WO2009068668A1 - New therapeutic approaches for treating cmt and related disorders - Google Patents
New therapeutic approaches for treating cmt and related disorders Download PDFInfo
- Publication number
- WO2009068668A1 WO2009068668A1 PCT/EP2008/066468 EP2008066468W WO2009068668A1 WO 2009068668 A1 WO2009068668 A1 WO 2009068668A1 EP 2008066468 W EP2008066468 W EP 2008066468W WO 2009068668 A1 WO2009068668 A1 WO 2009068668A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- compound
- cas
- drug
- pmp22
- ketoprofen
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
- A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid, pantothenic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/20—Pills, tablets, discs, rods
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
- A61K31/047—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates having two or more hydroxy groups, e.g. sorbitol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/485—Morphinan derivatives, e.g. morphine, codeine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7004—Monosaccharides having only carbon, hydrogen and oxygen atoms
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0087—Galenical forms not covered by A61K9/02 - A61K9/7023
- A61K9/0095—Drinks; Beverages; Syrups; Compositions for reconstitution thereof, e.g. powders or tablets to be dispersed in a glass of water; Veterinary drenches
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/08—Solutions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/4841—Filling excipients; Inactive ingredients
- A61K9/4866—Organic macromolecular compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/02—Drugs for disorders of the nervous system for peripheral neuropathies
Definitions
- the present invention relates to compositions and methods for the treatment of the Charcot-Marie-Tooth disease and related disorders.
- CMT Charcot-Marie-Tooth disease
- CMT Charcot-Marie-Tooth disease
- PMP22 protein is not only the structural component of myelin sheaths, but also as an important regulatory protein, influencing multiple phenotypic traits in Schwann cells.
- the exact mechanism linking abnormal level of the protein to a modification of its functions in a mutant CMTlA glia cell is not completely understood, but some cellular mechanisms potentially explaining its detrimental effects on Schwann cell biology are starting to emerge.
- the purpose of the present invention is to provide new therapeutic approaches for treating CMT and related disorders.
- the invention also relates to compositions and methods for modulation of PMP22 expression in a subject.
- the inventors have identified various pathways which can be regulated in a subject to ameliorate CMT and related disorders.
- the inventors have also identified several drugs which, in combination(s) or alone, can effectively affect such pathways leading to CMT and related disorders, and represent new therapy for the treatment of these disorders.
- the invention therefore provides novel compositions and methods for treating CMT disease and related disorders.
- An object of this invention more specifically relates to the use of combinations of compounds for (the manufacture of a medicament for) treating CMT or a related disorder, wherein said compounds are selected from a GABA-B receptor agonist, a muscarinic receptor agonist, an antagonist of a steroid hormone receptor, a drug affecting the D-sorbitol signalling pathways, an opioid receptor antagonist or partial agonist, a thyroid hormone signalling inhibitor, an ERK (extracellular signal-regulated kinase) activator and a pAkt kinase inhibitor, a COX inhibitor, and any combination(s) thereof.
- the compound may be a drug or an antibody (or a fragment or derivative thereof), a protein or a peptide.
- An other object of the invention relates to the use of combinations of compounds selected from: compound A: D-Sorbitol (CAS 50-70-4) and its possible salts, prodrugs and derivatives; compound B: Baclofen (CAS 1134-47-0 and CAS 63701-56-4 for baclofen - hydrochloride) and its possible salts, prodrugs and derivatives; compound C: Pilocarpine (CAS 92-13-7 and CAS 54-71-7 for pilocarpine hydrochloride) and its possible salts, prodrugs and derivatives; compound D: Naltrexone (CAS 16590-41-3 and CAS 16676-29-2 for naltrexone hydrochloride) and its possible salts, prodrugs and derivatives; compound E: Methimazole (CAS 60-56-0) and its possible salts and derivatives;compound F: Mifepristone (CAS 84371-65-3) and its possible salts , prodrugs and derivatives; Montelukast (CAS 1589
- An other object of the invention relates to the use of a compound selected from Acetazolamide (CAS 59-66-5 and CAS 1424-27-7 for sodium form) and its possible salts and derivatives; Aminoglutethimide (CAS 125-84-8) and its possible salts and derivatives; Aztreonam (CAS 78110-38-0 and CAS 80581-86-8 exists for Aztreonam disodium) and its possible salts and derivatives; Baclofen (CAS 1134-47-0 and CAS 63701-56-4 for baclofen - hydrochloride) and its possible salts, prodrugs and derivatives; Balsalazide (CAS 80573-04-2, 150399-21-6 (disodium form), 213594-60-6 (disodium form), and 82101-18-6) and its possible salts and derivatives; Bicalutamide (CAS 90357-06-5) and its possible salts and derivatives; Bromocriptine (CAS 25614- 03-3 and CAS
- a further object of this invention relates to the use of a combination of at least two compounds selected from D-Sorbitol (compound A); Baclofen (compound B); Pilocarpine (compound C); Naltrexone (compound D); Methimazole (compound E); Mifepristone (compound F), and Ketoprofen (compound G), or salts or prodrugs thereof, for the (manufacture of a medicament for the) treatment of CMT or a related disorder.
- a further object of this invention relates to the use of a compound selected from D-Sorbitol (compound A); Baclofen (compound B); Pilocarpine (compound C); Naltrexone (compound D); Methimazole (compound E); Mifepristone (compound F), and Ketoprofen (compound G), or salts or prodrugs thereof, for the (manufacture of a medicament for the) treatment of CMT or a related disorder.
- Sorbitol (compound A); Baclofen (compound B); Pilocarpine (compound C);
- Naltrexone compound D
- Methimazole compound E
- Mifepristone compound F
- Ketoprofen compound G
- salts, prodrugs or agonists thereof for the (manufacture of a medicament for the) treatment of CMT or a related disorder.
- a further object of this invention relates to the use of a combination of at least two compounds selected from Acetazolamide; Aminoglutethimide; Aztreonam; Baclofen
- Balsalazide Balsalazide; Bicalutamide; Bromocriptine; Bumetanide; Buspirone; Ciprofloxacin; Clonidine; Cyclosporine A; Disulfiram; Exemestane; Felbamate; Fenof ⁇ brate;
- Tamoxifen Trilostane; Valproic acid; Carbamazepine; Ketoprofen; Flurbiprofen;
- Diclofenac Meloxicam; D-Sorbitol; Tacrolimus; Diazepam; Dutasteride; Indomethacin;
- An other object of the invention relates to the use of a combination of at least two compounds selected from D-Sorbitol (compound A); Baclofen (compound B);
- Pilocarpine (compound C); Naltrexone (compound D); Methimazome (compound E); Mifepristone (compound F), Ketoprofen (compound G) or salts, prodrugs or agonists thereof, for (the manufacture of a medicament for) reducing PMP22 expression in a subject having CMT or a related disorder.
- An other object of the invention relates to the use of a combination of at least two compounds selected from Acetazolamide; Aminoglutethimide; Aztreonam; Baclofen Balsalazide; Bicalutamide; Bromocriptine; Bumetanide; Buspirone; Ciprofloxacin;
- Clonidine Cyclosporine A; Disulfiram; Exemestane; Felbamate; Fenof ⁇ brate;
- a further object of this invention is a pharmaceutical composition
- a pharmaceutical composition comprising a combination of at least two compounds selected from the group of D-Sorbitol, Baclofen, Pilocarpine, Naltrexone, Methimazole, Mifepristone and Ketoprofen, salts or prodrugs thereof, and a pharmaceutically suitable excipient.
- a further object of this invention resides in the use of a combination of drugs for treating CMT or a related disorder, wherein said combination is selected from:
- a pAkt kinase inhibitor and a drug affecting thyroid hormone signalling; a compound selected from a drug affecting the sorbitol signalling pathways, an opioid receptor antagonist and Cox inhibitor;
- the invention concerns the use of the above compounds or compositions or combinations for the treatment of CMT.
- the invention further provides a method for treating CMT or a related disorder, particularly CMT, comprising administering to a subject in need thereof an effective amount of any compound or combination of compounds or composition as disclosed above.
- a preferred method comprises the administration of a combination of at least two compounds selected from compound A, compound B, compound C, compound D, compound E, compound F, and compound G, or salts or prodrugs thereof.
- a specific object of this invention is a method of treating CMTIa in a subject, comprising administering to the subject an effective amount of a compound or combination of compounds as disclosed above.
- a further object of this invention is a method of treating CMT, particularly CMTIa, the method comprising (1) assessing whether a subject has CMT, particularly CMTIa and (2) treating the subject having CMT, particularly CMTIa with an effective amount of a combination of compounds as described above. Determining whether a subject has CMT, particularly CMTIa, can be done by various tests known per se in the art, such as DNA assays. Such diagnosis can be made, e.g. by assessing expression or function of PMP22 in (a sample from) the patient prior and during to therapy.
- a further object of this invention is a composition comprising PMP22 or a PMP22 fragment as an immunogen for the vaccination of patients.
- a further object of this invention is a vaccine comprising an anti-PMP22 antibody, or a fragment or derivative of such antibody.
- the invention may be used for treating CMT or a related disorder in any mammalian subject, particularly human subjects, more preferably CMTIa.
- Figure 1 Effect of selected drugs on PMP22 mRNA expression level.
- Figure 2. Effect of selected drugs on PMP22 mRNA expression level.
- Figure 3. Effect of selected drugs at various doses on PMP22 mRNA expression level.
- Figure 4. Effect of selected drugs on PMP22 protein expression level.
- Figure 6 Results of the motor assessment of the female rats in the Bar-test throughout the treatment study presented in form of trends.
- A Methimazole ;
- B Pilocarpine.
- Figure 7 The mean bar-test performances recorded in this test after 16 weeks of treatment.
- Figure 8 Electrophysiological assessment of the sensitive nerve potential amplitude in CMT rats treated with drugs during 20 weeks.
- the present invention provides new therapeutic approaches for treating CMT or related disorders.
- the invention discloses novel use of drugs or drug combinations which allow an effective correction of such diseases and may be used in any mammalian subject.
- CMT related disorder designates other diseases associated with abnormal expression, of myelin proteins which include PMP22.
- the variety of these diseases is due to the variety of PMP22 roles.
- PMP22 is firstly a major component of myelin expressed in the compact portion of essentially all myelinated fibers in the peripheral nervous system.
- PMP22 protein interacts with another structural myelin protein PO, and therefore, the altered PMP22/P0 protein ratio might influence the compaction of myelin sheaths (Vallat et al, 1996; D'Urso et al., 1999).
- PMP22 protein is also involved in the regulation of cell spreading in a Rho-dependent manner and thus could affect axonal ensheathment (Brancolini et al., 1999). Moreover, PMP22 forms complexes with ⁇ 6 ⁇ 4 integrins and could mediate the interaction of Schwann cells with extracellular matrix (Amici et al., 2006; Amici et al., 2007). Furthermore, increased level of PMP22 protein can alter the Arf6-regulated plasma membrane endosomal recycling pathway and lead to accumulation of PMP22 in the late endosomes (Chies et al., 2003).
- PMP22 is directly involved in the control of cell proliferation and programmed cell death (Sancho et al., 2001; Atanasoski et al., 2002) and mutant PMP22 protein was shown to provoke profound reorganization and the aberrant expression of axonal ion channels (Ulzheimer et al., 2004; Devaux & Scherer, 2005). PMP22 is also expressed in some parts of human brain (Ohsawa Y et al, 2006). There is evidence for its implication in mood disorders (Le- Niculescu H et al, 2008) and in schizophrenia (Dracheva S et al, 2006). PMP22 is playing a role in establishing brain/blood barrier (Roux KJ et al, 2004) that is often defective in multiple sclerosis and neurodegenerative diseases.
