WO2009068313A2 - Brassica plant comprising a mutant indehiscent allele - Google Patents
Brassica plant comprising a mutant indehiscent allele Download PDFInfo
- Publication number
- WO2009068313A2 WO2009068313A2 PCT/EP2008/010147 EP2008010147W WO2009068313A2 WO 2009068313 A2 WO2009068313 A2 WO 2009068313A2 EP 2008010147 W EP2008010147 W EP 2008010147W WO 2009068313 A2 WO2009068313 A2 WO 2009068313A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- sequence
- mutant
- ind
- region
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/10—Seeds
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/20—Brassicaceae, e.g. canola, broccoli or rucola
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/8266—Abscission; Dehiscence; Senescence
Definitions
- Brassica plant comprising a mutant INDEHISCENT allele
- This invention relates to the field of agricultural products, especially crop plants, particularly of the Brassicaceae family, in particular Brassica species, of which the fruit dehiscence properties are modulated. More specifically the invention relates to improved methods and means for reducing seed shattering, or delaying seed shattering until after harvest, in plants such as Brassicaceae plants, particularly Brassicaceae plants grown for seed production, while maintaining at the same time an agronomically relevant treshability of the pods.
- Brassica plants comprising at least two IND genes, in particular Brassica napus plants, and cells, parts, seeds and progeny thereof, characterized in that they comprise three full knock-out mutant ind alleles in their genome, whereby the fruit dehiscence properties are significantly altered.
- methods for generating Brassica plants in which seed shattering is reduced, or in which seed shattering is delayed until after harvest, while an agronomically relevant treshability of the pods is preferably maintained are provided herein, as are seed pods and seeds obtainable from such plants.
- detection tools kits and methods for detecting the presence of one or more mutant ind and/or wild type IND alleles in biological samples, as well as methods for transferring one or more mutant ind and/or wild type IND alleles to other plants and methods for combining different ind and/or IND alleles in plants.
- methods for combining a suitable number of mutant ind alleles, which encode non-functional or no IND proteins and/or IND proteins having significantly reduced activity in vivo in such a way as to significantly reduce seed shattering, or to delay seed shattering until after harvest, while maintaining at the same time an agronomically relevant treshability of the pods.
- seeds and seed oils and the methods and/or kits of the invention are provided. Also provided are methods and means to increase the yield, particularly grain and seed yield.
- the yield increase phenotype may be separate from the reduced or delayed seed shatter phenotype.
- a silique consists of two carpels joined margin to margin. The suture between the margins forms a thick rib, called replum.
- replum a thick rib
- the two valves separate progressively from the replum, along designated lines of weakness in the pod, eventually resulting in the shattering of the seeds that were attached to the replum.
- the dehiscence zone defines the exact location of the valve dissociation.
- seed shatter also referred to as “seed shatter” or “pod shatter”
- pod shatter Shedding of seed (also referred to as “seed shatter” or “pod shatter”) by mature pods before or during crop harvest is a universal phenomenon with crops that develop dry dehiscent fruits.
- Premature seed shatter results in a reduced seed recovery, which represents a problem in crops that are grown primarily for the seeds, such as oil-producing Brassica plants, particularly oilseed rape.
- Another problem related to premature seed shattering is an increase in volunteer growth in the subsequent crop year.
- pod shatter-related yield losses are on average 20% (Child et al, 1998, J Exp Bot 49: 829-838), but can reach up to 50%, depending on the weather conditions (MacLeod, 1981, Harvesting in Oilseed Rape, pp. 107-120 Cambridge Agricultural
- Prakash and Chopra (1988, Plant breeding 101 : 167-168) describe the introgression of resistance to shattering in Brassica napus from Brassica juncea through non-homologous recombination.
- Spence et al. (1996, J of Microscopy 181 : 195-203) describe that some lines of Brassica juncea show a reduced tendency to shatter as compared to Brassica napus lines.
- Morgan et al., 1998 Fields Crop Research 58, 153-165 describe genetic variation for pod shatter resistance among lines of oilseed rape developed from synthetic B. napus and conclude that lines which required much energy to open their pods appeared to have increased vascularisation in the dehiscence zone and to have reduced cell wall degradation within the dehiscence zone.
- Child and Huttly (1999, Proc 10th Int. Rapeseed Congress) describe variation in pod maturation in an irradiation-induced mutant B. napus and a population of its parent cultivar, Jet Neuf, wherein the most resistant wild-type and mutant plants showed much lignification of groups of cells throughout the dehiscence zone and wherein vascular traces situated close to the inner edge of the dehiscence zone in the mutant were described to help to secure the valves. Child et al.
- mutants in the INDEHISCENT gene (referred to as INDl) in Arabidopsis thaliana (Liljegren et al., 2004, Cell 116: 843-853; PCT publication WO 01/79517), as well as in ALCATRAZ (referred to as ALC; Rajani et al. 2001, Current Biology 11, 1914-1922) interfered with pod dehiscence leading to pod shatter resistance.
- ALC FRUITFUL
- SHP and IND a repressor of SHP and IND
- IND an atypical basic helix-loop-helix (bHLH) gene, directs the differentiation of the valve margin into the separation and lignif ⁇ ed layers in Arabidopsis thaliana.
- bHLH basic helix-loop-helix
- FUL and REPLUMLESS (RPL), a homeodomain transcription factor that is expressed in the replum (Roeder et al., 2003, Curr Biol 13, 1630-1635), have been found to set the boundaries of the genes that confer valve margin identity (Gu et al., 1998, Development 125, 1509-1517; Ferrandiz et al, 2000, Science, 289, 436-438; Roeder et al, 2003, supra).
- FILAMENTOUS FLOWER FIL
- YABBY3 YABBY3
- JAG JAGGED
- JAG C2H2 zinc-finger transcription factor
- Liljegren et al. (2004, Cell 116: 843-853) describe five mutant alleles of Arabidopsis IND.
- the lignified cells in the dehiscence zone are either absent or present in plants comprising these mutant alleles depending on the severity of the mutations (severe ind mutants do not contain lignified cells in the region corresponding to the inner part of the valve margin in wild-type plants), but in all cases the silique is indehiscent.
- Wu et al. (2006), Planta 224, 971-979 describe a sixth mutant allele of Arabidopsis IND.
- Plants comprising this mutant allele show no lignified cells at the junctions of the valve margin and the replum, contain fewer cells in a region of seven layers of cells, which appeared to encompass the commonly known dehiscence zone and replum border in wild-type plants, and exhibit incomplete cytokinesis in this layer.
- WO99/00503, WO01/79517 and WO0159122 describe downregulation of the expression of the Arabidopsis ALC, IND, AGLl and AGL5 genes and orthologs thereof using gene-silencing techniques (such as antisense suppression or cosuppression) and mutagenesis.
- Vancanneyt et al., 2002 (XIII International Conference on Arabidopsis Research, Sevilla, Spain June 28-July 2; 2002) reported that the expression of FUL from A. thaliana under control of a CaMV 35S promoter in oilseed rape resulted in a number of pod shatter resistant transformants. Pods of such pod shatter resistant lines had no dehiscence zone, and opening of the pods could only be achieved by random fracture of the valves by applying considerable pressure.
- WO 2004/113542 describes that moderate dsRNA gene silencing of genes involved in the development of the dehiscence zone and valve margins of pods in Brassicaceae plants allows the isolation of transgenic lines with increased pod shatter resistance and reduced seed shattering, the pods of which however may still be opened along the dehiscence zone by applying limited physical forces.
- the inventors have found that the fruit dehiscence properties in Brassica plants can be controlled by controlling the number of IND genes/alleles that are "functionally expressed" in seed pods, i.e. that result in functional (biologically active) IND protein.
- the dehiscence properties of the seed pods can be modified, more specifically pod shatter resistance can be increased and seed shattering can be reduced, or seed shattering can be delayed until after harvest, while maintaining at the same time an agronomically relevant treshability of the pods, such that the pods may still be opened along the dehiscence zone by applying limited physical forces.
- the present invention provides a Brassica plant comprising at least two IND genes, in particular a Brassica napus plant (and parts thereof, such as seed pods and seeds), characterized in that it comprises three full knock-out mutant IND alleles in its genome, in particular of an IND-Al and/or an IND-Cl gene, and wherein the pod shatter resistance of the plant is significantly increased compared to the pod shatter resistance of a plant not comprising mutant IND alleles, but wherein the plant preferably maintains an agronomically relevant treshability of the pods.
- IND genes in particular a Brassica napus plant (and parts thereof, such as seed pods and seeds)
- the pod shatter resistance of the plant is significantly increased compared to the pod shatter resistance of a plant not comprising mutant IND alleles, but wherein the plant preferably maintains an agronomically relevant treshability of the pods.
- the invention provides (isolated) nucleic acid sequences encoding wild type and/or mutant IND proteins, as well as fragments thereof, and methods of using these nucleic acid sequences to modify the fruit dehiscence properties of plants. Also provided are the proteins themselves and their use.
- the invention further relates to a plant, and cells, parts, seeds and progeny thereof, comprising at least one full knock-out mutant IND allele, and thus a reduced amount of functional IND protein compared to a plant, and cells, parts, seeds and progeny thereof, comprising an IND allele encoding the corresponding functional IND protein.
- Such plants, and cells, parts, seeds and progeny thereof can be used for obtaining plants with modified fruit dehiscence properties, in particular for obtaining Brassica plants with significantly reduced seed shattering that maintain an agronomically relevant treshability of the pods.
- plant part includes anything derived from a plant of the invention, including plant parts such as cells, tissues, organs, seeds, seed pods, seed meal, seed cake, seed fats or oils.
- the invention relates to seed pods with modified shatter resistance, which can be obtained from a plant according to the present invention, and the use of said seed pods, for example for planting and growing progeny from the plants.
- methods are provided for generating and selecting plants, and cells, parts, seeds and progeny thereof, containing at least one full knock-out ind allele.
- methods are provided for generating and selecting Brassica plants comprising at least two IND genes, in particular Brassica napus plants, and cells, parts, seeds and progeny thereof, containing at least one full knock-out mutant ind allele present at at least one of the at least two different IND loci in the genome, for example at at least one of the two different loci of the Brassica IND-Al and IND-Cl gene, and to distinguish between the presence of mutant ind alleles and wild type IND alleles in a plant or plant part.
- IND genes in particular Brassica napus plants, and cells, parts, seeds and progeny thereof, containing at least one full knock-out mutant ind allele present at at least one of the at least two different IND loci in the genome, for example at at least one of the two different loci of the Brassica IND-Al and IND-Cl gene, and to distinguish between the presence of mutant ind alleles and wild type IND alleles in a plant or plant part.
- methods for generating and/or identifying ind alleles or plants or plant parts comprising such alleles and for combining a suitable number of ind alleles and/or different types of ind alleles in a single plant, whereby the fruit dehiscence properties of this plant are significantly modified.
- the mutant IND alleles of the invention are used to increase the yield of harvested seed or grain from Brassica plants.
- the increased yield may be a consequence of reducing or delaying seed shattering, but may also be independent from the reduced or delayed seed shatter.
- Brassica plants are provided comprising at least two IND genes, or a cell, part, seed or progeny thereof, characterized in that these plants comprise two mutant homozygous IND alleles as herein described in their genome.
- Figure 1 Schematical representation of the IND-Al gene, encoding a wild-type IND-Al protein from Brassica napus (SEQ ID NO: 5).
- Figure 2 Schematical representation of the IND-Cl gene, encoding a wild-type IND-Cl protein from Brassica napus (SEQ ID NO: 7).
- “Increase of pod shatter resistance” and “reduction of seed shattering”, as used herein, refers to a decreased seed shatter tendency and/or a delay in the timing of seed shattering, in particular until after harvest, of Brassica plants, the fruits of which normally do not mature synchronously, but sequentially, so that some pods burst open and shatter their seeds before or during harvest.
- the level of resistance to pod shattering is positively correlated with and can, for example, be measured by determining the force needed to break pods in the 'tensile separation test' (Davies and Bruce, 1997, J Mat Sci 32: 5895-5899; Morgan et al., 1998, Fields Crop Research 58, 153- 165), the number of intact pods remaining after e.g. 20 sec ('IP20'; Morgan et al, 1998, supra), 9.7 or 17 sec (Bruce et al, 2002, Biosystems Eng 81(2): 179-184) in a 'random impact test', the
- the drum is opened and the number of broken and damaged pods is counted.
- the most accurate estimation of the level of shattering resistance for each line is calculated by fitting a linear x linear curve to all the available data and estimating the time taken for half of the pods within a sample to be broken ("pod sample half-life" or "LD50"). It is important however that pods open mainly along the dehiscence zone, and are not simply pulverized, as may occur with indehiscent pods.
- pod shatter resistance refers to an increase of pod shatter resistance in a plant which results in pod shatter-related yield losses in the field (pre-harvest) below those normally observed for that plant in the field.
- pod shatter-related yield losses in the field are reported to be about 11% for a season with on average good growth conditions and about 25% for a season with on average bad growth conditions.
- a positive correlation has been found between these levels of seed loss and the level of seed loss at 9.7 s and 17 s treatment time, respectively, in the random impact test as described by Bruce et al., 2002 (Biosystems Eng 81(2): 179-184).
- the pod sample half-life ('LD50', see above) of the plant can be compared with the pod sample half-life of a plant known to have an average level of pod shatter resistance, such as, for oilseed rape, all currently commercially available oilseed rape varieties.
- pod or seed shattering or “fruit or pod dehiscence” refers to a process that takes place in a fruit after seed maturation, whereby the valves detach from the central septum freeing the seeds. The region that breaks (i.e. the "dehiscence zone”) runs the entire length of the fruit between the valves and the replum (external septum).
- the "dehiscence zone” is essentially a non-lignified layer of cells between a region of lignified cells in the valve and the replum. Shattering occurs due to the combination of cell wall loosening in the dehiscence zone and the tensions established by the differential mechanical properties of the drying cells in the silique.
- a Brassica “fruit”, as used herein, refers to an organ of a Brassica plant that develops from a gynoecium composed of fused carpels, which, upon fertilization, grows to become a "(seed) pod” or “silique” that contains the developing seeds.
- a Brassica "(seed) pod” or “silique” consists of a fruit wall (carpel) enclosing two locules separated by the septum.
- the "dehiscence zones” develop at the carpel margins adjacent to the septum and run the length of the silique.
- the cells of the dehiscence zone eventually begin to degrade and this weakens the contact between the carpel walls or valves and the septum.
- the loss of cellular cohesion is confined to the cells of the dehiscence zone and results from middle lamella breakdown (Meakin and Roberts, 1990, J Exp Bot 41, 995-1011).
- Dehiscence zones refers to layers of simple, parenchymatous cells, contained in the sutures situated on both sides of the bi-valved pod of plants, in particular Brassica plants.
- the dehiscence zones are situated between the pod valve edge and a central replum that contains the main vascular bundle to the stalk or pedicel. Dissociation of the cells in the dehiscence zone takes place during pod senescence and is complete by the time the pods reach full maturity (Meakin and Roberts, 1990, supra). Valve separation can than take place.
- the dehiscence zone contains vascular traces, which pass from the pod wall to the pedicel (stalk) and the replum.
- the process of pod shatter takes place only after external force fractures the delicate vascular threads, allowing the valves to separate and the seeds to fall to the ground. This occurs during disturbance of the canopy, for example by contact with the combine during harvesting.
- the vascular tissue contains thickened, lignified cells, which form the collenchymatous groups of cells found adjacent to the conductive cells (Meakin and Roberts, 1990, supra). This provides rigidity to the tissue and presumably, some resistance to fracturing.
- an agronomically relevant treshability refers to the resistance of a pod, particularly an oilseed rape pod, to opening along the dehiscence zone of the pod with concurrent release of the seeds, upon application of physical forces that allow complete opening of the pods while preventing damage to the seeds, as they are used e.g. in a combine harvester.
- a positive correlation has been found between a pod sample half-life ('LD50') in a random impact test and their treshability. Oilseed rape pod sample half-lives, as determined in a RIT performed as described in the Examples, which correspond to agronomically relevant treshability should not exceed 80 seconds.
- Typical sample half-life values for control lines of commercially available oilseed rape varieties are about 10 seconds.
- lines with significantly increased pod shatter resistance with agronomically relevant treshability have a pod sample half-life in RIT between about 10 and about 80 seconds, between about 10 and about 60 seconds, between about 10 and about 50 seconds, between about 20 and about 60 seconds, between about 20 and about 50 seconds, between about 40 and about 60 seconds, of about 57 seconds.
- the definition does not encompass weeds, such as Arabidopsis thaliana.
- nucleic acid sequence refers to a DNA or RNA molecule in single or double stranded form, particularly a DNA encoding a protein or protein fragment according to the invention.
- endogenous nucleic acid sequence refers to a nucleic acid sequence within a plant cell, e.g. an endogenous allele of an IND gene present within the nuclear genome of a Brassica cell.
- isolated nucleic acid sequence is used to refer to a nucleic acid sequence that is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.
- gene means a DNA sequence comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. into a pre-mRNA, comprising intron sequences, which is then spliced into a mature mRNA, or directly into a mRNA without intron sequences) in a cell, operable linked to regulatory regions (e.g. a promoter).
- a gene may thus comprise several operably linked sequences, such as a promoter, a 5' leader sequence comprising e.g. sequences involved in translation initiation, a (protein) coding region (cDNA or genomic DNA) and a 3' non-translated sequence comprising e.g. transcription termination sites.
- Endogenous gene is used to differentiate from a “foreign gene", “transgene” or “chimeric gene”, and refers to a gene from a plant of a certain plant genus, species or variety, which has not been introduced into that plant by transformation (i.e. it is not a "transgene"), but which is normally present in plants of that genus, species or variety, or which is introduced in that plant from plants of another plant genus, species or variety, in which it is normally present, by normal breeding techniques or by somatic hybridization, e.g., by protoplast fusion.
- an "endogenous allele” of a gene is not introduced into a plant or plant tissue by plant transformation, but is, for example, generated by plant mutagenesis and/or selection or obtained by screening natural populations of plants.
- “Expression of a gene” or “gene expression” refers to the process wherein a DNA region, which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA molecule. The RNA molecule is then processed further (by post-transcriptional processes) within the cell, e.g. by RNA splicing and translation initiation and translation into an amino acid chain (polypeptide), and translation termination by translation stop codons.
- the term “functionally expressed” is used herein to indicate that a functional protein is produced; the term “not functionally expressed” to indicate that a protein with significantly reduced or no functionality (biological activity) is produced or that no protein is produced (see further below).
- protein or “polypeptide” are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3 -dimensional structure or origin. A “fragment” or “portion” of an IND protein may thus still be referred to as a "protein”.
- isolated protein is used to refer to a protein that is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.
- transcription factor is used to refer to a protein consisting of at least two discrete domains - a DNA binding domain and an activation or repression domain - that operate together to modulate the rate of transcriptional initiation from target gene promoters (Ptashne, 1988, Nature 335, 683- 689).
- basic helix-loop-helix (bHLH) domain transcription factor is used to refer to a transcription factor comprising, apart from the bHLH DNA binding domain (Heim et al, 2003, MoI Biol Evol 20, 735-747; Toledo-Ortiz et al, 2003, Plant Cell 15, 1749-1770), domains which are known to be important for the regulation of gene expression which may be conserved at the amino acid level in related proteins from different species (Quong et al, 1993, MoI Cell Biol 13, 792-800).
