WO2009108215A1 - Tumor grading and cancer prognosis - Google Patents

Tumor grading and cancer prognosis Download PDF

Info

Publication number
WO2009108215A1
WO2009108215A1 PCT/US2008/075528 US2008075528W WO2009108215A1 WO 2009108215 A1 WO2009108215 A1 WO 2009108215A1 US 2008075528 W US2008075528 W US 2008075528W WO 2009108215 A1 WO2009108215 A1 WO 2009108215A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
mgi
grade
genes
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/075528
Other languages
English (en)
French (fr)
Inventor
Mark G. Erlander
Xiao-Jun Ma
Dennis Sgroi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biotheranostics Inc
Original Assignee
Aviaradx Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aviaradx Inc filed Critical Aviaradx Inc
Priority to JP2010524215A priority Critical patent/JP2010538609A/ja
Priority to CA2698569A priority patent/CA2698569A1/en
Priority to EP08872935.5A priority patent/EP2195467B1/en
Priority to ES08872935T priority patent/ES2618353T3/es
Priority to CN200880114588.6A priority patent/CN102395682B/zh
Publication of WO2009108215A1 publication Critical patent/WO2009108215A1/en
Priority to US12/718,973 priority patent/US9447470B2/en
Anticipated expiration legal-status Critical
Priority to US15/807,456 priority patent/US11021754B2/en
Priority to US17/239,207 priority patent/US12492432B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification

