WO2009062241A1 - Crystal structure of a bacterial enzyme and uses thereof - Google Patents

Abstract

The present invention is predicated, in part, on the determination of the crystal structure of Staphylococcus aureus biotin protein ligase. The present invention provides, among other things, the crystal structure of Staphylococcus aureus biotin protein ligase complexed with biotinyl 5'-adenylate at a resolution of 2.6 Angstroms. Accordingly, the present invention also provides methods for the identification and/or rational design of antagonists and agonists of biotin protein ligase enzymes, and in particular, antagonists of Staphylococcus aureus biotin protein ligase. Such antagonists may be used to inhibit bacterial infections, including Staphylococcus aureus infections.

Description

CRYSTAL STRUCTURE OF A BACTERIAL ENZYME AND USES THEREOF

Priority Claim

This international patent application claims priority to Australian provisional patent application 2007906228 filed on 13 November 2007, the content of which is herein incorporated by reference.

Field of the Invention

The present invention relates to a crystal of Staphylococcus aureus biotin protein ligase and the determination of the structure of the biotin protein ligase.

The present invention also relates to methods of identifying and designing agents that bind to a biotin protein ligase, and to agents identified and designed by these methods.

Background of the Invention

The treatment of bacterial infections has traditionally relied on the use of antibiotics. However the treatment of many bacterial infections is becoming increasingly difficult because of resistance developed by some bacteria to one or more known antibiotics.

For example, resistance of bacteria such as Enterococcus faecium, Streptococcus pyogenes, Proteus vulgaris, Streptococcus pneumoniae and Acinetobacter baumannii to antibiotics is rapidly becoming a significant clinical problem.

In the case of Staphylococcus aureus (S. aureus), resistance to antibiotics is of particular concern, as not only does Staphylococcus aureus cause a range of minor illnesses such as skin infections, pimples, impetigo, boils, cellulitis and abscesses, but it is also responsible for life-threatening diseases, such as pneumonia, meningitis, endocarditis, Toxic Shock Syndrome (TSS), and septicaemia. Staphylococcus aureus is extremely adaptable to antibiotic pressure, and until recently vancomycin was the only effective agent available. However, VRSA (Vancomycin- resistant Staphylococcus aureus) has now been identified in the clinical setting, indicating that some strains now have resistance to all glycopeptide antibiotics.

As such, the identification of new molecular targets has become one of the major avenues for the development of new anti-bacterial agents.

In this regard, biotinylation is a process that is ubiquitous to all organisms. In this process biotin, also known as vitamin H, is covalently attached at the active site of the class of metabolic enzymes known as biotin carboxylases, biotin decarboxylases and biotin transcarboxylases. These are key enzymes involved in gluconeogenesis, lipogenesis, amino acid metabolism and energy transduction. Covalent attachment of biotin is required for the function of these enzymes.

The enzyme required for the covalent attachment of biotin to cognate proteins is biotin protein ligase (BPL). Biotin is post-translationally attached to cognate proteins via an amide linkage to a specific lysine residue in a two-step reaction, which is of stringent specificity.

Despite the fact that biotin-dependent enzymes are present in all organisms, biotinylation is still a rare modification in the cells, with only between one and five distinct protein species actually being biotinylated.

As biotinylation is a process that is essential in all organisms, it represents a potential target for the development of new compounds that may inhibit the growth of pathogenic bacteria, such as S. aureus. The present invention relates to crystallization of the biotin protein ligase from Staphylococcus aureus, the determination of the structure of the enzyme at 2.6 Angstroms and the use of the structure to identify or design agents that bind to the enzyme. Such agents may act as agonists or antagonists of the biotin protein ligase. Antagonist agents would be considered candidate anti-bacterial agents.

A reference herein to a patent document or other matter which is given as prior art is not to be taken as an admission that that document or matter was known or that the information it contains was part of the common general knowledge as at the priority date of any of the claims.

Summary of the Invention

In the present studies, the crystal structure of Staphylococcus aureus biotin protein ligase complexed with biotinyl 5'-adenylate has been determined at a resolution of 2.6 Angstroms. Determination of the crystal structure has been used in the present studies to identify molecules that interact with the biotin binding domain of the enzyme.

Thus, the determination of the crystal structure allows the identification and/or rational design of antagonists and agonists of biotin protein ligase enzymes, and in particular, antagonists of Staphylococcus aureus biotin protein ligase. Such antagonists may be used to inhibit bacterial infections, including Staphylococcus aureus infections.

Accordingly, the present invention provides a crystal of a Staphylococcus aureus biotin protein ligase.

The present invention also provides a method of producing a crystal of a Staphylococcus aureus biotin protein ligase, the method including the hanging drop diffusion technique using a precipitant solution including about 8% PEG.

The present invention also provides a method of identifying an agent which is capable of acting as a ligand of a biotin protein ligase, the method including identifying an agent that has a conformation and/or polarity such that it is capable of interacting with at least one relevant amino acid residue of a Staphylococcus aureus biotin protein ligase.

The present invention also provides an isolated biotin binding domain of a Staphylococcus aureus biotin protein ligase.