- CMT related disorder designates Alzheimer's disease (AD), senile dementia of AD type (SDAT), Parkinson's disease, Lewis body dementia, vascular dementia, autism, mild cognitive impairment (MCI), age-associated memory impairment (AAMI) and problem associated with ageing, post-encephalitic Parkinsonism, schizophrenia, depression, bipolar disease and other mood disorders, Huntington's disease, motor neurone diseases including amyotrophic lateral sclerosis (ALS), multiple sclerosis, idiopathic neuropathies, diabetic neuropathy, toxic neuropathy including neuropathy induced by drug treatments, neuropathies provoked by HIV, radiation, heavy metals and vitamin deficiency states, prion-based neurodegeneration, including Creutzfeld- Jakob disease (CJD), bovine spongiform encephalopathy (BSE), GSS, FFI, Kuru and Alper's syndrome.
- CJD Creutzfeld- Jakob disease
- BSE bovine spongiform encephalopathy
- GSS FFI
- CMT related disorder designates a neuropathy, such as demyelinating neuropathies, including HNPP (hereditary neuropathy with liability to pressure palsies), CMTlB, CMTlC, CMTlD, CMTlX, CMT2A, CMT2B, CMT2D, CMT2E, CMT2-P0, severe demyelinating neuropathies DSS (Dejerine-Sottas syndrome), CHN (congenital hypomyelinating neuropathy), CMT4A, CMT4B1, CMT4B2, CMT4D, CMT4F, CMT4, AR-CMT2A, HSNl .
- HNPP hereditary neuropathy with liability to pressure palsies
- CMTlB CMTlC
- CMTlD CMTlX
- CMT2A CMT2B
- CMT2D CMT2E
- CMT2-P0 severe demyelinating neuropathies
- DSS Dejerine-Sottas syndrome
- CHN
- treatment includes the therapy, prevention, prophylaxis, retardation or reduction of pain provoked by the disorder.
- treatment includes in particular the control of disease progression and associated symptoms.
- the term compound designates the chemical compounds as specifically named in the application, as well as any pharmaceutically composition with acceptable salt, hydrate, ester, ether, isomers, racemate, conjugates, pro-drugs thereof.
- the term antibody designates a monoclonal or a polyclonal antibody.
- the term fragment designates, without limitation, an immunoglobulin chain, a Fab or Fab' fragment, or a CDR region.
- a derivative of an antibody includes single chain antibody, a humanized antibody, a chimeric antibody, etc. Antibody fragments or derivatives shall retain the epitope specificity of the antibody.
- the term "combination" designates a treatment wherein at least two drugs are co-administered to a subject to cause a biological effect.
- the at least two drugs may be administered together or separately, at the same time or sequentially. Also, the at least two drugs may be administered through different routes and protocols.
- peripheral myelin protein(s) can be modulated by drugs affecting muscarinic receptor, GABA-B receptor, steroid hormone receptor, opioid receptor, sorbitol signalling pathways, or activating ERK (extracellular signal-regulated kinase) , COX inhibitors, thyroid hormone signalling inhibitors and/or inhibiting pAkt kinase, thereby allowing the design of new therapeutic approaches of CMT and related disorders.
- drugs affecting muscarinic receptor, GABA-B receptor, steroid hormone receptor, opioid receptor, sorbitol signalling pathways, or activating ERK (extracellular signal-regulated kinase) , COX inhibitors, thyroid hormone signalling inhibitors and/or inhibiting pAkt kinase thereby allowing the design of new therapeutic approaches of CMT and related disorders.
- the invention discloses the identification and activities of particular drugs which, either in combination(s) or alone modulate the above pathways and may be used to treat said diseases.
- the invention shows that compound A, compound B, compound C, compound D, compound E, compound F and compound G, either in combination(s) or alone, preferably in combination, can be used to treat CMT or related disorders.
- This drug is a member of bladder irrigant, laxative and hyperosmotic classes. It has been approved for the treatment of i) Irrigation of Urinary Bladder (Adult) for preventing infection during prostate surgery or other urinary tract surgeries ii)
- Extracellular Signal-Regulated Kinase (ERK) and Akt pathways control expression of the PMP22 gene in the opposing manner: transcription of the PMP22 gene is enhanced by the activated PI3K/pAkt/GSK-3 ⁇ signalling pathway and is suppressed by the Ras/MEK/ERK kinase cascade.
- Compound A is able to activate ERK/JNK/p38 kinases and, probably, decreases expression of the PMP22 gene by modulating ERK kinase activity ((Bogoyevitch et al, 1995; Galvez et al, 2003).
- Misfolded PMP22 protein aggregations provoked by overexpression of PMP22 gene are the integral phenotypic characteristic of CMTlA Schwann cells and might affect intracellular membrane dynamics, protein sorting and degradation.
- D-sorbitol as a cellular osmolyte which possesses a chaperone activity, could additionally suppress deleterious effect of overexpressed PMP22 gene by augmenting capacity of intracellular machinery, implicated in protein folding and clearance (Fortun et al., 2005; Fortun et al., 2006; Welch & Brown, 1996).
- Compound A might also exert an enhanced effect via stimulation of muscarinic type 2 receptor to which compound A binds specifically. This leads to a decrease in PMP22 expression.
- compound A suppresses apoptosis and oxidative stress by feed back inhibition of aldose reductase pathway.
- D-Sorbitol is produced in aldose reductase metabolic pathway. Attenuation of aldose reductase gene suppresses apoptosis and oxidative stress in rat cells (Nambu H et al, 2008)
- Compound B is a direct agonist at GABA-B receptors. Its precise mechanism of action is not fully known. It is capable of inhibiting both monosynaptic and polysynaptic reflexes at the spinal level, possibly by hyperpolarization of afferent terminals, although actions at supraspinal sites may also occur and contribute to its clinical effect.
- GABA(B) receptor was shown to activate ERK1/2 kinases via GPCR interacting scaffolding protein (GISP) and thus could negatively regulate PI3K-Akt-GSK-3 ⁇ signalling pathway and activity of steroid hormone receptors implicated in positive transcriptional regulation of PMP22 gene in Schwann cells (Kantamneni et al., 2007; Lange et al., 2007; Miller et al.,2007; Tu et al., 2007). Additionally, GABAB receptors can - in a developmental context-dependent manner - decreases activity of GABAA receptors that are also recognized as positive modulators of PMP22 expression (Obrietan & van den Pol, 1998).
- GISP GPCR interacting scaffolding protein
- Ci 1Hi 6 N 2 O 2 has been approved for the treatment of i) symptoms of dry mouth from salivary gland hypo function caused by radiotherapy for cancer of the head and neck; and ii) the treatment of symptoms of dry mouth in patients with Sjogren's syndrom.
- Agonist of muscarinic receptors causes smooth muscle fibers contraction (digestive tract, eye, bronchus), stimulates sudoral, salivary, bronchus and gastric secretions. Furthermore, it exhibits a complex cardiovascular action, stimulating both parasympathomimetic (vasodilation) excitoganglionary pathways.
- muscarinic receptors can selectively block signalling by IGF-I mediated by pAkt/GSK-3 ⁇ functional module by promoting IRS-I tyrosine dephosphorylation, which uncouple IRS-I from the stimulated IGF-I receptor (Batty et al., 2004; Stirnweiss et al., 2006).
- This drug has been approved for the treatment of alcohol dependence and for the blockade of the effects of exogenously administered opioids.
- This drug binds to the opioid mu receptor antagonistically, thereby preventing conventional opiate (heroin, morphine) drugs from binding and inducing opioid neural responses. It markedly attenuates or completely blocks, reversibly, the subjective effects of intravenously administered opioids. When co-administered with morphine, on a chronic basis, it blocks the physical dependence to morphine, heroin and other opioids.
- Extracellular Signal-Regulated Kinase (ERK) and Akt pathways control expression of the PMP22 gene in the opposing manner: transcription of the PMP22 7
- Schwann cells express, though at low levels, all types of opioid and sigma receptors and their natural ligands prodynorphin and proenkephalin, - an observation indicating that an autocrine opioid signalling could play an important role in biology of these glial cells. Signalling through opioid receptors is extremely complex and varies between acute and chrocnic agonist application modes. We suggest that naltrexone might attenuate activation of pAkt kinase and down-regulation of Erk kinase-mediated signalling, provoked, - as it was demonstrated for some neuronal cells, - by acute morphine application (Muller&Schwald, 2004).
- Extracellular Signal-Regulated Kinase (ERK) and Akt pathways control expression of the PMP22 gene in the opposing manner: transcription of the PMP22 gene is elevated by the activated PI3K/pAkt/GSK-3 ⁇ signalling pathway and is suppressed by the Ras/MEK/ERK kinase cascade. Compound C, via negative regulation of the ⁇ opioid receptor, could block activity of the pAkt kinase and augment signalling via Erk kinase, therefore decreasing transcription of the PMP22 gene.
- ERK Extracellular Signal-Regulated Kinase
- This drug has been approved for the treatment of hyperthyroidism, goiter, Graves disease and psoriasis.
- Methimazole binds and blocks activity of thyroid peroxidise, a rate limiting enzyme in synthesis of thyroid hormones that convert iodide to iodine. Thus, methimazole effectively inhibits the production of new thyroid hormones.
- Triiodothyronine T3 is a strong activator of EGR2 expression in Schwann cells; since the EGR2 transcription factor is recognized as a major positive regulator of promyelinating transcription program in Schwann cells, signalling via thyroid hormone receptors could influence transcription of the PMP22 gene (Mercier et al., 2001). We supposed that methimazole could decrease transcription of PMP22 gene by attenuating thyroid hormone signalling in damaged Schwann cells.
- the anti-progestational activity of compound F results from competitive interaction with progesterone at progesterone-receptor sites. Based on studies with various oral doses in several animal species (mouse, rat, rabbit and monkey), the compound inhibits the activity of endogenous or exogenous progesterone.
- Compound F is an antagonist of progesterone and glucocorticoid receptors, which are positive regulators of PMP22 transcription. Though compound F was developed as a progesterone receptor antagonist, it is also recognized as glucocorticoid hormone receptors antagonist; additionally, it displays also a weak anti-androgen activity and does not bind to the estrogen receptor or to the mineralocorticoid receptors. We Transcription of PMP22 protein is positively regulated by several nuclear receptors, including steroid hormone receptors, expressed in Schwann cells (Robert et al, 2001; Schumacher et al., 2001).
- Ketoprofen has been approved for the treatment of rheumatoid arthritis and osteoarthritis.
- Compound G is a nonsteroidal anti-inflammatory drug that blocks activity of both cylooxygenase-1 (COX-I) and cylooxygenase-2 (COX-2) and due to this effect, inhibits prostaglandin and leukotriene synthesis.
- Schwann cells express several types of functional prostaglandin EP, prostacyclin IP, trombaxone, cysteinyl leukotriene and leukotriene B4 receptors, possess an inducible COX-2 activity and are able to produce prostaglandin E2, thromboxane A2 and leukotriene LTC4 (Constable et al., 1999; Muja et al., 2001; Woodhams et al., 2007).
- Akt signalling pathway which promotes expression of myelin-related proteins including PMP22.
- recent findings suggest that the PGE2 prostaglandin is tightly implicated in metabolism of ⁇ -catenin, a down- stream effector of pAkt signalling and activator of promyelinating transcriptional program in Schwann cells (Ogata et al, 2004). It was demonstrated that upon the activation of EP receptors by PGE2, the Gas subunit binds to Axin/GSK-3 ⁇ complex and decreases GSK-3 ⁇ - mediated phosphorylation and degradation of ⁇ -catenin.
- PGE2 phosphatidylinositol 3-kinases
- cox- inhibitor ketoprofen (Compound G) could decrease transcription of the PMP22 gene by suppressing autocrine signalling through prostaglandin receptors in Schwann cells, which potentiate activity of ⁇ -catenin.
