Mycoplasma positive cell lysate in a Mycoplasma negative cell lysate (each with 106 human genome equivalents per 100 μL of lysate) used 2 μL of the mixture for PCR. The Venor®GeM kit for conventional PCR was performed according to the manufacturer's instructions using the AmpliTaq Gold polymerase, AmpliTaq gold buffer and 2.5 mM MgCl2 (Applied Biosystems, Branchburg, New Jersey, USA). Briefly, 2 μL of DNA extracts were amplified in 25 μL containing Ix AmpliTaq Gold buffer, 2.5 μL of the primer/dNTP mix, 2.5 mM MgCl2, 2.5 μL of the internal control DNA and 1 U of DNA AmpliTaq Gold polymerase. A 15 min denaturation step at 94 0C was followed by 39 cycles of amplification with a Mastercycler (Eppendorf, Germany). Each cycle included a denaturation step at 94 0C for 30 s, an annealing step at 55 0C for 30 s, and an elongation step at 72 0C for 30 s. The experiment was performed with positive and several water PCR controls. For final analysis, 5 μL of PCR products were loaded on a 1.5% agarose gel.
The Multiplex PCR was performed as described in Example 3 with all primers indicated in Table 1 (SEQ ID 1 to 66). Subsequently, PCR products were simultaneously detected using specific oligonucleotide probes coupled to Luminex beads (Table 1, SEQ ID 78 to 120, 122 to 134, 145).
Upon gel electrophoresis, the Venor®GeM kit allowed the detection of the Mycoplasma genus in up to 1, 300-fold diluted DNA extracts, while the internal PCR control was positive for all reactions. The multiplex PCR assay with subsequent Luminex detection showed a six- fold increased sensitivity allowing the detection and typing of Mycoplasma in 7, 800-fold diluted DNA extracts. More remarkably, this increased sensitivity was observed despite the co-detection of POLA, human β-globin, human Y-chromosome, adenoviral and EBV DNA that was present in the DNA extract.
Example 9:
Evaluation of the cell culture contamination multiplex PCR with cell culture samples
A broad spectrum of cell lines was obtained from 12 individual laboratories within the German Cancer Research Center (DKFZ). DNA extracts of 106 cells from 59 cell lines were prepared as described in Example 2. The multiplex primer mixture comprised all primers listed in Table 1 (SEQ ID 1 to 66) and subsequent detection was performed using the oligonucleotide probes shown in Table 1 (SEQ ID 78 to 120, 122 to 134, 145). Of all cell lines, 19 (32 %) were Mycoplasma positive with M. hyorhinis being most prevalent (73 % of positive cell lines). Of three HPV- 18 positive cell lines, one was derived from a cervical carcinoma being naturally infected with HPV- 18. For the remaining two cell lines (SiHa, and CEM), the presence of HPV- 18 suggested a HeLa contamination. SMRV was found positive with both gag and env probes in 8 cases (13 %). However, 4 of these cases were found in different preparations of the same Namalwa cell line. In addition, two mouse cell lines were found to be cross-contaminated with human cells as it was demonstrated by positive signals with the human- and mouse-specific beta-globin oligonucleotide probes. Moreover, as confirmed by POLA, species-specific beta globin or mitochondrial DNA detection, none of the 59 PCRs failed.
Example 10:
Simultaneous detection of all targets by McCT
To determine the ability of McCT to detect multiple targets at the same time, an artificial mixture was generated from several positive controls. In total, 34 different lysates and positive controls were mixed to obtain a sample positive for all PCR targets. For pig DNA and some Mycoplasma species no suitable control DNA was available.
The Multiplex PCR was performed as described in Example 3 with all primers indicated in Table 1 (SEQ ID 1 to 66 and 149 to 154). Subsequently, PCR products were simultaneously detected using specific oligonucleotide probes coupled to Luminex beads
(SEQ ID: 78 to 119, and 121 to 134, and 145, 146, 148). The assay was performed for all
34 controls and the artificial mixture. For each probe, MFI values in reactions with no PCR product added to the hybridization mixture (water control) were considered background values. The cutoff was defined as 1.2 times the water control value plus 5 MFI.
Despite the fact that some targets were diluted 34-fold, 41 of 42 present "contaminations" could be detected simultaneously as determined in duplicates (Table. 4). VZV was positive only once in one replicate. This data highlights the good suitability and robustness of McCT to detect more than 40 targets simultaneously. P-792
-49-
Table 4. Simultaneous detection of multiple contaminations
Target-specific bead-coupled oligonucleotides
I I ! E E s < a « ϊ ! 1 11 I -3 fe 9 E
I ? 11 1
S s
Figure imgf000050_0001
55 549 205 194 528 370 112 23 47 106 372 272 755 28 302 622 242 11. 301 350 797 50 835 26 247 106 848 245 313 35 3 389 333 16 48 112 5 5 19 40 414 162 135 375 287 81 23 29 72 261 184 634 20 231 446 179 12 215 195 552 35 645 18 148 79 754 209 251 35 3 339 270 11 35 80 5 5 15
3 4 3 32 8 2 22 5 4 4 5 5 1 1 17 15 15 15 13 18 22 6 6 7 5 5
10 9 43 12 9 15 7 31 23 23 23 21 27 31 12 12 13 11 11 10 10 10 10 10 10 9 9 11 11 16 11
1 positive reactions are indicated in bold and underlined, some lines contain more than one target as frequently cell lines were used.