Definitions

  • the disclosure relates to the identification and use of gene expression profiles, or patterns, with clinical relevance to cancer.
  • the disclosure is based in part on the identities of genes that are expressed in correlation with tumor grade.
  • the levels of gene expression form a molecular index that is able to determine tumor grade in a patient and predict clinical outcome, and so prognosis for the patient.
  • the molecular grading of cancer may optionally be used in combination with a second molecular index for diagnosing cancer and its prognosis.
  • the gene expression profiles may be used to predict the clinical outcome of subjects afflicted with cancer, predict cancer recurrence, and/or predict occurrence of metastatic cancer.
  • the profiles may also be used in the study and/or diagnosis of cancer cells and tissue as well as for the study of a subject's prognosis.
  • the profiles are used to determine the treatment of cancer based upon the likelihood of life expectancy, cancer recurrence, and/or cancer metastasis.
  • Genome-wide expression profiling studies have created a "small flood" of prognostic gene signatures for breast cancer. An important issue is whether these signatures overlap in the prognostic space and whether combining several of them would provide more accurate prognosis.
  • four signatures (the intrinsic subtypes, 70-gene signature, wound response signature and Recurrence Score), developed using different patient cohorts and methodologies, were found to be highly concordant in classifying patients into low and high risk groups. Furthermore, combining these signatures did not yield significant improvement in predictive accuracy, suggesting that the prognostic information space spanned by these signatures are largely overlapping.
  • GGI genomic grade index
  • 70-gene signature van 't Veer LJ, Dai H, van de Vijver MJ, et al. Nature 415:530-6, 2002
  • Oncotype DX 21-gene recurrence score algorithm Paik S, Shak S, Tang G, et al N Engl J Med 351:2817-26, 2004.
  • the 97-gene tumor grade signature was reported to be comparable to the 70-gene signature and Recurrence Score algorithm in independent cohorts, and it has been hypothesized that most of the prognostic power of these signatures comes from genes associated with cellular proliferation.
  • IGS 186-gene "invasiveness gene signature”
  • the disclosure is based in part on the discovery and determination of gene expression levels in tumor cells that are correlated with tumor grade.
  • the expression levels may be used to provide prognostic information, such as cancer recurrence, and predictive information, such as responsiveness to certain therapies.
  • Bub IB One gene identified by the disclosure encodes Bub IB. Therefore, and in a first aspect of the disclosure, compositions and methods are described for the use of BublB gene expression to study or determine tumor grade, to provide prognostic information, and/or provide predictions of clinical responsiveness. In some cases, the determination is made with tumor cells from a subject to arrive at a diagnosis corresponding to that of a Grade I, Grade III, or intermediate grade tumor.
  • Non-limiting examples of cells for use in the disclosure include those freshly isolated from the subject, those frozen after isolation, and those that are fixed and/or embedded, such as formalin fixed, paraffin embedded (FFPE).
  • the cells are breast cells, such as breast cancer cells.
  • compositions and methods are disclosed for the use of four other gene expression levels to determine tumor grade, to provide prognostic information, and/or provide predictions of clinical responsiveness.
  • These additional genes encode CENPA, NEK2, RACGAPl, and RRM2.
  • a third aspect of the disclosure includes the use of any combination of the five disclosed genes. So in some embodiments, a combination of expression levels of Bub IB and any one, two, or three of these additional four genes may be used.
  • a combination of expression levels of CENPA and any one, two, or three of BublB, NEK2, RACGAPl, or RRM2; of NEK2 and any one, two, or three of BublB, CENPA, RACGAPl, or RRM2; of RACGAPl and any one, two, or three of BublB, CENPA, NEK2, or RRM2; of RRM2 and any one, two, or three of BublB, CENPA, NEK2, or RACGAPl may be used.
  • a combination of all five expression levels as a 5-gene tumor grade signature (or molecular grade index) is disclosed.
  • This index, or MGI is able to recapitulate tumor grade and predict clinical outcome with comparable performance to the 97-gene GGI in two independent cohorts.
  • MGI also serves as a prognostic factor for cancer recurrence and/or survival outcome.
  • the disclosure includes the use of the 5-gene MGI in combination with a second molecular index for cancer.
  • the combination is of the second molecular index with all five of the disclosed genes.
  • the combination may be with any one, two, three, or four of the five disclosed genes as described herein.
  • the second molecular index is one based on the expression levels of two genes HoxB13 and IL17BR.
  • a two-gene ratio of HoxB13 expression to IL17BR expression (or HoxB13:IL17BR ratio) may be used as the second molecular index (see US 2005/0239079 Al; US 2005/0239083 Al; and US 2006/0154267 Al).
  • the second index may be a two-gene ratio of HoxB13 expression to CHDH expression.
  • H:I HoxB13:IL17BR
  • expression of the one or more of the genes in the disclosed 5- gene signature may be used in combination with other genes or another molecular index for cancer prognosis.
  • Non-limiting examples include the genomic grade index (GGI) based on 97 tumor grade-associated genes (Sotiriou et al., supra) and subsets of genes within those 97 genes; the MammaPrint 70-gene signature (van 't Veer et al., supra) and subsets of genes within those 70 genes; the OncotypeDX 21 -gene recurrence score algorithm (Paik et al., supra) and subsets of genes within those 21 genes; and the Veridex 76 gene assay (Wang et al.
  • genes expressed in correlation with a proliferation phenotype are within the sets of 97, 70, 21, and 76 genes as described above.
  • Non-limiting examples of genes expressed in correlation with a proliferation phenotype are Ki-67, STK15, Survivin, Cyclin Bl, and MYBL2.
  • the expression level(s) of any one, two, three, or four of the five MGI genes may be used with other genes or another molecular index for cancer prognosis or as a predictor of clinical outcome.
  • the expression levels of all five genes, as an MGI may also be used in combination with additional genes or another index as described above and hereafter.
  • a combination of expression levels of one, some, or all, of the MGI genes with additional genes may also be further combined with the H:I ratio as described above and hereafter as a prognostic factor or a predictor of clinical outcome.
  • So embodiments of the disclosure include methods that assaying for the expression of one, some, or all of the MGI genes, optionally with one or more additional genes as described above, and optionally in combination with the H:I ratio, as a prognostic factor or a predictor of treatment outcome.
  • Such an assay method may be used to stratify ER+ subjects for prognostic value and for predictive value.
  • the stratification may be based on differential expression levels that correlate with, and so indicate, tumor aggressiveness as a non-limiting example.
  • the stratification may be based on differential expression levels that correlate with, and so indicate, chemotherapy responsiveness (or sensitivity) and/or non- responsiveness (or resistance), which may also be considered as a predictor of chemotherapy benefit.
  • the stratification may be used to predict endocrine resistance (such as resistance to tamoxifen as a non-limiting example) and/or prediction of benefit from inhibitors that target endocrine resistant breast cancers.
  • Non- limiting examples of such inhibitors include those that target mTOR (mammalian target of rapamycin, a serine/threonine protein kinase), PDK (phosphoinositide 3-kinase), an AKT family serine/threonine protein kinase (members of which include Aktl, Akt2, and Akt3 in humans), and/or EGFR (epidermal growth factor receptor; HERl in humans).
  • the detection of gene expression may of course be in any suitable cell containing sample as described herein.
  • the tumor grade independent H:I ratio may be used in combination with a different molecular index for cancer prognosis (in place of one, some, or all MGI genes).
  • indices include the genomic grade index (GGI) based on 97 tumor grade-associated genes (Sotiriou et al., supra) and subsets of genes within those 97 genes; the MammaPrint 70-gene signature (van 't Veer et al., supra) and subsets of genes within those 70 genes; the Oncotype DX 21-gene recurrence score algorithm (Paik et al., supra) and subsets of genes within those 21 genes; and the Veridex 76 gene assay (Wang et al.
  • genes expressed in correlation with a proliferation phenotype are within the sets of 97, 70, 21, and 76 genes as described above.
  • Non-limiting examples of genes expressed in correlation with a proliferation phenotype are the Ki-67 genes, STK15, Survivin, Cyclin Bl, and MYBL2.
  • the disclosure includes assaying for the expression of the H:I ratio in combination with the expression level(s) of one or more additional genes, such as one or more selected from Ki-67, STK15, Survivin, Cyclin Bl, and MYBL2.
  • the assay method may be used to stratify ER+ subjects for prognostic value and for predictive value.
  • the stratification may be based on differential expression levels that correlate with, and so indicate, tumor aggressiveness as a non-limiting example.
  • the stratification may be based on differential expression levels that correlate with, and so indicate, chemotherapy responsiveness (or sensitivity) and/or non-responsiveness (or resistance), which may also be considered as a predictor of chemotherapy benefit.
  • the stratification may be used to predict endocrine resistance and/or prediction of benefit from inhibitors that target endocrine resistant breast cancers.
  • inhibitors include those that target mTOR (mammalian target of rapamycin, a serine/threonine protein kinase), PDK (phosphoinositide 3-kinase), an AKT family serine/threonine protein kinase (members of which include Aktl, Akt2, and Akt3 in humans), and/or EGFR (epidermal growth factor receptor; HERl in humans).
  • the detection of gene expression may of course be in any suitable cell containing sample as described herein.
  • expression of one or more genes selected from Bub IB, CENPA, NEK2, RACGAPl, and RRM2 may be used as a prognostic factor or a predictor of clinical outcome, or to determine tumor grade in a subject with benign breast disease, such as a subject who would be diagnosed as having benign breast disease in the absence of the instant disclosure.
  • benign breast disease is discussed by Hartmann et al. (N. Engl. J. Med., 2005, 353:3).
  • Non-limiting examples of benign breast disease include histological findings of non-proliferative lesions, proliferative lesions without atypia, and atypical hyperplasia.
  • this disclosure includes a method to determine tumor grade in a breast cell of a subject, such as a cell from a histological sample used to diagnose benign breast disease.
  • the method may comprise assaying a sample of breast cells from a subject for the expression levels of Bub IB, CENPA, NEK2, RACGAPl, and RRM2, wherein said expression levels are correlated with a Grade I or Grade III tumor, or even an intermediate grade tumor.
  • the method may comprise assaying for any subset of these five genes, down to any one of the genes, to determine the possible presence of tumor cells of Grade I, Grade III, or an intermediate grade.
  • the cells are from the sample used to diagnose the presence of lesions with atypia or atypical hyperplasia.
  • the disclosure further includes the use of the MGI and the H:I ratio in a sample from subject with benign breast disease to determine whether the subject is at risk for subsequent development of breast cancer.
  • the disclosure provides for the use of just the H:I ratio with such a sample to determine the risk of breast cancer development.
  • expression of one or more genes selected from Bub IB, CENPA, NEK2, RACGAPl, and RRM2 may be used as a prognostic factor or a predictor of clinical outcome, or to determine tumor grade in a subject with ductal carcinoma in situ (or DCIS).
  • this disclosure includes a method to determine tumor grade in a breast cell of a subject afflicted with, or suspected of having, DCIS.
  • the cell may be one from a histological sample used to diagnose DCIS in the subject.
  • the method may comprise assaying a sample of breast cancer cells from a subject for the expression levels of BublB, CENPA, NEK2, RACGAPl, and RRM2, wherein said expression levels are used as a prognostic factor or a predictor of clinical outcome, or are correlated with a Grade I or Grade III tumor, or even an intermediate grade tumor.
  • the method may comprise assaying for any subset of these five genes, down to any one of the genes, as a prognostic factor or a predictor of clinical outcome, or to determine the presence of tumor cells of Grade I, Grade III, or an intermediate grade.
  • the disclosure includes compositions and methods for detecting the expression of one or more genes selected from BublB, CENPA, NEK2, RACGAPl, and RRM2 for use as a prognostic for local recurrence of cancer in DCIS.
  • a method based on the expression levels is advantageously used on a breast cancer cell containing sample from a subject with DCIS.
  • the cell may be one from a pre-operative histological sample used to diagnose cancer in the subject.
  • the standard of care is surgery, with breast conserving surgery preferred over a radical mastectomy, to remove the DCIS.
  • the disclosure includes detecting expression of all five of these genes where high MGI expression is an indicator of increased likelihood of local cancer recurrence in the subject due to failure of the breast conserving surgery and subsequent radiation therapy and/or endocrine therapy or chemotherapy.
  • such a method utilizes detection of the H:I ratio as a substitute indicator for high MGI expression.
  • the disclosure includes a method that combines detection of high MGI and the H:I ratio as indicators of increased likelihood of local cancer recurrence following treatment for DCIS.
  • the method may comprise assaying for any subset of the five MGI genes, down to any one of the genes, optionally in combination with the H:I ratio, as indicators increased likelihood of local cancer recurrence following treatment for DCIS.
  • the methods may further include identifying the subject as likely, or unlikely, to experience local cancer recurrence, and optionally further include adjusting treatment modalities for the subject to address the expected outcome.
  • determination of a low likelihood of recurrence may be used to confirm the suitability of, or to select, breast conserving surgery, optionally with reduction in post-operative therapies, such as omission of radiation and/or omission of endocrine therapy or chemotherapy.
  • determination of a high likelihood of recurrence may be used to confirm the suitability of, or to select, radical mastectomy with inclusion of post-operative therapies, such as radiation and/or endocrine therapy or chemotherapy.
  • the disclosure includes use of one or more genes selected from BublB, CENPA, NEK2, RACGAPl, and RRM2 (or all five genes) as a prognostic factor or a predictor of clinical outcome, or to determine tumor grade in a subject that is under evaluation based on the 2005 St. Gallen expert consensus on the primary therapy of early breast cancer (see Goldhirsch et al. Ann. Oncol., 2005, 16:1569-1583).
  • this disclosure includes a method to assess expression of one, some, or all of the MGI genes in a breast cell of a subject as part of the differential diagnosis and selection of therapy based on the expert consensus.
  • Non-limiting examples of portions of the consensus that may be used with the disclosed methods include the algorithm for selection of adjuvant systemic therapy for early breast cancer; responsiveness or non-responsiveness to endocrine therapy or uncertain endocrine responsiveness; and nodal status.
  • the disclosed methods of molecular gene expression profiling are used to confirm classifications of low and high risk groups as well as resolve at least some intermediate risk category subjects into the low or high risk groups.
  • the disclosed methods may be used to select or eliminate therapies for premenopausal women, or for postmenopausal women, diagnosed with cancer. Premenopausal women include those who are less than about 35 years of age.
  • high MGI expression is an indicator of cancer recurrence.
  • the disclosure includes using the expression level(s) of one or more genes selected from BublB, CENPA, NEK2, RACGAPl, and RRM2 as a prognostic for recurrence of breast cancer, such as in cases of DCIS, in a premenopausal subject.
  • the H:I ratio is also assayed and used as a combination with the MGI gene(s).
  • the method may include assaying a breast cancer cell containing sample from a subject for expression of these genes.
  • the cell may be one from a preoperative histological sample used to diagnose cancer in the subject.
  • the method includes using expression of all five of these genes as an embodiment, where high MGI expression is an indicator of increased likelihood of cancer recurrence in the premenopausal subject.
  • the methods may include identifying the premenopausal subject as likely, or unlikely, to experience cancer recurrence, and optionally further include adjusting treatment modalities for the subject to address the expected outcome.
  • determination of a low likelihood of recurrence may be used to confirm the suitability of, or to select, breast conserving therapies, optionally with reduction in post-operative therapies like radiation and/or endocrine therapy or chemotherapy.
  • determination of a high likelihood of recurrence may be used to confirm the suitability of, or to select, radical treatment modalities with inclusion of post-operative therapies, such as radiation and/or endocrine therapy or chemotherapy.
  • the methods may be used to aid in the selection of treatment, such as among endocrine therapy, chemotherapy, radiation therapy, or a combination thererof.
  • the disclosure includes compositions and methods for determining the expression levels of one or more of the five MGI genes, or all five of them, as a predictor of endocrine therapy effectiveness.
  • the predictor may be of responsiveness or non- responsiveness to an SERM, such as tamoxifen, or an SERD. This includes cases where assay of a breast cancer cell containing sample from a subject reveals a high MGI, indicating the likelihood of non-responsiveness to tamoxifen.
  • the predictor may be of the effectiveness of one form of endocrine therapy over another.
  • the method may include identification of a high MGI in the expression of one or all five genes, which indicates a likelihood of greater responsiveness to an AI over tamoxifen.
  • an AI include non-steroidal inhibitors such as letrozole and anastrozole and irreversible steroidal inhibitors such as exemestane.
  • the disclosure includes compositions and methods for the use of the expression levels of one or more of the five MGI genes, or all five of them, as a predictor of chemotherapy treatment outcome.
  • the H:I ratio is also assayed and used as a combination with the MGI gene(s).
  • the expression level(s) of the genes may thus be used to predict chemo- sensitivity, such as to paclitaxel/FAC (paclitaxel followed by 5-fluorouracil, doxorubicin and cyclophosphamide) or taxol or anthracyclin therapy as a non-limiting examples.
  • the disclosure includes detecting expression of all five of these genes, where high MGI expression is an indicator of increased likelihood of a complete pathological response (pCR) to chemotherapy, such as post-operative (post-surgical intervention) treatment with paclitaxel/FAC as a non-limiting example.
  • the detecting may be of expression in a cancer cell from a pre-operative cell containing sample used to diagnose cancer in the subject.
  • the method may comprise assaying for any subset of the five MGI genes, down to any one of the genes, as predicators of sensitivity or resistance to chemotherapy.