- the invention relates to the use of the following compounds, either in combination(s) or alone or to treat CMT or related disorders : Acetazolamide;
- Aminoglutethimide Aztreonam; Baclofen Balsalazide; Bicalutamide; Bromocriptine;
- Bumetanide Buspirone; Ciprofloxacin; Clonidine; Cyclosporine A; Disulfiram;
- Metformin Methimazole; Methylergonovine; Metopirone; Metoprolol; Mifepristone;
- Phenoxybenzamine Phenylbutyrate; Pilocarpine; Pioglitazone; Prazosin; Raloxifene ;
- Rifampin Simvastatin; Spironolactone; Tamoxifen; Trilostane; Valproic acid; Carbamazepine; Ketoprofen; Flurbiprofen; Diclofenac; Meloxicam; D-Sorbitol;
- Tacrolimus Diazepam; Dutasteride; Indomethacin; Dinoprostone; Carbachol; Estradiol;
- Curcumin Lithium; Rapamycin; Betaine; Trehalose; Amiloride; Albuterol,
- the invention further shows that particular cell pathways can be modulated to effectively treat CMT or related disorders. More specifically, the invention shows that functionality of PMP22 that includes its expression, folding or transport or of peripheral myelin protein(s) can be modulated by drugs affecting muscarinic receptor, GABA-B receptor, steroid hormone receptor, opioid receptor, sorbitol signalling pathways, thyroid hormne signalling pathway, or activating ERK (extracellular signal-regulated kinase) or inhibiting pAkt kinase and/or COX inhibitors thereby allowing the design of new therapeutic approaches of CMT and related disorders. Such pathways may be modulated either independently, or in combination, to provide the best possible therapeutic effect.
- Preferred drug combinations according to this invention are selected from:
- pAkt kinase inhibitor and a compound selected from a drug inhibiting thyroid hormone signalling; a drug affecting the sorbitol signalling pathways, an opioid receptor antagonist and a COX inhibitor;
- an opioid receptor antagonist and a COXinhibitor Preferred examples of drug combinations are selected from:
- muscarinic receptor agonist and a GABA-B receptor agonist
- a GABA-B receptor agonist and a pAkt kinase inhibitor a GABA-B receptor agonist and thyroid hormone signalling inhibitor a GABA-B receptor agonist and COX inhibitor or an ERK activator and a pAkt kinase inhibitor .
- an ERK activator and thyroid hormone signalling inhibitor an ERK activator and COX inhibitor or thyroid hormone signalling inhibitor and COX inhibitor
- the antagonist of a steroid hormone receptor is compound F
- the muscarinic receptor agonist is compound A or compound C
- the GABA-B receptor agonist is compound B or compound E
- the pAkt kinase inhibitor is compound D
- the ERK activator is compound A.
- a particular embodiment of the invention resides in a combination therapy for treating CMT or a related disorder, wherein said combination therapy comprises compound A and at least a second compound selected from an antagonist of a steroid hormone receptor, a muscarinic receptor agonist, a GABA-B receptor agonist, an ERK activator, a pAkt kinase inhibitor, an opioid receptor antagonis, COX inhibitor and inhibitor or thyroid hormone signalling.
- a particular embodiment of the invention resides in a combination therapy for treating CMT or a related disorder, wherein said combination therapy comprises compound B and at least a second compound selected from an antagonist of a steroid hormone receptor, a muscarinic receptor agonist, an ERK activator, a pAkt kinase inhibitor, a drug affecting the sorbitol signalling pathways, an opioid receptor antagonist COX inhibitor and inhibitor or thyroid hormone signalling.
- a particular embodiment of the invention resides in a combination therapy for treating CMT or a related disorder, wherein said combination therapy comprises compound C and at least a second compound selected from an antagonist of a steroid hormone receptor, a GABA-B receptor agonist, an ERK activator, a pAkt kinase inhibitor, a drug affecting the sorbitol signalling pathways, an opioid receptor antagonist COX inhibitor and inhibitor or thyroid hormone signalling.
- a particular embodiment of the invention resides in a combination therapy for treating CMT or a related disorder, wherein said combination therapy comprises compound D and at least a second compound selected from an antagonist of a steroid hormone receptor, a muscarinic receptor agonist, a GABA-B receptor agonist, a drug affecting the sorbitol signalling pathways, an ERK activator COX inhibitor and inhibitor or thyroid hormone signalling.
- a second compound selected from an antagonist of a steroid hormone receptor, a muscarinic receptor agonist, a GABA-B receptor agonist, a drug affecting the sorbitol signalling pathways, an ERK activator COX inhibitor and inhibitor or thyroid hormone signalling.
- a particular embodiment of the invention resides in a combination therapy for treating CMT or a related disorder, wherein said combination therapy comprises compound E and at least a second compound selected from an antagonist of a steroid hormone receptor, a muscarinic receptor agonist, a drug affecting the sorbitol signalling pathways, an ERK activator, a pAkt kinase inhibitor, an opioid receptor antagonist, COX inhibitor and inhibitor or thyroid hormone signalling.
- a particular embodiment of the invention resides in a combination therapy for treating CMT or a related disorder, wherein said combination therapy comprises compound F and at least a second compound selected from a muscarinic receptor agonist, a GABA-B receptor agonist, an ERK activator, a pAkt kinase inhibitor, a drug affecting the sorbitol signalling pathways, an opioid receptor antagonist COX inhibitor and inhibitor or thyroid hormone signalling.
- drug combinations comprise as active substances at least:
- Therapy according to the invention may be performed as drug combination or alone and/or in conjunction with any other therapy. It and may be provided at home, the doctor's office, a clinic, a hospital's outpatient department, or a hospital, so that the doctor can observe the therapy's effects closely and make any adjustments that are needed.
- the duration of the therapy depends on the stage of the disease being treated, the age and condition of the patient, and how the patient responds to the treatment.
- a person having a greater risk of developing an additional neuropathic disorder may receive prophylactic treatment to alleviate or to delay eventual neuropathic response.
- each component of the combination can be controlled independently.
- one drug may be administered orally while the second drug may be administered intramuscularly.
- Combination therapy may be given in on-and-off cycles that include rest periods so that the patient's body has a chance to recovery from any as yet unforeseen side-effects.
- the drugs may also be formulated together such that one administration delivers both drugs.
- each drug of the combination may be by any suitable means that results in a concentration of the drug that, combined with the other component, is able to correct the effect of elevated expression of PMP22 upon reaching the peripheral nerves.
- compositions include those suitable for oral, rectal, topical (including transdermal, buccal and sublingual), or parenteral (including subcutaneous, intramuscular, intravenous and intradermal) administration.
- patient packs containing a number dosing units or other means for administration of metered unit doses for use during a distinct treatment period in a single package, usually a blister pack.
- Patient packs have an advantage over traditional prescriptions, where a pharmacist divides a patient's supply of a pharmaceutical from a bulk supply, in that the patient always has access to the package insert contained in the patient pack, normally missing in traditional prescriptions. The inclusion of a package insert has been shown to improve patient compliance with the physician's instructions.
- the invention further includes a pharmaceutical formulation, as herein before described, in combination with packaging material suitable for said formulations.
- a formulation for the combination treatment can be inferred by instructions, facilities, provisions, adaptations and/or other means to help using the formulation most suitably for the treatment.
- Such measures make a patient pack specifically suitable for and adapted for use for treatment with the combination of the present invention.
- the drug may be contained in any appropriate amount in any suitable carrier substance, and is may be present in an amount of 1-99% by weight of the total weight of the composition.
- the composition may be provided in a dosage form that is suitable for the oral, parenteral (e.g., intravenously, intramuscularly), rectal, cutaneous, nasal, vaginal, inhalant, skin (patch), or ocular administration route.
- the composition may be in the form of, e.g., tablets, capsules, pills, powders, granulates, suspensions, emulsions, solutions, gels including hydrogels, pastes, ointments, creams, plasters, drenches, osmotic delivery devices, suppositories, enemas, injectables, implants, sprays, or aerosols.
- compositions may be formulated according to conventional pharmaceutical practice (see, e.g., Remington: The Science and Practice of Pharmacy 7
- compositions according to the invention may be formulated to release the active drug substantially immediately upon administration or at any predetermined time or time period after administration.
- the controlled release formulations include (i) formulations that create a substantially constant concentration of the drug within the body over an extended period of time; (ii) formulations that after a predetermined lag time create a substantially constant concentration of the drug within the body over an extended period of time; (iii) formulations that sustain drug action during a predetermined time period by maintaining a relatively, constant, effective drug level in the body with concomitant minimization of undesirable side effects associated with fluctuations in the plasma level of the active drug substance; (iv) formulations that localize drug action by, e.g., spatial placement of a controlled release composition adjacent to or in the diseased tissue or organ; and (v) formulations that target drug action by using carriers or chemical derivatives to deliver the drug to a particular target cell type.
- Administration of drugs in the form of a controlled release formulation is especially preferred in cases in which the drug, either alone or in combination, has (i) a narrow therapeutic index (i.e., the difference between the plasma concentration leading to harmful side effects or toxic reactions and the plasma concentration leading to a therapeutic effect is small; in general, the therapeutic index, TI, is defined as the ratio of median lethal dose (LD50) to median effective dose (ED50)); (ii) a narrow absorption window in the gastro -intestinal tract; or (iii) a very short biological half- life so that frequent dosing during a day is required in order to sustain the plasma level at a therapeutic level.
- a narrow therapeutic index i.e., the difference between the plasma concentration leading to harmful side effects or toxic reactions and the plasma concentration leading to a therapeutic effect is small
- the therapeutic index, TI is defined as the ratio of median lethal dose (LD50) to median effective dose (ED50)
- LD50 median lethal dose
- ED50 median effective dose
- Controlled release may be obtained by appropriate selection of various formulation parameters and ingredients, including, e.g., various types of controlled release compositions and coatings.
- the drug is formulated with appropriate excipients into a pharmaceutical composition that, upon administration, releases the drug in a controlled manner (single or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, nanoparticles, patches, and liposomes).
- Formulations for oral use include tablets containing the active ingredient(s) in a mixture with non-toxic pharmaceutically acceptable excipients.
- excipients may be, for example, inert diluents or fillers (e.g., sucrose, microcrystalline cellulose, starches including potato starch, calcium carbonate, sodium chloride, calcium phosphate, calcium sulfate, or sodium phosphate); granulating and disintegrating agents (e.g., cellulose derivatives including microcrystalline cellulose, starches including potato starch, croscarmellose sodium, alginates, or alginic acid); binding agents (e.g., acacia, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, carboxymethylcellulose sodium, methylcellulose, hydroxypropyl methylcellulose, ethylcellulose, polyvinylpyrrolidone, or polyethylene glycol); and lubricating agents, glidants, and antiadhes
- the tablets may be uncoated or they may be coated by known techniques, optionally to delay disintegration and absorption in the gastrointestinal tract and thereby providing a sustained action over a longer period.
- the coating may be adapted to release the active drug substance in a predetermined pattern (e.g., in order to achieve a controlled release formulation) or it may be adapted not to release the active drug substance until after passage of the stomach (enteric coating).
- the coating may be a sugar coating, a film coating (e.g., based on hydroxypropyl methylcellulose, methylcellulose, methyl hydroxyethylcellulose, hydroxypropylcellulose, carboxymethylcellulose, acrylate copolymers, polyethylene glycols and/or polyvinylpyrrolidone), or an enteric coating (e.g., based on methacrylic acid copolymer, cellulose acetate phthalate, hydroxypropyl methylcellulose phthalate, hydroxypropyl methylcellulose acetate succinate, polyvinyl acetate phthalate, shellac, and/or ethylcellulose).
- a time delay material such as, e.g., glyceryl monostearate or glyceryl distearate may be employed.
- the solid tablet compositions may include a coating adapted to protect the composition from unwanted chemical changes, (e.g., chemical degradation prior to the release of the active drug substance).