- Transcriptional regulators comprising a bHLH domain bind DNA through residues in the basic region while the helix-loop-helix domain promotes dimerization, allowing family members to form hetero- or homodimers (Murre et al., 1989, Cell 56, 777-783).
- IND gene refers herein to a nucleic acid sequence encoding an INDEHISCENT (IND) protein, which is a bHLH domain transcription factor required for seed dispersal (Liljegren et al, 2004, Cell 1 16: 843-853).
- allele(s) means any of one or more alternative forms of a gene at a particular locus. In a diploid (or amphidiploid) cell of an organism, alleles of a given gene are located at a specific location or locus (loci plural) on a chromosome. One allele is present on each chromosome of the pair of homologous chromosomes.
- homologous chromosomes means chromosomes that contain information for the same biological features and contain the same genes at the same loci but possibly different alleles of those genes.
- Homologous chromosomes are chromosomes that pair during meiosis.
- Non-homologous chromosomes representing all the biological features of an organism, form a set, and the number of sets in a cell is called ploidy. Diploid organisms contain two sets of non-homologous chromosomes, wherein each homologous chromosome is inherited from a different parent.
- amphidiploid species essentially two sets of diploid genomes exist, whereby the chromosomes of the two genomes are referred to as "homeologous chromosomes" (and similarly, the loci or genes of the two genomes are referred to as homeologous loci or genes).
- a diploid, or amphidiploid, plant species may comprise a large number of different alleles at a particular locus.
- heterozygous means a genetic condition existing when two different alleles reside at a specific locus, but are positioned individually on corresponding pairs of homologous chromosomes in the cell.
- homozygous means a genetic condition existing when two identical alleles reside at a specific locus, but are positioned individually on corresponding pairs of homologous chromosomes in the cell.
- locus means a specific place or places or a site on a chromosome where for example a gene or genetic marker is found.
- 11 IND-Al locus refers to the position on a chromosome of the A genome where the IND-Al gene (and two IND-Al alleles) may be found
- IND-Cl locus refers to the position on a chromosome of the C genome where the IND-Cl gene (and two IND-Cl alleles) may be found.
- plant or “plants” according to the invention
- plant parts cells, tissues or organs, seed pods, seeds, severed parts such as roots, leaves, flowers, pollen, etc.
- progeny of the plants which retain the distinguishing characteristics of the parents such as seed obtained by selfing or crossing, e.g. hybrid seed (obtained by crossing two inbred parental lines), hybrid plants and plant parts derived there from are encompassed herein, unless otherwise indicated.
- a “molecular assay” refers herein to an assay that indicates (directly or indirectly) the presence or absence of one or more particular IND alleles at one or both IND loci (e.g. at one or both of the IND-Al or IND-Cl loci). In one embodiment it allows one to determine whether a particular (wild type or mutant) allele is homozygous or heterozygous at the locus in any individual plant.
- Wild type refers to a typical form of a plant or a gene as it most commonly occurs in nature.
- a wild type plant refers to a plant with the most common phenotype of such plant in the natural population.
- a wild type allele refers to an allele of a gene required to produce the wild-type phenotype.
- a “mutant plant” refers to a plant with a different rare phenotype of such plant in the natural population or produced by human intervention, e.g. by mutagenesis, and a “mutant allele” refers to an allele of a gene required to produce the mutant phenotype.
- wild type IND e.g. wild type IND-Al or IND-Cl
- IND-Al or IND-Cl means a naturally occurring IND allele found within plants, in particular Brassicacea plants, especially Brassica plants, which encodes a functional IND protein (e.g. a functional IND-Al or IND-Cl, respectively).
- mutant IND e.g. mutant IND-Al or IND-Cl
- IND-Al or IND-Cl refers to an IND protein having no biological activity or a significantly reduced biological activity as compared to the corresponding wild-type functional IND protein, or encoding no IND protein at all.
- a "mutant IND allele” also called “full knock-out” or “null” allele
- a "full knock-out IND allele” is a mutant IND allele the presence of which in homozygous state at each IND locus in the plant (e.g. a Brassica napus plant with two full knock-out IND-Al alleles and two full knock-out IND-Cl alleles) results in an increase of pod shatter resistance in that plant which is too high to be still agronomically relevant.
- Mutant alleles of the IND protein-encoding nucleic acid sequences are designated as "ind” (e.g. ind-al or ind-cl, respectively) herein.
- Mutant alleles can be either "natural mutant” alleles, which are mutant alleles found in nature (e.g. produced spontaneously without human application of mutagens) or "induced mutant” alleles, which are induced by human intervention, e.g. by mutagenesis.
- a "significantly reduced amount of functional IND protein” refers to a reduction in the amount of a functional IND protein produced by the cell comprising a mutant IND allele by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% (i.e. no functional IND protein is produced by the cell) as compared to the amount of the functional IND protein produced by the cell not comprising the mutant IND allele.
- This definition encompasses the production of a "non- functional" IND protein (e.g. truncated IND protein) having no biological activity in vivo, the reduction in the absolute amount of the functional IND protein (e.g.
- mutant IND protein refers to an IND protein encoded by a mutant IND nucleic acid sequence ("ind allele") whereby the mutation results in a significantly reduced and/or no IND activity in vivo, compared to the activity of the IND protein encoded by a non-mutant, wild type IND sequence ⁇ "IND allele").
- “Mutagenesis” refers to the process in which plant cells (e.g., a plurality of Brassica seeds or other parts, such as pollen, etc.) are subjected to a technique which induces mutations in the DNA of the cells, such as contact with a mutagenic agent, such as a chemical substance (such as ethylmethylsulfonate (EMS), ethylnitrosourea (ENU), etc.) or ionizing radiation (neutrons (such as in fast neutron mutagenesis, etc.), alpha rays, gamma rays (such as that supplied by a Cobalt 60 source), X-rays, UV-radiation, etc.), or a combination of two or more of these.
- a mutagenic agent such as a chemical substance (such as ethylmethylsulfonate (EMS), ethylnitrosourea (ENU), etc.) or ionizing radiation (neutrons (such as in
- the desired mutagenesis of one or more IND alleles may be accomplished by use of chemical means such as by contact of one or more plant tissues with ethylmethylsulfonate (EMS), ethylnitrosourea, etc., by the use of physical means such as x-ray, etc, or by gamma radiation, such as that supplied by a Cobalt 60 source. While mutations created by irradiation are often large deletions or other gross lesions such as translocations or complex rearrangements, mutations created by chemical mutagens are often more discrete lesions such as point mutations.
- chemical means such as by contact of one or more plant tissues with ethylmethylsulfonate (EMS), ethylnitrosourea, etc.
- EMS alkylates guanine bases which results in base mispairing: an alkylated guanine will pair with a thymine base, resulting primarily in G/C to A/T transitions.
- Brassica plants are regenerated from the treated cells using known techniques. For instance, the resulting Brassica seeds may be planted in accordance with conventional growing procedures and following self-pollination seed is formed on the plants.
- doubled haploid plantlets may be extracted to immediately form homozygous plants, for example as described by Coventry et al. (1988, Manual for Microspore Culture Technique for Brassica napus. Dep. Crop Sci. Techn. Bull. OAC Publication 0489. Univ.
- DeleteageneTM Delete-a-gene; Li et al, 2001, Plant J 27: 235-242
- TILLING targeted induced local lesions in genomes
- non-naturally occurring when used in reference to a plant, means a plant with a genome that has been modified by man.
- a transgenic plant for example, is a non- naturally occurring plant that contains an exogenous nucleic acid molecule, e.g., a chimeric gene comprising a transcribed region which when transcribed yields a biologically active RNA molecule capable of reducing the expression of an endogenous gene, such as an IND gene according to the invention, and, therefore, has been genetically modified by man.
- a plant that contains a mutation in an endogenous gene for example, a mutation in an endogenous IND gene, (e.g.
- a plant of a particular species such as Brassica napus, that contains a mutation in an endogenous gene, for example, in an endogenous IND gene, that in nature does not occur in that particular plant species, as a result of, for example, directed breeding processes, such as marker-assisted breeding and selection or introgression, with a plant of the same or another species, such as Brassica juncea or rapa, of that plant is also considered a non-naturally occurring plant.
- a plant containing only spontaneous or naturally occurring mutations i.e.
- a plant that has not been genetically modified by man is not a "non-naturally occurring plant" as defined herein and, therefore, is not encompassed within the invention.
- a non-naturally occurring plant typically has a nucleotide sequence that is altered as compared to a naturally occurring plant
- a non-narurally occurring plant also can be genetically modified by man without altering its nucleotide sequence, for example, by modifying its methylation pattern.
- ortholog of a gene or protein refers herein to the homologous gene or protein found in another species, which has the same function as the gene or protein, but is (usually) diverged in sequence from the time point on when the species harboring the genes diverged (i.e. the genes evolved from a common ancestor by speciation).
- Orthologs of the Brassica napus IND genes may thus be identified in other plant species (e.g. Brassica juncea, etc.) based on both sequence comparisons (e.g. based on percentages sequence identity over the entire sequence or over specific domains) and/or functional analysis.
- a "variety" is used herein in conformity with the UPOV convention and refers to a plant grouping within a single botanical taxon of the lowest known rank, which grouping can be defined by the expression of the characteristics resulting from a given genotype or combination of genotypes, can be distinguished from any other plant grouping by the expression of at least one of the said characteristics and is considered as a unit with regard to its suitability for being propagated unchanged (stable).
- sequence identity of two related nucleotide or amino acid sequences, expressed as a percentage, refers to the number of positions in the two optimally aligned sequences which have identical residues (xlOO) divided by the number of positions compared.
- a gap i.e., a position in an alignment where a residue is present in one sequence but not in the other, is regarded as a position with non-identical residues.
- the default scoring matrix used is EDNAFULL and for proteins the default scoring matrix is EBLOSUM62.
- Substantially identical or “essentially similar”, as used herein, refers to sequences, which, when optimally aligned as defined above, share at least a certain minimal percentage of sequence identity (as defined further below).
- Stringent hybridization conditions can be used to identify nucleotide sequences, which are substantially identical to a given nucleotide sequence. Stringent conditions are sequence dependent and will be different in different circumstances. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequences at a defined ionic strength and pH. The T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Typically stringent conditions will be chosen in which the salt concentration is about 0.02 molar at pH 7 and the temperature is at least 60°C. Lowering the salt concentration and/or increasing the temperature increases stringency.
- Stringent conditions for RNA-DNA hybridizations are for example those which include at least one wash in 0.2X SSC at 63°C for 20min, or equivalent conditions.
- High stringency conditions can be provided, for example, by hybridization at 65 °C in an aqueous solution containing 6x SSC (2Ox SSC contains 3.0 M NaCl, 0.3 M Na-citrate, pH 7.0), 5x Denhardt's (10OX Denhardt's contains 2% Ficoll, 2% Polyvinyl pyrollidone, 2% Bovine Serum Albumin), 0.5% sodium dodecyl sulphate (SDS), and 20 ⁇ g/ml denaturated carrier DNA (single-stranded fish sperm DNA, with an average length of 120 - 3000 nucleotides) as nonspecific competitor. Following hybridization, high stringency washing may be done in several steps, with a final wash (about 30 min) at the hybridization temperature in 0.2-0. l ⁇ SSC, 0.1% SDS.
- Moderate stringency conditions refers to conditions equivalent to hybridization in the above described solution but at about 60-62°C. Moderate stringency washing may be done at the hybridization temperature in Ix SSC, 0.1% SDS. "Low stringency” refers to conditions equivalent to hybridization in the above described solution at about 50-52°C. Low stringency washing may be done at the hybridization temperature in 2x SSC, 0.1% SDS. See also Sambrook et al (1989) and Sambrook and Russell (2001).
- “Increased harvested yield” or “increased seed or grain yield” refers to the larger amount of seed or grain harvested from a plurality of plants, each comprising mutant IND alleles according to the invention, when compared to the amount of seed or grain harvested from a similar number of isogenic plants without the mutant IND alleles.
- Yield is typically expressed in volume units of harvested seed per surface units, such as bushels/acre or Kg/ha.
- the yield increase is typically expressed in percentage, whereby the yield of the reference or control plant is referred to as 100% and the yield of the plants according to the inventions is expressed in % relative to the yield of the control plant.
- Observed yield increases in Brassica plants according to the invention ranged from at least 101% to at least 124% and it is expected that higher yield increases are feasible. Yield increase may also range from 104% to 108% or 105% to 110%.
- IND-Al A genome
- MD-C/ C genome
- each IND gene can be present in vivo for each IND gene at each IND locus in the genome (one allele being the gene sequence found on one chromosome and the other on the homologous chromosome).
- the nucleotide sequence of these two alleles may be identical (homozygous plant) or different (heterozygous plant) in any given plant, although the number of different possible alleles existing for each IND gene may be much larger than two in the species population as a whole.
- Brassica napus plants which are homozygous for a full knockout ind allele in only one of the two IND genes, i.e. in IND-Al or IND-Cl, do not show a significant increase in pod shatter resistance compared to Brassica napus plants not comprising mutant IND alleles, while in Brassica napus plants, which are homozygous for a full knockout ind allele in both IND genes, pod shatter resistance is significantly increased, but the level of pod shatter resistance is too high to maintain an agronomically relevant treshability.
- pod shatter resistance is significantly increased in Brassica napus plants comprising three full knockout ind alleles of the two Brassica napus IND genes, to a level whereby the plants maintain an agronomically relevant treshability of the pods. It is thought that the presence of three full knockout ind alleles in a Brassica plant comprising at least two IND genes, in particular in a Brassica napus plant comprising an IND-Al and an IND-Cl gene, may be required in order to obtain a plant, which shows an increased pod shatter resistance, while maintaining an agronomically relevant treshability of the pods.
- a Brassica plant comprising at least two IND genes, in particular a Brassica napus plant comprising an IND-Al and an IND-Cl gene, comprising 3 ind alleles is provided herein, whereby the ind alleles result in a significantly reduced amount of functional IND protein of the type encoded by the wild-type equivalent of these mutant alleles and thus an overall significantly reduced amount of the functional IND proteins produced in the plant cells, specifically in the developing seed pods, in vivo.
- IND proteins can thus be tuned in such a way as to provide plants that produce sufficient IND protein(s) to enable an agronomically relevant treshability of the seed pods, while reducing seed shattering before or during harvest.
- a plant in particular a Brassica plant, comprising at least one functionally expressed IND allele, which encodes a fully functional IND protein, while the remaining alleles may be (mutant) ind alleles.
- an homozygous IND single mutant Brassica napus plant is provided herein, wherein the genotype of the plant can be described as ind-al/ind- al, IND-Cl /IND-Cl, or IND-Al /IND-Al, ind-cl/ind-cl.
- an homozygous IND double mutant Brassica napus plant is provided herein, wherein the genotype of the plant can be described as ind-al/ind-al, ind-cl/ind-cl.
- an homozygous IND single mutant Brassica napus plant comprising one further mutant IND allele is provided herein, wherein the genotype of the plant can be described as ind-al/ind-al, IND-Cl/ ind-cl, or IND-Al /ind-al, ind-cl/ind-cl.
- nucleic acid sequences of wild type and mutant IND genes/alleles from Brassica species are also provided herein.
- the use of these plants for transferring mutant IND alleles to other plants is also an embodiment of the invention, as are the plant products of any of the plants described.
- kits and methods for marker assisted selection (MAS) for combining or detecting IND genes and/or alleles are provided.
- MAS marker assisted selection
- the Brassica plants described herein which exhibit reduced or delayed seed shattering have an increase in the yield of harvested seed.
- the harvested seed yield from Brassica plants comprising only two mutant IND alleles in homozygous state i.e. wherein the genotype of the plant can be described as ind-al/ind-al, IND- Cl/ IND-Cl, or IND-Al/ IND-Al, ind-cl/ind-cl was also significantly increased, when compared to isogenic Brassica plants not comprising the mutant IND alleles, despite the absence of an observable reduced or delayed seed shatter phenotype in the Brassica plants comprising the mutant IND alleles.
- the invention thus also provides Brassica plants comprising at least two IND genes, wherein at least two alleles produce a functional IND protein, which plants have a higher seed yield. It will be clear that the two mutant alleles at the IND-A locus or at the IND-C locus may be the same mutant allele or a different mutant allele.
- Nucleic acid sequences according to the invention Provided are both wild type IND nucleic acid sequences encoding functional IND proteins and mutant ind nucleic acid sequences (comprising one or more mutations, preferably mutations which result in no or a significantly reduced biological activity of the encoded IND protein or in no IND protein being produced) of IND genes from Brassicaceae, particularly from Brassica species, especially from Brassica napus, but also from other Brassica crop species.
- Brassica species comprising an A and/or a C genome may comprise different alleles of IND-A or IND-C genes, which can be identified and combined in a single plant according to the invention.
- mutagenesis methods can be used to generate mutations in wild type IND alleles, thereby generating mutant ind alleles for use according to the invention.
- specific IND alleles are preferably combined in a plant by crossing and selection
- the IND and/or ind nucleic acid sequences are provided within a plant (i.e. endogenously), e.g. a Brassica plant, preferably a Brassica plant which can be crossed with Brassica napus or which can be used to make a "synthetic" Brassica napus plant.
- a plant i.e. endogenously
- a Brassica plant preferably a Brassica plant which can be crossed with Brassica napus or which can be used to make a "synthetic" Brassica napus plant.
- Hybridization between different Brassica species is described in the art, e.g., as referred to in Snowdon (2007, Chromosome research 15: 85-95).
- Interspecific hybridization can, for example, be used to transfer genes from, e.g., the C genome in B. napus (AACC) to the C genome in B. carinata (BBCC), or even from, e.g., the C genome in B. napus (AACC) to the B genome in B. juncea (AABB) (by the sporadic event of illegitimate recombination between their C and B genomes).
- "Resynthesized” or “synthetic" Brassica napus lines can be produced by crossing the original ancestors, B. oleracea (CC) and B. rapa (AA).
- Interspecific, and also intergeneric, incompatibility barriers can be successfully overcome in crosses between Brassica crop species and their relatives, e.g., by embryo rescue techniques or protoplast fusion (see e.g. Snowdon, above).
- isolated IND and ind nucleic acid sequences e.g. isolated from the plant by cloning or made synthetically by DNA synthesis
- variants thereof and fragments of any of these are also provided herein, as these can be used to determine which sequence is present endogenously in a plant or plant part, whether the sequence encodes a functional, a nonfunctional or no protein (e.g. by expression in a recombinant host cell as described below) and for selection and transfer of specific alleles from one plant into another, in order to generate a plant having the desired combination of functional and mutant alleles.
- Nucleic acid sequences of IND-Al and IND-Cl have been isolated from Brassica napus as depicted in the sequence listing.
- the wild type IND sequences are depicted, while the mutant ind sequences of these sequences, and of sequences essentially similar to these, are described herein below and in the Examples, with reference to the wild type IND sequences.
- the genomic IND protein-encoding DNA from Brassica napus does not comprise any introns.
- IND-Al nucleic acid sequences or “IND-Al variant nucleic acid sequences” according to the invention are nucleic acid sequences encoding an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 2 or nucleic acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 5.