  • the method may further include identifying the subject as likely, or unlikely, to experience pCR, and optionally further include adjusting treatment modalities for the subject to address the expected outcome.
  • determination of a low likelihood of pCR may be used to confirm the suitability of, or to select, treatment with chemotherapy, such as paclitaxel/FAC.
  • determination of a high likelihood of pCR may be used to confirm the suitability of, or to select, omission of chemotherapy, such as omission of paclitaxel/FAC, in favor of other treatment modalities, such as radical mastectomy with inclusion of post-operative therapies, such as radiation.
  • the disclosure further includes compositions and methods for the use of the expression levels of one or more of the five MGI genes, or all five of them, as a predictor of a cancer's responsiveness (sensitivity) to radiation treatment.
  • the H:I ratio is also assayed and used as a combination with the MGI gene(s).
  • High MGI expression may thus be used to predict a breast cancer patient to be responsive to radiation treatment, such as post-surgical intervention. Therefore, the disclosure includes detecting expression of all five of these genes, where high MGI expression is an indicator of post-operative sensitivity to radiation treatment.
  • the cancer cell may be one from a pre-operative histological sample used to diagnose cancer in the subject.
  • the method may comprise assaying for any subset of the five MGI genes, down to any one of the genes, as predicators of responsiveness to radiation therapy.
  • the method may further include identifying the subject as likely, or unlikely, to be responsive to radiation therapy after surgical intervention, and optionally further include adjusting treatment modalities for the subject to address the expected outcome.
  • determination of a likelihood of responsiveness (sensitivity) to post-surgery radiation may be used to confirm the suitability of, or to select, radiation therapy.
  • determination of a low likelihood of responsiveness (sensitivity) to post- surgery radiation may be used to confirm the suitability of, or to select, omitting radiation therapy, optionally in favor of chemotherapy.
  • Figure 1 illustrates the combination of the 5-gene expression pattern into a single index score (molecular grade index or MGI) via unsupervised principle component analysis.
  • MGI molecular grade index
  • Figure 1 B illustrates a model-based clustering of MGI across the entire dataset, resulting in a bimodal distribution with a natural cutoff point around 0. This cutpoint correctly classified most of the grade 1 and grade 3 tumors (89% overall accuracy) and stratified grade 2 tumors into two groups (59% and 41% in the low and high MGI group, respectively).
  • Survival probability data over 12 years from the grade 2 tumor subjects was plotted based upon MGI values of ⁇ 0 and >0 in part C of Figure 1 to illustrate the prognostic capability of MGI.
  • Figure 2 shows a comparison of MGI and GGI for correlation with tumor grade and clinical outcome.
  • Parts A to C illustrate a comparison of the 5-gene expression pattern to GGI in the Uppsala cohort, while parts D to f correspond to the Swedish cohort.
  • Parts A and D are receiver operating characteristic (ROC) curve analysis of MGI and GGI for discriminating grade 1 and grade 3 tumors.
  • Parts B to F show Kaplan-Meier survival curves showing probability of breast cancer- specific death according to MGI or GGI status (high vs. low).
  • Figure 3 shows Kaplan-Meier survival curves according to the 76-gene prognostic signature or MGI in the TRANSBIG cohort. Parts A and B are for all patients. Parts C and D correspond to the ER+ tumor grade 1 or 2 subgroup.
  • Figure 4 shows MGI determined by the RT-PCR TaqManTM assay in the MGH cohort.
  • Part A illustrates the correlation of MGI with tumor grade.
  • Parts B to D show Kaplan-Meier analyses of distant metastasis-free survival according to MGI using all patients (part B), lymph node-negative (part C) or lymph node-positive patients (part D).
  • Figure 5 shows Kaplan-Meier analyses of distant metastasis-free survival according to MGI (part A), H:I ratio (part B), or the three groups (low-, intermediate- and high-risk) generated by combing MGI and H:I ratio (part C) in the MGH cohort, or the same three risk groups in the Oxford cohort (part D).
  • Figure 5E illustrates the interaction between MGI and the H:I ratio in the Table 1 cohort.
  • MGI was most robust in predicting distant metastasis in high HOXB13:IL17BR patients, and similarly, the H:I ratio was most robust in high MGI patients.
  • Figure 6 shows correlation of the H:I ratio and MGI with ER, PR and HER2 expression as determined by real-time RT-PCR in the lymph node-negative endocrine therapy-treated patients of the Table 1 cohort.
  • X-axis groups defined by the H:I ratio, MGI or their combination.
  • Y-axis relative expression level of ER, PR or HER2 as indicated.
  • FIG. 7 illustrates the interaction between MGI and the H to I ratio in the last cohort. Similar to the Table 1 cohort, MGI and the H:I ratio provide additional prognostic information to each other. Tumors with high values in both indexes were associated with much worse outcome than those with only one high index.
  • Figure 8 illustrates application of the MGI to more accurately identify the intermediate and low risk populations under St. Gallen protocols into high, intermediate, and low risk populations.
  • Figure 9 illustrates a hypothetical result of an MGI value of 2.1 and its correlation with a 19% risk of cancer recurrence within 5 years.
  • Figure 10 shows Kaplan-Meier curve analyses of patient stratification by MGI according to clinical treatment or lack thereof.
  • Panel A shows the results with patients that received no systemic treatment.
  • Panel B shows the results with patients that received only endocrine therapy.
  • HR hazard ratio from univariate Cox regression analysis, and p values are from log-rank test.
  • Figure 11 shows the predictive ability of MGI for sensitivity to chemotherapy.
  • Figure 12 shows Kaplan-Meier curve analyses of patient stratification by MGI according to pre- or post- menopause status.
  • Panel A shows the results with post- menopausal women (age > 50).
  • Panel B shows the results with pre-menopausal women (age ⁇ 50).
  • HR hazard ratio from univariate Cox regression analysis, and p values are from log-rank test.
  • a gene expression "pattern” or “profile” or “signature” refers to the relative expression of one or more genes between two or more clinical outcomes, cancer outcomes, cancer recurrence and/or survival outcomes which is correlated with being able to distinguish between said outcomes. In some cases, the outcome is that of breast cancer.
  • a "gene” is a polynucleotide that encodes a discrete product, whether RNA or proteinaceous in nature. It is appreciated that more than one polynucleotide may be capable of encoding a discrete product.
  • the term includes alleles and polymorphisms of a gene that encodes the same product, or a functionally associated (including gain, loss, or modulation of function) analog thereof, based upon chromosomal location and ability to recombine during normal mitosis.
  • correlate or “correlation” or equivalents thereof refer to an association between expression of one or more genes and a physiologic state of a cell to the exclusion of one or more other state as identified by use of the methods as described herein.
  • a gene may be expressed at a higher or a lower level and still be correlated with one or more cancer state or outcome.
  • a "polynucleotide” is a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA and RNA. It also includes known types of modifications including labels known in the art, methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as uncharged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), as well as unmodified forms of the polynucleotide.
  • uncharged linkages e.g., phosphorothioates, phosphorodithioates, etc.
  • amplify is used in the broad sense to mean creating an amplification product can be made enzymatically with DNA or RNA polymerases.
  • Amplification generally refers to the process of producing multiple copies of a desired sequence, particularly those of a sample.
  • Multiple copies mean at least 2 copies.
  • a “copy” does not necessarily mean perfect sequence complementarity or identity to the template sequence.
  • nucleic acid molecule shares a substantial amount of sequence identity with another nucleic acid molecule.
  • Methods for amplifying mRNA are generally known in the art, and include reverse transcription PCR (RT-PCR) and those described in U.S. Patent Application 10/062,857 (filed on October 25, 2001), as well as U.S.
  • RNA may be directly labeled as the corresponding cDNA by methods known in the art.
  • a "microarray” is a linear or two-dimensional array of preferably discrete regions, each having a defined area, formed on the surface of a solid support such as, but not limited to, glass, plastic, or synthetic membrane.
  • the density of the discrete regions on a microarray is determined by the total numbers of immobilized polynucleotides to be detected on the surface of a single solid phase support, preferably at least about 50/cm , more preferably at least about 100/cm 2 , even more preferably at least about 500/cm 2 , but preferably below about 1,000/cm 2 .
  • the arrays contain less than about 500, about 1000, about 1500, about 2000, about 2500, or about 3000 immobilized polynucleotides in total.
  • a DNA microarray is an array of oligonucleotides or polynucleotides placed on a chip or other surfaces used to hybridize to amplified or cloned polynucleotides from a sample. Since the position of each particular group of primers in the array is known, the identities of a sample polynucleotides can be determined based on their binding to a particular position in the microarray.
  • one embodiment of the disclsoure involves determining expression by hybridization of mRNA, or an amplified or cloned version thereof, of a sample cell to a polynucleotide that is unique to a particular gene sequence.
  • Preferred polynucleotides of this type contain at least about 20, at least about 22, at least about 24, at least about 26, at least about 28, at least about 30, or at least about 32 consecutive basepairs of a gene sequence that is not found in other gene sequences.
  • the term "about” as used in the previous sentence refers to an increase or decrease of 1 from the stated numerical value.
  • the term "about” as used in the preceding sentence refers to an increase or decrease of 10% from the stated numerical value.
  • Such polynucleotides may also be referred to as polynucleotide probes that are capable of hybridizing to sequences of the genes, or unique portions thereof, described herein.
  • the sequences are those of mRNA encoded by the genes, the corresponding cDNA to such mRNAs, and/or amplified versions of such sequences.
  • the polynucleotide probes are immobilized on an array, other devices, or in individual spots that localize the probes.
  • all or part of a disclosed sequence may be amplified and detected by methods such as the polymerase chain reaction (PCR) and variations thereof, such as, but not limited to, quantitative PCR (Q-PCR), reverse transcription PCR (RT- PCR), and real-time PCR, optionally real-time RT-PCR.
  • PCR polymerase chain reaction
  • Q-PCR quantitative PCR
  • RT- PCR reverse transcription PCR
  • real-time PCR optionally real-time RT-PCR.
  • Such methods would utilize one or two primers that are complementary to portions of a disclosed sequence, where the primers are used to prime nucleic acid synthesis.
  • the newly synthesized nucleic acids are optionally labeled and may be detected directly or by hybridization to a polynucleotide of the disclosure.
  • the newly synthesized nucleic acids may be contacted with polynucleotides (containing sequences) of the disclosure under conditions which allow for their hybridization.
  • gene expression may be determined by analysis of expressed protein in a cell sample of interest by use of one or more antibodies specific for one or more epitopes of individual gene products (proteins) in said cell sample.
  • Such antibodies are preferably labeled to permit their easy detection after binding to the gene product.
  • label refers to a composition capable of producing a detectable signal indicative of the presence of the labeled molecule. Suitable labels include radioisotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent moieties, magnetic particles, bioluminescent moieties, and the like. As such, a label is any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
  • support refers to conventional supports such as beads, particles, dipsticks, fibers, filters, membranes and silane or silicate supports such as glass slides.
  • a "cancer tissue sample” or “cancer cell sample” refers to a cell containing sample of tissue isolated from an individual afflicted with the corresponding cancer.
  • the sample may be from material removed via a surgical procedure, such as a biopsy.
  • Such samples are primary isolates (in contrast to cultured cells) and may be collected by any suitable means recognized in the art.
  • the "sample” may be collected by an noninvasive method, including, but not limited to, abrasion, fine needle aspiration.
  • breast tissue sample or “breast cell sample” refers to a sample of breast tissue or fluid isolated from an individual suspected of being afflicted with, or at risk of developing, breast cancer. Such samples are primary isolates (in contrast to cultured cells) and may be collected by any non-invasive means, including, but not limited to, ductal lavage, fine needle aspiration, needle biopsy, the devices and methods described in U.S. Pat. No. 6,328,709, or any other suitable means recognized in the art. Alternatively, the “sample” may be collected by an invasive method, including, but not limited to, surgical biopsy.
  • “Expression” and “gene expression” include transcription and/or translation of nucleic acid material. Of course the term may also be limited, if so indicated, as referring only to the transcription of nucleic acids.
  • Conditions that "allow” an event to occur or conditions that are “suitable” for an event to occur are conditions that do not prevent such events from occurring. Thus, these conditions permit, enhance, facilitate, and/or are conducive to the event.
  • Such conditions known in the art and described herein, depend upon, for example, the nature of the nucleotide sequence, temperature, and buffer conditions. These conditions also depend on what event is desired, such as hybridization, cleavage, strand extension or transcription.
  • Sequence "mutation,” as used herein, refers to any sequence alteration in the sequence of a gene disclosed herein interest in comparison to a reference sequence.
  • a sequence mutation includes single nucleotide changes, or alterations of more than one nucleotide in a sequence, due to mechanisms such as substitution, deletion or insertion.
  • Single nucleotide polymorphism is also a sequence mutation as used herein. Because the present disclosure is based on the relative level of gene expression, mutations in non-coding regions of genes as disclosed herein may also be assayed in the practice of the disclosure.
  • Detection includes any means of detecting, including direct and indirect detection of gene expression and changes therein. For example, “detectably less” products may be observed directly or indirectly, and the term indicates any reduction (including the absence of detectable signal). Similarly, “detectably more” product means any increase, whether observed directly or indirectly.
  • Increases and decreases in expression of the disclosed sequences are defined in the following terms based upon percent or fold changes over expression in normal cells. Increases may be of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200% relative to expression levels in normal cells. Alternatively, fold increases may be of 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 fold over expression levels in normal cells. Decreases may be of 10, 20, 30, 40, 50, 55, 60, 65, 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 99 or 100% relative to expression levels in normal cells.
  • MGI 5-gene tumor grade signature
  • MGI and the H:I ratio appear to represent two distinct prognostic modules in breast cancer, as suggested by the observation that the H:I ratio, but not MGI, is associated with estrogen signaling.
  • MGI and the H:I ratio are also potential predictive factors for therapeutic benefit from chemotherapy and endocrine therapy, respectively.
  • High tumor grade or mitotic index predicts benefit from chemotherapy in node-negative breast cancer patients.
  • the proliferation group of genes in the Recurrence Score algorithm has been shown to predict chemotherapy benefit in ER+ node-negative patients.
  • high MGI predicts complete pathological response in ER+ breast cancer patients treated with preoperative paclitaxel followed by 5-fluorouracil, doxorubicin, and cyclophosphamide.
  • H:I ratio Two recent studies of the H:I ratio have demonstrated its potential as a novel biomarker of endocrine responsiveness beyond estrogen and progesterone receptors. In a study of recurrent breast cancer, low H:I was strongly associated with response to first-line tamoxifen therapy. Similarly, in an analysis of tumor samples from a prospective randomized clinical trial comparing 2 years vs. 5 years of tamoxifen therapy, low HOXB 13 or low H:I ratio significantly predicted benefit from prolonged tamoxifen therapy. These results are consistent with the observation that estrogen negatively regulates HOXB 13 and positively regulates IL17BR expression.
  • a high HOXB 13 or H:I index can be considered as a marker of dysfunctional estrogen signaling.
  • the dual roles of MGI and the H:I ratio are especially relevant in the context of the latest (2005) St. Gallen consensus guidelines for treatment selection for early stage breast cancer.
  • the St. Gallen guidelines classify ER+ node-negative breast cancer patients into low and intermediate risk groups, with the majority falling into the latter.
  • An important treatment decision is whether to withhold chemotherapy for some of the patients in the intermediate-risk group, a question targeted by two new prospective clinical trials.
  • applying the St. Gallen guidelines resulted in the classification of 86% the patients into the intermediate risk group, which could be re-classified as low (43%), intermediate (26%) or high (31%) risk using MGI and the H:I ratio.
  • this disclosure includes a validated MGI as a powerful prognostic factor in ER+ breast cancer. Furthermore, MGI and the H:I ratio can be combined to provide more accurate prognostic information than either alone. The identification of a subset of patients with very poor outcome using these two biomarkers facilitates clinical trial designs to target those cancers with both high MGI and high H:I ratio.
  • genes disclosed as expressed in correlation with particular tumor grades provide the ability to focus gene expression analysis to only those genes that contribute to the ability to identify a subject as likely to have a particular prognosis, or clinical outcome, relative to another.
  • the expression of other genes in a cancer cell would be relatively unable to provide information concerning, and thus assist in these discriminations.
  • any method known in the art may be utilized.
  • expression based on detection of RNA which hybridizes to the genes identified and disclosed herein is used. This is readily performed by any RNA detection or amplification+detection method known or recognized as equivalent in the art such as, but not limited to, reverse transcription-PCR, the methods disclosed in U.S. patent application Ser. No.
  • expression based on detection of DNA status may be used. Detection of the DNA of an identified gene as methylated or deleted may be used for genes that have decreased expression. This may be readily performed by PCR based methods known in the art, including, but not limited to, Q-PCR. Conversely, detection of the DNA of an identified gene as amplified may be used for genes that have increased expression in correlation with a particular breast cancer outcome. This may be readily performed by PCR based, fluorescent in situ hybridization (FISH) and chromosome in situ hybridization (CISH) methods known in the art.