Claims

Claims
1. A method for determining contaminations in a cell culture sample comprising the steps of a) contacting a sample of a cell culture suspected to comprise contaminations with a composition comprising oligonucleotides of at least three different groups of oligonucleotides, said groups being selected from aa) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by the squirrel monkey retrovirus (SMRV), wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 1 and SEQ ID NO:2, and ii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:3 and SEQ ID NO:4, and iii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i) and/or (ii), bb) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by different Mycoplasma species, wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:5 and SEQ ID NO:6, and ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:7 and SEQ ID NO:8, and iii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i) and/or (ii), cc) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by HeLa cells wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:9 and SEQ ID NO: 10, and ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), dd) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by adenovirus, wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO : 11 and SEQ ID NO : 12, and ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), ee) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by A. laidwaii wherein said at least one pair is selected the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO: 13 and SEQ ID NO: 14, and ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), ff) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides for a mammalian globin, wherein said at least one pair is selected the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO: 15 and SEQ ID NO: 16, ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:17 and SEQ ID NO: 18, iii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO: 19 and SEQ ID NO:20, and iiii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii) and/or (iii), gg) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by various hepatitis B virus (HBV) strains wherein said at least one pair is selected the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:21 and SEQ ID NO:22, and ii) a pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), hh) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by a herpes virus wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:23 and SEQ ID NO:24, ii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:25 and SEQ ID NO:26, iii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:27 and SEQ ID NO:28, iiii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:29 and SEQ ID NO:30, iiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:31 and SEQ ID NO:32, iiiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:33 and SEQ ID NO:34, iiiiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:35 and SEQ ID NO:36, and iiiiiiii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:37 and SEQ ID NO:38, and iiii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii), (iii), (iiii), (iiiϋ), (iiiiϋ), (iiiiiii) and/or (iiiiiiii), jj) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by a mammalian Y chromosome wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:39 and SEQ ID NO:40, ii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:41 and SEQ ID NO:42, iii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:43 and SEQ ID NO:44, and iiii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii) and/or (iii), and kk) an oligonucleotide group comprising at least one pair of oligonucleotides capable of specifically amplifying polynucleotides comprised by SV40 (simian virus 40), wherein said at least one pair is selected from the following pairs of oligonucleotides i) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:45 and SEQ ID NO:46, ii) a pair of oligonucleotides having a nucleic acid sequence as shown in SEQ ID NO:47 and SEQ ID NO:48, iii) a pair of oligonucleotides having a nucleic acid sequence as shown in