- These nucleic acid sequences may also be referred to as being "essentially similar” or "essentially identical” to the IND sequences provided in the sequence listing.
- IND-Cl nucleic acid sequences or “IND-Cl variant nucleic acid sequences” according to the invention are nucleic acid sequences encoding an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 4 (IND-Cl -long) or with SEQ ID NO: 4 from the amino acid at position 16 to the amino acid at position 210 (IND-Cl -short) or nucleic acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 3 (IND-Cl -long), with SEQ ID NO:3 from the nucleotide at position 46 to the nucleotide at position 633 (IND-Cl -short) or with SEQ ID NO: 7.
- These nucleic acid sequences may also be referred to as being "essentially similar” or "essentially identical
- the invention provides both nucleic acid sequences encoding wild type, functional IND-Al and IND-Cl proteins, including variants and fragments thereof (as defined further below), as well as mutant nucleic acid sequences of any of these, whereby the mutation in the nucleic acid sequence preferably results in one or more amino acids being inserted, deleted or substituted in comparison to the wild type IND protein.
- the mutation(s) in the nucleic acid sequence result in one or more amino acid changes (i.e. in relation to the wild type amino acid sequence one or more amino acids are inserted, deleted and/or substituted) whereby the biological activity of the IND protein is significantly reduced or completely abolished.
- a significant reduction in or complete abolishment of the biological activity of the IND protein refers herein to a reduction in or abolishment of the DNA binding activity, the dimerization capacity and/or transcriptional regulating activity of the IND protein, such that the pod shatter resistance of a plant expressing the mutant IND protein is increased as compared to a plant expressing the corresponding wild type IND protein.
- the level of resistance to pod shattering in the plants can be determined by performing macroscopical, microscopical and histological assays on fruits and flowers of the plants comprising the specific IND allele/protein and of corresponding wild type plants analogous to the assays performed on Arabidopsis fruits and flowers as described by Liljegren et al. (2004, supra) or as described in the Examples below.
- changes in pod shatter resistance can be evaluated and/or measured, e.g., by macroscopical tests, such as inspection of the seed pods with naked eye to evaluate, e.g., the presence or absence of the valve margins, the length of the beak of the pods, etc.; a Manual Impact Test (MIT) to compare the level of pod shatter resistance between different mutant IND lines and corresponding wild type lines by evaluating the ease of pod opening upon gently twisting the pods; a Random Impact Test (RIT) to compare the treshability of seed pods from plants from different mutant IND lines and corresponding wild type lines, respectively, by measuring the half-life of pod samples of these lines; and/or by microscopic tests to examine, e.g., whether and how cells at the valve margin and the dehiscence zone of seed pods are affected by mutations in IND.
- macroscopical tests such as inspection of the seed pods with naked eye to evaluate, e.g., the presence or absence of the valve margins, the length of the beak
- the dimerization partner of the IND protein e.g., the IND protein itself in case its functioning depends on the formation of an homodimer or another protein in case its functioning depends on the formation of an heterodimer
- the gene(s) the transcription of which is regulated by the IND protein are identified and characterized
- the functionality of a specific IND allele/protein can alternatively be evaluated by recombinant DNA techniques as known in the art, e.g., by co-expressing both partners of the dimer in a host cell (e.g. a bacterium, such as E. col ⁇ ) and evaluating if dimers can still be formed, if the dimers can still bind to the bHLH binding site of the regulated gene(s), and/or if the transcription of these gene(s) is still regulated by this binding.
- a host cell e.g. a bacterium, such as E. col ⁇
- fragments of the IND sequences and IND variant nucleic acid sequences defined above for use as primers or probes and as components of kits according to another aspect of the invention (see further below).
- a "fragment" of a IND or ind nucleic acid sequence or variant thereof (as defined) may be of various lengths, such as at least 10, 12, 15, 18, 20, 50, 100, 200, 500, 600 contiguous nucleotides of the /TVD or ind sequence (or of the variant sequence).
- nucleic acid sequences depicted in the sequence listing encode wild type, functional IND proteins from Brassica napus. Thus, these sequences are endogenous to the Brassica napus plants from which they were isolated. Other Brassica crop species, varieties, breeding lines or wild accessions may be screened for other IND alleles, encoding the same IND proteins or variants thereof.
- nucleic acid hybridization techniques e.g.
- Southern blot analysis using for example stringent hybridization conditions
- PCR-based techniques may be used to identify /7VD alleles endogenous to other Brassica plants, such as various Brassica napus varieties, lines or accessions, but also Brassica juncea (especially IND alleles on the A-genome), Brassica carinata (especially IND alleles on the C-genome) and Brassica rapa (A-genome) and Brassica oleracea (C-genome) plants, organs and tissues can be screened for other wild type IND alleles.
- Brassica juncea especially IND alleles on the A-genome
- Brassica carinata especially IND alleles on the C-genome
- Brassica rapa A-genome
- Brassica oleracea Brassica oleracea
- /ND nucleic acid sequences provided in the sequence listing, or variants or fragments of any of these, may be used.
- whole sequences or fragments may be used as probes or primers.
- specific or degenerate primers may be used to amplify nucleic acid sequences encoding IND proteins from the genomic DNA of the plant, plant organ or tissue.
- These /ND nucleic acid sequences may be isolated and sequenced using standard molecular biology techniques. Bioinformatics analysis may then be used to characterize the allele(s), for example in order to determine which /ND allele the sequence corresponds to and which I ⁇ D protein or protein variant is encoded by the sequence.
- Whether a nucleic acid sequence encodes a functional I ⁇ D protein can be analyzed by recombinant D ⁇ A techniques as known in the art, e.g., by a genetic complementation test using, e.g., an Arabidopsis plant, which is homozygous for a full knock-out ind mutant allele or a Brassica napus plant, which is homozygous for a full knock-out ind mutant allele of both the I ⁇ D- Al and I ⁇ D-C1 gene.
- nucleic acid sequences and variants thereof may be identified in silico, by screening nucleic acid databases for essentially similar sequences.
- a nucleic acid sequence may be synthesized chemically. Fragments of nucleic acid molecules according to the invention are also provided, which are described further below. Fragments include nucleic acid sequences encoding only the bHLH domain, or smaller fragments comprising part of the bHLH domain, such as the basic domain or the HLH domain, etc.
- Nucleic acid sequences comprising one or more nucleotide deletions, insertions or substitutions relative to the wild type nucleic acid sequences are another embodiment of the invention, as are fragments of such mutant nucleic acid molecules.
- Such mutant nucleic acid sequences can be generated and/or identified using various known methods, as described further below. Again, such nucleic acid molecules are provided both in endogenous form and in isolated form.
- the mutation(s) result in one or more changes (deletions, insertions and/or substitutions) in the amino acid sequence of the encoded IND protein (i.e. it is not a "silent mutation").
- the mutation(s) in the nucleic acid sequence result in a significantly reduced or completely abolished biological activity of the encoded IND protein relative to the wild type protein.
- the nucleic acid molecules may, thus, comprise one or more mutations, such as:
- a "nonsense mutation” or "STOP codon mutation” which is a change in the nucleic acid sequence that results in the introduction of a premature STOP codon and thus the termination of translation (resulting in a truncated protein); plant genes contain the translation stop codons "TGA” (UGA in RNA), "TAA” (UAA in RNA) and “TAG” (UAG in RNA); thus any nucleotide substitution, insertion, deletion which results in one of these codons to be in the mature mRNA being translated (in the reading frame) will terminate translation.
- a frameshift mutation resulting in the nucleic acid sequence being translated in a different frame downstream of the mutation.
- a frameshift mutation can have various causes, such as the insertion, deletion or duplication of one or more nucleotides.
- the mutation(s) in the nucleic acid sequence preferably result in a mutant protein comprising significantly reduced or no biological activity in vivo or in the production of no protein Basically, any mutation which results in a protein comprising at least one amino acid insertion, deletion and/or substitution relative to the wild type protein can lead to significantly reduced or no biological activity.
- mutant IND protein mutations in certain parts of the protein are more likely to result in a reduced function of the mutant IND protein, such as mutations leading to truncated proteins, whereby significant portions of the functional domains, such as the DNA binding domain ('b'), the dimerization domain ('HLH') and/or transcription regulating domains, are lacking.
- the Arabidopsis INDEHISCENT protein (locus At4gOO 120.1; SEQ ID NO: 10) is 198 amino acids in length and comprises a "basic helix-loop-helix (bHLH) dimerisation" domain located between the amino acids at position 121 and 168 (pfam domain PFOOOlO), between the amino acids at position 124 and 173 (smart domain SM00353), or between the amino acids at position 112 and 168 (prosite domain PS50888) and an "helix-loop- helix (HLH) DNA binding" domain between the amino acids at position 114 and 196 or 198 (superfam domain G3D.4.10.280.10 or SSF47459, respectively) of SEQ ID NO: 10.
- bHLH basic helix-loop-helix
- HHLH helix-loop-helix
- the IND-Al protein of Brassica described herein is about 185 amino acids in length (SEQ ID NO:2) and the IND-Cl protein about 195 (SEQ ID NO:4 from the amino acid at position 16 to 210) or 210 (SEQ ID NO:4) amino acids and they comprise the "basic bHLH dimerisation" domain located between the amino acids at position 120 and 167 in SEQ ID NO: 2 and position 133 and 180 in SEQ ID NO: 4 (pfam domain PFOOOlO), between the amino acids at position 123 and 172 in SEQ ID NO: 2 and position 136 and 185 in SEQ ID NO: 4 (smart domain SM00353), or between the amino acids at position 111 and 167 in SEQ ID NO: 2 and position 124 and 180 in SEQ ID NO: 4 (prosite domain PS50888) and the "HLH DNA binding" domain between the amino acids at position 127 and 208 or 210 in SEQ ID NO: 4 (superfam domain G3D.4.10.280.10 or
- the consensus bHLH domain sequence of 133 Arabidopsis bHLH transcription factor genes consists of approximately 56 amino acids (Heim et al, Fig. 1; corresponding to position 119-174 in SEQ ID NO: 10).
- This bipartite domain comprises (1) the basic region, located at the N-terminal end of the domain, which is involved in DNA binding and consists of about 13 amino acids with a high number of basic residues ("b"; corresponding to position 119-131 in SEQ ID NO: 10), and (2) the helix- loop-helix region, located at the C-terminal end, which functions as a dimerization domain and is constituted of about 43 mainly hydrophobic amino acid residues (corresponding to position 132- 174 in SEQ ID NO: 10) that form two amphipathic alpha-helices of about 15 amino acids (“Hl”; corresponding to position 132-146 in SEQ ID NO: 10) and 22 amino acids ("H2"; corresponding to position 153-174 in SEQ ID NO: 10), respectively, separated by a loop region of about 6 and up to about 14 amino acids ("L”; corresponding to position 147-152 in SEQ ID NO: 10), which is the most divergent region of the bHLH domain in terms of size and amino acid composition
- the 5-9-13. motif of the bHLH domain encoded by Arabidopsis gene At4g00120 consists of amino acid residues GIn (Q), Ala (A) and Arg (R), respectively (corresponding to positions 123, 127 and 131, respectively, in SEQ ID NO: 10) ( Figure 4 of Heim et al. ⁇ supra).
- Such plant proteins which have a variation of the H-E-R configuration, may further contain helix-breaking prolines in the basic region, e.g. members of Group VIII and X, characteristics that may interfere with affinity for DNA.
- the bHLH domain of the Arabidopsis bHLH transcription factor family consists of approximately 56 amino acids (Toledo-Ortiz et al; corresponding to position 115-167 in SEQ ID NO: 10).
- This bipartite domain comprises (1) the basic region, located at the N-terminal end of the domain, which is involved in DNA binding and consists of about 17 amino acids with a high number of basic residues ("b"; corresponding to position 115-131 in SEQ ID NO: 10), and (2) the HLH region, located at the C-terminal end, which functions as a dimerization domain and is constituted of about 39 mainly hydrophobic amino acid residues (corresponding to position 132- 167 in SEQ ID NO: 10) that form two amphipathic alpha-helices of about 15 amino acids ("Hl” corresponding to position 132-146 in SEQ ID NO: 10, and "H2" corresponding to position 152- 167 in SEQ ID NO: 10) separated by a loop region of about 9 amino acids ("L”; corresponding to position 147-151 in SEQ ID NO: 10), which is the most divergent region of the bHLH domain in terms of size and amino acid composition.
- the identified conserved amino acids correspond to the amino acids at position 1, 2, 13, 14, 16 (in b); 20, 21, 24, 27, 28 (in Hl); 39 (in L); 42, 45, 46, 49, 50, 52, 53, and 56 (in H2) of the Arabidopsis bHLH domain defined by Toledo-Ortiz et ⁇ /.(2003, supra), which correspond to the amino acids at position 115, 116, 127, 128, 130 (in b); 134, 135, 138, 141, 142 (in Hl); 150 (in L); 153, 156, 157, 160, 161, 163, 164, and 167 (in H2) of SEQ ID NO: 10. According to Liljegren et al.
- the bHLH domain of the Arabidopsis IND gene comprises a basic region of 13 amino acids (SEQ ID NO: 10 from the amino acid at position 119 to 131) and two alpha-helices of 14 and 15 amino acids, respectively, (SEQ ID NO: 10 from the amino acid at position 132-145 and from the amino acid at position 153 to 167, respectively) separated by a variable loop region of 7 amino acids (SEQ ID NO: 10 from the amino acid at position 146 to 152).
- Optimal alignment of the Arabidopsis IND nucleic acid (SEQ ID NO: 9) and amino acid (SEQ ID NO: 10) sequences with /ND nucleic acid sequences, in particular the Brassica IND nucleic acid (SEQ ID NO: 1 and 3) and amino acid (SEQ ID NO: 2 and 4) sequences of the present invention allows to determine the positions of the corresponding conserved domains and amino acids in these Brassica sequences (see Table 1 for the Brassica IND sequences of SEQ ID NO: 1 to 4).
- nucleic acid sequences comprising one or more of any of the types of mutations described above are provided.
- ind sequences comprising one or more stop codon (nonsense) mutations, one or more missense mutations and/or one or more frameshift mutations are provided. Any of the above mutant nucleic acid sequences are provided per se (in isolated form), as are plants and plant parts comprising such sequences endogenously.
- nonsense stop codon
- a nonsense mutation in an IND allele is a mutation in an IND allele whereby one or more translation stop codons are introduced into the coding DNA and the corresponding mRNA sequence of the corresponding wild type IND allele.
- Translation stop codons are TGA (UGA in the mRNA), TAA (UAA) and TAG (UAG).
- a mutant IND allele comprising a nonsense mutation is an IND allele wherein an in-frame stop codon is introduced in the IND codon sequence by a single nucleotide substitution, such as the mutation of CAG to TAG, TGG to TAG, TGG to TGA, or CAA to TAA.
- a mutant IND allele comprising a nonsense mutation is an /ND allele wherein an in-frame stop codon is introduced in the /ND codon sequence by double nucleotide substitutions, such as the mutation of CAG to TAA, TGG to TAA, or CGG to TAG or TGA.
- a mutant /ND allele comprising a nonsense mutation is an /ND allele wherein an in-frame stop codon is introduced in the IND codon sequence by triple nucleotide substitutions, such as the mutation of CGG to TAA.
- the truncated protein lacks the amino acids encoded by the coding DNA downstream of the mutation (i.e. the C-terminal part of the IND protein) and maintains the amino acids encoded by the coding DNA upstream of the mutation (i.e. the N- terminal part of the IND protein).
- a mutant /TVD allele comprising a nonsense mutation is an IND allele wherein the nonsense mutation is present anywhere in front of the conserved Leu residue of the H2 domain (at position 56 in the consensus bHLH domain sequence as described by Heim et ah, 2003, see above), so that at least the conserved Leu residue is lacking.
- a mutant IND allele comprising a nonsense mutation which results in a truncated protein of less than about 170 amino acids (lacking the conserved Leu), less than about 150 amino acids (lacking the H2 domain), less than about 145 amino acids (lacking the L and H2 domains), less than about 130 amino acids (lacking the HLH domain), less than about 115 amino acids (lacking the bHLH domain), or even less amino acids in length, such as mutant IND alleles corresponding to the Arabidopsis ind-4 or ind-5 (Liljegren et ah, 2004, supra) alleles are provided (see Table 1).
- a missense mutation in an IND allele is any mutation (deletion, insertion or substitution) in an IND allele whereby one or more codons are changed into the coding DNA and the corresponding mRNA sequence of the corresponding wild type IND allele, resulting in the substitution of one or more amino acids in the wild type IND protein for one or more other amino acids in the mutant IND protein.
- a mutant IND allele comprising a missense mutation is an IND allele wherein one or more of the conserved amino acids indicated above or in Table 1 is/are substituted. As indicated above, some of the conserved amino acids are more critical for the biological activity of the IND protein than others.
- missense mutations which result in the substitution of, e.g., the amino acids at position 5, 9, and 13 or at positions 10 and 12 of the consensus bHLH domain sequence defined by Heim et al. ⁇ supra) are more likely to result in a significantly reduced or no activity, due to a reduced ability to bind to the target DNA, of the IND protein.
- missense mutations which result in the substitution of, e.g., the amino acids at position 16, 20, 23, 27 in helixl or at positions 36, 39, 43, 49, 53, and 56 in helix2 of the consensus bHLH domain sequence defined by Heim et al.
- ⁇ supra are more likely to result in a significantly reduced or no activity, due to a reduced dimerization ability, of the IND protein.
- Seeds comprising a mutant IND-Al allele comprising a missense mutation which causes the substitution of the Arg residue at position 10 of the consensus bHLH domain sequence defined by Heim et al. ⁇ supra) for an His residue (called hereinafter ind-al -EMS05) have been deposited at the ATCC on November 20, 2007, under accession number PTA-8795.
- a mutant IND allele comprising a missense mutation is an IND allele comprising a missense mutation corresponding to the missense mutation in the Arabidopsis ind-1 or ind- 3 (Liljegren et al, 2004, supra) alleles (see Table 1).
- a frameshift mutation in an IND allele is a mutation (deletion, insertion, duplication, and the like) in an IND allele that results in the nucleic acid sequence being translated in a different frame downstream of the mutation.
- a mutant IND allele comprising a frameshift mutation is an IND allele comprising a frameshift mutation corresponding to the frameshift mutation in the Arabidopsis ind-2 (Liljegren et al, 2004, supra) allele, wherein a single nucleotide is deleted within codon 26, which results in a frameshift and production of a truncated protein of 35 amino acids (according to Liljegren et al, 2004, supra).
- a mutant IND allele comprising a frameshift mutation is an IND allele comprising a frameshift mutation corresponding to the frameshift mutation in the Arabidopsis ind-6 (Wu et al, 2006, supra) allele, wherein a Ds transposon is inserted after nucleotide 183 causing an 8 nucleotide duplication at the insertion site, or to the corresponding revertant Arabidopsis ind alleles (see Wu et al, 2006, supra, Fig. Ia).
- Amino acid sequences according to the invention Provided are both wild type (functional) IND amino acid sequences and mutant IND amino acid sequences (comprising one or more mutations, preferably mutations which result in a significantly reduced or no biological activity of the IND protein) from Brassicaceae, particularly from Brassica species, especially from Brassica napus, but also from other Brassica crop species.