  • FISH fluorescent in situ hybridization
  • CISH chromosome in situ hybridization
  • Detection may be performed by any immunohistochemistry (IHC) based, blood based (especially for secreted proteins), antibody (including autoantibodies against the protein) based, exfoliate cell (from the cancer) based, mass spectroscopy based, and image (including used of labeled ligand) based method known in the art and recognized as appropriate for the detection of the protein.
  • IHC immunohistochemistry
  • Antibody and image based methods are additionally useful for the localization of tumors after determination of cancer by use of cells obtained by a noninvasive procedure (such as ductal lavage or fine needle aspiration), where the source of the cancerous cells is not known.
  • a labeled antibody or ligand may be used to localize the carcinoma(s) within a patient.
  • nucleic acid based assay to determine expression is by immobilization of one or more sequences of the genes identified herein on a solid support, including, but not limited to, a solid substrate as an array or to beads or bead based technology as known in the art.
  • a solid support including, but not limited to, a solid substrate as an array or to beads or bead based technology as known in the art.
  • solution based expression assays known in the art may also be used.
  • the immobilized gene(s) may be in the form of polynucleotides that are unique or otherwise specific to the gene(s) such that the polynucleotide would be capable of hybridizing to a DNA or RNA corresponding to the gene(s).
  • These polynucleotides may be the full length of the gene(s) or be short sequences of the genes (up to one nucleotide shorter than the full length sequence known in the art by deletion from the 5' or 3' end of the sequence) that are optionally minimally interrupted (such as by mismatches or inserted non-complementary basepairs) such that hybridization with a DNA or RNA corresponding to the gene(s) is not affected.
  • the polynucleotides used are from the 3' end of the gene, such as within about 350, about 300, about 250, about 200, about 150, about 100, or about 50 nucleotides from the polyadenylation signal or polyadenylation site of a gene or expressed sequence.
  • Polynucleotides containing mutations relative to the sequences of the disclosed genes may also be used so long as the presence of the mutations still allows hybridization to produce a detectable signal.
  • the immobilized gene(s) may be used to determine the state of nucleic acid samples prepared from sample cancer, or breast, cell(s) for which the outcome of the sample's subject (e.g. patient from whom the sample is obtained) is not known or for confirmation of an outcome that is already assigned to the sample's subject. Without limiting the disclosure, such a cell may be from a patient with ER+ breast cancer.
  • the immobilized polynucleotide(s) need only be sufficient to specifically hybridize to the corresponding nucleic acid molecules derived from the sample under suitable conditions.
  • the disclosure is based in part upon the discovery of a gene expression based prognostic factor and predictor of clinical outcome and tumor grade, such as that which utilize cancer samples from FFPE tissues, frozen samples or fresh samples.
  • the expression levels of these genes correlate with tumor grade and clinical outcomes as described herein as well as determining prognosis for a subject.
  • the identified genes have roles in the cell cycle and reported peak expression as follows: Gene Peak of Expression Role in Cell Cycle
  • Hs. 1594 (with 129 corresponding sequences), Hs. 153704 (with 221 corresponding sequences), Hs. 696319 (with 349 corresponding sequences), and Hs. 226390 (with 1348 corresponding sequences), respectively.
  • the sequences corresponding to each of these Unigene identifiers are hereby incorporated by reference as if fully set forth and may be used in the practice of the disclosure by the skilled person as deemed appropriate.
  • sequences of the same genes have also been identified and characterized from other animal species.
  • the skilled person in the field is clearly aware of how to identify the disclosed genes relative to other animal genes.
  • the skilled person may also optionally compare the known sequences of the disclosed genes from different animal sources to identify conserved regions and sequences unique to these genes relative to other genes.
  • sequences unique to an individual or a subpopulation may be used.
  • the preferred unique sequences are preferably of the lengths of polynucleotides of the disclosure as discussed herein.
  • any method known in the art may be utilized.
  • expression based on detection of RNA which hybridizes to polynucleotides containing the above described sequences is used. This is readily performed by any RNA detection or amplification+detection method known or recognized as equivalent in the art such as, but not limited to, reverse transcription-PCR (optionally real-time PCR), the methods disclosed in U.S. patent application Ser. No. 10/062,857 entitled “Nucleic Acid Amplification” filed on Oct. 25, 2001 as well as U.S. Provisional Patent Application 60/298,847 (filed Jun. 15, 2001) and 60/257,801 (filed Dec.
  • RNA stability results in an observation of increased expression
  • decreased RNA stability results in an observation of decreased expression
  • methods to identify increased RNA stability (resulting in an observation of increased expression) or decreased RNA stability (resulting in an observation of decreased expression) may also be used. These methods include the detection of sequences that increase or decrease the stability of mRNAs containing the genes' sequences. These methods also include the detection of increased mRNA degradation.
  • polynucleotides having sequences present in the 3' untranslated and/or non-coding regions of the above disclosed sequences are used to detect expression levels of the gene sequences in cancer, or breast, cells.
  • Such polynucleotides may optionally contain sequences found in the 3' portions of the coding regions of the above disclosed sequences.
  • Polynucleotides containing a combination of sequences from the coding and 3' non- coding regions preferably have the sequences arranged contiguously, with no intervening heterologous sequence(s).
  • the disclosure may be practiced with polynucleotides having sequences present in the 5' untranslated and/or non-coding regions of the gene sequences in cancer, or breast, cells to detect their levels of expression.
  • polynucleotides may optionally contain sequences found in the 5' portions of the coding regions.
  • Polynucleotides containing a combination of sequences from the coding and 5' non-coding regions preferably have the sequences arranged contiguously, with no intervening heterologous sequence(s).
  • the disclosure may also be practiced with sequences present in the coding regions of the disclosed gene sequences.
  • Non-limiting polynucleotides contain sequences from 3' or 5' untranslated and/or non- coding regions of at least about 20, at least about 22, at least about 24, at least about 26, at least about 28, at least about 30, at least about 32, at least about 34, at least about 36, at least about 38, at least about 40, at least about 42, at least about 44, or at least about 46 consecutive nucleotides.
  • the term "about” as used in the previous sentence refers to an increase or decrease of 1 from the stated numerical value.
  • the term "about” as used in the preceding sentence refers to an increase or decrease of 10% from the stated numerical value.
  • Sequences from the 3' or 5' end of the above described coding regions as found in polynucleotides of the disclosure are of the same lengths as those described above, except that they would naturally be limited by the length of the coding region.
  • the 3' end of a coding region may include sequences up to the 3' half of the coding region.
  • the 5' end of a coding region may include sequences up the 5' half of the coding region.
  • the above described sequences, or the coding regions and polynucleotides containing portions thereof may be used in their entireties.
  • Polynucleotides combining the sequences from a 3' untranslated and/or non-coding region and the associated 3' end of the coding region may be at least or about 100, at least about or 150, at least or about 200, at least or about 250, at least or about 300, at least or about 350, or at least or about 400 consecutive nucleotides.
  • the polynucleotides used are from the 3' end of the gene, such as within about 350, about 300, about 250, about 200, about 150, about 100, or about 50 nucleotides from the polyadenylation signal or polyadenylation site of a gene or expressed sequence.
  • Polynucleotides containing mutations relative to the sequences of the disclosed genes may also be used so long as the presence of the mutations still allows hybridization to produce a detectable signal.
  • polynucleotides containing deletions of nucleotides from the 5' and/or 3' end of the above disclosed sequences may be used.
  • the deletions are preferably of 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50- 60, 60-70, 70-80, 80-90, 90-100, 100-125, 125-150, 150-175, or 175-200 nucleotides from the 5 1 and/or 3' end, although the extent of the deletions would naturally be limited by the length of the disclosed sequences and the need to be able to use the polynucleotides for the detection of expression levels.
  • primers and optional probes for quantitative PCR include those of primers and optional probes for quantitative PCR.
  • the primers and probes are those which amplify a region less than about 350, less than about 300, less than about 250, less than about 200, less than about 150, less than about 100, or less than about 50 nucleotides from the from the polyadenylation signal or polyadenylation site of a gene or expressed sequence.
  • polynucleotides containing portions of the above disclosed sequences including the 3' end may be used. Such polynucleotides would contain at least or about 50, at least or about 100, at least about or 150, at least or about 200, at least or about 250, at least or about 300, at least or about 350, or at least or about 400 consecutive nucleotides from the 3' end of the disclosed sequences.
  • the disclosure also includes polynucleotides used to detect gene expression in breast cells.
  • the polynucleotides may comprise a shorter polynucleotide consisting of sequences found in the above genes in combination with heterologous sequences not naturally found in combination with the sequences.
  • Non-limiting examples include short sequences from cloning vectors or present in restriction fragments used to prepare labeled probes or primers as described herein.
  • the disclosure includes the identity of genes, the expression of which can be used to provide prognostic information related to cancer.
  • the expression levels of these genes may be used in relation to breast cancer.
  • the gene expression profile correlates with (and so are able to discriminate between) patients with good or poor cancer recurrence and/or survival outcomes.
  • the disclosure includes a method to compare gene expression in a sample of cancer cells from a patient to the gene expression profile to determine the likely clinical or treatment outcome for the patient, or natural biological result, in the absence of intervention.
  • inventions of the disclosure may be advantageously used to meet an important unmet diagnostic need for the ability to predict whether a patient will likely benefit from a given treatment type or whether a patient will be better off with another type of treatment.
  • a low H:I ratio value is strongly associated with response to first-line tamoxifen therapy.
  • an analysis of tumor samples from a prospective randomized clinical trial comparing 2 years vs. 5 years of tamoxifen therapy indicates that low HOXB 13 or low HOXB13:IL17BR significantly predicts benefit from prolonged tamoxifen therapy.
  • the ability of the MGI to predict the presence of grade I versus grade III tumors allows the clinician in the relevant field to select therapy appropriate to cancers of these two grades.
  • the MGI not only confirms grade I and grade III classifications made by other means, but it can, in combination with the H:I ratio, more accurately classify tumors as low, intermediate, or high risk that have been incorrectly classified by other methods. This is illustrated in Figure 8, where stratification based on 2005 St. Gallen protocol is significantly corrected by the use of the disclosed MGI and H:I ratio
  • the disclosure includes a method to identify a patient, from a population of patients with cancer cells, as belonging to a subpopulation of patients with a better prognosis or a subpopulation with a poor prognosis.
  • the subpopulation with a better prognosis is similar to subjects identified as having a Grade I tumor compared to a subpopulation of patients with a poorer prognosis, similar to subjects identified as having a Grade III tumor.
  • the disclosed methods are not necessarily perfect in application, and it is possible that a given patient will be identified as having an "intermediate" tumor grade between that of Grades I and III. In which case, the skilled practitioner would treat the subject accordingly.
  • the disclosure nevertheless provides a non- subjective means for the identification of patients with tumors of Grade I, intermediate, or Grade III, which identification can be used to a patient's benefit by the skilled practitioner.
  • the disclosed methods can classify tumors of "intermediate” grade by other methods into Grade I or Grade III status. This provides an enormous benefit to the corresponding patient subpopulation, which would otherwise have been treated as having "intermediate” grade tumors. So in some embodiments, a method of reducing the number of "intermediate” grade classification is provided by use of the disclosed 5- gene MGI.
  • the disclosure includes a method of determining prognosis and/or survival outcome by assaying for the expression patterns disclosed herein. So where subjective interpretation may have been previously used to determine the prognosis and/or treatment of cancer patients, this disclosure provides objective gene expression patterns, which may used alone or in combination with subjective criteria to provide a more accurate assessment of patient outcomes, including survival and the recurrence of cancer.
  • the assaying includes detecting the expression level of Bub IB, wherein the expression level is correlated with a Grade I or Grade III tumor.
  • the disclosed genes are identified as correlated with tumor grade and clinical outcomes such that the levels of their expression are relevant to a determination of the treatment protocols of a patient.
  • the disclosure provides a method to determine therapeutic treatment for a cancer patient by determining prognosis for said patient by assaying a sample of cancer cells from said patient for the expression levels described herein to determine the tumor grade, and selecting a treatment for a patient with a tumor of such grade.
  • the assaying includes detecting the expression level of Bub IB, wherein the expression level is correlated with a Grade I or Grade III tumor.
  • a method of the disclosure may include assaying a sample of cancer cells from a cancer afflicted subject for the expression level of Bub IB wherein the expression level classifies the cancer as corresponding to a Grade I or Grade III tumor, or identifies the subject as having a prognosis of likely cancer recurrence, or predicts the responsiveness of the subject to treatment with endocrine therapy, chemotherapy, or radiation therapy.
  • the assaying may include measuring or detecting or determining the expression level of the gene in any suitable means described herein or known to the skilled person.
  • the cancer is breast cancer, and the subject is a human patient.
  • the cancer cells may be those of a tumor and/or from a node negative (lymph nodes negative for cancer) or node positive (lymph nodes positive for cancer) subject.
  • the method may be practiced along with assaying for the expression of one or more of the other four genes of the MGI, wherein the expression levels of the genes used in combination are used to classify, identify, or predict as provided by the method.
  • the requisite level of expression level may be that which is identified by the methods described herein for the genes used.
  • the assaying may include preparing RNA from the sample, optionally for use in PCR (polymerase chain reaction) or other analytical methodology as described herein.
  • the PCR methodology is optionally RT-PCR (reverse transcription-PCR) or quantitative PCR, such as real-time RT-PCR.
  • the assaying may be conducted by use of an array, such as a microarray as known in the relevant field.
  • the sample of cancer cells is dissected from tissue removed or obtained from said subject.
  • sample types including a formalin fixed paraffin embedded (FFPE) sample as a non-limiting example.
  • the method may include assaying or determining the H:I ratio (ratio of HoxB13 and IL17BR expression levels) in the sample as disclosed herein.
  • all five genes of the MGI may be assayed and used to detect expression levels that correspond to a value that is "high risk” (which is above the cutoff) for MGI, or to detect expression levels that correspond to a value that is "low risk” (which is at or below the cutoff) for MGI, as disclosed herein.
  • the MGI cutoff threshold may be 0 (zero), such as where the measurements of expression levels are standardized to 0 (zero) with a standard deviation of 1.
  • the cutoff may be at or about 0.05, at or about 0.10, at or about 0.15, at or about 0.20, at or about 0.25, at or about -0.05, at or about -0.10, at or about -0.15, at or about -0.20, at or about -0.25, at or about -0.30, at or about - 0.35, at or about -0.40, at or about -0.45, at or about -0.50, at or about -0.55, at or about -0.60, at or about -0.65, at or about -0.70, at or about -0.75, at or about -0.80, at or about -0.85, at or about -0.90, at or about -0.95, at or about -1.0, at or about -1.1, at or about -1.2, at or about -1.3, at or about - 1.4, at or about -1.5, at or about -1.6, at or about -1.7, at or about -1.8, at or about -1.9, at or about -
  • H:I ratio its determination maybe made as described in Ma et al. (2004) and Ma et al. (2006) as referenced herein. For example, a value of 0.06 may be used to determine whether a sample has a "high risk” (>0.06) or "low risk” ( ⁇ 0.06) H:I ratio.
  • the disclosed methods provide two possible assay outcomes for a given sample: "high risk MGI” corresponding to a value above 0 (zero) and "low risk MGI” corresponding to a value ⁇ 0.
  • a “high risk MGI” is indicative of a "high risk” cancer, including breast cancer, that is analogous to that of a Grade III tumor as defined by methodologies and standards known in the field.
  • a “low risk MGI” is indicative of a "low risk” cancer, including breast cancer, that is analogous to that of a Grade I tumor as defined by methodologies and standards known in the field.
  • the stratification, or classification, of cancers into two groups is shown in Figure 1, panel C, and in Figure 4, panel B, where the level of risk identified by a "high risk MGI" is indicative of an increased likelihood of cancer recurrence, such as cancer metastases or distal recurrence of cancer, including recurrence of breast cancer. In many embodiments, this risk of recurrence is present regardless of treatment with or without tamoxifen or other endocrine therapies. In embodiments disclosed herein, the recurrence may be local recurrence of DCIS. The level of risk identified by a "low risk MGI" is indicative of reduced likelihood of cancer recurrence, including reduced likelihood of breast cancer recurrence.
  • the reduced risk of recurrence is present regardless of treatment with or without tamoxifen.
  • the risk of recurrence, or likelihood of no recurrence may be considered as risk over time, such as a period of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12 or more years. Therefore, the risk assessment provided by MGI may be used as a prognostic indicator of cancer recurrence and/or survival outcome for a subject.
  • the disclosure further includes the determination of a recurrence risk over time based upon the MGI value relative to the risk of recurrence determined by the methodologies described herein.