SEQ ID NO:49 and SEQ ID NO:50, and iiii) at least one pair of oligonucleotides which are capable of specifically amplifying polynucleotides which are amplified by the oligonucleotides of (i), (ii) and/or (iii), and b) determining the contaminations in said sample based on the amplified polynucleotides obtained in step a).
2. The method of claim 1, wherein in step a) the oligonucleotide mixture further comprises oligonucleotides capable of amplifying a fragment of the polymerase A (PoIA) polynucleotide, wherein said oligonucleotides bind to highly conserved regions of the PolA-polynucleotide.
3. The method of claim 2, wherein the oligonucleotides capable of amplifying a fragment of the polymerase A (PoIA) polynucleotide have a nucleic acid sequence as shown in SEQ ID NO:51 and SEQ ID NO:52.
4. The method of any one of claims 1 to 3, wherein the amplified polynucleotides are obtained by polymerase chain reaction.
5. The method of any one of claims 1 to 4, wherein the determination of the various amplified polynucleotides comprises the step of hybridizing the amplified polynucleotides with probe oligonucleotides that specifically bind to the amplified polynucleotides .
6. The method of claim 5 wherein the probe oligonucleotides that specifically bind to the amplified polynucleotides are selected from the group consisting of probe oligonucleotides having a nucleic acid sequence as shown in SEQ ID No. 78 to 119, and SEQ ID No. 121 to 134, and SEQ ID No. 145 tol48.
7. A composition comprising oligonucleotides as defined in claim 1.
8. The composition of claim 7 further comprising oligonucleotides capable of amplifying a fragment of the polymerase A (PoIA) polynucleotide, wherein said oligonucleotides bind to highly conserved regions of the PolA-polynucleotide.
9. The composition of claim 8, wherein the oligonucleotides capable of amplifying a fragment of the polymerase A (PoIA) polynucleotide have a nucleic acid sequence as shown in SEQ ID NO:51 and SEQ ID NO:52.
10. A composition comprising at least five probe oligonucleotides selected from the group of probe oligonucleotides having a nucleic acid sequence as shown in SEQ ID No. 78 to 119, and SEQ ID No. 121 to 134, and SEQ ID No. 145 to 148.
11. Use of a composition of any one of claims 7 to 9 and/or of claim 10 for determining contaminations in a cell culture sample.
12. The use of claim 11, wherein the contaminations are detected simultaneously.
13. The use of claims 11 and 12, wherein the contaminations are selected from the group consisting of SMRV (squirrel monkey retrovirus), Mycoplasma including M. arginini, M. fermentans, M. orale, M. hyorhinis, M. hominis, M. salivarium, M. synoviae, M. pirum, M. gallisepticum, and M. pneumoniae, A. laidlawii, eukaryotic host cells comprising adenovirus 1, 2, 5, 6 DNA, HeIa cells, human cells, rat cells, mouse cells, Chinese hamster cells, pig cells, bovine cells, rabbit cells, Guinean pig cells, canine cells, feline cells, green monkey cells, cynomolgus cells, male host cells, human host cells comprising a herpes virus including HBV 1 to 8, human host cells comprising hepatitis B virus DNA including HVA genotypes A to H and eukaryotic host cells comprising SV40 DNA.
14. A kit, preferably adapted for carrying out the method of any one of claims 1 to 6, comprising the composition of any one of claims 7 to 9 and an instruction manual.
15. The kit of claim 14, wherein the kit further comprises the composition of claim 10.
PCT/EP2009/052575 2008-03-05 2009-03-05 Comosition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures WO2009109611A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US12/920,095 US9034604B2 (en) 2008-03-05 2009-03-05 Composition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures
EP09717728.1A EP2262908B1 (en) 2008-03-05 2009-03-05 Composition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP08152321A EP2098599A1 (en) 2008-03-05 2008-03-05 Composition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures
EP08152321.9 2008-03-05

Publications (1)