- Brassica species comprising an A and/or a C genome may encode different IND-A or IND-C amino acids.
- mutagenesis methods can be used to generate mutations in wild type IND alleles, thereby generating mutant alleles which can encode further mutant IND proteins.
- the wild type and/or mutant IND amino acid sequences are provided within a Brassica plant (i.e. endogenously).
- isolated IND amino acid sequences e.g. isolated from the plant or made synthetically, as well as variants thereof and fragments of any of these are also provided herein.
- Amino acid sequences of IND-Al and IND-Cl proteins have been isolated from Brassica napus as depicted in the sequence listing. The wild type IND sequences are depicted, while the mutant IND sequences of these sequences, and of sequences essentially similar to these, are described herein below, with reference to the wild type IND sequences.
- the IND proteins of Brassica described herein are about 185-210 amino acids in length and comprise a number of structural and functional domains.
- IND-Al amino acid sequences or “IND-Al variant amino acid sequences” according to the invention are amino acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 2. These amino acid sequences may also be referred to as being “essentially similar” or “essentially identical” to the IND sequences provided in the sequence listing.
- EfD-Cl amino acid sequences or "IND-Cl variant amino acid sequences” according to the invention are amino acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 4 (IND-Cl- long) or with SEQ ID NO:4 from the amino acid at position 16 to the amino acid at position 210 (IND-Cl -short). These amino acid sequences may also be referred to as being “essentially similar” or “essentially identical” the /ND sequences provided in the sequence listing.
- the invention provides both amino acid sequences of wild type, functional IND-Al and IND-Cl proteins, including variants and fragments thereof (as defined further below), as well as mutant amino acid sequences of any of these, whereby the mutation in the amino acid sequence preferably results in a significant reduction in or a complete abolishment of the biological activity of the IND protein as compared to the biological activity of the corresponding wild type IND protein.
- a significant reduction in or complete abolishment of the biological activity of the IND protein refers herein to a reduction in or abolishment of the DNA binding activity, the dimerization capacity and/or transcriptional regulating activity of the IND protein, such that the pod shatter resistance of a plant expressing the mutant IND protein is increased as compared to a plant expressing the corresponding wild type IND protein compared to the pod shatter resistance of a corresponding wild type plant.
- fragments of the IND amino acid sequences and IND variant amino acid sequences defined above are provided herein.
- a "fragment" of a IND amino acid sequence or variant thereof (as defined) may be of various lengths, such as at least 10, 12, 15, 18, 20, 50, 100, 150, 175, 180 contiguous amino acids of the IND sequence (or of the variant sequence).
- amino acid sequences depicted in the sequence listing are wild type, functional IND proteins from Brassica napus. Thus, these sequences are endogenous to the Brassica napus plants from which they were isolated. Other Brassica crop species, varieties, breeding lines or wild accessions may be screened for other functional IND proteins with the same amino acid sequences or variants thereof, as described above.
- IND amino acid sequences and variants thereof may be identified in silico, by screening amino acid databases for essentially similar sequences. Fragments of amino acid molecules according to the invention are also provided. Fragments include amino acid sequences of the bHLH domain, or smaller fragments comprising part of the bHLH domain, such as the basic domain or the HLH domain, etc.
- Amino acid sequences of mutant IND proteins Amino acid sequences comprising one or more amino acid deletions, insertions or substitutions relative to the wild type amino acid sequences are another embodiment of the invention, as are fragments of such mutant amino acid molecules.
- Such mutant amino acid sequences can be generated and/or identified using various known methods, as described above. Again, such amino acid molecules are provided both in endogenous form and in isolated form.
- the mutation(s) in the amino acid sequence result in a significantly reduced or completely abolished biological activity of the IND protein relative to the wild type protein.
- any mutation which results in a protein comprising at least one amino acid insertion, deletion and/or substitution relative to the wild type protein can lead to significantly reduced or no biological activity.
- mutations in certain parts of the protein are more likely to result in a reduced function of the mutant IND protein, such as mutations leading to truncated proteins, whereby significant portions of the functional domains, such as the DNA binding domain ('b'), the dimerization domain ('HLH') and/or amino acids which are important in the regulation of transcription (See Table 1), are lacking or are being substituted.
- mutant IND proteins comprising one or more deletion or insertion mutations, whereby the deletion(s) or insertion(s) result(s) in a mutant protein which has significantly reduced or no activity in vivo.
- Such mutant IND proteins are IND proteins wherein at least 1, at least 2, 3, 4, 5, 10, 20, 30, 50, 100, 100, 150, 175, 180 or more amino acids are deleted or inserted as compared to the wild type IND protein, whereby the deletion(s) or insertion(s) result(s) in a mutant protein which has significantly reduced or no activity in vivo.
- mutant IND proteins are provided which are truncated whereby the truncation results in a mutant protein that has significantly reduced or no activity in vivo.
- Such truncated IND proteins are IND proteins which lack functional domains in the C-terminal part of the corresponding wild type IND protein and which maintain the N-terminal part of the corresponding wild type IND protein.
- a truncated IND protein comprising the N-terminal part of the corresponding wild type IND protein up to but not including the conserved Leu residue of the H2 domain (at position 56 in the consensus bHLH domain sequence as described by Heim et al, 2003, see above) is provided.
- a truncated IND protein comprising the N-terminal part of the corresponding wild type IND protein lacking part or all of the second H domain, and/or lacking part or all of the L domain, and/or lacking part or all of the first H domain, and/or lacking part or all of the basic domain (as described above), or even more amino acids are provided (see Table above).
- mutant IND proteins comprising one or more substitution mutations, whereby the substitution(s) result(s) in a mutant protein that has significantly reduced or no activity in vivo.
- Such mutant IND proteins are IND proteins whereby conserved amino acid residues which have a specific function, such as a function in DNA binding, dimerization or transcription regulation, are substituted.
- a mutant IND protein comprising a substitution of a conserved amino acid residue which has a biological function, such as the conserved amino acids of the basic domain, or the Hl, L or H2 domain as indicated in Table 1 above, is provided.
- Mutant ind alleles may be generated (for example induced by mutagenesis) and/or identified using a range of methods, which are conventional in the art, for example using PCR based methods to amplify part or all of the ind genomic or cDNA.
- plants are grown from the treated seeds, or regenerated from the treated cells using known techniques.
- mutagenized seeds may be planted in accordance with conventional growing procedures and following self-pollination seed is formed on the plants.
- doubled haploid plantlets may be extracted from treated microspore or pollen cells to immediately form homozygous plants, for example as described by Coventry et al. (1988, Manual for Microspore Culture Technique for Brassica napus. Dep. Crop Sci. Techn. Bull. OAC Publication 0489. Univ. of Guelph, Guelph, Ontario, Canada).
- Additional seed which is formed as a result of such self-pollination in the present or a subsequent generation may be harvested and screened for the presence of mutant MD alleles, using techniques which are conventional in the art, for example polymerase chain reaction (PCR) based techniques (amplification of the ind alleles) or hybridization based techniques, e.g. Southern blot analysis, BAC library screening, and the like, and/or direct sequencing of ind alleles.
- PCR polymerase chain reaction
- SNP detection methods conventional in the art can be used, for example oligoligation-based techniques, single base extension-based techniques or techniques based on differences in restriction sites, such as TILLING.
- mutant IND allele mutagenization (spontaneous as well as induced) of a specific wild-type IND allele results in the presence of one or more deleted, inserted, or substituted nucleotides (hereinafter called "mutation region") in the resulting mutant MD allele.
- the mutant IND allele can thus be characterized by the location and the configuration of the one or more deleted, inserted, or substituted nucleotides in the wild type IND allele.
- a "5' or 3' flanking region or sequence” as used herein refers to a DNA region or sequence in the mutant (or the corresponding wild type) IND allele of at least 20 bp, preferably at least 50 bp, at least 750 bp, at least 1500 bp, and up to 5000 bp of DNA different from the DNA containing the one or more deleted, inserted, or substituted nucleotides, preferably DNA from the mutant (or the corresponding wild type) IND allele which is located either immediately upstream of and contiguous with (5' flanking region or sequence") or immediately downstream of and contiguous with (3' flanking region or sequence") the mutation region in the mutant IND allele (or in the corresponding wild type IND allele).
- a “joining region” as used herein refers to a DNA region in the mutant (or the corresponding wild type) IND allele where the mutation region and the 5' or 3' flanking region are linked to each other.
- a “sequence spanning the joining region between the mutation region and the 5' or 3' flanking region thus comprises a mutation sequence as well as the flanking sequence contiguous therewith.
- the tools developed to identify a specific mutant IND allele or the plant or plant material comprising a specific mutant IND allele, or products which comprise plant material comprising a specific mutant IND allele are based on the specific genomic characteristics of the specific mutant IND allele as compared to the genomic characteristics of the corresponding wild type IND allele, such as, a specific restriction map of the genomic region comprising the mutation region, molecular markers or the sequence of the flanking and/or mutation regions.
- primers and probes can be developed which specifically recognize a sequence within the 5' flanking, 3' flanking and/or mutation regions of the mutant IND allele in the nucleic acid (DNA or RNA) of a sample by way of a molecular biological technique. For instance a PCR method can be developed to identify the mutant IND allele in biological samples (such as samples of plants, plant material or products comprising plant material).
- Such a PCR is based on at least two specific "primers": one recognizing a sequence within the 5' or 3' flanking region of the mutant IND allele and the other recognizing a sequence within the 3' or 5' flanking region of the mutant IND allele, respectively; or one recognizing a sequence within the 5' or 3' flanking region of the mutant IND allele and the other recognizing a sequence within the mutation region of the mutant IND allele; or one recognizing a sequence within the 5' or 3' flanking region of the mutant IND allele and the other recognizing a sequence spanning the joining region between the 3' or 5' flanking region and the mutation region of the specific mutant IND allele (as described further below), respectively.
- the primers preferably have a sequence of between 15 and 35 nucleotides which under optimized PCR conditions "specifically recognize” a sequence within the 5' or 3' flanking region, a sequence within the mutation region, or a sequence spanning the joining region between the 3' or 5' flanking and mutation regions of the specific mutant IND allele, so that a specific fragment ("mutant IND specific fragment” or discriminating amplicon) is amplified from a nucleic acid sample comprising the specific mutant IND allele. This means that only the targeted mutant IND allele, and no other sequence in the plant genome, is amplified under optimized PCR conditions.
- PCR primers suitable for the invention may be the following:
- - oligonucleotides ranging in length from 17 nt to about 200 nt comprising a nucleotide sequence of at least 17 consecutive nucleotides, preferably 20 consecutive nucleotides selected from the 5' or 3' flanking sequence of a specific mutant IND allele or the complement thereof (i.e., for example, the sequence 5' or 3' flanking the one or more nucleotides deleted, inserted or substituted in the mutant IND alleles of the invention, such as the sequence 5' or 3' flanking the non-sense, mis-sense or frameshift mutations described above or the sequence 5' or 3' flanking the STOP codon mutations indicated in the above Tables or the substitution mutations indicated above or the complement thereof) (primers recognizing 5' flanking sequences); or - oligonucleotides ranging in length from 17 nt to about 200 nt, comprising a nucleotide sequence of at least 17 consecutive nucleotides, preferably 20 nucleo
- the primers may of course be longer than the mentioned 17 consecutive nucleotides, and may e.g. be 18, 19, 20, 21, 30, 35, 50, 75, 100, 150, 200 nt long or even longer.
- the primers may entirely consist of nucleotide sequence selected from the mentioned nucleotide sequences of flanking and mutation sequences. However, the nucleotide sequence of the primers at their 5' end (i.e. outside of the 3'-located 17 consecutive nucleotides) is less critical.
- the 5' sequence of the primers may consist of a nucleotide sequence selected from the flanking or mutation sequences, as appropriate, but may contain several (e.g. 1, 2, 5, 10) mismatches.
- the 5' sequence of the primers may even entirely consist of a nucleotide sequence unrelated to the flanking or mutation sequences, such as e.g. a nucleotide sequence representing restriction enzyme recognition sites.
- a nucleotide sequence representing restriction enzyme recognition sites e.g. a nucleotide sequence representing restriction enzyme recognition sites.
- Such unrelated sequences or flanking DNA sequences with mismatches should preferably be not longer than 100, more preferably not longer than 50 or even 25 nucleotides.
- suitable primers may comprise or consist of a nucleotide sequence spanning the joining region between flanking and mutation sequences (i.e., for example, the joining region between a sequence 5' or 3' flanking one or more nucleotides deleted, inserted or substituted in the mutant IND alleles of the invention and the sequence of the one or more nucleotides inserted or substituted or the sequence 3' or 5', respectively, flanking the one or more nucleotides deleted, such as the joining region between a sequence 5' or 3' flanking non-sense, missense or frameshift mutations in the IND genes of the invention described above and the sequence of the non-sense, missense or frameshift mutations, or the joining region between a sequence 5' or 3' flanking a potential STOP codon mutation as indicated in the above Tables or the substitution mutations indicated above and the sequence of the potential STOP codon mutation or the substitution mutations, respectively), provided the nucleotide sequence is not derived exclusively from either the mutation region or flanking
- PCR primer pairs should also not comprise sequences complementary to each other.
- the "complement of a nucleotide sequence represented in SEQ ID No: X” is the nucleotide sequence which can be derived from the represented nucleotide sequence by replacing the nucleotides through their complementary nucleotide according to Chargaff s rules (A ⁇ -»T; G ⁇ -»C) and reading the sequence in the 5' to 3' direction, i.e. in opposite direction of the represented nucleotide sequence. Examples of primers suitable to identify specific mutant IND alleles are described in the Examples.
- nucleotide sequence of SEQ ID No. Z from position X to position Y indicates the nucleotide sequence including both nucleotide endpoints.
- the amplified fragment has a length of between 50 and 1000 nucleotides, such as a length between 50 and 500 nucleotides, or a length between 100 and 350 nucleotides.
- the specific primers may have a sequence which is between 80 and 100% identical to a sequence within the 5' or 3' flanking region, to a sequence within the mutation region, or to a sequence spanning the joining region between the 3' or 5' flanking and mutation regions of the specific mutant IND allele, provided the mismatches still allow specific identification of the specific mutant IND allele with these primers under optimized PCR conditions.
- the range of allowable mismatches however, can easily be determined experimentally and are known to a person skilled in the art.
- Detection and/or identification of a "mutant IND specific fragment” can occur in various ways, e.g., via size estimation after gel or capillary electrophoresis or via fluorescence-based detection methods.
- the mutant IND specific fragments may also be directly sequenced.
- Other sequence specific methods for detection of amplified DNA fragments are also known in the art.
- PCR identification protocol for each specific mutant IND allele. It is however understood that a number of parameters in the PCR identification protocol may need to be adjusted to specific laboratory conditions, and may be modified slightly to obtain similar results. For instance, use of a different method for preparation of DNA may require adjustment of, for instance, the amount of primers, polymerase, MgCl 2 concentration or annealing conditions used. Similarly, the selection of other primers may dictate other optimal conditions for the PCR identification protocol. These adjustments will however be apparent to a person skilled in the art, and are furthermore detailed in current PCR application manuals such as the one cited above. Examples of PCR identification protocols to identify specific mutant IND alleles are described in the Examples.
- specific primers can be used to amplify a mutant IND specific fragment that can be used as a "specific probe" for identifying a specific mutant IND allele in biological samples.
- Contacting nucleic acid of a biological sample, with the probe, under conditions that allow hybridization of the probe with its corresponding fragment in the nucleic acid results in the formation of a nucleic acid/probe hybrid.
- the formation of this hybrid can be detected (e.g. labeling of the nucleic acid or probe), whereby the formation of this hybrid indicates the presence of the specific mutant IND allele.
- identification methods based on hybridization with a specific probe (either on a solid phase carrier or in solution) have been described in the art.
- the specific probe is preferably a sequence that, under optimized conditions, hybridizes specifically to a region within the 5' or 3' flanking region and/or within the mutation region of the specific mutant IND allele (hereinafter referred to as "mutant IND specific region").
- the specific probe comprises a sequence of between 10 and 1000 bp, 50 and 600 bp, between 100 to 500 bp, between 150 to 350bp, which is at least 80%, preferably between 80 and 85%, more preferably between 85 and 90%, especially preferably between 90 and 95%, most preferably between 95% and 100% identical (or complementary) to the nucleotide sequence of a specific region.
- the specific probe will comprise a sequence of about 13 to about 100 contiguous nucleotides identical (or complementary) to a specific region of the specific mutant MD allele.
- oligonucleotides ranging in length from 13 nt to about 1000 nt, comprising a nucleotide sequence of at least 13 consecutive nucleotides selected from the 5' or 3' flanking sequence of a specific mutant IND allele or the complement thereof (i.e., for example, the sequence 5' or 3' flanking the one or more nucleotides deleted, inserted or substituted in the mutant IND alleles of the invention, such as the sequence 5' or 3' flanking the non-sense, mis-sense or frameshift mutations described above or the sequence 5' or 3' flanking the potential STOP codon mutations indicated in the above Tables or the substitution mutations indicated above), or a sequence having at least 80% sequence identity therewith (probes recognizing 5' flanking sequences); or
- oligonucleotides ranging in length from 13 nt to about 1000 nt, comprising a nucleotide sequence of at least 13 consecutive nucleotides selected from the mutation sequence of a specific mutant IND allele or the complement thereof (i.e., for example, the sequence of nucleotides inserted or substituted in the IND genes of the invention, or the complement thereof), or a sequence having at least 80% sequence identity therewith (probes recognizing mutation sequences).
- the probes may entirely consist of nucleotide sequence selected from the mentioned nucleotide sequences of flanking and mutation sequences. However, the nucleotide sequence of the probes at their 5' or 3' ends is less critical. Thus, the 5' or 3' sequences of the probes may consist of a nucleotide sequence selected from the flanking or mutation sequences, as appropriate, but may consist of a nucleotide sequence unrelated to the flanking or mutation sequences. Such unrelated sequences should preferably be not longer than 50, more preferably not longer than 25 or even not longer than 20 or 15 nucleotides.
- suitable probes may comprise or consist of a nucleotide sequence spanning the joining region between flanking and mutation sequences (i.e., for example, the joining region between a sequence 5' or 3' flanking one or more nucleotides deleted, inserted or substituted in the mutant IND alleles of the invention and the sequence of the one or more nucleotides inserted or substituted or the sequence 3' or 5', respectively, flanking the one or more nucleotides deleted, such as the joining region between a sequence 5' or 3' flanking non-sense, mis-sense or frameshift mutations in the IND genes of the invention described above and the sequence of the non-sense, mis-sense or frameshift mutations, or the joining region between a sequence 5' or 3' flanking a potential STOP codon mutation as indicated in the above Tables or the substitution mutations indicated above and the sequence of the potential STOP codon or substitution mutation, respectively), provided the mentioned nucleotide sequence is not derived exclusively from either the mutation region or
- Detection and/or identification of a "mutant IND specific region" hybridizing to a specific probe can occur in various ways, e.g., via size estimation after gel electrophoresis or via fluorescence- based detection methods. Other sequence specific methods for detection of a "mutant IND specific region” hybridizing to a specific probe are also known in the art.