- the coating may be applied on the solid dosage form in a similar manner as that described in Encyclopedia of Pharmaceutical
- the two drugs may be mixed together in the tablet, or may be partitioned.
- the first drug is contained on the inside of the tablet, and the second drug is on the outside, such that a substantial portion of the second drug is released prior to the release of the first drug.
- Formulations for oral use may also be presented as chewable tablets, or as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (e.g., potato starch, microcrystalline cellulose, calcium carbonate, calcium phosphate or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example, liquid paraffin, or olive oil. Powders and granulates may be prepared using the ingredients mentioned above under tablets and capsules in a conventional manner.
- an inert solid diluent e.g., potato starch, microcrystalline cellulose, calcium carbonate, calcium phosphate or kaolin
- an oil medium for example, liquid paraffin, or olive oil.
- Powders and granulates may be prepared using the ingredients mentioned above under tablets and capsules in a conventional manner.
- Controlled release compositions for oral use may, e.g., be constructed to release the active drug by controlling the dissolution and/or the diffusion of the active drug substance.
- Dissolution or diffusion controlled release can be achieved by appropriate coating of a tablet, capsule, pellet, or granulate formulation of drugs, or by incorporating the drug into an appropriate matrix.
- a controlled release coating may include one or more of the coating substances mentioned above and/or, e.g., shellac, beeswax, glycowax, castor wax, carnauba wax, stearyl alcohol, glyceryl monostearate, glyceryl distearate, glycerol palmitostearate, ethylcellulose, acrylic resins, dl-polylactic acid, cellulose acetate butyrate, polyvinyl chloride, polyvinyl acetate, vinyl pyrrolidone, polyethylene, polymethacrylate, methylmethacrylate, 2-hydroxymethacrylate, methacrylate hydrogels, 1,3 butylene glycol, ethylene glycol methacrylate, and/or polyethylene glycols.
- the matrix material may also include, e.g., hydrated metylcellulose, carnauba wax and stearyl alcohol, carbopol 934, silicone, glyceryl tristearate, methyl acrylate-methyl methacrylate, polyvinyl chloride, polyethylene, and/or halogenated fluorocarbon.
- a controlled release composition containing one or more of the drugs of the claimed combinations may also be in the form of a buoyant tablet or capsule (i.e., a tablet or capsule that, upon oral administration, floats on top of the gastric content for a certain period of time).
- a buoyant tablet formulation of the drug(s) can be prepared by granulating a mixture of the drug(s) with excipients and 20-75% w/w of hydrocolloids, such as hydroxyethylcellulose, hydroxypropylcellulose, or hydroxypropylmethylcellulose. The obtained granules can then be compressed into tablets. On contact with the gastric juice, the tablet forms a substantially water- impermeable gel barrier around its surface. This gel barrier takes part in maintaining a density of less than one, thereby allowing the tablet to remain buoyant in the gastric juice.
- Powders, dispersible powders, or granules suitable for preparation of an aqueous suspension by addition of water are convenient dosage forms for oral administration.
- Formulation as a suspension provides the active ingredient in a mixture with a dispersing or wetting agent, suspending agent, and one or more preservatives.
- Suitable suspending agents are, for example, sodium carboxymethylcellulose, methylcellulose, sodium alginate, and the like.
- the pharmaceutical composition may also be administered parenterally by injection, infusion or implantation (intravenous, intramuscular, subcutaneous, or the like) in dosage forms, formulations, or via suitable delivery devices or implants containing conventional, non-toxic pharmaceutically acceptable carriers and adjuvants.
- injection, infusion or implantation intravenous, intramuscular, subcutaneous, or the like
- suitable delivery devices or implants containing conventional, non-toxic pharmaceutically acceptable carriers and adjuvants.
- compositions for parenteral use may be provided in unit dosage forms (e.g., in single-dose ampoules), or in vials containing several doses and in which a suitable preservative may be added (see below).
- the composition may be in form of a solution, a suspension, an emulsion, an infusion device, or a delivery device for implantation or it may be presented as a dry powder to be reconstituted with water or another suitable vehicle before use.
- the composition may include suitable parenterally acceptable carriers and/or excipients.
- the active drug(s) may be incorporated into microspheres, microcapsules, nanoparticles, liposomes, or the like for controlled release.
- the composition may include suspending, solubilizing, stabilizing, pH-adjusting agents, and/or dispersing agents.
- the pharmaceutical compositions according to the invention may be in the form suitable for sterile injection.
- the suitable active drug(s) are dissolved or suspended in a parenterally acceptable liquid vehicle.
- acceptable vehicles and solvents that may be employed are water, water adjusted to a suitable pH by addition of an appropriate amount of hydrochloric acid, sodium hydroxide or a suitable buffer, 1,3-butanediol, Ringer's solution, and isotonic sodium chloride solution.
- the aqueous formulation may also contain one or more preservatives (e.g., methyl, ethyl or n-propyl p-hydroxybenzoate).
- a dissolution enhancing or solubilizing agent can be added, or the solvent may include 10-60% w/w of propylene glycol or the like.
- Controlled release parenteral compositions may be in form of aqueous suspensions, microspheres, microcapsules, magnetic microspheres, oil solutions, oil suspensions, or emulsions.
- the active drug(s) may be incorporated in biocompatible carriers, liposomes, nanoparticles, implants, or infusion devices.
- Materials for use in the preparation of microspheres and/or microcapsules are, e.g., biodegradable/bioerodible polymers such as polygalactin, poly-(isobutyl cyanoacrylate), poly(2-hydroxyethyl-L- glutamnine).
- Biocompatible carriers that may be used when formulating a controlled release parenteral formulation are carbohydrates (e.g., dextrans), proteins (e.g., albumin), lipoproteins, or antibodies.
- Materials for use in implants can be nonbiodegradable (e.g., polydimethyl siloxane) or biodegradable (e.g., poly(caprolactone), poly(glycolic acid) or poly(ortho esters)).
- suitable dosage forms for a composition include suppositories (emulsion or suspension type), and rectal gelatin capsules (solutions or suspensions).
- the active drug(s) are combined with an appropriate pharmaceutically acceptable suppository base such as cocoa butter, esterif ⁇ ed fatty acids, glycerinated gelatin, and various water-soluble or dispersible bases like polyethylene glycols.
- an appropriate pharmaceutically acceptable suppository base such as cocoa butter, esterif ⁇ ed fatty acids, glycerinated gelatin, and various water-soluble or dispersible bases like polyethylene glycols.
- additives, enhancers, or surfactants may be incorporated.
- the pharmaceutical compositions may also be administered topically on the skin for percutaneous absorption in dosage forms or formulations containing conventionally non-toxic pharmaceutical acceptable carriers and excipients including microspheres and liposomes.
- the formulations include creams, ointments, lotions, liniments, gels, hydrogels, solutions, suspensions, sticks, sprays, pastes, plasters, and other kinds of transdermal drug delivery systems.
- the pharmaceutically acceptable carriers or excipients may include emulsifying agents, antioxidants, buffering agents, preservatives, humectants, penetration enhancers, chelating agents, gel-forming agents, ointment bases, perfumes, and skin protective agents.
- the emulsifying agents may be naturally occurring gums (e.g., gum acacia or gum tragacanth)
- the preservatives, humectants, penetration enhancers may be parabens, such as methyl or propyl p-hydroxybenzoate, and benzalkonium chloride, glycerin, propylene glycol, urea, etc.
- compositions described above for topical administration on the skin may also be used in connection with topical administration onto or close to the part of the body that is to be treated.
- the compositions may be adapted for direct application or for application by means of special drug delivery devices such as dressings or alternatively plasters, pads, sponges, strips, or other forms of suitable flexible material.
- the compounds may be used in slow release formulations, and/or formulated with agents that modify tissue distribution or bioavailability. More particularly, in a preferred embodiment, the combination of at least 2 compounds is formulated with drug eluting polymer or biomolecules or micelles or liposome-forming lipids or oil in water emulsions, or pegylated or solid nanoparticles or microparticles for oral or parenteral or intratechal administration to modify tissue distribution or bioavailability.
- formulating agents include PGA, PLGA, cyclodextrins, albumin or protein carriers, nano and microparticles, liposomes, emulsions, and PEG.
- the compounds may be associated in pharmaceutical compositions in different ways. They may be mixed together as separate entities. They may be formulated separately. They may also be linked, covalently or non-covalently, with or without a linker. In a particular embodiment, at least two compounds are linked, preferably through a cleavable or non-cleavable linker. Dosages and duration of the treatment
- the drugs of the combination may be administered concomitantly, either in the same or different pharmaceutical formulation or sequentially. If there is sequential administration, the delay in administering the second
- a minimum requirement for a combination according to this description is that the combination should be intended for combined use with the benefit of the efficacious effect of the combination of the active ingredients.
- the intended use of a combination can be inferred by facilities, provisions, adaptations and/or other means to help using the combination according to the invention.
- Therapeutically effective amounts of two or more drugs that are subjects of this invention can be used together for the preparation of a medicament useful for reducing the effect of increased expression of PMP22 gene, preventing or reducing the risk of developing CMTlA disease, halting or slowing the progression of CMTlA disease once it has become clinically manifest, and preventing or reducing the risk of a first or subsequent occurrence of an neuropathic event.
- the active drugs of the present invention may be administered in divided doses, for example two or three times daily, a single daily dose of each drug in the combination is preferred, with a single daily dose of all drugs in a single pharmaceutical composition (unit dosage form) being most preferred.
- Administration can be one to several times daily for several days to several years, and may even be for the life of the patient. Chronic or at least periodically repeated long-term administration will be indicated in most cases.
- unit dosage form refers to physically discrete units (such as capsules, tablets, or loaded syringe cylinders) suitable as unitary dosages for human subjects, each unit containing a predetermined quantity of active material or materials calculated to produce the desired therapeutic effect, in association with the required pharmaceutical carrier. 5
- each drug in the combination preferred for a unit dosage will depend upon several factors including the administration method, the body weight and the age of the patient, the severity of the neuropathic damage caused by CMTlA disease or risk of potential side effects considering the general health status of the person to be treated. Additionally, pharmacogenomic (the effect of genotype on the pharmacokinetic, pharmacodynamic or efficacy profile of a therapeutic) information about a particular patient may affect the dosage used.
- the preferred dosage of each drug in the combination will usually lie within the range of doses not above the usually prescribed for long-term maintenance treatment or proven to be safe in the large phase 3 clinical studies.
- the special doses should be chosen if administered topically.
- the most preferred dosage will correspond to amounts from 1% up to 10% of those usually prescribed for long-term maintenance treatment.
- the amount of the drug actually administered will be determined by a physician, in the light of the relevant circumstances including the condition or conditions to be treated, the exact composition to be administered, the age, weight, and response of the individual patient, the severity of the patient's symptoms, and the chosen route of administration. Therefore, the above dosage ranges are intended to provide general guidance and support for the teachings herein, but are not intended to limit the scope of the invention.
- Vials of rat Schwann cells (SC) primary culture (Sciencell # Rl 700) are defrost and seeded at the density of 10 000 cells/cm2 in "Sciencell Schwann cell medium” (basal medium from Sciencell # Rl 701) in poly-L-lysine pre-coated 75 cm 2 flasks.
- the culture medium is composed of basal medium, 5% Fetal Bovine Serum (3H-Biomedical AB
- Schwann cells are purified by gentle agitation or by thy 1.1 immunopanning that allow SC isolation from adherent fibroblasts, to produce cultures that are at least 95% pure. SC are then counted (Tryptan blue method) and seeded in poly-L-lysine pre-coated 75 cm 2 flask in the same SC medium.
- SC Primary Schwann cell cultures
- the dorsal skin is removed from the hind paw and the lower torso.