  • Figure 9 illustrates a non-limiting example of an MGI value of 2.1 and its indication of a 19% risk of cancer recurrence within 5 years. The figure further illustrates that the risk of recurrence is related to the value of the MGI, and that the selection of 0 (zero) as the threshold or cutoff value is non-limiting because other values may also be used.
  • the four possible assay outcomes are as follows: 1) "high risk MGI” and “high risk H:I” which may be considered “high risk” like a “high risk MGI” alone; 2) "high risk MGI” and “low risk H:I” which may be considered as analogous to an "intermediate risk” of cancer recurrence;
  • MGI and H:I thus identifies 3 different subtypes that have been observed to differ in their tumor biology and are associated with different patient outcomes.
  • an intermediate risk may be used to treat the patient with this tumor with endocrine therapy (such as tamoxifen as a non-limiting example) based on the prediction that the patient will benefit therefrom.
  • endocrine therapy such as tamoxifen as a non-limiting example
  • a patient with "high risk MGI” and "high risk H:I” is unlikely to benefit from endocrine mono-therapy. Therefore, the assessment does not represent a simple continuum of risk. This helps a skilled clinician because the assessment identifies the underlying biology which is helpful with respect to treatment choices. To make a choice of therapies, a clinician may determine that when patient is high risk (i.e.
  • MGI risk of recurrence despite treatment with tamoxifen
  • panels A and B where "high risk" MGI is used an indicator of recurrence despite treatment with tamoxifen as monotherapy.
  • a combination of MGI and H:I determinations may also be used to the same effect.
  • the disclosure further includes using MGI alone, H:I alone, or a combination of MGI and H:I to predict responsiveness to an inhibitor that targets endocrine resistant cancers as described herein.
  • the possible indication of non- responsive to endocrine therapy and responsiveness to the disclosed inhibitors may be combined with another aspect of the disclosure which is a method to select therapies based upon the prognostic and predictive indications determined by the disclosed methods.
  • embodiments of the disclosure include methods further including selecting, and optionally treating, the subject with the inhibitor to improve responsiveness to tamoxifen or another form of endocrine therapy.
  • the method further includes treatment with tamoxifen or other form of endocrine therapy.
  • the above description related to responsiveness to an inhibitor that targets endocrine resistant cancers may also be applied in cases of assaying for the H:I ratio alone as described herein.
  • the disclosure further includes assaying for a "high risk” MGI, optionally with an H:I determination, as an indicator of non-responsiveness to other forms of endocrine therapy, such as treatment with an SERM, an SERD, or an AL
  • a "low risk” MGI optionally with an H:I determination, as an indicator of responsiveness to tamoxifen and other SERMs as well as an SERD or an AL
  • endocrine therapy may also be used in relation to methods to select therapies as disclosed herein.
  • a method may include not selecting endocrine therapy in favor of other therapies such as chemotherapy and/or radiation therapy where lack of response is predicted.
  • the method may include selection of endocrine therapy where responsiveness is predicted.
  • the assay for a "high risk” MGI, "high risk” H:I, or a combination of MGI and H:I values may also be used as an indicator of relative responsiveness within endocrine therapy, such as better responsiveness to treatment with an AI relative to an SERM.
  • a "high risk” MGI value may be used as an indicator of responsiveness to an AI, such as letrozole, relative to tamoxifen.
  • the disclosure further includes a method of selecting treatment with an AI based upon such a prediction.
  • MGI alone, H:I alone, or a combination of MGI and H:I determinations may also be used to indicate non-responsiveness to chemotherapy.
  • "high risk" MGI is predictive of resistance to chemotherapy with paclitaxel, 5- fluorouracil, doxorubicin and cyclophosphamide as a non-limiting example.
  • the disclosure further includes a method of not selecting chemotherapy as the sole therapy in favor of other treatment modalities, such as radiation as a non-limiting example.
  • the disclosure includes determination of MGI alone, H:I alone, or a combination of MGI and H:I determinations as a predictor of a cancer's responsiveness (sensitivity) to radiation treatment.
  • a "high risk" MGI may be used to predict a cancer patient to be responsive to radiation treatment, such as after surgical intervention.
  • the method may further include identifying the subject as likely, or unlikely, to be responsive to radiation therapy after surgical intervention.
  • the disclosure further includes a method of selecting radiation therapy based upon prediction of responsiveness thereto.
  • the disclosure further includes a method of determining MGI alone, H:I alone, or a combination of MGI and H:I determinations as a prognostic factor or predictor of clinical responsiveness in pre-menopausal women and post-menopausal women.
  • Figure 12 shows the ability of a "high risk" MGI to stratify both classes of women based upon survival outcomes.
  • Post-menopausal women may be defined as those that are >50 years old while pre-menopausal women may be defined as those who are less than 50 years old.
  • "high risk" MGI is an indicator of increased likelihood of cancer recurrence over time relative to a "low risk” MGI.
  • the disclosure further includes a method of not selecting appropriate therapies for pre- and post-menopausal women based upon the MGI value, H:I value, or combination of both values determined from a sample from the woman.
  • a method to determine therapeutic treatment for a cancer patient may begin with assaying for MGI as described herein.
  • the determined value may be used to classify the cancer as corresponding to a Grade I or Grade III tumor, or identify the subject as having a prognosis of likely cancer recurrence, or having responsiveness or non-responsiveness to therapies as described herein.
  • the method may then include selecting treatment for a patient with such a tumor or such a prognosis or such responsiveness or non-responsiveness.
  • the selected treatment may include surgery and chemotherapy and/or radiation because the prognosis is poor and/or non-responsiveness to other therapies is indicated.
  • Further embodiments of the disclosure include a method of determining tumor grade or cancer risk in a subject diagnosed with benign cancer.
  • the method may include assaying a sample of breast cells from the subject for the expression levels of Bub IB, CENPA, NEK2, RACGAPl, and RRM2, wherein said expression levels are correlated with a Grade I or Grade III tumor or a "high risk” or "low risk” of cancer.
  • Embodiments of this method include determining the MGI value based on the expression levels, and optionally using it to select therapeutic treatment for the subject.
  • the disclosure includes a method of determining tumor grade, or risk of local cancer recurrence, in a subject diagnosed with DCIS.
  • the method may include assaying a sample of breast cancer cells from the subject for the expression levels of Bub IB, CENPA, NEK2, RACGAPl, and RRM2, wherein said expression levels are correlated with a Grade I or Grade III tumor or a "high risk” or "low risk” of local cancer recurrence.
  • the five genes of the MGI may be used singly with significant accuracy or in combination to increase the ability to accurately correlating a molecular expression phenotype with a tumor grade and/or cancer outcome.
  • This correlation is a way to molecularly provide for the determination of cancer recurrence and/or survival outcomes as disclosed herein. Additional uses of the correlated genes are in the classification of cells and tissues; determination of diagnosis and/or prognosis; and determination and/or alteration of therapy.
  • an assay may utilize any identifying feature of an identified individual gene as disclosed herein as long as the assay reflects, quantitatively or qualitatively, expression of the gene in the "transcriptome” (the transcribed fraction of genes in a genome) or the “proteome” (the translated fraction of expressed genes in a genome). Identifying features include, but are not limited to, unique nucleic acid sequences used to encode (DNA), or express (RNA), said gene or epitopes specific to, or activities of, a protein encoded by said gene. All that is required is the identity of the gene(s) necessary to discriminate between cancer outcomes and an appropriate cell containing sample for use in an expression assay.
  • the nature of the cell containing sample is not limiting, as fresh tissue, freshly frozen tissue, and fixed tissue, such as formalin-fixed paraffin-embedded (FFPE) tissues, may be used in the disclosed methods.
  • fresh tissue freshly frozen tissue
  • fixed tissue such as formalin-fixed paraffin-embedded (FFPE) tissues
  • the disclosure provides for the identification of the gene expression patterns by analyzing global, or near global, gene expression from single cells or homogenous cell populations which have been dissected away from, or otherwise isolated or purified from, contaminating cells beyond that possible by a simple biopsy. Because the expression of numerous genes fluctuate between cells from different patients as well as between cells from the same patient sample, the levels of gene expression may be determined in correspondence to one or more "control" or "normalization” genes, the expression(s) of which are relatively constant in the cells of a patient or between patients.
  • the disclosure includes physical and methodological means for detecting the expression of gene(s) identified by the models generated by individual expression patterns. These means may be directed to assaying one or more aspect of the DNA template(s) underlying the expression of the gene(s), of the RNA used as an intermediate to express the gene(s), or of the proteinaceous product expressed by the gene(s).
  • One advantage provided by the disclosure is that contaminating, non-cancer cells (such as infiltrating lymphocytes or other immune system cells) are not present to possibly affect the genes identified or the subsequent analysis of gene expression to identify the cancer recurrence and/or survival outcomes of patients. Such contamination is present where a biopsy containing many cell types is used to assay gene expression profiles. While the present disclosure is described mainly in the context of human cancer, such as breast cancer, it may be practiced in the context of cancer of any animal. Preferred animals for the application of the present disclosure are mammals, particularly those important to agricultural applications (such as, but not limited to, cattle, sheep, horses, and other "farm animals"), animal models of cancer, and animals for human companionship (such as, but not limited to, dogs and cats).
  • the methods provided by the disclosure may also be automated in whole or in part.
  • kits comprising agents for the detection of expression of the disclosed genes for grading tumors or determining cancer outcomes.
  • kits optionally comprise the agent with an identifying description or label or instructions relating to their use in the methods of the present disclosure.
  • kit may comprise containers, each with one or more of the various reagents (typically in concentrated form) utilized in the methods, including, for example, pre-fabricated microarrays, buffers, the appropriate nucleotide triphosphates (e.g., dATP, dCTP, dGTP and dTTP; or rATP, rCTP, rGTP and UTP), reverse transcriptase, DNA polymerase, RNA polymerase, and one or more primer complexes of the present disclosure (e.g., appropriate length poly(T) or random primers linked to a promoter reactive with the RNA polymerase).
  • the appropriate nucleotide triphosphates e.g., dATP, dCTP, dGTP and dTTP; or rATP, rCTP, rGTP and UTP
  • reverse transcriptase e.g., DNA polymerase, RNA polymerase
  • primer complexes of the present disclosure e.g., appropriate
  • GSE3494 Two public and previously published microarray datasets (accessions GSE3494, GSE1456) were downloaded from Gene Expression Omnibus (GEO, http://ncbi.nih.gov/geo).
  • GSE3494 Uppsala cohort
  • Miller LD Smeds J, George J, et al Proc Natl Acad Sci U S A 102:13550-5, 2005.
  • Clinical outcome data (breast cancer- specific death) were available for 236 patients with a median follow-up of 10 years.
  • GSE1456 (Stockholm cohort) consists of a similar series of 159 breast cancer patients treated at the Karolinska Hospital, Sweden from 1994 to 199614. Both GSE3494 and GSE1456 contain gene expression data from frozen tumor samples analyzed on the Affymetrix U133A and U133B arrays (Affymetrix, Santa Clara, CA).
  • a second cohort of 239 patients used a retrospective case-cohort design (Pawitan Y, Bjohle J, Amler L, et al Breast Cancer Res 7:R953-64, 2005) and was derived from 683 stage I to stage III patients with estrogen receptor-positive breast cancer treated at the Massachusetts General Hospital from 1991 to 1999.
  • Clinical follow-up data were obtained from tumor registry and hospital records. Cases were all patients who developed distant metastasis during follow-up; controls were randomly selected from patients who remained disease-free at last follow-up to achieve a 2:1 ratio of controls to cases. In addition, controls were frequency- matched to cases with respect to adjuvant therapy and time of diagnosis. For about 80% of the cases and controls, both clinical outcome data and formalin-fixed paraffin-embedded (FFPE) tumor blocks were retrieved successfully.
  • FFPE formalin-fixed paraffin-embedded
  • the final cohort consisted of 79 cases and 160 controls, and its patient and tumor characteristics were summarized in Table 1. This study was approved by local Institutional Review Boards. This last cohort consisted of 84 of the Oxford series described previously (Loi S, Haibe-Kains B, Desmedt C, et al: Definition of clinically distinct molecular subtypes in estrogen receptor-positive breast carcinomas through genomic grade. J Clin Oncol 25:1239-46, 2007). All patients had estrogen receptor-positive breast cancer and were lymph node-negative and treated with tamoxifen adjuvant monotherapy. This study used portions of the total RNA from previously isolated frozen tumor samples.
  • RNA extraction was performed as described before (Ma et al., id.).
  • the cycling threshold numbers were normalized to the mean CT of four reference genes (ACTB, HMBS, SDHA and UBC). The use of these genes is supported by the previous reports regarding these genes and representative sequences of each of these genes known to the skilled person. Normalized CTs were taken to represent relative gene expression levels.
  • the expression levels of the disclosed genes are combined to form a single index that serves as a strong prognostic factor and predictor of clinical outcome(s).
  • the index is a summation of the expression levels of the genes used and uses coefficients determined from principle component analysis to combine cases of more than one disclosed gene into a single index.
  • the coefficients are determined by factors such as the standard deviation of each gene's expression levels across a representative dataset, and the expression value for each gene in each sample.
  • the representative dataset is quality controlled based upon the average expression values for reference gene(s) as disclosed herein. For example, 1
  • the HOXB13:IL17BR ratio was calculated as the difference in standardized expression levels between HOXB 13 and IL17BR as described previously (Ma et al., id.).
  • the means and standard deviations for HOXB 13 and IL17BR used for standardizing the Table 1 cohort were derived from an analysis of 190 FFPE tissue sections from a separate population-based cohort of estrogen receptor-positive lymph node-negative breast cancer patients.
  • Genomic Grade Index was calculated from microarray data using the 128 Affymetrix probe sets representing 97 genes and scaled within each dataset to have a mean of - 1 for grade 1 tumors and +1 for grade 3 tumors as described previously (Sotiriou et al., supra).
  • H/I CUT-POINT The cutpoint of 0.06 for the HOXB13:IL17BR ratio, previously defined to stratify patients treated with adjuvant tamoxifen into low and high risk of recurrence, was applied directly in this study.
  • MGI CUT-POINT The calculation and the cutpoint for MGI were defined without using any clinical outcome data and instead was a natural cutpoint.
  • Initial analysis of MGI in the Uppsala cohort indicated good discrimination of grade 1 and grade 3 tumors using the mean (0) as cutpoint, and model-based clustering of MGI also indicated a bimodal distribution with a natural cutpoint around 0. This cutpoint was further supported by receiver operating characteristic (ROC) analysis.
  • ROC receiver operating characteristic
  • GGI GENOMIC GRADE INDEX
  • Proportional hazards (PH) assumption was checked by scaled Schoenfeld residuals; variables violating PH assumption were adjusted for in the model through stratification.
  • PH Proportional hazards
  • Example II Prognostic performance of MGI in breast cancer patients
  • MGI 97-gene genomic grade index
  • ROC analysis indicated that MGI and GGI were comparable in discriminating grade 1 and grade 3 tumors (Fig. 2).
  • MGI performed consistently as a strong prognostic factor comparable to or exceeding much more complex signatures.
  • Example III Development and validation of an RT-PCR assay for MGI
  • Primers and probes for the 5 MGI genes were designed for the TaqMan real-time PCR (RT-PCR) assay format (Table 2). Table 2. Primer and probes sequences for molecular grade index genes
  • NEK2 CCCATGAGCCATGCCTTTC AGTACACATGATATTTCG GTTGCTGAAGAACAGTAAAACCAATT RACGAP1 GGCATCCCAACTAACAATAAAGAG TATAAGGGAAGATTGTCAAT ATGACTGTAGCTTTTCTTACCACAAA RRM2 CCTTTAACCAGCACAGCCAGTT AAAGATGCAGCCTCA CATTAAAATCTGCGTTGAAGCA
  • RNA samples from formalin-fixed paraffin-embedded (FFPE) specimens (Cronin M, Pho M, Dutta D, et al: Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay. Am J Pathol 164:35-42, 2004), which are the most common sample type in the clinical setting.
  • FFPE formalin-fixed paraffin-embedded
  • the RT-PCR-based MGI also accurately discriminated grade 1 and grade 3 tumors (86% accuracy) using the same cutpoint of 0 as described before (Fig. 4, part A).
  • Kaplan-Meier analysis indicated that high MGI was significantly associated with high risk of distant metastasis irrespective of nodal status (Fig. 4, parts B-D).
  • MGI remained highly significant with a hazard ratio of 4.7 (2.1- 10.8) (Table 3).
  • MGI as determined by RT-PCR maintained its high correlation with tumor grade and its robust prognostic performance in an entirely independent cohort.
  • Example IV Complementary prognostic value of MGI and HOXB13:IL17BR
  • Tumor Size >2cm vs. ⁇ 2cm 1.0 0.3 - 2.9 0.9804
  • MGI and the H:I ratio provided additional prognostic information to each other, and combining both indexes was particularly effective in identifying a subset of patients (-30%) with very poor outcome despite endocrine therapy, indicating a need of additional therapies for these patients.
  • Example V Differential correlation of HOXB13:IL17BR and MGI with ER and PR expression
  • HOXB 13 and IL17BR are both regulated by estrogen receptor. HOXB 13 expression is suppressed while IL17BR expression is stimulated by estrogen in ER+ breast cancer cell lines (Zuncai W, Dahiya S, Provencher H, et al: The prognostic biomarkers HOXB 13, IL17BR and CHDH are regulated by estrogen in breast cancer. Clin Cancer Res, 2007). So the expression of the 5-genes in MGI was tested for possible similar regulation by estrogen signaling. In the ER+ node-negative endocrine-treated patient group analyzed above, where high H:I was strongly correlated with lower PR expression, MGI was not significantly associated with either ER or PR mRNA expression (Fig. 6).
  • the high risk group was associated with poor PR expression.
  • H:I ratio and MGI likely represent distinct biological pathways, which may explain their usefulness in determining tumor aggressiveness when used together.
  • Example VI MGI is significantly associated with pCR
  • MGI pathological complete response