- plants or plant parts comprising one or more mutant ind alleles can be generated and identified using other methods, such as the "Delete-a-geneTM” method which uses PCR to screen for deletion mutants generated by fast neutron mutagenesis (reviewed by Li and Zhang, 2002, Funct Integr Genomics 2:254-258), by the TILLING (Targeting Induced Local Lesions IN Genomes) method which identifies EMS-induced point mutations using denaturing high- performance liquid chromatography (DHPLC) to detect base pair changes by heteroduplex analysis (McCallum et al, 2000, Nat Biotech 18:455, and McCallum et al. 2000, Plant Physiol. 123, 439-442), etc.
- DPLC denaturing high- performance liquid chromatography
- TILLING uses high-throughput screening for mutations (e.g. using CeI 1 cleavage of mutant- wildtype DNA heteroduplexes and detection using a sequencing gel system).
- TILLING uses high-throughput screening for mutations (e.g. using CeI 1 cleavage of mutant- wildtype DNA heteroduplexes and detection using a sequencing gel system).
- the use of TILLING to identify plants or plant parts comprising one or more mutant ind alleles and methods for generating and identifying such plants, plant organs, tissues and seeds is encompassed herein.
- the method according to the invention comprises the steps of mutagenizing plant seeds (e.g. EMS mutagenesis), pooling of plant individuals or DNA, PCR amplification of a region of interest, heteroduplex formation and high-throughput detection, identification of the mutant plant, sequencing of the mutant PCR product. It is understood that other mutagenesis and selection methods may equally be used to generate such mutant plants.
- natural (spontaneous) mutant alleles may be identified by methods known in the art.
- ECOTILLING may be used (Henikoff et al. 2004, Plant Physiology 135(2):630-6) to screen a plurality of plants or plant parts for the presence of natural mutant ind alleles.
- Brassica species are screened which comprise an A and/or a C genome, so that the identified ind allele can subsequently be introduced into other Brassica species, such as Brassica napus, by crossing (inter- or intraspecii ⁇ c crosses) and selection.
- ECOTILLING natural polymorphisms in breeding lines or related species are screened for by the TILLING methodology described above, in which individual or pools of plants are used for PCR amplification of the ind target, heteroduplex formation and high-throughput analysis. This can be followed by selecting individual plants having a required mutation that can be used subsequently in a breeding program to incorporate the desired mutant allele.
- the identified mutant alleles can then be sequenced and the sequence can be compared to the wild type allele to identify the mutation(s).
- functionality can be tested as indicated above.
- a plurality of mutant ind alleles and Brassica plants comprising one or more of these
- the desired mutant alleles can then be combined with the desired wild type alleles by crossing and selection methods as described further below. Finally a single plant comprising the desired number of mutant ind and the desired number of wild type IND alleles is generated.
- Oligonucleotides suitable as PCR primers or specific probes for detection of a specific mutant IND allele can also be used to develop methods to determine the zygosity status of the specific mutant IND allele.
- a PCR-based assay can be developed to determine the presence of a mutant and/or corresponding wild type IND specific allele:
- two primers specifically recognizing the wild-type IND allele can be designed in such a way that they are directed towards each other and have the mutation region located in between the primers. These primers may be primers specifically recognizing the 5' and 3' flanking sequences, respectively. This set of primers allows simultaneous diagnostic PCR amplification of the mutant, as well as of the corresponding wild type IND allele.
- two primers specifically recognizing the wild-type IND allele can be designed in such a way that they are directed towards each other and that one of them specifically recognizes the mutation region.
- These primers may be primers specifically recognizing the sequence of the 5' or 3' flanking region and the mutation region of the wild type IND allele, respectively.
- This set of primers, together with a third primer which specifically recognizes the sequence of the mutation region in the mutant IND allele, allow simultaneous diagnostic PCR amplification of the mutant IND gene, as well as of the wild type IND gene.
- two primers specifically recognizing the wild-type IND allele can be designed in such a way that they are directed towards each other and that one of them specifically recognizes the joining region between the 5' or 3' flanking region and the mutation region.
- These primers may be primers specifically recognizing the 5' or 3' flanking sequence and the joining region between the mutation region and the 3' or 5' flanking region of the wild type IND allele, respectively.
- This set of primers together with a third primer which specifically recognizes the joining region between the mutation region and the 3' or 5' flanking region of the mutant IND allele, respectively, allow simultaneous diagnostic PCR amplification of the mutant IND gene, as well as of the wild type IND gene.
- the zygosity status of a specific mutant IND allele can be determined by using alternative primer sets that specifically recognize mutant and wild type IND alleles.
- the diagnostic PCR assays described above will give rise to a single PCR product typical, preferably typical in length, for either the mutant or wild type IND allele. If the plant is heterozygous for the mutant IND allele, two specific PCR products will appear, reflecting both the amplification of the mutant and the wild type IND allele.
- Identification of the wild type and mutant IND specific PCR products can occur e.g. by size estimation after gel or capillary electrophoresis (e.g. for mutant /ND alleles comprising a number of inserted or deleted nucleotides which results in a size difference between the fragments amplified from the wild type and the mutant IND allele, such that said fragments can be visibly separated on a gel); by evaluating the presence or absence of the two different fragments after gel or capillary electrophoresis, whereby the diagnostic PCR amplification of the mutant IND allele can, optionally, be performed separately from the diagnostic PCR amplification of the wild type IND allele; by direct sequencing of the amplified fragments; or by fluorescence-based detection methods.
- size estimation after gel or capillary electrophoresis e.g. for mutant /ND alleles comprising a number of inserted or deleted nucleotides which results in a size difference between the fragments amplified from the wild type and the mutant
- a hybridization- based assay can be developed to determine the presence of a mutant and/or corresponding wild type IND specific allele:
- two specific probes recognizing the wild-type /ND allele can be designed in such a way that each probe specifically recognizes a sequence within the /ND wild type allele and that the mutation region is located in between the sequences recognized by the probes.
- These probes may be probes specifically recognizing the 5' and 3' flanking sequences, respectively. The use of one or, preferably, both of these probes allows simultaneous diagnostic hybridization of the mutant, as well as of the corresponding wild type IND allele.
- two specific probes recognizing the wild-type IND allele can be designed in such a way that one of them specifically recognizes a sequence within the IND wild type allele upstream or downstream of the mutation region, preferably upstream of the mutation region, and that one of them specifically recognizes the mutation region.
- These probes may be probes specifically recognizing the sequence of the 5' or 3' flanking region, preferably the 5' flanking region, and the mutation region of the wild type IND allele, respectively.
- the use of one or, preferably, both of these probes, optionally, together with a third probe which specifically recognizes the sequence of the mutation region in the mutant IND allele allow diagnostic hybridization of the mutant and of the wild type IND gene.
- a specific probe recognizing the wild-type IND allele can be designed in such a way that the probe specifically recognizes the joining region between the 5' or 3' flanking region, preferably the 5' flanking region, and the mutation region of the wild type IND allele.
- This probe optionally, together with a second probe that specifically recognizes the joining region between the 5' or 3' flanking region, preferably the 5' flanking region, and the mutation region of the mutant IND allele, allows diagnostic hybridization of the mutant and of the wild type IND gene.
- the zygosity status of a specific mutant IND allele can be determined by using alternative sets of probes that specifically recognize mutant and wild type IND alleles.
- the diagnostic hybridization assays described above will give rise to a single specific hybridization product, such as one or more hybridizing D ⁇ A (restriction) fragments, typical, preferably typical in length, for either the mutant or wild type /ND allele. If the plant is heterozygous for the mutant /ND allele, two specific hybridization products will appear, reflecting both the hybridization of the mutant and the wild type /ND allele.
- Identification of the wild type and mutant /ND specific hybridization products can occur e.g. by size estimation after gel or capillary electrophoresis (e.g. for mutant /ND alleles comprising a number of inserted or deleted nucleotides which results in a size difference between the hybridizing DNA (restriction) fragments from the wild type and the mutant IND allele, such that said fragments can be visibly separated on a gel); by evaluating the presence or absence of the two different specific hybridization products after gel or capillary electrophoresis, whereby the diagnostic hybridization of the mutant IND allele can, optionally, be performed separately from the diagnostic hybridization of the wild type IND allele; by direct sequencing of the hybridizing DNA (restriction) fragments; or by fluorescence-based detection methods.
- size estimation after gel or capillary electrophoresis e.g. for mutant /ND alleles comprising a number of inserted or deleted nucleotides which results in a size difference between the hybridizing DNA
- detection methods specific for a specific mutant /TVD allele that differ from PCR- or hybridization-based amplification methods can also be developed using the specific mutant IND allele specific sequence information provided herein.
- Such alternative detection methods include linear signal amplification detection methods based on invasive cleavage of particular nucleic acid structures, also known as InvaderTM technology, (as described e.g. in US patent 5,985,557 "Invasive Cleavage of Nucleic Acids", 6,001,567 "Detection of Nucleic Acid sequences by Invader Directed Cleavage, incorporated herein by reference), RT-PCR-based detection methods, such as Taqman, or other detection methods, such as SNPlex.
- the target mutation sequence may e.g. be hybridized with a labeled first nucleic acid oligonucleotide comprising the nucleotide sequence of the mutation sequence or a sequence spanning the joining region between the 5' flanking region and the mutation region and with a second nucleic acid oligonucleotide comprising the 3' flanking sequence immediately downstream and adjacent to the mutation sequence, wherein the first and second oligonucleotide overlap by at least one nucleotide.
- the duplex or triplex structure that is produced by this hybridization allows selective probe cleavage with an enzyme (Cleavase®) leaving the target sequence intact.
- the cleaved labeled probe is subsequently detected, potentially via an intermediate step resulting in further signal amplification.
- kits refers to a set of reagents for the purpose of performing the method of the invention, more particularly, the identification of a specific mutant IND allele in biological samples or the determination of the zygosity status of plant material comprising a specific mutant IND allele. More particularly, a preferred embodiment of the kit of the invention comprises at least two specific primers, as described above, for identification of a specific mutant IND allele, or at least two or three specific primers for the determination of the zygosity status. Optionally, the kit can further comprise any other reagent described herein in the PCR identification protocol.
- the kit can comprise at least one specific probe, which specifically hybridizes with nucleic acid of biological samples to identify the presence of a specific mutant IND allele therein, as described above, for identification of a specific mutant IND allele, or at least two or three specific probes for the determination of the zygosity status.
- the kit can further comprise any other reagent (such as but not limited to hybridizing buffer, label) for identification of a specific mutant IND allele in biological samples, using the specific probe.
- the kit of the invention can be used, and its components can be specifically adjusted, for purposes of quality control (e.g., purity of seed lots), detection of the presence or absence of a specific mutant IND allele in plant material or material comprising or derived from plant material, such as but not limited to food or feed products.
- quality control e.g., purity of seed lots
- detection of the presence or absence of a specific mutant IND allele in plant material or material comprising or derived from plant material such as but not limited to food or feed products.
- primer encompasses any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process, such as PCR.
- primers are oligonucleotides from 10 to 30 nucleotides, but longer sequences can be employed.
- Primers may be provided in double-stranded form, though the single-stranded form is preferred. Probes can be used as primers, but are designed to bind to the target DNA or RNA and need not be used in an amplification process.
- recognizing refers to the fact that the specific primers specifically hybridize to a nucleic acid sequence in a specific mutant IND allele under the conditions set forth in the method (such as the conditions of the PCR identification protocol), whereby the specificity is determined by the presence of positive and negative controls.
- hybridizing refers to the fact that the probe binds to a specific region in the nucleic acid sequence of a specific mutant IND allele under standard stringency conditions.
- Standard stringency conditions refers to the conditions for hybridization described herein or to the conventional hybridizing conditions as described by Sambrook et al., 1989 (Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbour Laboratory Press, NY) which for instance can comprise the following steps: 1) immobilizing plant genomic DNA fragments or BAC library DNA on a filter, 2) prehybridizing the filter for 1 to 2 hours at 65°C in 6 X SSC, 5 X Denhardt's reagent, 0.5% SDS and 20 ⁇ g/ml denaturated carrier DNA, 3) adding the hybridization probe which has been labeled, 4) incubating for 16 to 24 hours, 5) washing the filter once for 30 min.
- a “biological sample” is a sample of a plant, plant material or product comprising plant material.
- plant is intended to encompass plant tissues, at any stage of maturity, as well as any cells, tissues, or organs taken from or derived from any such plant, including without limitation, any seeds, leaves, stems, flowers, roots, single cells, gametes, cell cultures, tissue cultures or protoplasts.
- Plant material refers to material that is obtained or derived from a plant. Products comprising plant material relate to food, feed or other products that are produced using plant material or can be contaminated by plant material.
- the present invention also relates to the combination of specific IND alleles in one plant, to the transfer of one or more specific mutant IND allele(s) from one plant to another plant, to the plants comprising one or more specific mutant IND allele(s), the progeny obtained from these plants and to plant cells, plant parts, and plant seeds derived from these plants.
- a method for combining two or more selected mutant IND alleles in one plant comprising the steps of:
- step (c) optionally, repeating step (b) until an Fl plant comprising all selected mutant IND alleles is obtained, (d) optionally, - identifying an Fl plant, which is homozygous or heterozygous for a selected mutant IND allele by determining the zygosity status of the mutant IND alleles, as described above, or
- - generating plants which are homozygous for one or more of the selected mutant IND alleles by performing one of the following steps: - extracting doubled haploid plants from treated microspore or pollen cells of Fl plants comprising the one or more selected mutant IND alleles, as described above, selfing the Fl plants comprising the one or more selected mutant IND allele(s) for one or more generations (y), collecting Fl Sy seeds from the sellings, and identifying Fl Sy plants, which are homozygous for the one or more mutant IND allele, as described above.
- the first and the second plant are Brassicaceae plants, particularly Brassica plants, especially Brassica napus plants or plants from another Brassica crop species.
- the first plant is a Brassicaceae plant, particularly a Brassica plant, especially a Brassica napus plant or a plant from another Brassica crop species
- the second plant is a plant from a Brassicaceae breeding line, particularly from a Brassica breeding line, especially from a Brassica napus breeding line or from a breeding line from another Brassica crop species.
- “Breeding line”, as used herein, is a preferably homozygous plant line distinguishable from other plant lines by a preferred genotype and/or phenotype that is used to produce hybrid offspring.
- a method for making a plant in particular a Brassica crop plant, such as a Brassica napus plant, of which the pod shatter resistance is increased but. which preferably maintains an agronomically relevant treshability of the pods is provided comprising combining and/or transferring mutant IND alleles according to the invention in or to one Brassica plant, as described above.
- the plant is a Brassica plant comprising at least two IND genes wherein pod shatter resistance is increased while maintaining an agronomically relevant treshability of the pods by combining and/or transferring three mutant /ND alleles according to the invention in or to the Brassica plant, as described above.
- a method for making a hybrid Brassica crop seed or plant comprising at least two /ND genes, in particular a hybrid Brassica napus seed or plant, of which the pod shatter resistance is increased but which maintains an agronomically relevant treshability of the pods comprising the steps of:
- the first or the second selected mutant IND allele is the same mutant IND allele as the third selected mutant /ND allele, such that the Fl hybrid seeds are homozygous for one mutant IND allele and heterozygous for the other,
- the first plant is used as a male parent plant and the second plant is used as a female parent plant.
- the first plant is completely pod shatter resistant. Such plants may be obtained by sowing complete indehiscent seed pods obtained by selfing the plants and harvesting complete seed pods in stead of thrashing the seed pods to harvest the seeds.
- SEQ ID NO: 1 Coding DNA of the IND-Al gene encoding a wild-type IND-Al protein from
- SEQ ID NO: 2 wild type IND-Al protein encoded by SEQ ID NO: 1.
- SEQ ID NO: 3 Coding DNA of the IND-Cl gene encoding a wild-type IND-Cl protein from Brassica napus.
- SEQ ID NO: 4 wild type IND-Cl protein encoded by SEQ ID NO: 3.
- SEQ ID NO: 5 Genomic DNA of the IND-Al gene encoding a wild-type IND-Al protein from
- SEQ ID NO: 6 wild type IND-Al protein encoded by SEQ ID NO: 5.
- SEQ ID NO: 7 Genomic DNA of the IND-Cl gene encoding a wild-type IND-Cl protein from
- SEQ ID NO: 8 wild type IND-Cl protein encoded by SEQ ID NO: 7.
- SEQ ID NO: 9 Coding DNA of the Arabidopsis INDl gene.
- SEQ ID NO: 10 Arabidopsis INDl protein encoded by SEQ ID NO: 9.
- SEQ ID NO: 11 nucleotide sequence of an IND homologue from Brassica napus (BNl -IND -
- SEQ ID NO: 12 nucleotide sequence of a second IND homologue from Brassica napus (BN2- IND - SEQ ID NO: 3 of WO04/113542)
- SEQ ID NO 13 Forward oligonucleotide for detection of IND-Al-EMSOl
- SEQ ID NO 14 Forward oligonucleotide for detection of IND-Al-WT
- SEQ ID NO 15 Reverse oligonucleotide for detection of IND-Al-EMSOl and -WT
- SEQ ID NO 16 Forward oligonucleotide for detection of IND-Al -EMS05
- SEQ ID NO 17 Forward oligonucleotide for detection of IND-A 1 -WT
- SEQ ID NO 18 Reverse oligonucleotide for detection of IND-A 1-EMS05 and -WT
- SEQ ID NO 19 Reverse oligonucleotide for detection of IND-Cl-EMSOl
- SEQ ID NO 20 Reverse oligonucleotide for detection of IND-Cl-WT
- SEQ ID NO 21 Forward oligonucleotide for detection of IND-Cl-EMSOl and -WT
- SEQ ID NO 22 Reverse oligonucleotide for detection of IND-C 1-EMS03
- SEQ ID NO 23 Reverse oligonucleotide for detection of IND-Cl-WT
- SEQ ID NO 24 Forward oligonucleotide for detection of IND-C 1-EMS03 and -WT
- SEQ ID NO 25 Oligonucleotide for detection of IND-Al-EMSOl and -WT
- SEQ ID NO 26 Oligonucleotide for detection of IND-Al-EMSOl
- SEQ ID NO 27 Oligonucleotide for detection of IND-Al-WT
- SEQ ID NO 28 Oligonucleotide for detection of IND-A 1-EMS05 and -WT
- SEQ ID NO 29 Oligonucleotide for detection of IND-A 1-EMS05
- SEQ ID NO 30 Oligonucleotide for detection of IND-Al-WT
- SEQ ID NO 31 Oligonucleotide for detection of IND-Cl-EMSOl and -WT
- SEQ ID NO 32 Oligonucleotide for detection of IND-Cl-EMSOl
- SEQ ID NO 33 Oligonucleotide for detection of IND-Cl-WT
- SEQ ID NO 34 Oligonucleotide for detection of IND-C 1-EMS03 and -WT
- SEQ ID NO 35 Oligonucleotide for detection of IND-Cl -EMS03
- SEQ ID NO 36 Oligonucleotide for detection of IND-C 1 -WT
- SEQ ID NO 37 Forward oligonucleotide for detection of IND-Al
- SEQ ID NO 38 Reverse oligonucleotide for detection of IND-Al
- SEQ ID NO 39 Forward oligonucleotide for detection of IND-Cl
- SEQ ID NO 40 Reverse oligonucleotide for detection of IND-Cl
- BAC Bacterial Artificial Chromosome
- BAC library of the line (average clone size of more than 120 kb) arrayed as individual duplicated clones on high density nylon filters were screened by standard Southern hybridization procedures: - A mixture of two probes with the sequence of SEQ ID NO: 2 of WO04/113542 ("BnI-IND") and SEQ ID NO: 3 of WO04/113542 (“BN2-IND”) (SEQ ID NO: 11 and 12, respectively) and labeled according to standard procedures were used for hybridizing to the DNA on the nylon membrane.