- the sciatic nerve is isolated and transferred to a culture dish containing ice-cold Leibovitz (L15, Invitogen #11415) supplemented with 1% penicillin/streptomycin solution (50UI/ml and 50 ⁇ g/ml, respectively; Invitrogen #15070) and 1% of bovine serum albumin (BSA, Sigma A6003). Both nerves per rats are transferred in a 15ml tube containing ice-cold L15. The L15 medium is then removed and replaced by 2.4ml of DMEM (Invitrogen #21969035) with 10mg/ml of collagenase (Sigma #A6003).
- DMEM Invitrogen #21969035
- Nerves are incubated in this medium for 30 minutes at 37°C.
- the medium is then removed and both nerves are dissociated by trypsin (10% trypsin EDTA 10x, Invitrogen #15400054) diluted in PBS without calcium and magnesium (Invitrogen # 2007-03) for 20min at 37°C.
- trypsin 10% trypsin EDTA 10x, Invitrogen #15400054
- PBS calcium and magnesium
- FCS foetal calf serum
- the cell suspension is centrifuged at 35Og for lOmin at room temperature (RT) and the pellets are suspended in DMEM with 10% FCS and 1% penicillin/streptomycin. Cells are counted (Tryptan blue method) and seeded in Falcon 100mm Primaria tissue culture plates at the density of 5.10 5 to 10 6 cells/dish.
- the medium is changed with DMEM, 10% FCS, 1% penicillin/streptomycin and lO ⁇ M of cytosine b-D-arabinofuranoside (Sigma #C1768). 48hrs later, medium is eliminated and cells are washed three times with DMEM. The SC growth medium is then added, composed of DMEM, 10% FCS, 1% penicillin/streptomycin, 2 ⁇ M of Forskolin (Sigma #F6886), lO ⁇ g/ml of bovine pituitary extract (PEX, Invitrogen #13028). The medium is replaced every 2-3 days.
- Schwann cells After 8 days of culture (4 to 10 days depending on cell batches), Schwann cells reach confluency and the culture, containing a large amount of contaminating fibroblasts, is purified by the thy 1.1 immunopanning method. After this purification, cells are suspended in growth medium at 10 000 cells/cm2 in poly-L-lysine pre-coated 75 cm 2 flasks. Once they reach confluency, cells are rinsed, trypsinized (trypsin-EDTA), counted and platted in 12 well-dishes (100 000 cells/well).
- trypsinized trypsinized (trypsin-EDTA)
- the medium is replaced by a defined medium consisting in a mix of DMEM-F 12 (Invitrogen # 21331020) complemented by 1% of N2 supplement (Invitrogen # 17502), 1% L-Glutamine (Invitrogen #25030024) 2.5% FBS (Sciencell #0025), 0.02 ⁇ g/ml of corticosterone (Sigma # C2505), 4 ⁇ M Forskolin and 50 ⁇ g/ml of gentamycin. Growth factors are not added to this medium, to promote SC differentiation
- the medium is replaced by a defined medium (DMEM-F 12) complemented with 1 % Insulin-Transferrin- Selenium - X (ITS, Invitrogen # 51300), 16 ⁇ g/ml of Putrescine (Sigma # P5780), 0.02 ⁇ g/ml of corticosterone and 50 ⁇ g/ml of gentamicin.
- ITS Insulin-Transferrin- Selenium - X
- Drugs are added to a defined medium composed of DMEM-F 12, with 1 % Insulin- Transferrin-Selenium - X (ITS, Invitrogen # 51300), 16 ⁇ g/ml of Putrescine, 0.02 ⁇ g/ml of corticosterone, 1OnM Progesterone and 50 ⁇ g/ml of gentamicin.
- ITS Insulin- Transferrin-Selenium - X
- Schwann cells are purified using the clone Thyl.l (ATCC TIB- 103TM) immunopanning protocole.
- Antibody pre-coated 100mm bacteria Petri dishes are prepared as follows: these dishes are washed three times with PBS and treated by 20ml of Tris HCl solution 50 mM, pH 9.5, with 10 ⁇ g/ml of goat Anti-Mouse IgM MU antibody (Jackson ImmunoResearch #115-005-020) overnight at 4°C; then rinsed 3 times with PBS and treated by a solution of PBS with 0.02% of BSA and supernatant obtained from Tl lD7e2 hybridoma culture (ATCC #TIB-103) containing the Thy 1.1 IgM antibody for 2hours at room temperature. Finally, the plates are washed three times with PBS before the cell suspensions are added.
- SC are detached with trypsin EDTA.
- trypsin is neutralized with DMEM- 10% FBS and the cells are centrifuged.
- the pellet of dissociated cells is resuspended in 15ml of medium with 0.02% BSA at the density of 0.66x10 6 cells per ml (maximum) and transferred to Petri dish (about 6.6 million of cells/ lOml/dish of 100mm).
- the cell suspension is incubated in the Thy 1.1 coated Petri dish during 45 min at 37°C with gentle agitation every 15 min to prevent non-specific binding. The majority of fibroblast cells expressing Thy 1.1 adhere on the dish. At the end of the incubation, the cell suspension is recovered and centrifuged. This cell suspension contains in theory only Schwann cells. Cells are centrifuged and cell pellet is suspended in growth medium with lO ⁇ M of Forskolin at 16 000 cells/cm 2 in T75 cm 2 flask Poly-L-Lysine treated.
- Quantitative RT-PCR is used to compare the levels of PMP22 mRNA after drug stimulation, relative with housekeeping Ribosomal Ll 3 A mRNA in rat Schwann cell primary culture.
- RNAs from each cell sample are extracted and purified from SC using the Qiagen RNeasy micro kit (Qiagen #74004). Nucleic acids are quantified by Nanodrop spectrophotometer using l ⁇ l of RNA sample. The RNA integrity is determined through a BioAnalyzer (Agilent) apparatus. RNAs are reverse-transcribed into cDNA according to standard protocol. cDNA templates for PCR amplification are synthesized from 200ng of total RNA using Superscript II reverse-transcriptase (Invitrogen # 18064-014) for 60 min at 42°C in the presence of oligo(dT), in a final volume of 20 ⁇ l.
- Superscript II reverse-transcriptase Invitrogen # 18064-014
- cDNAs are subjected to PCR amplification using the «LightCycler® 480» system (Roche Molecular Systems Inc.) Each cDNA are diluted five times before being used for PCR amplification. 2.5 ⁇ l of this cDNAs enters the PCR reaction solution (final volume of lO ⁇ l). Preliminary experiments ensured that quantitation was done in the exponential phase of the amplification process for both sequences and that expression of the reference gene was uniform in the different culture conditions.
- PCR reaction is perfomed by amplification of 50OnM of forward primer of rat PMP22 (NM O 17037), 5-GGAAACGCGAATGAGGC-3, and 50OnM of reverse primer 5- GTTCTGTTTGGTTTGGCTT-3 (amplification of 148-bp).
- a 152-bp fragment of the RPL13A ribosomal (NM 173340) RNA is amplified in parallel in separate reactions for normalization of the results by using a 50OnM of forward primer 5- CTGCCCTCAAGGTTGTG-3, and a 50OnM of reverse primer 5- CTTCTTCTTCCGGT AATGGAT-3.
- FRET probes are composed of 0.3 ⁇ M of Pmp22-FL-5-GCTCTGAGCGTGCATAGGGTAC or Rpll3A-FL- 5- TCGGGTGGAAGTACCAGCC, labelled at their 3' end with a donor fiuorophore dye (Fluorescein). 0.15 ⁇ M Red640 probes are defined as follows: Pmp22-red-5'- AGGGAGGGAGGAAGGAAACCAGAAA- or Rpll3A-red-5'-
- TGACAGCTACTCTGGAGGAGAAACGGAA labelled at their 5' end with an acceptor fiuorophore dye (Rhodamine Red 640).
- Rhodamine Red 640 an acceptor fiuorophore dye
- PCR conditions lOsec at 95°C, lOsec at 63°C and 12 sec at 72°C and 30sec at 40 0 C (Forty amplification cycles).
- the relative levels of PMP22 gene expression is measured by determining the ratio between the products generated from the target gene PMP22 and the endogenous internal standard RPL 13 A. 4 - PMP22 protein expression analysis by flow cytometry (FACS)
- Cells are centrifuged at 7000 rpm for 5 minutes and the pellets are suspended in a solution of permeabilization (AbCys #Reagent B BUF09B) and labelled with primary PMP22 antibody (Abeam #ab61220, 1/50) for lhr room at temperature. Cells are then centrifuged at 7000 rpm for 5 minutes and cell pellets are rinsed once in PBS. A secondary antibody is added, coupled to Alexa Fluor 488 (goat anti-rabbit IgG, Molecular Probes #A11008, 1/100), for one hour at room temperature. Cells are then centrifuged at 7000 rpm for 5 minutes and cell pellets are rinsed once in PBS.
- Alexa Fluor 488 goat anti-rabbit IgG, Molecular Probes #A11008, 1/100
- the labelling is increased adding a tertiary antibody coupled to Alexa Fluor 488 (chicken anti-goat IgG, Molecular Probes #A21467, 1/100) for one hour incubation, at room temperature. Cells are then rinsed once in PBS. Control without any antibody (unlabelled cells) is performed to determine the level of auto fluorescence and adapted the sensitivity of the photomultiplicators. Control with both secondary and tertiary antibodies but without primary antibody, is performed to assess non specific binding of antibodies.
- Alexa Fluor 488 dry anti-goat IgG, Molecular Probes #A21467, 1/100
- FSC Forward Scatter
- SSC Side Scatter
- Cells are prepared according to the following protocol: Schwann cells are stained with antibody anti-S100 Protein (Dako #S0311, 1/100) for lhr room at temperature. This antibody is labelled according to protocol described above for PMP22 immunostaining but without incubation with tertiary antibody.
- antibody anti-S100 Protein Dako #S0311, 1/100
- Drugs are incubated for 24hrs or 48hrs in the same defined medium than described above (3 wells/condition) in absence of Forskolin to avoid adenylate cyclase stimulation saturation, but in presence of 1OnM of progesterone. After drug incubation, supernatants are recovered and Schwann cells are frozen for RT-Q-PCR analysis.
- Figure 4 describes the results for 6 drugs and show that they are able to decrease significantly PMP22 protein expression, 24hrs after their addition to the culture medium.
- the results of the action of some individual drugs on the protein level of PMP22 are also shown on table 1 above.
- Fig. 5 the effect of a combination of pilocarpine and Naltrexone on PMP22 protein expression after 24hrs of incubation are shown. The levels of protein expression were compared to untreated controls. These differences were shown to be statistically significant.
- Table 2 summarizes the results obtained with various drug combinations, at various concentrations, on PMP22 protein expression. These results were statistically significant and demonstrate the advantage and beneficial effect of the proposed drug combinations.
- the rats are treated chronically with drugs - force fed or injected by Alzet osmotic subcutaneous pump (DURECT Corporation Cupertino, CA), depending on each drug bioavailability during 10-20 weeks.
- the animals are weighted twice a week in order to adjust the doses to growing body weight. If the osmotic pump is chosen for the treatment administration, the doses of the drug are calculated on the basis of the estimated mean body weight of the animals expected for their age over the period of the pump duration (6 weeks).
- the pumps are re-implanted if necessary, with the appropriated aesthesia protocol.
- the grip strength test measures the strength with which an animal holds on to a grip with its forepaws or its hindpaws separately.
- a dynamometer is placed with a grip to measure the strength (Force Gauge FG-5000A).
- the rat is held by the experimenter in a way that it grasps the grip either with its forepaws or with its hind paws and pulls gently the rat backwards until it releases the grip.
- the force measured when the animal releases the grip is recorded.
- Two successive trials measuring the forepaws and two successive trials measuring the hindpaws strength per animal are processed ; only the maximum score (one for forepaws and one for hindpaws) is noticed (in N).