Publication Number Publication Date
WO2009109611A1 true WO2009109611A1 (en) 2009-09-11

Family

ID=39591708

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2009/052575 WO2009109611A1 (en) 2008-03-05 2009-03-05 Comosition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures

Country Status (3)

Country Link
US (1) US9034604B2 (en)
EP (2) EP2098599A1 (en)
WO (1) WO2009109611A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9206484B2 (en) 2010-04-21 2015-12-08 Gen-Probe Incorporated Compositions, methods and kits to detect herpes simplex virus nucleic acids
WO2016063076A1 (en) * 2014-10-24 2016-04-28 University Of Portsmouth Higher Education Corporation Cell assay kit and method

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2459745B1 (en) * 2009-08-01 2014-11-12 Roche Diagnostics GmbH Improved detection of bacterial (mollicutes) contamination
AU2013205110B2 (en) 2012-04-24 2016-10-13 Gen-Probe Incorporated Compositions, Methods and Kits to Detect Herpes Simplex Virus Nucleic Acids
AU2013202805B2 (en) 2013-03-14 2015-07-16 Gen-Probe Incorporated System and method for extending the capabilities of a diagnostic analyzer
TWI735433B (en) 2015-03-27 2021-08-11 美商再生元醫藥公司 Compositions and methods for detecting a biological contaminant
CN108359746B (en) * 2018-03-26 2021-10-22 福州大学 Method and primer for detecting cell cross contamination caused by Hela cells
US11434527B2 (en) * 2018-05-18 2022-09-06 The Asan Foundation Method for detecting mycoplasma using mitochondrial DNA as internal control sample
RU2717975C2 (en) * 2018-08-06 2020-03-27 Общество с ограниченной ответственностью "ОНКОДИАГНОСТИКА АТЛАС" Method for estimating cross-contamination of samples in ngs-data on analysis of high-polymorphic loci
CN117025808A (en) * 2023-10-09 2023-11-10 美格医学检验所(广州)有限公司 Pathogenic microorganism detection primer combination, kit and detection method

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030108864A1 (en) * 2000-03-27 2003-06-12 Haiyan Liu Detection of viable agents
US6815161B1 (en) * 1999-04-01 2004-11-09 Immunosciences Lab, Inc. Detection of Mycoplasma in patients with chronic fatigue syndrome and related disorders

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007084567A2 (en) * 2006-01-17 2007-07-26 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Detection and discrimination of hepatitis c virus, human immunodeficiency virus type-1 and hepatitis b virus

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6815161B1 (en) * 1999-04-01 2004-11-09 Immunosciences Lab, Inc. Detection of Mycoplasma in patients with chronic fatigue syndrome and related disorders
US20030108864A1 (en) * 2000-03-27 2003-06-12 Haiyan Liu Detection of viable agents