- BnI-IND sequence of SEQ ID NO: 2 of WO04/113542
- BN2-IND SEQ ID NO: 3 of WO04/113542
- Hybridization was performed under the following conditions: - The labeled probe (20 ng of each sequence) was denaturated by heating for 5 minutes at
- hybridization buffer (same buffer as for the pre-hybridization) - The hybridization was performed overnight at 65°C.
- the blots were washed three times for 30 minutes at 65°C in the hybridization tubes (once with 30ml 6xSSC with 0.1% SDS and twice with 30ml 2xSSC with 0.1% SDS) and one time for 10 minutes at 65°C with 500ml 2xSSC with 0.1% SDS in a box.
- BAC clone DNA was isolated through alkaline lysis as described in the art from the positive colonies grown up in 25 ml Luria Broth medium containing 25 ⁇ g/ml chloramphenicol.
- the DNA concentration of each preparation was estimated by comparing the band intensity of 1 ⁇ l of each sample to the band intensity of 1 , 2, 4, 8 and 20 ⁇ l of a solution containing 25 ng/ ⁇ l Lambda DNA (Life Technologies®) on a 1% TBE (Invitrogen®) agarose gel
- the DNA samples were transferred to a nylon membrane (Hybond-N+ Amersham Pharmacia Biotech®) by dry alkali capillary blotting.
- a nylon membrane Hybond-N+ Amersham Pharmacia Biotech®
- the nylon membranes with digested BAC clone and genomic DNA were screened by standard Southern hybridization procedures as described above for the BAC library screenings, except that for the genomic DNA the Kodak XOMAT AR films were exposed to the radioactive blots for 2 days at -70°C.
- BAC clones were grouped in 2 groups and for each of the 2 groups a BAC clone was selected containing a full-length IND sequence (named IND-Al and IND-Cl).
- IND-Al and IND-Cl a full-length IND sequence
- Example 2 Characterization of IND gene sequences from Brassica napus After sequencing the genomic DNA fragments (SEQ ID NO: 5 and 7, respectively), the coding regions of the IND sequences were determined with FgeneSH (Softberry, Inc. Mount Kisco, NY, USA) and est2genome (Rice et al., 2000, Trends in Genetics 16 (6): 276 — 277; Mott, 1997, Comput. Applic. 13:477-478) as depicted in the sequence listing.
- FgeneSH Softberry, Inc. Mount Kisco, NY, USA
- the protein encoding regions of the IND genes of the elite spring oilseed rape breeding line are represented in SEQ ID NO:1 (IND-Al), SEQ ID NO:3 from the nucleotide at position 46 to the nucleotide at position 633 (IND-Cl -short) and SEQ ID NO:3 (IND-Cl -long), respectively.
- SEQ ID NO:1 IND-Al
- SEQ ID NO:3 from the nucleotide at position 46 to the nucleotide at position 633
- SEQ ID NO:3 IND-Cl -long
- the percentage (nucleotide) sequence identity between the complete coding regions of IND-Al and IND-Cl-long is 81% and between the complete coding regions of IND-Al and IND-Cl-short is 87%, while the percentage (nucleotide) sequence identity between the regions encoding the bHLH domains of IND-AJ and IND-Cl -long and -short (as determined according to Toledo- Ortiz et al., 2003, Plant Cell 15, 1749-1770) is 98%. These percentages indicate that the IND genes are more conserved in the region encoding the bHLH domain than in the remaining part of the coding region.
- the percentage (amino acid) sequence identity between the complete IND-Al and IND-Cl-long proteins is 75% and between the complete IND-Al and IND-Cl-short proteins is 80%
- the percentage (amino acid) sequence identity between the bHLH domains of IND- Al and IND-Cl-long and -short is 98%.
- RT-PCR assays specific for each IND gene were performed on total RNA isolated from Brassica napus leaves, pod walls, dehiscence zone tissue and seeds using the following primers: INDAlFl 5 1 AGGAGAGGAAGAGATGGATCC 3' (SEQ ID No. 37) INDAlRl 5' TGAGTGTGAGGCTGAAGAAGC 3' (SEQ ID No. 38) for the IND-Al gene, and INDClFl 5' CCTCATCATCTCCTTATGAAC 3 1 (SEQ ID No. 39) INDClR 5' CGTATTGCATCTCCTTCATCT 3'. (SEQ ID No. 40) for the IND-Cl gene.
- Ml seeds The mutagenized seeds (Ml seeds) were rinsed 3 times and dried in a fume hood overnight. 30,000 Ml plants were grown in soil and selfed to generate M2 seeds. M2 seeds were harvested for each individual Ml plant. - Two times 4800 M2 plants, derived from different Ml plants, were grown and DNA samples were prepared from leaf samples of each individual M2 plant according to the CTAB method (Doyle and Doyle, 1987, Phytochemistry Bulletin 19:11-15).
- the DNA samples were screened for the presence of point mutations in the IND genes causing the introduction of STOP codons in the protein-encoding regions of the IND genes or the substitution of amino acids in the IND proteins, particularly in the bHLH domain of the IND proteins, by direct sequencing by standard sequencing techniques (Agowa) and analyzing the sequences for the presence of the point mutations using the NovoSNP software (VIB Antwerp).
- Brassica plants comprising the mutations in the IND genes identified in Example 4 were identified as follows:
- each mutant IND gene identified in the DNA sample of an M2 plant at least 50 M2 plants derived from the same Ml plant as the M2 plant comprising the IND mutation were grown and DNA samples were prepared from leaf samples of each individual M2 plant.
- M2 plants comprising the same mutation were selfed and M3 seeds were harvested.
- Example 6 Analysis of the fruit dehiscence properties of Brassica plants comprising a mutant Brassica IND gene
- ind fruit was compared to wild-type fruit using the following macroscopic tests: (a) Inspection of the seed pods and plants in general with naked eye to determine differences in the phenotype of the pods and plants caused by the presence of certain mutant IND alleles.
- a score of 1 (sharp indentation between the valve and the beak) corresponds to a wildtype phenotype of the pods, more specifically a pod shatter sensitive phenotype of the pods;
- a score of 2 to 4 (more gradual transition between the valve and the beak) corresponds to a pod shatter resistant phenotype of the pods, wherein seed shattering is significantly reduced or delayed while an agronomically relevant treshability of the pods is maintained, such that the pods may still be opened along the dehiscence zone by applying limited physical forces;
- a score of 5 (no indentation between the valve and the beak) corresponds to a pod shatter resistant phenotype of the pods, wherein seed shattering is reduced or delayed to a degree which does not allow an agronomically relevant treshability of the pods anymore, such that the pods cannot be opened along the dehisc
- Brassica lines comprising the mutant IND alleles and Brassica lines comprising the corresponding wild type IND alleles was compared in a semi-quantitative way by determining the physical forces needed to open closed mature pods by manually applying torsion on the pods. A distinction was made between pods which completely open along the dehiscence zone at the slightest torsion, pods which open only at the base of the dehiscence zone and need stronger torsion to open completely and pods which can only be crushed and do not open along the dehiscence zone.
- the pod shatter resistance of the pods was attributed a score from 1 to 5 based on this physical force: 1 for pods which completely open along the dehiscence zone at the slightest torsion, 2-4 for pods which open only at the base of the dehiscence zone and need stronger torsion to open completely and 5 for pods which can only be crushed and do not open along the dehiscence zone.
- the pods checked for soundness before the test, were shaken for cumulative times of 10, 20, 40, and, if more than 50% of pods remained intact, 80s.
- the drum was opened after each period and the number of closed pods counted.
- the pods were examined and classed as "closed” if the dehiscence zone of both valves was still closed. Thus the pods were classed as "opened” if one or both of the valves was detached, so that the seed had been released. If the majority of the pods was broken or damaged without opening of the dehiscence zone, the sample was marked "uncountable".
- the plots were attributed a score of 1-9 to indicate the level of seed shattering on the plot before harvest: a score of 1 to indicate that practically all plants on the plot were shattering before harvest to a score of 9 to indicate that practically no plants on the plot were shattering before harvest.
- the plots were attributed a score of 1-5 to indicate the level of combiner harvest ability on the plot: a score of 1, to 3 or to 5 to indicate that it was difficult, to feasible, or to easy, respectively, to harvest the plot with a combiner.
- the plots were attributed a score of 1-5 to indicate the level of treshing ability of the plot: a score of 1, to 3 or to 5 to indicate that it was difficult, to feasible, or to easy, respectively, to manually harvest the seed remaining in the straw after combiner harvest.
- the seed yield per plot after combining (YLDP; expressed in grams per plot) was determined by harvesting the seeds per plot with a combine harvester and weighing the seeds and the seed yield after treshing of straw (YLDS; expressed in weight% of the straw) was determined by manually harvesting the seeds remaining in the straw after seed harvest with the combine harvester.
- Explants of about 3 mm taken from the proximal and distal ends of pods of similar developmental stage (about 35 days after anthesis (DAA), a stage of development which closely corresponds to the onset of visible pericarp yellowing) and size were harvested from plants grown in a plant growth room (two pods for each genotype) and/or in the field. Both dehiscence zones were dissected from the pods.
- Fixation was done in 10OmM K-phosphate buffer pH7 with 10% formalin and 0.25% glutaraldehyde for a total of 4 hours. Vacuum infiltration was done after 1 and 2 hours for 15 minutes. The fixative was renewed after each vacuum infiltration. Dehydration: The specimen was rinsed 2 times 30 minutes With 10OmM K-phosphate buffer pH7. Dehydration was done with technical ethanol diluted with 0.85% NaCl in water: 60 minutes (') in 50% ethanol, 90' in 70% ethanol, 90' in 80% ethanol, 90' in 90% ethanol, 90' in 95% ethanol, 90' in 100% ethanol at room temperature
- Embedding was done with The Leica 7022-31731 Historesin or the Kulzer Histo-Technik 7100 (Heraeus) embedding kits, which are three component resin (a basic resin, an activator and a hardener) kits. The three components were used in the proportions as advised by the manufacturer as follows: the specimen were incubated for 4 hours in 50% ethanol/50% basic resin, overnight in 30% ethanol/70% basic resin
- the embedding was done in flat embedding moulds (AGAR flat embedding moulds G3531 with cavities of about 300 ⁇ l: 14 mm long x 6 mm wide x 4 mm deep): 100-125 ⁇ l of embedding medium/cavity was added, the embedding medium was polymerized at 55°C for about one hour, the tissue was put on the polymerized embedding medium (1 explant/cavity), the cavities ware filed with embedding medium, the embedding medium was polymerized for 3 to 5 hours at
- Sectioning The plastic blocks were glued with the flat side on a lcm 3 perpex block and trimmed squarely around the specimen. 4 ⁇ m sections (3 to 4 explants per genotype, about 25 sections per explant) were cut with a ralph glass knife (made on -1 position of the histoknifemaker of Reichert-Jung using 6 mm thick glass rods under a cutting angle of about 6°) on the microtome. The sections were attached on glass slides treated with Vectabond (Vector laboratories).
- POSHlOl, POSH103, POSH104, POSH105 and POSH106 and heterozygous M2 plants No. POSH105; see Table 4a and b for the corresponding ind alleles) were grown in the glass house and analyzed as described above. No significant difference in phenotype and fruit dehiscence properties was observed between wild type plants and these heterozygous and homozygous single mutant plants.
- Brassica plants and the fruit dehiscence properties of those Brassica plants To determine the correlation between the presence of at least three mutant IND alleles in a Brassica plant and the fruit dehiscence properties of the Brassica plant, the Brassica plants identified in Example 5, and/or progeny thereof, comprising the mutant IND alleles, were crossed with each other and the fruit dehiscence properties of the progeny Brassica plants was analyzed as described above.
- Progeny i.e., homozygous double mutant plants with genotype ind-al/ind-al, ind-cl/ind-cl; homozygous single and heterozygous single -i.e., triple- mutant plants with genotype ind-al/ind- al, IND-C 1/ind-cl and IND-A 1/ind-al, ind-cl/ind-cl; and wild type plants with genotype IND- A1/IND-A1, IND-Cl/IND-Cl) of line 51, line 45, line 176 and line 48, which themselves are heterozygous (genotype: IND- A 1/ind-al, IND-Cl/ ind-cl) for alleles IND-Al-EMSOl and IND- Cl-EMSOl (line 51), alleles IND-Al-EMSOl and IND-C1-EMS03 (line 45), alleles IND-Al- EMS05 and IND-
- Macroscopical evaluation a) Inspection of the seed pods and plants with naked eye.
- the pods from double homozygous mutant IND sibling plants (genotype: ind-al/ind-al, ind- cl/ind-cl) derived from lines 51, 45, 176 and 48 showed an altered pod morphology, already at immature stage, as compared to pods from wild-type IND sibling plants. More specifically, the pods of the double homozygous mutant IND sibling plants showed a lack of proper valve margin definition, particularly apparent at both the proximal and distal end of the fruit, as compared to the pods from wild-type IND sibling plants, which showed clearly defined margins.
- the sharp indentation between the valve and the beak at the distal end of the pods in the wild-type sibling plants was largely absent in the double homozygous ind sibling plants, which showed a more gradual transition between valve and beak tissue.
- the flowers of the double homozygous mutant /JVD sibling plants of line 51 sometimes displayed deformed petals under greenhouse conditions.
- the pods from plants derived from line 45 were in general smaller than the pods from plants derived from the other lines. Since this size difference occurred in both wild-type and mutant ind sibling plants derived from line 45, it is probably caused by a background mutation in this line.
- the pods from plants comprising one ind allele in homozygous state and one ind allele in heterozygous state showed an intermediate phenotype. More specifically, the valve margins of the pods of these mutant /TVD sibling plants were in general better defined than in the double homozygous mutant IND sibling plants, but the sharp indentation between the valve and the beak at the distal end of the pods in the wild-type sibling plants was still largely absent in these mutant plants.
- Table 5a shows the visual pod scores attributed to the phenotype of the pods from plants grown in the field as described above: Table 5 a
- the pods from plants comprising two mutant IND alleles in homozygous state (genotype: ind-al/ind-al, ind-cl/ind-cl) derived from lines 51, 45, 176 and 48 were completely pod shatter resistant (pods did not open along the dehiscence zone even after applying a strong torsion).
- the pod shatter resistance of pods from plants comprising one ind allele in homozygous state . and one ind allele in heterozygous state was increased as compared to the pod shatter resistance of pods from their wild-type sibling plants, but the pods could still be opened along the dehiscence zone after applying limited physical forces.
- Table 5b shows the scores attributed to the pods from plants grown in the field based on the physical force needed to open closed mature pods by manually applying torsion on the pods as described above:
- the half life of pod samples was significantly higher for pods from homozygous double mutants (genotype ind-al/ind-al, ind-cl/ind-cl) derived from line 51 than for pods of homozygous double mutants derived from line 45, indicating that homozygous double mutant plants comprising the IND-Cl-EMSOl allele (line 51) were more pod shatter resistant than homozygous double mutant plants comprising the IND-Cl-
- EMS03 allele line 45.
- Table 5c further shows that the LD50 value was in general higher for pods from plants comprising one ind-cl allele in homozygous state and one ind-al allele in heterozygous state (genotype: IND-Al/ ind-al, ind-cl /ind-cl) than for pods from plants comprising one ind-al allele in homozygous state and one ind-cl allele in heterozygous state (genotype: ind-al/ind- al, IND-Cl /ind-cl) indicating that the mutations in the IND-Cl allele could have a stronger effect on pod shatter resistance than the mutations in the IND-Al allele.
- Table 5d shows the level of seed shattering (SHAT), combiner harvest ability (CHAl), treshing ability (CHA2), seed yield per plot after combining (YLDP) and seed yield after treshing of straw (YLDS) determined as described above for field plots with ind plants and wild-type plants as indicated.
- the YieldWTSeg% value represents the YLDP as a percentage of the wildtype segregant within one line, i. e. within line 51, 45, 176 or 48, respectively.
- the dehiscence zones were still well differentiated and mostly non-lignified in pods from plants comprising two ind alleles in homozygous state derived from line 51 (genotype ind-al/ind-al, ind-cl/ind-cl) grown under greenhouse conditions but the dehiscence zones did show extra lignification where the pod walls come together ("weaker morphological phenotype"). Pods from these plants grown under field conditions showed a lignif ⁇ cation pattern similar to that of pods from plants with genotype IND- Al /ind-al, ind-cl/ind-cl derived from line 45 described below.
- pods from plants with genotype IND-Al/ ind-al, ind-cl /ind-cl derived from lines 45 displayed a more subtle morphological phenotype than pods from plants of their homozygous double mutant siblings (see above). More specifically, lignification did not occur throughout the complete dehiscence zone but the pods of these plants only displayed a few extra layers of lignified cells where the inner pod wall is attached to the septum, either symmetrically at both sides of the septum or only unilaterally.
- a similar pod phenotype was observed for pods from plants with genotype IND-Al /ind-al, ind-cl /ind- cl derived from lines 51 grown under field conditions. Pods from plants with genotype ind- al/ind-al, IND-Cl/ind-cl derived from lines 45 and 51 did not show an obvious phenotype under field conditions.
- the mutant IND genes are transferred into (elite) Brassica breeding lines by the following method: A plant containing a mutant IND gene (donor plant), is crossed with an (elite) Brassica line (elite parent / recurrent parent) or variety lacking the mutant IND gene.
- the following introgression scheme is used (the mutant IND gene is abbreviated to ind while the wild type is depicted as IND):
- BCl plants 50% /ND / ind and 50% IND / IND
- the 50% IND / ind are selected using molecular markers (e.g. AFLP, PCR, InvaderTM, and the like; see also below) for the mutant IND allele (ind).
- molecular markers e.g. AFLP, PCR, InvaderTM, and the like; see also below
- BC2 cross IND / ind (BC 1 plant) X /ND / IND (recurrent parent)
- BC3-6 plants 50% /ND / ind and 50% /ND / /ND
- the 50% IND / ind are selected using molecular markers for the mutant IND allele (ind).
- molecular markers can be used specific for the genetic background of the elite parent.
- Plants containing ind are selected using molecular markers for the mutant IND allele (ind).
- Individual BC3-6 Sl plants that are homozygous for the mutant IND allele (ind / ind) are selected using molecular markers for the mutant and the wild-type IND alleles. These plants are then used for seed production.
- PCR assays can be developed to discriminate plants comprising a specific point mutation in an IND allele from plants not comprising that specific point mutation. The following discriminating PCR assays were thus developed to detect the presence or absence and the zygosity status of the mutant alleles identified in Example 4 (see Table 4): - Template DNA:
- Genomic DNA isolated from leaf material of homozygous or heterozygous mutant Brassica plants comprising a mutant MD allele, called hereinafter "IND-Xx-EMSXX”
- IND-Xx-EMSXX mutant MD allele
- Wild type DNA control Genomic DNA isolated from leaf material of wild type Brassica plants (comprising the wild type equivalent of the mutant IND allele, called hereinafter "IND-Xx-WT").