- the Bar Test evaluates rats' ability to hold on a fix rod. Pmp22 rats which display muscular weakness, exhibit a performance deficit in this test (Sereda et al, 1996). The rat is placed on its four paws on the middle of the rod (diameter: 2.5 cm ; length : 50 cm; 30 cm above the table). Trials are performed consecutively; the number and the duration of trials in our experiments have been depending on batches of the animals. This variability in the testing have been introduced in order to determine the schedule appropriated to the best detection of the motor deficiency in the CMT rats in the course of the experiments.
- Body weights, overt signs (coat appearance, body posture, gait, tremor etc.) of the animals are monitored throughout the experiment.
- the rats are subjected to electrophysiological evaluation and histological measurement.
- the potential amplitude measured on the distal portion of the tail was found to be significantly diminished in the TG placebo group that may reflect the important axonal loss which in turn is due to the demyelination.
- This electrophysiological parameter turns to be significantly improved upon the treatment with methimazole (Fig. 8), while the nerve conduction velocity (NCV) was not significantly affected.
- CMTlA sensor nerve action potential (SNAP) amplitude was more reduced and SNAP duration more prolonged than in CMT2.
- CMAP composed muscle action potential
- D from about 0.1 to about 20 mg and compound F from about 0.2 to about 50 mg every day orally for several months, the most preferred dosages for both drugs in the composition ranging from 0.1 to 5 mg per unit (per day).
- compound F Administered concomitantly orally for several months: compound F from about 5 to about 200 mg once a week (the most preferred dosage being up to 50 mg weekly), compound D from about 0.1 to about 20 mg daily (the most preferred dosage for this drug being from 0.1 to 5 mg per day).
- compound F as a skin patch releasing the drug preferably at a rate of about 0.2 to about 2 mg per day.
- compound F once a week from about 5 to about 200 mg once a week (the most preferred dosage being up to 50 mg weekly), and compound A twice a day in a drink, the total daily dosage of compound A being from about 1 to about 50 g.
- Peripheral myelin protein 22 is in complex with alpha6beta4 integrin, and its absence alters the Schwann cell basal lamina. J Neurosci. 2006; 26(4):1179-1189.
- peripheral myelin protein 22 aggregates is hindered by the enhancement of autophagy and expression of cytoplasmic chaperones. Neurobiol Dis. 2007; 25(2): 252-265.
- GISP a novel brain-specific protein that promotes surface expression and function of GABA(B) receptors. J Neurochem. 2007;100(4):1003-17.
- CMT rat peripheral neuropathy and dysmyelination caused by transgenic overexpression of PMP22. Ann. N.- Y. Acad. Sci. 1999; 883:254-261. 5
- Notterpek L Shooter EM, Snipes GJ. Upregulation of the endosomal-lysosomal pathway in the trembler-J neuropathy. J Neurosci. 1997;17(11): 4190-4200.
- Trembler mouse carries a point mutation in a myelin gene. Nature. 1992; 356(6366): 241-244. 5
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Emergency Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Physiology (AREA)
- Nutrition Science (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Abstract
Description
Claims
Priority Applications (26)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP12196650.1A EP2609916B1 (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating CMT and related disorders |
ES08854467T ES2408785T3 (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for the treatment of CMT and related disorders |
SI200830954T SI2211846T1 (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating CMT and related disorders |
US12/744,962 US8992891B2 (en) | 2007-11-30 | 2008-11-28 | Therapeutic approaches for treating CMT and related disorders |
CA2705408A CA2705408C (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating cmt and related disorders |
PL08854467T PL2211846T3 (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating CMT and related disorders |
MX2010005709A MX2010005709A (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating cmt and related disorders. |
NZ585440A NZ585440A (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating cmt and related disorders |
JP2010535399A JP5953000B2 (en) | 2007-11-30 | 2008-11-28 | A novel therapeutic approach for the treatment of CMT and related diseases |
EP08854467A EP2211846B1 (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating CMT and related disorders |
DK08854467.1T DK2211846T3 (en) | 2007-11-30 | 2008-11-28 | Hitherto unknown approaches to the treatment of CMT and related disorders |
AU2008328745A AU2008328745B2 (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating CMT and related disorders |
CN200880118498.4A CN101883561B (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating Charcot-Marie-Tooth disease |
EP18203488.4A EP3459535B1 (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating cmt and related disorders |
PL12196650T PL2609916T3 (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating CMT and related disorders |
BRPI0819678A BRPI0819678A2 (en) | 2007-11-30 | 2008-11-28 | method for treating cmt and related disorders |
EA201000914A EA019402B1 (en) | 2007-11-30 | 2008-11-28 | Compositions and method for treatment of charcot-marie-tooth disease |
IL205741A IL205741A0 (en) | 2007-11-30 | 2010-05-13 | New therapeutic approaches for treating cmt and related disorders |
ZA2010/03610A ZA201003610B (en) | 2007-11-30 | 2010-05-21 | New therapeutic approaches for treating cmt and related disorders |
HRP20130345AT HRP20130345T1 (en) | 2007-11-30 | 2013-04-17 | New therapeutic approaches for treating cmt and related disorders |
US14/627,229 US20150157626A1 (en) | 2007-11-30 | 2015-02-20 | Therapeutic approaches for treating cmt and related disorders |
US15/966,848 US10322101B2 (en) | 2007-11-30 | 2018-04-30 | Therapeutic approaches for treating CMT and related disorders |
US16/055,797 US10463640B2 (en) | 2007-11-30 | 2018-08-06 | Therapeutic approaches for treating CMT and related disorders |
US16/055,710 US10441558B2 (en) | 2007-11-30 | 2018-08-06 | Therapeutic approaches for treating CMT and related disorders |
CY20181101374T CY1121183T1 (en) | 2007-11-30 | 2018-12-19 | NEW TREATMENT METHODS FOR CMT TREATMENT AND RELATED DISORDERS |
US16/586,136 US20200155491A1 (en) | 2007-11-30 | 2019-09-27 | Therapeutic approaches for treating cmt and related disorders |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP07301614.9 | 2007-11-30 | ||
EP07301614A EP2065038A1 (en) | 2007-11-30 | 2007-11-30 | New therapeutic approaches for treating Charcot-Marie-Tooth disease |
US99180007P | 2007-12-03 | 2007-12-03 | |
US60/991,800 | 2007-12-03 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/744,962 A-371-Of-International US8992891B2 (en) | 2007-11-30 | 2008-11-28 | Therapeutic approaches for treating CMT and related disorders |
US14/627,229 Continuation US20150157626A1 (en) | 2007-11-30 | 2015-02-20 | Therapeutic approaches for treating cmt and related disorders |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2009068668A1 true WO2009068668A1 (en) | 2009-06-04 |
Family
ID=39264515
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2008/066468 WO2009068668A1 (en) | 2007-11-30 | 2008-11-28 | New therapeutic approaches for treating cmt and related disorders |
Country Status (24)
Country | Link |
---|---|
US (6) | US8992891B2 (en) |
EP (4) | EP2065038A1 (en) |
JP (4) | JP5953000B2 (en) |
KR (1) | KR101546031B1 (en) |
CN (2) | CN104257657B (en) |
AU (1) | AU2008328745B2 (en) |
BR (1) | BRPI0819678A2 (en) |
CA (3) | CA3031490C (en) |
CY (2) | CY1113980T1 (en) |
DK (2) | DK2609916T3 (en) |
EA (3) | EA019402B1 (en) |
ES (3) | ES2831855T3 (en) |
HR (2) | HRP20130345T1 (en) |
HU (1) | HUE040596T2 (en) |
IL (1) | IL205741A0 (en) |
LT (1) | LT2609916T (en) |
MX (1) | MX2010005709A (en) |
NZ (1) | NZ585440A (en) |
PL (2) | PL2609916T3 (en) |
PT (2) | PT2609916T (en) |
SI (2) | SI2211846T1 (en) |
TR (1) | TR201819564T4 (en) |
WO (1) | WO2009068668A1 (en) |
ZA (1) | ZA201003610B (en) |
Cited By (17)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009153291A1 (en) * | 2008-06-18 | 2009-12-23 | Pharnext | Combination of pilocarpin and methimazol for treating charcot-marietooth disease and related disorders |
WO2010139627A1 (en) | 2009-06-02 | 2010-12-09 | Pharnext | New compositions for treating cmt and related disorders |
CN102247324A (en) * | 2011-07-14 | 2011-11-23 | 海南美兰史克制药有限公司 | Flumazenil liposome injection |
CN102811716A (en) * | 2010-01-15 | 2012-12-05 | 国立健康与医学研究所 | Compounds for the treatment of autism |
CN102887830A (en) * | 2012-09-04 | 2013-01-23 | 苏州弘森药业有限公司 | Preparation method of phenoxybenzamine hydrochloride |
US20130217036A1 (en) * | 2009-11-20 | 2013-08-22 | Pharnext | New diagnostic tools for charcot-marie-tooth disease |
WO2013127918A1 (en) | 2012-03-01 | 2013-09-06 | Pharnext | New therapeutic approaches for treating parkinson's disease |
WO2013127917A1 (en) | 2011-03-01 | 2013-09-06 | Pharnext | New compositions for treating amyotrophic lateral sclerosis |
JP2014506583A (en) * | 2011-02-18 | 2014-03-17 | ザ スクリプス リサーチ インスティチュート | Directed differentiation of oligodendrocyte progenitor cells to myelinating cell fate |
US8992891B2 (en) | 2007-11-30 | 2015-03-31 | Pharnext | Therapeutic approaches for treating CMT and related disorders |
US9393241B2 (en) | 2009-06-02 | 2016-07-19 | Pharnext | Compositions for treating CMT and related disorders |
US9585893B2 (en) | 2011-02-23 | 2017-03-07 | Coeruleus Ltd. | Flumazenil complexes, compositions comprising same and uses thereof |
WO2018076060A1 (en) * | 2016-10-26 | 2018-05-03 | Genea Ip Holdings Pty Ltd | Improved generation of muscle lineage cells and therapeutic uses thereof |
US10300015B2 (en) | 2013-06-05 | 2019-05-28 | Pharnext | Stable oral solutions for combined API |
US10383870B2 (en) | 2016-06-10 | 2019-08-20 | Pharnext | Early treatment of CMT disease |
EP3563841A1 (en) | 2014-08-29 | 2019-11-06 | Pharnext | New therapeutic approaches for treating parkinson's disease |
EP3426349A4 (en) * | 2016-03-09 | 2020-01-01 | Ionis Pharmaceuticals, Inc. | Methods and compositions for inhibiting pmp22 expression |