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
COBO ET AL: "Microbiological contamination in stem cell cultures", CELL BIOLOGY INTERNATIONAL, ACADEMIC PRESS, GB, vol. 31, no. 9, 31 May 2007 (2007-05-31), pages 991 - 995, XP022102834, ISSN: 1065-6995 *
COOPER JASON K ET AL: "Species identification in cell culture: a two-pronged molecular approach.", IN VITRO CELLULAR & DEVELOPMENTAL BIOLOGY. ANIMAL 2007 NOV-DEC, vol. 43, no. 10, November 2007 (2007-11-01), pages 344 - 351, XP002489254, ISSN: 1071-2690 *
LAM W Y ET AL: "Rapid multiplex nested PCR for detection of respiratory viruses.", JOURNAL OF CLINICAL MICROBIOLOGY NOV 2007, vol. 45, no. 11, November 2007 (2007-11-01), pages 3631 - 3640, XP002489255, ISSN: 0095-1137 *
MIDDLETON P G ET AL: "INSERTION OF SMRV-H VIRAL DNA AT THE C-MYC GENE LOCUS OF A BL CELL LINE AND PRESENCE IN ESTABLISHED CELL LINES", INTERNATIONAL JOURNAL OF CANCER, NEW YORK, NY, US, vol. 52, no. 3, 30 September 1992 (1992-09-30), pages 451 - 454, XP000565572, ISSN: 0020-7136 *
TANG J ET AL: "Primer mixture enhances PCR detection of Mycoplasma/Acholeplasma contaminants in cell cultures.", IN VITRO CELLULAR & DEVELOPMENTAL BIOLOGY. ANIMAL JAN 1999, vol. 35, no. 1, January 1999 (1999-01-01), pages 1 - 3, XP002489253, ISSN: 1071-2690 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9206484B2 (en) 2010-04-21 2015-12-08 Gen-Probe Incorporated Compositions, methods and kits to detect herpes simplex virus nucleic acids
US9994921B2 (en) 2010-04-21 2018-06-12 Gen-Probe Incorporated Compositions, methods and kits to detect herpes simplex virus nucleic acid
US10597738B2 (en) 2010-04-21 2020-03-24 Gen-Probe Incorporated Compositions, methods and kits to detect herpes simplex virus nucleic acid
WO2016063076A1 (en) * 2014-10-24 2016-04-28 University Of Portsmouth Higher Education Corporation Cell assay kit and method
EP3653725A1 (en) * 2014-10-24 2020-05-20 Helen Fillmore Cell assay kit and method

Also Published As

Publication number Publication date
US9034604B2 (en) 2015-05-19
EP2098599A1 (en) 2009-09-09
EP2262908A1 (en) 2010-12-22
EP2262908B1 (en) 2016-05-11
US20110091885A1 (en) 2011-04-21

Similar Documents

Publication Publication Date Title
US9034604B2 (en) Composition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures
CN107090519B (en) Multiple RT-PCR combined gene chip detection kit for common respiratory pathogens
RU2441918C2 (en) Vitro diagnostic kit for identification of human papillomavirus in clinical samples
CN111304371B (en) Locked nucleic acid probe fluorescent quantitative PCR detection composition, detection method and detection kit for African swine fever virus wild strain
CN110777221A (en) Locked nucleic acid probe fluorescent quantitative PCR detection composition, detection method and detection kit for African swine fever virus
CN103695566A (en) Multiplex PCR (polymerase chain reaction) primer, probe and gene chip for detecting bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus
US8895247B2 (en) Method for detection of human papillomavirus (HPV) type
EP2271778B1 (en) Method for detection of herpesvirus in a test sample
CN112646931A (en) Primer pair, probe, kit and detection method for detecting porcine circovirus type 4
CN110819629A (en) Primer combination and detection method for detecting blue tongue 8 type and/or blue tongue 16 type viruses
CN111500774A (en) Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit
CN107604102B (en) Double Real time PCR detection kit for pigeon TTV and novel pigeon adenovirus
US20130116136A1 (en) Probes for genotyping low-risk-hpv
JP5164850B2 (en) Oligonucleotide, its use, detection method and kit for diagnosing the presence of H5 and N1 genes of influenza A virus
CN110724770A (en) Anti-pollution fluorescent quantitative PCR (polymerase chain reaction) primer group, kit and detection method for detecting African swine fever virus
CN116769941A (en) Compositions and kits for detection of mycoplasma
CA3218222A1 (en) Compositions and methods for detecting human adenovirus nucleic acid
CN116479169A (en) Microdroplet digital PCR detection kit for detecting multiple viruses infected by central nervous system and application thereof
US20120107797A1 (en) Genotyping of bovine papillomavirus genotypes
EP3942078A1 (en) Compositions and methods for detecting group a streptococcus
CN116144843A (en) Real-time fluorescent isothermal amplification detection kit for HPV16 and/or HPV18 genotypes and special primer and probe thereof
CA3106975A1 (en) Compositions and methods for detecting nucleic acids of epstein-barr virus
JPH07250699A (en) Method for discriminatory detection of human herpes virus and reagent therefor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09717728

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2009717728

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12920095

Country of ref document: US