- each primer set consists of one primer specific for the mutant and the wild type target gene (e.g. primer POSHl 01 R2 is specific for IND-Al-EMSOl and IND-Al-WT) and one primer specific for the nucleotide difference (e.g. primer POSH 101 MFl is specific for the IND-Al-EMSOl and primer POSH 101 WFl is specific for IND-Al-WT).
- the last nucleotide of the latter primer matches with the nucleotide difference (underlined nucleotide in Table 6), but one (or more) additional target specific nucleotide(s) may be added to improve the annealing between the primer and its target sequence (see e.g. bold nucleotide in primer POSH 108MR1 ', which is specific for the IND-Cl -EMS03 allele, as compared to primer POSH 108WR1 ', which is specific for the IND-Cl-WT allele).
- Thermocycling profile 4 min at 95°C; 30x [lmin at 95°C (denaturation) and 1 min at annealing temperature specified in Table 6 and 2 min at 72°C (elongation)]; 5min at 72°C; cool down to 4°C.
- the optimal annealing temperature was determined by temperature gradient PCR wherein the annealing temperature was varied between 57°C to 70°C on a MJ Research thermocycler PTC-200 (Biozym).
- the optimal annealing temperature for the wild type /ND specific primers is that temperature at which a clear PCR fragment of the expected size can be detected (as described below) for the DNA sample from the wild type Brassica plant and not for the DNA sample from the mutant Brassica plant.
- the optimal annealing temperature for the mutant IND specific primers is that temperature at which a clear PCR fragment of the expected size can be detected (as described below) for the DNA sample from the mutant Brassica plant and not for the DNA sample from the wild type Brassica plant.
- 5 ⁇ l loading dye (orange dye) was added to 15 ⁇ l of the PCR samples and the samples were loaded on a 1.5% agarose gel.
- the wild-type DNA control shows the PCR fragment of the expected size for the IND -
- the positive DNA control shows the PCR fragment of the expected size for the IND-Xx-
- InvaderTM technology can be used to discriminate plants comprising a specific point mutation in an IND allele from plants not comprising that specific point mutation.
- the following discriminating InvaderTM probes were thus developed to detect the presence or absence and the zygosity status of the mutant alleles identified in Example 4 (see Table 7:
- each probe set consists of one probe specific for the mutant or the wild type target gene of which the first nucleotide after the 5' flap sequence matches with the nucleotide difference (underlined nucleotide in Table 7) (the so-called “primary probe”; e.g. the probe with SEQ ID NO: 26 is specific for IND-Al- EMSOl and the probe with SEQ ID NO: 27 is specific for IND-Al-WT) and one probe0 specific for the nucleotides upstream of the nucleotide difference (the so-called "invader® oligo"; e.g.
- the probe with SEQ ID NO: 25 is specific for the nucleotides upstream of the nucleotide difference between IND-Al-EMSOl and IND-Al-WT).
- the last nucleotide of the latter primer may match with the nucleotide difference in the mutant (as indicated by the bold nucleotides in Table 6), but other nucleotides may be used as well for this last nucleotide as 5 long as the primary probe and the invader® oligo are still able to form a single base overlap when hybridized to the target DNA to generate the specific invasive structure recognized by the Cleavase® enzymes (Third Wave Agbio).
- nucleotide sequences indicated as “flapl” and “flap2" in Table 7 represent the sequences of the 5' "flaps” which are cleaved from the primary probes in the primary phase of the InvaderTM assay and which are complementary to sequences in FRETTM cassette 1 and 2, respectively, and not complementary to the target mutant or wild type sequences.
- a signal is generated indicative of the presence in the sample of the mutant or corresponding wild-type target IND gene, respectively.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Botany (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Environmental Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Physiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Cultivation Of Plants (AREA)
- Pretreatment Of Seeds And Plants (AREA)
Priority Applications (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2010535299A JP5956109B2 (ja) | 2007-11-28 | 2008-11-25 | 突然変異indehiscent対立遺伝子を含むブラシカ植物 |
| CN200880125655.4A CN101970667B (zh) | 2007-11-28 | 2008-11-25 | 包含突变indehiscent等位基因的芸苔属植物 |
| EA201070652A EA031125B1 (ru) | 2007-11-28 | 2008-11-25 | Растение рода brassica, содержащее мутантный аллель indehiscent |
| US12/745,106 US9475849B2 (en) | 2007-11-28 | 2008-11-25 | Brassica plant comprising a mutant INDEHISCENT allele |
| CA2706612A CA2706612C (en) | 2007-11-28 | 2008-11-25 | Brassica plant comprising a mutant indehiscent allele |
| EP08854261.8A EP2220239B1 (en) | 2007-11-28 | 2008-11-25 | Brassica plant comprising a mutant indehiscent allele |
| DK08854261.8T DK2220239T3 (en) | 2007-11-28 | 2008-11-25 | BRASSICA PLANT COMPRISING A MUTANT INDEHISCENT allele |
| AU2008329065A AU2008329065B2 (en) | 2007-11-28 | 2008-11-25 | Brassica plant comprising a mutant indehiscent allele |
| PL08854261T PL2220239T3 (pl) | 2007-11-28 | 2008-11-25 | Roślina Brassica zawierająca zmutowane allele typu indehiscent |
| ES08854261.8T ES2543425T3 (es) | 2007-11-28 | 2008-11-25 | Planta de Brassica que comprende un alelo INDEHISCENT mutante |
| SI200831468T SI2220239T1 (sl) | 2007-11-28 | 2008-11-25 | Rastlina Brassica, ki vsebuje mutirane zaprte allele |
| ZA2010/03117A ZA201003117B (en) | 2007-11-28 | 2010-05-04 | Brassica plant comprising a mutant indehiscent allele |
| US15/264,276 US10426118B2 (en) | 2007-11-28 | 2016-09-13 | Brassica plant comprising a mutant indehiscent allele |
| US16/547,078 US11357189B2 (en) | 2007-11-28 | 2019-08-21 | Brassica plant comprising a mutant indehiscent allele |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP07023052.9 | 2007-11-28 | ||
| EP07023052 | 2007-11-28 | ||
| US466007P | 2007-11-29 | 2007-11-29 | |
| US61/004,660 | 2007-11-29 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/745,106 A-371-Of-International US9475849B2 (en) | 2007-11-28 | 2008-11-25 | Brassica plant comprising a mutant INDEHISCENT allele |
| US15/264,276 Division US10426118B2 (en) | 2007-11-28 | 2016-09-13 | Brassica plant comprising a mutant indehiscent allele |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2009068313A2 true WO2009068313A2 (en) | 2009-06-04 |
| WO2009068313A3 WO2009068313A3 (en) | 2009-09-03 |
Family
ID=40578264
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2008/010147 Ceased WO2009068313A2 (en) | 2007-11-28 | 2008-11-25 | Brassica plant comprising a mutant indehiscent allele |
Country Status (16)
| Country | Link |
|---|---|
| US (3) | US9475849B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP2220239B1 (cg-RX-API-DMAC7.html) |
| JP (3) | JP5956109B2 (cg-RX-API-DMAC7.html) |
| CN (3) | CN101970667B (cg-RX-API-DMAC7.html) |
| AR (1) | AR069454A1 (cg-RX-API-DMAC7.html) |
| AU (1) | AU2008329065B2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2706612C (cg-RX-API-DMAC7.html) |
| DK (1) | DK2220239T3 (cg-RX-API-DMAC7.html) |
| EA (1) | EA031125B1 (cg-RX-API-DMAC7.html) |
| ES (1) | ES2543425T3 (cg-RX-API-DMAC7.html) |
| PL (1) | PL2220239T3 (cg-RX-API-DMAC7.html) |
| PT (1) | PT2220239E (cg-RX-API-DMAC7.html) |
| SI (1) | SI2220239T1 (cg-RX-API-DMAC7.html) |
| UA (1) | UA99636C2 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2009068313A2 (cg-RX-API-DMAC7.html) |
| ZA (1) | ZA201003117B (cg-RX-API-DMAC7.html) |
Cited By (85)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010006732A3 (en) * | 2008-07-17 | 2010-03-11 | Bayer Bioscience N.V. | Brassica plant comprising a mutant indehiscent allelle |
| WO2011089071A2 (de) | 2010-01-22 | 2011-07-28 | Bayer Cropscience Ag | Akarizide und/oder insektizide wirkstoffkombinationen |
| WO2011151368A2 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives |
| WO2011151370A1 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | N-[(het)arylalkyl)] pyrazole (thio)carboxamides and their heterosubstituted analogues |
| WO2011151369A1 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | N-[(het)arylethyl)] pyrazole(thio)carboxamides and their heterosubstituted analogues |
| WO2011157976A1 (en) | 2010-06-16 | 2011-12-22 | Plant Bioscience Limited | Control of plant seed shattering |
| WO2012010579A2 (en) | 2010-07-20 | 2012-01-26 | Bayer Cropscience Ag | Benzocycloalkenes as antifungal agents |
| WO2012038480A2 (en) | 2010-09-22 | 2012-03-29 | Bayer Cropscience Ag | Use of biological or chemical control agents for controlling insects and nematodes in resistant crops |
| WO2012045798A1 (en) | 2010-10-07 | 2012-04-12 | Bayer Cropscience Ag | Fungicide composition comprising a tetrazolyloxime derivative and a thiazolylpiperidine derivative |
| WO2012052489A1 (en) | 2010-10-21 | 2012-04-26 | Bayer Cropscience Ag | 1-(heterocyclic carbonyl) piperidines |
| WO2012052490A1 (en) | 2010-10-21 | 2012-04-26 | Bayer Cropscience Ag | N-benzyl heterocyclic carboxamides |
| WO2012059497A1 (en) | 2010-11-02 | 2012-05-10 | Bayer Cropscience Ag | N-hetarylmethyl pyrazolylcarboxamides |
| WO2012065947A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | 5-halogenopyrazolecarboxamides |
| WO2012065945A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | 5-halogenopyrazole(thio)carboxamides |
| WO2012065944A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | N-aryl pyrazole(thio)carboxamides |
| EP2460406A1 (en) | 2010-12-01 | 2012-06-06 | Bayer CropScience AG | Use of fluopyram for controlling nematodes in nematode resistant crops |
| EP2460407A1 (de) | 2010-12-01 | 2012-06-06 | Bayer CropScience AG | Wirkstoffkombinationen umfassend Pyridylethylbenzamide und weitere Wirkstoffe |
| WO2012072660A1 (en) | 2010-12-01 | 2012-06-07 | Bayer Cropscience Ag | Use of fluopyram for controlling nematodes in crops and for increasing yield |
| WO2012089757A1 (en) | 2010-12-29 | 2012-07-05 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
| EP2474542A1 (en) | 2010-12-29 | 2012-07-11 | Bayer CropScience AG | Fungicide hydroximoyl-tetrazole derivatives |
| WO2012120105A1 (en) | 2011-03-10 | 2012-09-13 | Bayer Cropscience Ag | Use of lipochito-oligosaccharide compounds for safeguarding seed safety of treated seeds |
| WO2013020985A1 (en) | 2011-08-10 | 2013-02-14 | Bayer Intellectual Property Gmbh | Active compound combinations comprising specific tetramic acid derivatives |
| EP2561759A1 (en) | 2011-08-26 | 2013-02-27 | Bayer Cropscience AG | Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth |
| WO2013026836A1 (en) | 2011-08-22 | 2013-02-28 | Bayer Intellectual Property Gmbh | Fungicide hydroximoyl-tetrazole derivatives |
| WO2013037955A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of acylsulfonamides for improving plant yield |
| WO2013037956A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of 5-phenyl- or 5-benzyl-2 isoxazoline-3 carboxylates for improving plant yield |
| WO2013037717A1 (en) | 2011-09-12 | 2013-03-21 | Bayer Intellectual Property Gmbh | Fungicidal 4-substituted-3-{phenyl[(heterocyclylmethoxy)imino]methyl}-1,2,4-oxadizol-5(4h)-one derivatives |
| WO2013037958A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of phenylpyrazolin-3-carboxylates for improving plant yield |
| WO2013050410A1 (en) | 2011-10-04 | 2013-04-11 | Bayer Intellectual Property Gmbh | RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE |
| WO2013075817A1 (en) | 2011-11-21 | 2013-05-30 | Bayer Intellectual Property Gmbh | Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives |
| WO2013079566A2 (en) | 2011-11-30 | 2013-06-06 | Bayer Intellectual Property Gmbh | Fungicidal n-bicycloalkyl and n-tricycloalkyl (thio)carboxamide derivatives |
| WO2013092519A1 (en) | 2011-12-19 | 2013-06-27 | Bayer Cropscience Ag | Use of anthranilic acid diamide derivatives for pest control in transgenic crops |
| WO2013098147A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(pyridin-2-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
| WO2013098146A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(1,3-thiazol-4-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
| WO2013127704A1 (en) | 2012-02-27 | 2013-09-06 | Bayer Intellectual Property Gmbh | Active compound combinations containing a thiazoylisoxazoline and a fungicide |
| WO2013139949A1 (en) | 2012-03-23 | 2013-09-26 | Bayer Intellectual Property Gmbh | Compositions comprising a strigolactame compound for enhanced plant growth and yield |
| WO2013153143A1 (en) | 2012-04-12 | 2013-10-17 | Bayer Cropscience Ag | N-acyl- 2 - (cyclo) alkylpyrrolidines and piperidines useful as fungicides |
| WO2013156560A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives |
| WO2013156559A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives |
| EP2662364A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole tetrahydronaphthyl carboxamides |
| EP2662363A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole biphenylcarboxamides |
| EP2662370A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole benzofuranyl carboxamides |
| EP2662361A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazol indanyl carboxamides |
| EP2662360A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole indanyl carboxamides |
| EP2662362A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole indanyl carboxamides |
| WO2013167545A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | Pyrazole indanyl carboxamides |
| WO2013167544A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | 5-halogenopyrazole indanyl carboxamides |
| WO2013174836A1 (en) | 2012-05-22 | 2013-11-28 | Bayer Cropscience Ag | Active compounds combinations comprising a lipo-chitooligosaccharide derivative and a nematicide, insecticidal or fungicidal compound |
| WO2014060520A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives |
| WO2014060518A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method of plant growth promotion using carboxamide derivatives |
| WO2014060519A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives |
| WO2014060502A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Active compound combinations comprising carboxamide derivatives |
| EP2735231A1 (en) | 2012-11-23 | 2014-05-28 | Bayer CropScience AG | Active compound combinations |
| WO2014083089A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal and pesticidal mixtures |
| WO2014083033A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropsience Ag | Binary fungicidal or pesticidal mixture |
| WO2014082950A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal mixtures |
| WO2014083088A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary fungicidal mixtures |
| WO2014083031A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary pesticidal and fungicidal mixtures |
| WO2014090765A1 (en) | 2012-12-12 | 2014-06-19 | Bayer Cropscience Ag | Use of 1-[2-fluoro-4-methyl-5-(2,2,2-trifluoroethylsulfinyl)phenyl]-5-amino-3-trifluoromethyl)-1 h-1,2,4 tfia zole for controlling nematodes in nematode-resistant crops |
| WO2014095677A1 (en) | 2012-12-19 | 2014-06-26 | Bayer Cropscience Ag | Difluoromethyl-nicotinic- tetrahydronaphtyl carboxamides |
| WO2014095826A1 (en) | 2012-12-18 | 2014-06-26 | Bayer Cropscience Ag | Binary fungicidal and bactericidal combinations |
| WO2014167009A1 (en) | 2013-04-12 | 2014-10-16 | Bayer Cropscience Ag | Novel triazole derivatives |
| WO2014167008A1 (en) | 2013-04-12 | 2014-10-16 | Bayer Cropscience Ag | Novel triazolinthione derivatives |
| WO2014170364A1 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Binary insecticidal or pesticidal mixture |
| WO2014170345A2 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Method for improved utilization of the production potential of transgenic plants |
| EP2659006A4 (en) * | 2010-12-29 | 2014-10-29 | Dow Agrosciences Llc | METHODS FOR DETERMINING ZYGOSITY IN A BULK SAMPLE |
| WO2014177514A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | Nematicidal n-substituted phenethylcarboxamides |
| WO2014177582A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | N-(2-fluoro-2-phenethyl)carboxamides as nematicides and endoparasiticides |
| WO2014206953A1 (en) | 2013-06-26 | 2014-12-31 | Bayer Cropscience Ag | N-cycloalkyl-n-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives |
| EP2837287A1 (en) | 2013-08-15 | 2015-02-18 | Bayer CropScience AG | Use of prothioconazole for increasing root growth of Brassicaceae |
| WO2015082587A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
| WO2015082586A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
| WO2016038079A1 (en) * | 2014-09-11 | 2016-03-17 | Bayer Cropscience Nv | Plants with altered fruit abscission properties |
| EP2997825A1 (en) | 2011-04-22 | 2016-03-23 | Bayer Intellectual Property GmbH | Active compound combinations comprising a (thio)carboxamide derivative and a fungicidal compound |
| US9464284B2 (en) | 2009-03-09 | 2016-10-11 | Bioatla, Llc | Mirac proteins |
| WO2016166077A1 (en) | 2015-04-13 | 2016-10-20 | Bayer Cropscience Aktiengesellschaft | N-cycloalkyl-n-(biheterocyclyethylene)-(thio)carboxamide derivatives |
| WO2018019676A1 (en) | 2016-07-29 | 2018-02-01 | Bayer Cropscience Aktiengesellschaft | Active compound combinations and methods to protect the propagation material of plants |
| WO2018054829A1 (en) | 2016-09-22 | 2018-03-29 | Bayer Cropscience Aktiengesellschaft | Novel triazole derivatives and their use as fungicides |
| WO2018054832A1 (en) | 2016-09-22 | 2018-03-29 | Bayer Cropscience Aktiengesellschaft | Novel triazole derivatives |
| WO2019233863A1 (de) | 2018-06-04 | 2019-12-12 | Bayer Aktiengesellschaft | Herbizid wirksame bizyklische benzoylpyrazole |
| WO2022140762A1 (en) | 2020-12-21 | 2022-06-30 | BASF Agricultural Solutions Seed US LLC | Brassica napus plants comprising an improved fertility restorer |
| WO2023166030A1 (en) | 2022-03-01 | 2023-09-07 | BASF Agricultural Solutions Seed US LLC | Cas12a nickases |
| WO2025045884A1 (en) | 2023-08-31 | 2025-03-06 | Basf Agricultural Solutions Us Llc | Class 2 type v crispr-cas prime editing |
| RU2836060C2 (ru) * | 2018-10-12 | 2025-03-11 | Сингента Кроп Протекшн Аг | Новые аллели cenh3 пшеницы |