Families Citing this family (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010025322A2 (en) * | 2008-08-28 | 2010-03-04 | The Florida International University Board Of Trustees | Magnetic nanodelivery of therapeutic agents across the blood brain barrier |
US20130227717A1 (en) * | 2010-10-08 | 2013-08-29 | Life Sciences Research Partners Vzw | Hdac inhibitors to treat charcot-marie-tooth disease |
CN102464610B (en) * | 2010-11-16 | 2014-07-30 | 北大方正集团有限公司 | Preparation method of metyrapone |
WO2014063163A1 (en) | 2012-10-19 | 2014-04-24 | Block Jonathan D | Systems and methods for nerve mapping and monitoring |
US20150329483A1 (en) * | 2012-12-17 | 2015-11-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and Pharmaceutical Compositions for the Treatment of X-Linked Charcot-Marie-Tooth |
EP3104850A1 (en) | 2014-02-11 | 2016-12-21 | Pharnext | Combination of baclofen, acamprosate and medium chain triglycerides for the treatment of neurological disorders |
EA201691703A1 (en) * | 2014-02-24 | 2017-04-28 | Фарнекст | NEW COMPOSITIONS FOR THE TREATMENT OF MECHANICAL DAMAGES OF NERVES |
WO2016187595A2 (en) * | 2015-05-20 | 2016-11-24 | Lupin Atlantis Holdings Sa | Oral pharmaceutical composition of methylergonovine |
WO2018014007A1 (en) * | 2016-07-14 | 2018-01-18 | Sidewaystrategies Llc | System and methods for improving diagnostic evoked potential studies for functional assessments of nerves and nerve pathways |
CA3071114A1 (en) | 2017-07-28 | 2019-01-31 | Applied Therapeutics Inc. | Compositions and methods for treating galactosemia |
JP2022531466A (en) * | 2019-05-07 | 2022-07-06 | ユニバーシティ オブ マイアミ | Treatment and detection of hereditary neuropathy and related disorders |
JP2023524504A (en) * | 2020-05-01 | 2023-06-12 | アプライド セラピューティクス, インコーポレイテッド | Aldose reductase inhibitors for treating sorbitol dehydrogenase deficiency |
EP4019016A1 (en) * | 2020-12-24 | 2022-06-29 | Allaysis, LLC | Methods of administering intravenous baclofen |
US11523984B1 (en) * | 2021-11-12 | 2022-12-13 | Amneal Pharmaceuticals Llc | Compositions and methods of administering baclofen |
WO2023182288A1 (en) * | 2022-03-22 | 2023-09-28 | 国立大学法人京都大学 | Drug for treating or preventing charcot-marie-tooth disease |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000020024A2 (en) * | 1998-10-02 | 2000-04-13 | Celtrix Pharmaceuticals, Inc. | Methods for the treatment of non-thyroid disorders |
WO2004103263A2 (en) * | 2003-05-22 | 2004-12-02 | Yeda Research And Development Co. Ltd. | Dopamine and agonists and antagonists thereof for treatment of neurodegenerative diseases |
WO2005032555A2 (en) * | 2003-09-25 | 2005-04-14 | Euro-Celtique S.A. | Pharmaceutical combinations of hydrocodone and naltrexone |
WO2006117573A1 (en) * | 2005-05-04 | 2006-11-09 | Aimsco Limited | Combination therapy |
Family Cites Families (37)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
TW427904B (en) | 1995-12-07 | 2001-04-01 | American Home Prod | Neuroprotective agents |
AU9187598A (en) | 1997-09-30 | 1999-04-23 | Daiichi Pharmaceutical Co., Ltd. | Oral preparation |
AU6058299A (en) * | 1998-09-22 | 2000-04-10 | Incyte Genomics, Inc. | Human chaperone proteins |
US20040115133A1 (en) * | 2000-05-10 | 2004-06-17 | Wermeling Daniel P. | Intranasal opioid compositions |
WO2002049607A2 (en) | 2000-12-20 | 2002-06-27 | Firmenich Sa | Flavoured oral drug delivery system |
JP3805646B2 (en) | 2001-05-25 | 2006-08-02 | 久光メディカル株式会社 | Pharmaceutical solution |
ATE477795T1 (en) * | 2001-07-04 | 2010-09-15 | Sun Pharma Advanced Res Co Ltd | STOMACH RETENTION SYSTEM WITH CONTROLLED DRUG RELEASE |
CN1652752A (en) * | 2002-03-14 | 2005-08-10 | 欧罗赛铁克股份有限公司 | Naltrexone hydrochloride compositions |
US7790215B2 (en) * | 2002-03-26 | 2010-09-07 | Purdue Pharma Lp | Sustained-release gel coated compositions |
FR2842422B1 (en) | 2002-07-16 | 2006-06-30 | Univ Aix Marseille Ii | COMPOSITIONS FOR THE TREATMENT OF PERIPHERAL NEUROPATHIES, PREPARATION AND USES |
JP2004049093A (en) * | 2002-07-18 | 2004-02-19 | Meiji Milk Prod Co Ltd | Food composition and medicine for increasing intestinal butyric acid |
WO2004019938A1 (en) | 2002-08-28 | 2004-03-11 | Merck Frosst Canada & Co. | Oxazolidin-2-one and thiazolidin-2-one derivatives for use as ep4 receptor agonists in the treatment of glaucoma |
RU2224518C1 (en) * | 2003-02-10 | 2004-02-27 | Дулькис Мария Дмитриевна | Naltrexone liquid medicinal form |
EP1599186B1 (en) * | 2003-02-24 | 2013-04-10 | Pharmaceutical Productions Inc. | Transmucosal drug delivery system |
PL2368553T3 (en) * | 2003-04-08 | 2015-05-29 | Progenics Pharm Inc | Pharmaceutical formulations containing methylnaltrexone |
US20050038062A1 (en) * | 2003-04-14 | 2005-02-17 | Burns Lindsay H. | Methods and materials for the treatment of pain comprising opioid antagonists |
CA2537029C (en) | 2003-11-26 | 2013-03-12 | Likan Liang | Micellar systems useful for delivery of lipophilic or hydrophobic compounds |
FR2865648B1 (en) * | 2004-02-03 | 2006-06-30 | Philippe Perovitch | METHOD FOR DIFFUSION OF INSOLUBLE MOLECULES IN AQUEOUS MEDIUM AND COMPOSITION IMPLEMENTING SAID METHOD |
US20050220863A1 (en) | 2004-04-02 | 2005-10-06 | Chien-Hsuan Han | Pharmaceutical dosage forms having controlled release properties that contain a GABAB receptor agonist |
JP2006131545A (en) | 2004-11-05 | 2006-05-25 | Japan Science & Technology Agency | Therapeutic agent for neurogenic pain |
US20070099947A1 (en) | 2005-11-03 | 2007-05-03 | Alkermes, Inc. | Methods and compositions for the treatment of brain reward system disorders by combination therapy |
DE102006016990A1 (en) * | 2006-04-11 | 2007-10-18 | Hermann, Holger Lars, Dr. | Use of baclofen compounds to treat dependence on gamma-hydroxybutyrate or its analogs |
EP2377531A2 (en) * | 2006-05-09 | 2011-10-19 | Braincells, Inc. | Neurogenesis by modulating angiotensin |
EP2026813A2 (en) * | 2006-05-09 | 2009-02-25 | Braincells, Inc. | 5 ht receptor mediated neurogenesis |
EP2117517B1 (en) | 2007-01-11 | 2011-06-01 | XenoPort, Inc. | Sustained release oral dosage forms of a prodrug of r-baclofen and methods of treatment |
US20080255062A1 (en) | 2007-02-13 | 2008-10-16 | University Of Manitoba | Axon regeneration from adult sensory neurons |
US7806721B2 (en) * | 2007-08-02 | 2010-10-05 | Tyco Electronics Corporation | Patch panel modular jack assembly |
EP2065038A1 (en) | 2007-11-30 | 2009-06-03 | Pharnext | New therapeutic approaches for treating Charcot-Marie-Tooth disease |
EP2135607A1 (en) * | 2008-06-18 | 2009-12-23 | Pharnext | Combination of pilocarpin and methimazol for treating Charcot-MarieTooth disease and related disorders |
EP2263665A1 (en) | 2009-06-02 | 2010-12-22 | Pharnext | New compositions for treating CMT and related disorders |
US9393241B2 (en) * | 2009-06-02 | 2016-07-19 | Pharnext | Compositions for treating CMT and related disorders |
EP2322163A1 (en) | 2009-11-03 | 2011-05-18 | Pharnext | New therapeutics approaches for treating alzheimer disease |
IT1400067B1 (en) | 2010-05-21 | 2013-05-17 | Molteni & C | LIQUID NASAL SPRAY CONTAINING NALTREXONE WITH LOW DOSAGE. |
SI2796132T1 (en) | 2011-03-01 | 2018-09-28 | Pharnext | Baclofen and acamprosate based therapy of neurological disorders |
US9931326B2 (en) | 2011-03-29 | 2018-04-03 | Pharnext | Composition comprising torasemide and baclofen for treating neurological disorders |
CA2913331C (en) | 2013-06-05 | 2021-08-24 | Pharnext | Stable oral solutions for combined api |
US10383870B2 (en) | 2016-06-10 | 2019-08-20 | Pharnext | Early treatment of CMT disease |
-
2007
- 2007-11-30 EP EP07301614A patent/EP2065038A1/en not_active Withdrawn
-
2008
- 2008-11-28 HU HUE12196650A patent/HUE040596T2/en unknown
- 2008-11-28 TR TR2018/19564T patent/TR201819564T4/en unknown
- 2008-11-28 CA CA3031490A patent/CA3031490C/en active Active
- 2008-11-28 ES ES18203488T patent/ES2831855T3/en active Active
- 2008-11-28 US US12/744,962 patent/US8992891B2/en active Active
- 2008-11-28 PL PL12196650T patent/PL2609916T3/en unknown
- 2008-11-28 MX MX2010005709A patent/MX2010005709A/en active IP Right Grant
- 2008-11-28 EA EA201000914A patent/EA019402B1/en not_active IP Right Cessation
- 2008-11-28 AU AU2008328745A patent/AU2008328745B2/en active Active
- 2008-11-28 CN CN201410322856.0A patent/CN104257657B/en active Active
- 2008-11-28 LT LTEP12196650.1T patent/LT2609916T/en unknown
- 2008-11-28 EP EP08854467A patent/EP2211846B1/en active Active
- 2008-11-28 PT PT12196650T patent/PT2609916T/en unknown
- 2008-11-28 PT PT88544671T patent/PT2211846E/en unknown
- 2008-11-28 EA EA201301078A patent/EA032767B1/en not_active IP Right Cessation
- 2008-11-28 CN CN200880118498.4A patent/CN101883561B/en active Active
- 2008-11-28 KR KR1020107014240A patent/KR101546031B1/en active IP Right Grant
- 2008-11-28 SI SI200830954T patent/SI2211846T1/en unknown
- 2008-11-28 SI SI200832028T patent/SI2609916T1/en unknown
- 2008-11-28 EP EP12196650.1A patent/EP2609916B1/en active Active
- 2008-11-28 ES ES12196650T patent/ES2703508T3/en active Active
- 2008-11-28 PL PL08854467T patent/PL2211846T3/en unknown
- 2008-11-28 EA EA201791669A patent/EA035711B1/en not_active IP Right Cessation
- 2008-11-28 JP JP2010535399A patent/JP5953000B2/en active Active
- 2008-11-28 DK DK12196650.1T patent/DK2609916T3/en active
- 2008-11-28 NZ NZ585440A patent/NZ585440A/en unknown
- 2008-11-28 ES ES08854467T patent/ES2408785T3/en active Active
- 2008-11-28 CA CA2705408A patent/CA2705408C/en active Active
- 2008-11-28 CA CA3031484A patent/CA3031484C/en active Active
- 2008-11-28 BR BRPI0819678A patent/BRPI0819678A2/en not_active Application Discontinuation
- 2008-11-28 EP EP18203488.4A patent/EP3459535B1/en active Active
- 2008-11-28 DK DK08854467.1T patent/DK2211846T3/en active
- 2008-11-28 WO PCT/EP2008/066468 patent/WO2009068668A1/en active Application Filing
-
2010
- 2010-05-13 IL IL205741A patent/IL205741A0/en active IP Right Grant
- 2010-05-21 ZA ZA2010/03610A patent/ZA201003610B/en unknown
-
2013
- 2013-04-17 HR HRP20130345AT patent/HRP20130345T1/en unknown
- 2013-05-02 CY CY20131100368T patent/CY1113980T1/en unknown
-
2015
- 2015-02-20 US US14/627,229 patent/US20150157626A1/en not_active Abandoned
-
2016
- 2016-03-01 JP JP2016039032A patent/JP6608309B2/en active Active
-
2018
- 2018-02-26 JP JP2018031658A patent/JP2018109043A/en active Pending
- 2018-04-30 US US15/966,848 patent/US10322101B2/en active Active
- 2018-08-06 US US16/055,797 patent/US10463640B2/en active Active
- 2018-08-06 US US16/055,710 patent/US10441558B2/en active Active
- 2018-12-18 HR HRP20182147TT patent/HRP20182147T8/en unknown