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/US2008/075528 2007-09-06 2008-09-06 Tumor grading and cancer prognosis Ceased WO2009108215A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
JP2010524215A JP2010538609A (ja) 2007-09-06 2008-09-06 腫瘍グレード分類と癌の予後診断
CA2698569A CA2698569A1 (en) 2007-09-06 2008-09-06 Tumor grading and cancer prognosis
EP08872935.5A EP2195467B1 (en) 2007-09-06 2008-09-06 Tumor grading and cancer prognosis in breast cancer
ES08872935T ES2618353T3 (es) 2007-09-06 2008-09-06 Clasificación de tumores y pronóstico del cáncer de mama
CN200880114588.6A CN102395682B (zh) 2007-09-06 2008-09-06 肿瘤分级和癌症预后
US12/718,973 US9447470B2 (en) 2007-09-06 2010-03-06 Tumor grading and cancer prognosis
US15/807,456 US11021754B2 (en) 2007-09-06 2017-11-08 Tumor grading and cancer prognosis
US17/239,207 US12492432B2 (en) 2007-09-06 2021-04-23 Tumor grading and cancer prognosis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US97052907P 2007-09-06 2007-09-06
US60/970,529 2007-09-06

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/718,973 Continuation-In-Part US9447470B2 (en) 2007-09-06 2010-03-06 Tumor grading and cancer prognosis