| WO2025083165A1 (en) | 2023-10-19 | 2025-04-24 | Basf Agricultural Solutions Us Llc | Brassica napus plants having enhanced blackleg resistance |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9475849B2 (en) * | 2007-11-28 | 2016-10-25 | Bayer Cropscience N.V. | Brassica plant comprising a mutant INDEHISCENT allele |
| CN109879945B (zh) * | 2019-03-21 | 2021-05-28 | 华中农业大学 | 甘蓝型油菜抗裂角基因BnIND的功能及应用 |
| AU2020295398A1 (en) * | 2019-06-19 | 2021-12-23 | Pioneer Hi-Bred International, Inc. | Pod shatter tolerance in Brassica plants |
| CA3179374A1 (en) * | 2020-05-12 | 2021-11-18 | Monsanto Technology Llc | Automated phenotyping of seed shattering |
| WO2024098012A2 (en) * | 2022-11-04 | 2024-05-10 | Covercress Inc. | Brassica ind gene mutations conferring improved pod shatter-resistance |
Family Cites Families (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5846717A (en) | 1996-01-24 | 1998-12-08 | Third Wave Technologies, Inc. | Detection of nucleic acid sequences by invader-directed cleavage |
| AU672760B2 (en) | 1991-09-24 | 1996-10-17 | Keygene N.V. | Selective restriction fragment amplification: a general method for DNA fingerprinting |
| WO1997013865A1 (en) | 1995-10-06 | 1997-04-17 | Plant Genetic Systems, N.V. | Seed shattering |
| US5985557A (en) | 1996-01-24 | 1999-11-16 | Third Wave Technologies, Inc. | Invasive cleavage of nucleic acids |
| CN100567493C (zh) | 1997-06-27 | 2009-12-09 | 加利福尼亚大学董事会 | 具有迟发性种子散布的特性的种子植物 |
| US7135621B2 (en) * | 1998-06-25 | 2006-11-14 | The Regents Of The University Of California | Control of fruit dehiscence in plants by Indehiscent1 genes |
| AU2841500A (en) | 2000-02-11 | 2001-08-20 | Institute Of Molecular Agrobiology | Dehiscence gene and methods for regulating dehiscence |
| ATE385519T1 (de) | 2000-04-13 | 2008-02-15 | Univ California | Kontrolle der frucht-dehiszenz in arabidopsis durch indehiscent1-gene |
| JP2002252161A (ja) * | 2001-02-23 | 2002-09-06 | Hitachi Ltd | 半導体製造システム |
| EP1639113B1 (en) * | 2003-06-23 | 2012-01-25 | Bayer BioScience N.V. | Methods and means for delaying seed shattering in plants |
| EP1781083A4 (en) * | 2004-06-18 | 2009-09-09 | Univ California | SEQUENCES OF BRASSICA INDEHISCENT1 |
| US9475849B2 (en) * | 2007-11-28 | 2016-10-25 | Bayer Cropscience N.V. | Brassica plant comprising a mutant INDEHISCENT allele |
-
2008
- 2008-11-25 US US12/745,106 patent/US9475849B2/en active Active
- 2008-11-25 CN CN200880125655.4A patent/CN101970667B/zh active Active
- 2008-11-25 WO PCT/EP2008/010147 patent/WO2009068313A2/en not_active Ceased
- 2008-11-25 CN CN201410093702.9A patent/CN103898042B/zh active Active
- 2008-11-25 AU AU2008329065A patent/AU2008329065B2/en active Active
- 2008-11-25 EP EP08854261.8A patent/EP2220239B1/en active Active
- 2008-11-25 CA CA2706612A patent/CA2706612C/en active Active
- 2008-11-25 ES ES08854261.8T patent/ES2543425T3/es active Active
- 2008-11-25 PL PL08854261T patent/PL2220239T3/pl unknown
- 2008-11-25 EA EA201070652A patent/EA031125B1/ru not_active IP Right Cessation
- 2008-11-25 UA UAA201007679A patent/UA99636C2/ru unknown
- 2008-11-25 SI SI200831468T patent/SI2220239T1/sl unknown
- 2008-11-25 CN CN201410092859.XA patent/CN103898125B/zh active Active
- 2008-11-25 DK DK08854261.8T patent/DK2220239T3/en active
- 2008-11-25 PT PT88542618T patent/PT2220239E/pt unknown
- 2008-11-25 JP JP2010535299A patent/JP5956109B2/ja active Active
- 2008-11-28 AR ARP080105182A patent/AR069454A1/es active IP Right Grant
-
2010
- 2010-05-04 ZA ZA2010/03117A patent/ZA201003117B/en unknown
-
2014
- 2014-12-25 JP JP2014262573A patent/JP6109810B2/ja active Active
-
2016
- 2016-04-14 JP JP2016081421A patent/JP6109991B2/ja active Active
- 2016-09-13 US US15/264,276 patent/US10426118B2/en active Active
-
2019
- 2019-08-21 US US16/547,078 patent/US11357189B2/en active Active
Cited By (109)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10619165B2 (en) | 2008-07-17 | 2020-04-14 | Basf Agricultural Solutions Seed, Us Llc | Brassica plant comprising a mutant indehiscent allele |
| AU2009270539B2 (en) * | 2008-07-17 | 2015-04-23 | BASF Agricultural Solutions Seed US LLC | Brassica plant comprising a mutant indehiscent allelle |
| US8809635B2 (en) | 2008-07-17 | 2014-08-19 | Bayer CropScience, N.V. | Brassica plant comprising a mutant indehiscent allele |
| EP3156488A1 (en) | 2008-07-17 | 2017-04-19 | Bayer CropScience NV | Brassica plant comprising a mutant indehiscent allele |
| EA029333B1 (ru) * | 2008-07-17 | 2018-03-30 | Байер Кропсайенс Н.В. | Растение brassica, содержащее мутантный аллель indehiscent |
| WO2010006732A3 (en) * | 2008-07-17 | 2010-03-11 | Bayer Bioscience N.V. | Brassica plant comprising a mutant indehiscent allelle |
| US11708581B2 (en) | 2008-07-17 | 2023-07-25 | BASF Agricultural Solutions Seed US LLC | Brassica plant comprising a mutant indehiscent allele |
| US9994841B2 (en) | 2009-03-09 | 2018-06-12 | Bioatla, Llc | Mirac proteins |
| US9464284B2 (en) | 2009-03-09 | 2016-10-11 | Bioatla, Llc | Mirac proteins |
| US9982252B2 (en) | 2009-03-09 | 2018-05-29 | Bioatla, Llc | Mirac proteins |
| US9637735B2 (en) | 2009-03-09 | 2017-05-02 | Bioatla, Llc | Mirac proteins |
| US9637734B2 (en) | 2009-03-09 | 2017-05-02 | Bioatla, Llc | Mirac proteins |
| WO2011089071A2 (de) | 2010-01-22 | 2011-07-28 | Bayer Cropscience Ag | Akarizide und/oder insektizide wirkstoffkombinationen |
| US8722072B2 (en) | 2010-01-22 | 2014-05-13 | Bayer Intellectual Property Gmbh | Acaricidal and/or insecticidal active ingredient combinations |
| WO2011151369A1 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | N-[(het)arylethyl)] pyrazole(thio)carboxamides and their heterosubstituted analogues |
| WO2011151370A1 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | N-[(het)arylalkyl)] pyrazole (thio)carboxamides and their heterosubstituted analogues |
| WO2011151368A2 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives |
| WO2011157976A1 (en) | 2010-06-16 | 2011-12-22 | Plant Bioscience Limited | Control of plant seed shattering |
| WO2012010579A2 (en) | 2010-07-20 | 2012-01-26 | Bayer Cropscience Ag | Benzocycloalkenes as antifungal agents |
| WO2012038480A2 (en) | 2010-09-22 | 2012-03-29 | Bayer Cropscience Ag | Use of biological or chemical control agents for controlling insects and nematodes in resistant crops |
| WO2012038476A1 (en) | 2010-09-22 | 2012-03-29 | Bayer Cropscience Ag | Use of active ingredients for controlling nematodes in nematode-resistant crops |
| WO2012045798A1 (en) | 2010-10-07 | 2012-04-12 | Bayer Cropscience Ag | Fungicide composition comprising a tetrazolyloxime derivative and a thiazolylpiperidine derivative |
| WO2012052490A1 (en) | 2010-10-21 | 2012-04-26 | Bayer Cropscience Ag | N-benzyl heterocyclic carboxamides |
| WO2012052489A1 (en) | 2010-10-21 | 2012-04-26 | Bayer Cropscience Ag | 1-(heterocyclic carbonyl) piperidines |
| WO2012059497A1 (en) | 2010-11-02 | 2012-05-10 | Bayer Cropscience Ag | N-hetarylmethyl pyrazolylcarboxamides |
| US9206137B2 (en) | 2010-11-15 | 2015-12-08 | Bayer Intellectual Property Gmbh | N-Aryl pyrazole(thio)carboxamides |
| WO2012065944A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | N-aryl pyrazole(thio)carboxamides |
| WO2012065945A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | 5-halogenopyrazole(thio)carboxamides |
| WO2012065947A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | 5-halogenopyrazolecarboxamides |
| EP3103338A1 (de) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
| WO2012072660A1 (en) | 2010-12-01 | 2012-06-07 | Bayer Cropscience Ag | Use of fluopyram for controlling nematodes in crops and for increasing yield |
| EP2460406A1 (en) | 2010-12-01 | 2012-06-06 | Bayer CropScience AG | Use of fluopyram for controlling nematodes in nematode resistant crops |
| EP2460407A1 (de) | 2010-12-01 | 2012-06-06 | Bayer CropScience AG | Wirkstoffkombinationen umfassend Pyridylethylbenzamide und weitere Wirkstoffe |
| WO2012072696A1 (de) | 2010-12-01 | 2012-06-07 | Bayer Cropscience Ag | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
| EP3103334A1 (de) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
| EP3103340A1 (de) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
| EP3103339A1 (de) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
| EP3092900A1 (de) | 2010-12-01 | 2016-11-16 | Bayer Intellectual Property GmbH | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
| EP2659006A4 (en) * | 2010-12-29 | 2014-10-29 | Dow Agrosciences Llc | METHODS FOR DETERMINING ZYGOSITY IN A BULK SAMPLE |
| EP2474542A1 (en) | 2010-12-29 | 2012-07-11 | Bayer CropScience AG | Fungicide hydroximoyl-tetrazole derivatives |
| WO2012089757A1 (en) | 2010-12-29 | 2012-07-05 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
| WO2012120105A1 (en) | 2011-03-10 | 2012-09-13 | Bayer Cropscience Ag | Use of lipochito-oligosaccharide compounds for safeguarding seed safety of treated seeds |
| EP2997825A1 (en) | 2011-04-22 | 2016-03-23 | Bayer Intellectual Property GmbH | Active compound combinations comprising a (thio)carboxamide derivative and a fungicidal compound |
| US9265252B2 (en) | 2011-08-10 | 2016-02-23 | Bayer Intellectual Property Gmbh | Active compound combinations comprising specific tetramic acid derivatives |
| WO2013020985A1 (en) | 2011-08-10 | 2013-02-14 | Bayer Intellectual Property Gmbh | Active compound combinations comprising specific tetramic acid derivatives |
| WO2013026836A1 (en) | 2011-08-22 | 2013-02-28 | Bayer Intellectual Property Gmbh | Fungicide hydroximoyl-tetrazole derivatives |
| EP2561759A1 (en) | 2011-08-26 | 2013-02-27 | Bayer Cropscience AG | Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth |
| WO2013037717A1 (en) | 2011-09-12 | 2013-03-21 | Bayer Intellectual Property Gmbh | Fungicidal 4-substituted-3-{phenyl[(heterocyclylmethoxy)imino]methyl}-1,2,4-oxadizol-5(4h)-one derivatives |
| WO2013037955A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of acylsulfonamides for improving plant yield |
| WO2013037956A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of 5-phenyl- or 5-benzyl-2 isoxazoline-3 carboxylates for improving plant yield |
| WO2013037958A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of phenylpyrazolin-3-carboxylates for improving plant yield |
| WO2013050410A1 (en) | 2011-10-04 | 2013-04-11 | Bayer Intellectual Property Gmbh | RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE |
| WO2013075817A1 (en) | 2011-11-21 | 2013-05-30 | Bayer Intellectual Property Gmbh | Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives |
| WO2013079566A2 (en) | 2011-11-30 | 2013-06-06 | Bayer Intellectual Property Gmbh | Fungicidal n-bicycloalkyl and n-tricycloalkyl (thio)carboxamide derivatives |
| WO2013092519A1 (en) | 2011-12-19 | 2013-06-27 | Bayer Cropscience Ag | Use of anthranilic acid diamide derivatives for pest control in transgenic crops |
| WO2013098147A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(pyridin-2-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
| WO2013098146A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(1,3-thiazol-4-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
| WO2013127704A1 (en) | 2012-02-27 | 2013-09-06 | Bayer Intellectual Property Gmbh | Active compound combinations containing a thiazoylisoxazoline and a fungicide |
| WO2013139949A1 (en) | 2012-03-23 | 2013-09-26 | Bayer Intellectual Property Gmbh | Compositions comprising a strigolactame compound for enhanced plant growth and yield |
| WO2013153143A1 (en) | 2012-04-12 | 2013-10-17 | Bayer Cropscience Ag | N-acyl- 2 - (cyclo) alkylpyrrolidines and piperidines useful as fungicides |
| WO2013156560A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives |
| WO2013156559A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives |
| WO2013167545A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | Pyrazole indanyl carboxamides |
| EP2662361A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazol indanyl carboxamides |
| EP2662364A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole tetrahydronaphthyl carboxamides |
| EP2662363A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole biphenylcarboxamides |
| EP2662370A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole benzofuranyl carboxamides |
| EP2662360A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole indanyl carboxamides |
| WO2013167544A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | 5-halogenopyrazole indanyl carboxamides |
| EP2662362A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole indanyl carboxamides |
| WO2013174836A1 (en) | 2012-05-22 | 2013-11-28 | Bayer Cropscience Ag | Active compounds combinations comprising a lipo-chitooligosaccharide derivative and a nematicide, insecticidal or fungicidal compound |
| WO2014060518A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method of plant growth promotion using carboxamide derivatives |
| WO2014060502A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Active compound combinations comprising carboxamide derivatives |
| WO2014060520A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives |
| WO2014060519A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives |
| WO2014079789A1 (en) | 2012-11-23 | 2014-05-30 | Bayer Cropscience Ag | Active compound combinations |
| EP2735231A1 (en) | 2012-11-23 | 2014-05-28 | Bayer CropScience AG | Active compound combinations |
| WO2014083033A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropsience Ag | Binary fungicidal or pesticidal mixture |
| WO2014083088A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary fungicidal mixtures |
| WO2014082950A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal mixtures |
| WO2014083031A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary pesticidal and fungicidal mixtures |
| WO2014083089A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal and pesticidal mixtures |
| WO2014090765A1 (en) | 2012-12-12 | 2014-06-19 | Bayer Cropscience Ag | Use of 1-[2-fluoro-4-methyl-5-(2,2,2-trifluoroethylsulfinyl)phenyl]-5-amino-3-trifluoromethyl)-1 h-1,2,4 tfia zole for controlling nematodes in nematode-resistant crops |
| WO2014095826A1 (en) | 2012-12-18 | 2014-06-26 | Bayer Cropscience Ag | Binary fungicidal and bactericidal combinations |
| WO2014095677A1 (en) | 2012-12-19 | 2014-06-26 | Bayer Cropscience Ag | Difluoromethyl-nicotinic- tetrahydronaphtyl carboxamides |
| WO2014167009A1 (en) | 2013-04-12 | 2014-10-16 | Bayer Cropscience Ag | Novel triazole derivatives |
| WO2014167008A1 (en) | 2013-04-12 | 2014-10-16 | Bayer Cropscience Ag | Novel triazolinthione derivatives |
| WO2014170345A2 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Method for improved utilization of the production potential of transgenic plants |
| WO2014170364A1 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Binary insecticidal or pesticidal mixture |
| WO2014177582A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | N-(2-fluoro-2-phenethyl)carboxamides as nematicides and endoparasiticides |
| WO2014177514A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | Nematicidal n-substituted phenethylcarboxamides |
| WO2014206953A1 (en) | 2013-06-26 | 2014-12-31 | Bayer Cropscience Ag | N-cycloalkyl-n-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives |
| EP2837287A1 (en) | 2013-08-15 | 2015-02-18 | Bayer CropScience AG | Use of prothioconazole for increasing root growth of Brassicaceae |
| WO2015082587A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
| WO2015082586A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
| WO2016038079A1 (en) * | 2014-09-11 | 2016-03-17 | Bayer Cropscience Nv | Plants with altered fruit abscission properties |
| WO2016166077A1 (en) | 2015-04-13 | 2016-10-20 | Bayer Cropscience Aktiengesellschaft | N-cycloalkyl-n-(biheterocyclyethylene)-(thio)carboxamide derivatives |
| WO2018019676A1 (en) | 2016-07-29 | 2018-02-01 | Bayer Cropscience Aktiengesellschaft | Active compound combinations and methods to protect the propagation material of plants |
| WO2018054829A1 (en) | 2016-09-22 | 2018-03-29 | Bayer Cropscience Aktiengesellschaft | Novel triazole derivatives and their use as fungicides |
| WO2018054832A1 (en) | 2016-09-22 | 2018-03-29 | Bayer Cropscience Aktiengesellschaft | Novel triazole derivatives |
| WO2019233863A1 (de) | 2018-06-04 | 2019-12-12 | Bayer Aktiengesellschaft | Herbizid wirksame bizyklische benzoylpyrazole |
| RU2836060C2 (ru) * | 2018-10-12 | 2025-03-11 | Сингента Кроп Протекшн Аг | Новые аллели cenh3 пшеницы |
| WO2022140762A1 (en) | 2020-12-21 | 2022-06-30 | BASF Agricultural Solutions Seed US LLC | Brassica napus plants comprising an improved fertility restorer |
| WO2023166030A1 (en) | 2022-03-01 | 2023-09-07 | BASF Agricultural Solutions Seed US LLC | Cas12a nickases |
| WO2023166029A1 (en) | 2022-03-01 | 2023-09-07 | BASF Agricultural Solutions Seed US LLC | Cas12a nickases |
| WO2023166032A1 (en) | 2022-03-01 | 2023-09-07 | Wageningen Universiteit | Cas12a nickases |
| WO2025045884A1 (en) | 2023-08-31 | 2025-03-06 | Basf Agricultural Solutions Us Llc | Class 2 type v crispr-cas prime editing |
| WO2025045886A1 (en) | 2023-08-31 | 2025-03-06 | Basf Agricultural Solutions Us Llc | Class 2 type v crispr-cas prime editing |
| WO2025083165A1 (en) | 2023-10-19 | 2025-04-24 | Basf Agricultural Solutions Us Llc | Brassica napus plants having enhanced blackleg resistance |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11357189B2 (en) | Brassica plant comprising a mutant indehiscent allele | |
| US11708581B2 (en) | Brassica plant comprising a mutant indehiscent allele | |
| CA2822720C (en) | Brassica plant comprising a mutant alcatraz allele | |
| HK1156351B (en) | Brassica plant comprising a mutant indehiscent allelle |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200880125655.4 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08854261 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008329065 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2706612 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12745106 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010535299 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2008329065 Country of ref document: AU Date of ref document: 20081125 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3974/DELNP/2010 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008854261 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201070652 Country of ref document: EA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: A201007679 Country of ref document: UA |