- 2018-12-19 CY CY20181101374T patent/CY1121183T1/en unknown
-
2019
- 2019-04-17 JP JP2019078588A patent/JP2019142917A/en active Pending
- 2019-09-27 US US16/586,136 patent/US20200155491A1/en not_active Abandoned
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000020024A2 (en) * | 1998-10-02 | 2000-04-13 | Celtrix Pharmaceuticals, Inc. | Methods for the treatment of non-thyroid disorders |
WO2004103263A2 (en) * | 2003-05-22 | 2004-12-02 | Yeda Research And Development Co. Ltd. | Dopamine and agonists and antagonists thereof for treatment of neurodegenerative diseases |
WO2005032555A2 (en) * | 2003-09-25 | 2005-04-14 | Euro-Celtique S.A. | Pharmaceutical combinations of hydrocodone and naltrexone |
WO2006117573A1 (en) * | 2005-05-04 | 2006-11-09 | Aimsco Limited | Combination therapy |
Non-Patent Citations (6)
Title |
---|
COLOMBO G ET AL: "Effect of the combination of naltrexone and baclofen, on acquisition of alcohol drinking behavior in alcohol-preferring rats", DRUG AND ALCOHOL DEPENDENCE, ELSEVIER SCIENTIFIC PUBLISHERS, IR, vol. 77, no. 1, 7 January 2005 (2005-01-07), pages 87 - 91, XP004687645, ISSN: 0376-8716 * |
GRANDIS M ET AL: "Current therapy for Charcot-Marie-Tooth disease", CURRENT TREATMENT OPTIONS IN NEUROLOGY,, vol. 7, no. 1, 1 January 2005 (2005-01-01), pages 23 - 31, XP008090295, ISSN: 1092-8480 * |
KELTNER J L ET AL: "Myotonic pupils in Charcot-Marie-Tooth disease. Successful relief of symptoms with 0.025% pilocarpine", ARCHIVES OF OPHTHALMOLOGY, XX, XX, vol. 93, no. 11, 1 January 1975 (1975-01-01), pages 1141 - 1148, XP008090277, ISSN: 0003-9950 * |
MAGNAGHI VALERIO ET AL: "GABA receptor-mediated effects in the peripheral nervous system - A cross-interaction with neuroactive steroids", JOURNAL OF MOLECULAR NEUROSCIENCE, BIRKHAEUSER, CAMBRIDGE, MA, US, vol. 28, no. 1, 1 January 2006 (2006-01-01), pages 89 - 102, XP008090274, ISSN: 0895-8696 * |
WEIMER L H ET AL: "Medication-induced exacerbation of neuropathy in Charcot Marie Tooth Disease", JOURNAL OF NEUROLOGICAL SCIENCES, ELSEVIER SCIENTIFIC PUBLISHING CO, AMSTERDAM, NL, vol. 242, no. 1-2, 15 March 2006 (2006-03-15), pages 47 - 54, XP025191043, ISSN: 0022-510X, [retrieved on 20060315] * |
ZU HOERSTE GERD MEYER ET AL: "Myelin disorders: Causes and perspectives of Charcot-Marie-Tooth neuropathy", JOURNAL OF MOLECULAR NEUROSCIENCE, BIRKHAEUSER, CAMBRIDGE, MA, US, vol. 28, no. 1, 1 January 2006 (2006-01-01), pages 77 - 88, XP008090275, ISSN: 0895-8696 * |
Cited By (47)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10322101B2 (en) | 2007-11-30 | 2019-06-18 | Pharnext | Therapeutic approaches for treating CMT and related disorders |
US8992891B2 (en) | 2007-11-30 | 2015-03-31 | Pharnext | Therapeutic approaches for treating CMT and related disorders |
US10463640B2 (en) | 2007-11-30 | 2019-11-05 | Pharnext | Therapeutic approaches for treating CMT and related disorders |
US10441558B2 (en) | 2007-11-30 | 2019-10-15 | Pharnext | Therapeutic approaches for treating CMT and related disorders |
US9597297B2 (en) | 2008-06-18 | 2017-03-21 | Pharnext | Combination of pilocarpin and methimazol for treating Charcot-Marietooth disease and related disorders |
EA023380B1 (en) * | 2008-06-18 | 2016-05-31 | Фарнекст | Combination of pilocarpin and methimazol for treating charcot-marie-tooth disease and related disorders |
AU2009259336B2 (en) * | 2008-06-18 | 2015-01-29 | Pharnext | Combination of pilocarpin and methimazol for treating Charcot-Marietooth disease and related disorders |
WO2009153291A1 (en) * | 2008-06-18 | 2009-12-23 | Pharnext | Combination of pilocarpin and methimazol for treating charcot-marietooth disease and related disorders |
US8716269B2 (en) | 2008-06-18 | 2014-05-06 | Pharnext | Combination of pilocarpin and methimazol for treating Charcot-Marietooth disease and related disorders |
US10583135B2 (en) | 2009-06-02 | 2020-03-10 | Pharnext | Compositions for treating CMT and related disorders |
US10905686B2 (en) | 2009-06-02 | 2021-02-02 | Pharnext | Compositions for treating CMT and related disorders |
US11576908B2 (en) | 2009-06-02 | 2023-02-14 | Pharnext | Compositions for treating CMT and related disorders |
US11672796B2 (en) | 2009-06-02 | 2023-06-13 | Pharnext | Compositions for treating CMT and related disorders |
US9393241B2 (en) | 2009-06-02 | 2016-07-19 | Pharnext | Compositions for treating CMT and related disorders |
US9427436B1 (en) | 2009-06-02 | 2016-08-30 | Pharnext | Compositions for treating CMT and related disorders |
US9566275B2 (en) | 2009-06-02 | 2017-02-14 | Pharnext | Compositions for treating CMT and related disorders |
WO2010139627A1 (en) | 2009-06-02 | 2010-12-09 | Pharnext | New compositions for treating cmt and related disorders |
US20130217036A1 (en) * | 2009-11-20 | 2013-08-22 | Pharnext | New diagnostic tools for charcot-marie-tooth disease |
US20150301069A1 (en) * | 2009-11-20 | 2015-10-22 | Pharnext | Diagnostic tools for charcot-marie-tooth disease |
US9945876B2 (en) | 2009-11-20 | 2018-04-17 | Pharnext | Diagnostic tools for charcot-marie-tooth disease |
US9494605B2 (en) * | 2009-11-20 | 2016-11-15 | Pharnext | Diagnostic tools for charcot-marie-tooth disease |
US9592214B2 (en) | 2010-01-15 | 2017-03-14 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Compounds for the treatment of autism in a baby child |
US9415028B2 (en) | 2010-01-15 | 2016-08-16 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Compounds for the treatment of autism |
CN102811716A (en) * | 2010-01-15 | 2012-12-05 | 国立健康与医学研究所 | Compounds for the treatment of autism |
CN107595828A (en) * | 2010-01-15 | 2018-01-19 | 国立健康与医学研究所 | For treating the compound of autism |
US10493080B2 (en) | 2011-02-18 | 2019-12-03 | The Scripps Research Institute | Directed differentiation of oligodendrocyte precursor cells to a myelinating cell fate |
US10660899B2 (en) | 2011-02-18 | 2020-05-26 | The Scripps Research Institute | Directed differentiation of oligodendrocyte precursor cells to a myelinating cell fate |
US11246873B2 (en) | 2011-02-18 | 2022-02-15 | The Scripps Research Institute | Directed differentiation of oligodendrocyte precursor cells to a myelinating cell fate |
US9592288B2 (en) | 2011-02-18 | 2017-03-14 | The Scripps Research Institute | Directed differentiation of oligodendrocyte precursor cells to a myelinating cell fate |
JP2014506583A (en) * | 2011-02-18 | 2014-03-17 | ザ スクリプス リサーチ インスティチュート | Directed differentiation of oligodendrocyte progenitor cells to myelinating cell fate |
US9585893B2 (en) | 2011-02-23 | 2017-03-07 | Coeruleus Ltd. | Flumazenil complexes, compositions comprising same and uses thereof |
WO2013127917A1 (en) | 2011-03-01 | 2013-09-06 | Pharnext | New compositions for treating amyotrophic lateral sclerosis |
CN102247324A (en) * | 2011-07-14 | 2011-11-23 | 海南美兰史克制药有限公司 | Flumazenil liposome injection |
CN102247324B (en) * | 2011-07-14 | 2012-11-21 | 海南美兰史克制药有限公司 | Flumazenil liposome injection |
WO2013127918A1 (en) | 2012-03-01 | 2013-09-06 | Pharnext | New therapeutic approaches for treating parkinson's disease |
CN102887830A (en) * | 2012-09-04 | 2013-01-23 | 苏州弘森药业有限公司 | Preparation method of phenoxybenzamine hydrochloride |
US10300015B2 (en) | 2013-06-05 | 2019-05-28 | Pharnext | Stable oral solutions for combined API |
US10849851B2 (en) | 2013-06-05 | 2020-12-01 | Pharnext | Stable oral solutions for combined API |
EP3563841A1 (en) | 2014-08-29 | 2019-11-06 | Pharnext | New therapeutic approaches for treating parkinson's disease |
EP3426349A4 (en) * | 2016-03-09 | 2020-01-01 | Ionis Pharmaceuticals, Inc. | Methods and compositions for inhibiting pmp22 expression |
US11136577B2 (en) | 2016-03-09 | 2021-10-05 | Ionis Pharmaceuticals, Inc. | Methods and compositions for inhibiting PMP22 expression |
US11959080B2 (en) | 2016-03-09 | 2024-04-16 | Ionis Pharmaceuticals, Inc. | Methods and compositions for inhibiting PMP22 expression |
US10940147B2 (en) | 2016-06-10 | 2021-03-09 | Pharnext | Early treatment of CMT disease |
US10383870B2 (en) | 2016-06-10 | 2019-08-20 | Pharnext | Early treatment of CMT disease |
WO2018076060A1 (en) * | 2016-10-26 | 2018-05-03 | Genea Ip Holdings Pty Ltd | Improved generation of muscle lineage cells and therapeutic uses thereof |
CN110730819A (en) * | 2016-10-26 | 2020-01-24 | 索尼克马斯特有限公司 | Improved production of cells of muscle lineage and therapeutic uses thereof |
US10258628B2 (en) | 2016-10-26 | 2019-04-16 | Genea Biocells USA (Holdings), Inc. | Generation of muscle lineage cells and therapeutic uses thereof |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10441558B2 (en) | Therapeutic approaches for treating CMT and related disorders | |
EP2263665A1 (en) | New compositions for treating CMT and related disorders | |
AU2009259336B2 (en) | Combination of pilocarpin and methimazol for treating Charcot-Marietooth disease and related disorders | |
AU2016256808B2 (en) | New therapeutic approaches for treating CMT and related disorders | |
AU2014202258B2 (en) | New therapeutic approaches for treating CMT and related disorders | |
COHEN et al. | Patent 2705408 Summary | |
AU2014256372A1 (en) | New compositions for treating CMT and related disorders |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200880118498.4 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08854467 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2705408 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2008328745 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 205741 Country of ref document: IL |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1016/MUMNP/2010 Country of ref document: IN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 585440 Country of ref document: NZ Ref document number: 2008854467 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2010/005709 Country of ref document: MX |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12744962 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2010535399 Country of ref document: JP |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2008328745 Country of ref document: AU Date of ref document: 20081128 Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 20107014240 Country of ref document: KR Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 201000914 Country of ref document: EA |
|
ENP | Entry into the national phase |
Ref document number: PI0819678 Country of ref document: BR Kind code of ref document: A2 Effective date: 20100527 |