Publications (1)

Publication Number Publication Date
WO2009108215A1 true WO2009108215A1 (en) 2009-09-03

Family

ID=40790735

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/075528 Ceased WO2009108215A1 (en) 2007-09-06 2008-09-06 Tumor grading and cancer prognosis

Country Status (7)

Country Link
US (3) US9447470B2 (https=)
EP (1) EP2195467B1 (https=)
JP (2) JP2010538609A (https=)
CN (1) CN102395682B (https=)
CA (1) CA2698569A1 (https=)
ES (1) ES2618353T3 (https=)
WO (1) WO2009108215A1 (https=)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010151731A1 (en) * 2009-06-26 2010-12-29 University Of Utah Research Foundation Materials and methods for the identification of drug-resistant cancers and treatment of same
US20120269419A1 (en) * 2011-04-22 2012-10-25 Ge Global Research Analyzing the expression of biomarkers in cells with moments
WO2013173756A1 (en) 2012-05-18 2013-11-21 University Of North Dakota A method for quantifying proteins and isoforms thereof
WO2013190081A1 (en) * 2012-06-22 2013-12-27 Proyecto De Biomedicina Cima, S.L. Methods and reagents for the prognosis of cancer
WO2015038682A1 (en) 2013-09-11 2015-03-19 bio Theranostics, Inc. Predicting breast cancer recurrence
WO2015184182A1 (en) * 2014-05-29 2015-12-03 Biotheranostics, Inc Predicting likelihood of response to combination therapy
EP2852689A4 (en) * 2012-05-22 2016-05-11 Nanostring Technologies Inc NANO46 GENES AND METHOD FOR PREDICTING BREAST CANCER RESULTS
US9856533B2 (en) 2003-09-19 2018-01-02 Biotheranostics, Inc. Predicting breast cancer treatment outcome
US10329624B2 (en) 2001-12-21 2019-06-25 Biotheranostics, Inc. Grading of breast cancer
WO2020037203A3 (en) * 2018-08-17 2020-03-26 Genentech, Inc. Diagnostic and therapeutic methods for the treatment of breast cancer
US11078538B2 (en) 2010-12-09 2021-08-03 Biotheranostics, Inc. Post-treatment breast cancer prognosis
WO2022080598A1 (ko) * 2020-10-16 2022-04-21 고려대학교 산학협력단 유방암 초음파 영상을 이용한 dna 유전자 정보를 제공하는 방법
US11530448B2 (en) 2015-11-13 2022-12-20 Biotheranostics, Inc. Integration of tumor characteristics with breast cancer index

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK1899484T3 (da) * 2005-06-03 2015-11-23 Biotheranostics Inc Identifikation af tumorer og væv
CA2923166A1 (en) * 2013-09-09 2015-03-12 British Columbia Cancer Agency Branch Methods and kits for predicting outcome and methods and kits for treating breast cancer with radiation therapy
CN107119055A (zh) * 2017-05-18 2017-09-01 南京中医药大学 分子标志物bub1b基因及其应用
CN110021433B (zh) * 2017-08-30 2023-11-17 中山大学 一种用于精准预测胃肠胰神经内分泌肿瘤患者预后的系统
CN109706160A (zh) * 2019-02-22 2019-05-03 广西医科大学 重组人蛋白激酶Nek2蛋白表达和纯化方法
KR102405973B1 (ko) 2019-09-20 2022-06-07 고려대학교 산학협력단 유방암 초음파 영상과 유전자 정보를 이용한 유방암 치료법 선택을 위한 정보를 제공하는 방법
CN115029437A (zh) * 2022-04-28 2022-09-09 深圳市陆为生物技术有限公司 检测样本中生物标志物的试剂在制备乳腺癌患者化疗响应评估产品中的应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005008213A2 (en) * 2003-07-10 2005-01-27 Genomic Health, Inc. Expression profile algorithm and test for cancer prognosis
US20050079518A1 (en) * 2003-06-24 2005-04-14 Baker Joffre B. Prediction of likelihood of cancer recurrence
WO2006119593A1 (en) * 2005-05-13 2006-11-16 Universite Libre De Bruxelles Gene-based algorithmic cancer prognosis
WO2006132971A2 (en) * 2005-06-03 2006-12-14 Aviaradx, Inc. Identification of tumors and tissues

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5545522A (en) 1989-09-22 1996-08-13 Van Gelder; Russell N. Process for amplifying a target polynucleotide sequence using a single primer-promoter complex
AU1820100A (en) 1998-11-13 2000-06-05 Pro Duct Health, Inc. Devices and methods to identify ductal orifices during nipple aspiration
US20030228575A1 (en) * 2001-01-31 2003-12-11 Yuk Ming Dennis Lo Combination of circulating epstein-barr virus (EBV) DNA in the serum or plasma of patients and a method to assess EBV subtypes for the prediction and detection of epstein-barr virus associated cancers
WO2002092854A2 (en) * 2001-05-16 2002-11-21 Novartis Ag Genes expressed in breast cancer as prognostic and therapeutic targets
WO2002101357A2 (en) * 2001-06-10 2002-12-19 Irm Llc Molecular signatures of commonly fatal carcinomas
US20030198972A1 (en) * 2001-12-21 2003-10-23 Erlander Mark G. Grading of breast cancer
US20090252721A1 (en) * 2003-09-18 2009-10-08 Thomas Buschmann Differentially expressed tumour-specific polypeptides for use in the diagnosis and treatment of cancer
US9856533B2 (en) 2003-09-19 2018-01-02 Biotheranostics, Inc. Predicting breast cancer treatment outcome
CA2539107A1 (en) * 2003-09-19 2005-03-31 Arcturus Bioscience, Inc. Predicting breast cancer treatment outcome
US7504214B2 (en) 2003-09-19 2009-03-17 Biotheranostics, Inc. Predicting outcome with tamoxifen in breast cancer
US7498693B2 (en) 2004-02-18 2009-03-03 Diversified Technologies, Inc. More compact and higher reliability power source system

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050079518A1 (en) * 2003-06-24 2005-04-14 Baker Joffre B. Prediction of likelihood of cancer recurrence
WO2005008213A2 (en) * 2003-07-10 2005-01-27 Genomic Health, Inc. Expression profile algorithm and test for cancer prognosis
WO2006119593A1 (en) * 2005-05-13 2006-11-16 Universite Libre De Bruxelles Gene-based algorithmic cancer prognosis
WO2006132971A2 (en) * 2005-06-03 2006-12-14 Aviaradx, Inc. Identification of tumors and tissues

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHNG WEE-JOO ET AL: "A gene expression based centrosome index is a powerful prognostic factor in myeloma.", BLOOD, vol. 108, no. 11, Part 1, November 2006 (2006-11-01), & 48TH ANNUAL MEETING OF THE AMERICAN-SOCIETY-OF-HEMATOLOGY; ORLANDO, FL, USA; DECEMBER 09 -12, 2006, pages 967A, XP008107886, ISSN: 0006-4971 *
ESTHER ROBERT ET AL: "Impaired Bub1B mRNA expression is associated with osteogenic sarcoma.", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL MEETING, vol. 46, April 2005 (2005-04-01), & 96TH ANNUAL MEETING OF THE AMERICAN-ASSOCIATION-FOR-CANCER-RESEARCH; ANAHEIM, CA, USA; APRIL 16 -20, 2005, pages 1052, XP001537154, ISSN: 0197-016X *
SCINTU ET AL: "Genomic instability and increased expression of BUB1B and MAD2L1 genes in ductal breast carcinoma", CANCER LETTERS, NEW YORK, NY, US, vol. 254, no. 2, 31 July 2007 (2007-07-31), pages 298 - 307, XP022182291, ISSN: 0304-3835 *
YAMAMOTO ET AL: "Overexpression of BUBR1 is associated with chromosomal instability in bladder cancer", CANCER GENETICS AND CYTOGENETICS, ELSEVIER SCIENCE PUBLISHING, NEW YORK, NY, US, vol. 174, no. 1, 13 March 2007 (2007-03-13), pages 42 - 47, XP022001607, ISSN: 0165-4608 *

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10329624B2 (en) 2001-12-21 2019-06-25 Biotheranostics, Inc. Grading of breast cancer
US9856533B2 (en) 2003-09-19 2018-01-02 Biotheranostics, Inc. Predicting breast cancer treatment outcome
WO2010151731A1 (en) * 2009-06-26 2010-12-29 University Of Utah Research Foundation Materials and methods for the identification of drug-resistant cancers and treatment of same
US20210355550A1 (en) * 2010-12-09 2021-11-18 Biotheranostics, Inc. Post-treatment breast cancer prognosis
US11078538B2 (en) 2010-12-09 2021-08-03 Biotheranostics, Inc. Post-treatment breast cancer prognosis
US12460265B2 (en) 2010-12-09 2025-11-04 Biotheranostics, Inc. Post-treatment breast cancer prognosis
US20120269419A1 (en) * 2011-04-22 2012-10-25 Ge Global Research Analyzing the expression of biomarkers in cells with moments
WO2013173756A1 (en) 2012-05-18 2013-11-21 University Of North Dakota A method for quantifying proteins and isoforms thereof
US9470693B2 (en) 2012-05-18 2016-10-18 University Of North Dakota Method for quantifying proteins and isoforms thereof
EP2852689A4 (en) * 2012-05-22 2016-05-11 Nanostring Technologies Inc NANO46 GENES AND METHOD FOR PREDICTING BREAST CANCER RESULTS
WO2013190081A1 (en) * 2012-06-22 2013-12-27 Proyecto De Biomedicina Cima, S.L. Methods and reagents for the prognosis of cancer
EP3044335A4 (en) * 2013-09-11 2017-04-19 Bio Theranostics, Inc. Predicting breast cancer recurrence
WO2015038682A1 (en) 2013-09-11 2015-03-19 bio Theranostics, Inc. Predicting breast cancer recurrence
WO2015184182A1 (en) * 2014-05-29 2015-12-03 Biotheranostics, Inc Predicting likelihood of response to combination therapy
US10253369B2 (en) 2014-05-29 2019-04-09 Biotheranostics, Inc. Predicting likelihood of response to combination therapy
US11530448B2 (en) 2015-11-13 2022-12-20 Biotheranostics, Inc. Integration of tumor characteristics with breast cancer index
US12215390B2 (en) 2015-11-13 2025-02-04 Biotheranostics, Inc. Integration of tumor characteristics with breast cancer index
US11081236B2 (en) 2018-08-17 2021-08-03 Genentech, Inc. Diagnostic and therapeutic methods for the treatment of breast cancer
WO2020037203A3 (en) * 2018-08-17 2020-03-26 Genentech, Inc. Diagnostic and therapeutic methods for the treatment of breast cancer
US11676731B2 (en) 2018-08-17 2023-06-13 Genentech, Inc. Diagnostic and therapeutic methods for the treatment of breast cancer
IL280707B1 (en) * 2018-08-17 2025-11-01 Hoffmann La Roche Diagnostic and therapeutic methods for the treatment of breast cancer
IL280707B2 (en) * 2018-08-17 2026-03-01 Hoffmann La Roche Diagnostic and therapeutic methods for treating breast cancer
WO2022080598A1 (ko) * 2020-10-16 2022-04-21 고려대학교 산학협력단 유방암 초음파 영상을 이용한 dna 유전자 정보를 제공하는 방법

Also Published As

Publication number Publication date
US12492432B2 (en) 2025-12-09
CN102395682A (zh) 2012-03-28
JP2015057055A (ja) 2015-03-26
CN102395682B (zh) 2015-09-30
US11021754B2 (en) 2021-06-01
ES2618353T3 (es) 2017-06-21
EP2195467B1 (en) 2016-12-14
US20180291461A1 (en) 2018-10-11
US9447470B2 (en) 2016-09-20
CA2698569A1 (en) 2009-09-03
EP2195467A1 (en) 2010-06-16
JP2010538609A (ja) 2010-12-16
US20210371934A1 (en) 2021-12-02
US20110136680A1 (en) 2011-06-09

Similar Documents

Publication Publication Date Title
US12492432B2 (en) Tumor grading and cancer prognosis
US12460265B2 (en) Post-treatment breast cancer prognosis
CN101356532B (zh) 基于基因的算法型癌症预后
WO2010003773A1 (en) Algorithms for outcome prediction in patients with node-positive chemotherapy-treated breast cancer
EP2297359A1 (en) Gene expression profiles to predict breast cancer outcomes
EP2121988B1 (en) Prostate cancer survival and recurrence
IL276505A (en) Determining recurrence of breast cancer
CN107614696A (zh) 基因表现图谱以及将其应用于乳癌医疗之方法
US10253369B2 (en) Predicting likelihood of response to combination therapy
US20180051342A1 (en) Prostate cancer survival and recurrence
US20260125764A1 (en) Post-treatment breast cancer prognosis
HK1197803A (en) Post-treatment breast cancer prognosis
AU2014318859A1 (en) Predicting breast cancer recurrence
HK1127413A (en) Gene-based algorithmic cancer prognosis

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880114588.6

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08872935

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2698569

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2010524215

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2008872935

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2008872935

Country of ref document: EP