The present invention also provides an isolated molecule or molecular complex wherein at least a portion of the structural coordinates of the molecule or molecular complex define the same relative spatial configuration as at least a portion of the structural coordinates of the Staphylococcus aureus biotin protein ligase as set out in Figure 3. The present invention also provides a data set defining a scalable three-dimensional configuration of points at least a portion of the data set being derived from, or defining the same relative spatial configuration as, at least a portion of the structure coordinates of a Staphylococcus aureus biotin protein ligase.

The present invention also provides a scalable three dimensional configuration of points, at least a portion of the points being derived from, or defining the same relative spatial configuration as, at least a portion of the structure coordinates of a Staphylococcus aureus biotin protein ligase.

Various terms that will be used throughout the specification have meanings that will be well understood by a skilled addressee. However, for ease of reference, some of these terms will now be defined.

The term "biotin protein ligase" as used throughout the specification is to be understood to mean a protein that has the capacity to enzymatically attach a free biotin group covalently to a substrate in a reaction catalysed by the hydrolysis of a nucleoside triphosphate. The biotin protein ligase may be a naturally occurring form of a protein or a fragment thereof, a variant thereof , a synthetic form of a protein, or an analogue of a protein.

The term "biotinylation" as used throughout the specification is to be understood to mean the covalent attachment of a biotin group to one or more molecules. The biotinylation reaction may occur, for example, in vivo, in a biological system, in one or more isolated cells, or in a cell free system in vitro.

The terms "biotinyl 5 '-adenylate", "biotinyl-AMP" and "biotinyl-5'-AMP" are used interchangeably throughout the specification and would be understood by a person skilled in the art to mean the same.

The term "substrate" as used throughout the specification in relation to a biotin protein ligase is to be understood to mean a molecule that has the capacity to have a biotin group covalently attached to the molecule by the action of a biotin protein ligase. Examples of substrates include proteins (or fragments thereof) that have the capacity for a biotin group to be attached to them, polypeptides synthesized in vitro that have the capacity for a biotin group to be attached to them, or small molecules that have the capacity for a biotin group to be attached to them, such as hydroxylamine.

The term "biological system" as used throughout the specification is to be understood to mean a single or multi-cellular system in which biotinylation occurs. For example, the biological system may be one or more isolated cells, a unicellular organism such as a bacterium, the part or whole of a tissue or organ, or an entire multi-cellular organism, such as a human, animal or plant.

The term "variant" as used throughout the specification is to be understood to mean an amino acid sequence of a polypeptide or protein that is altered by one or more amino acids. The variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties to the replaced amino acid (e.g., replacement of leucine with isoleucine). A variant may also have "non-conservative" changes (e.g., replacement of a glycine with a tryptophan) or a deletion and/or insertion of one or more amino acids. The term "variant" also includes within its scope any insertions/deletions of amino acids to a particular polypeptide or protein. A "functional variant" will be understood to mean a variant that retains the functional capacity of a reference protein or polypeptide.

The term "nucleic acid" as used throughout the specification is to be understood to mean an oligonucleotide or polynucleotide. The nucleic acid may be DNA, RNA or a derivative thereof, and may be single stranded or double stranded. The nucleic acid may be any type of nucleic acid, including for example a nucleic acid of genomic origin, cDNA origin (i.e. derived from a mRNA), derived from a virus, or of synthetic origin.

The term "subject" as used throughout the specification is to be understood to mean a multicellular organism, including a human or an animal subject. For example, in the case where the subject is a human or animal, the subject organism may be a mammal, a primate, a livestock animal (eg. a horse, a cow, a sheep, a pig, or a goat), a companion animal (eg. a dog, a cat), a laboratory test animal (eg. a mouse, a rat, a guinea pig, a bird), an animal of veterinary significance, or an animal of economic significance. The term "isolated" as used throughout the specification is to be understood to mean an entity, for example a protein, a nucleic acid, or a cell, which is purified and/or removed from its natural environment. For example, an isolated biotin protein ligase may be a partially or substantially purified form of the enzyme.

The term "anti-pathogenic agent" as used throughout the specification is to be understood to mean an agent that functions to suppress, destroy, kill, or inhibit the growth, propagation, reproduction or maintenance of an organism. As will be appreciated, in certain embodiments the term relates to anti-microbial agents and antibacterial agents.

The term "structure coordinates" as used throughout the specification is to be understood to mean coordinates derived from mathematical equations related to the patterns obtained on diffraction of a beam of x-rays by the atoms (scattering centres) of a crystal analysed. The diffraction data are used to calculate an electron density map of the repeating unit of the crystal. The electron density maps are then used to establish the positions of the individual atoms of the molecule making up the crystal.

The term "binding domain" as used throughout the specification is to be understood to mean a region of a molecule or a molecular complex that, as a result of any one or more of properties such as one or more of its shape, charge, hydrophobicity or hydrophilicity, is able to interact with another chemical entity. A binding domain may include, or consist of, features such as cavities, pockets, surfaces, or interfaces between domains. Chemical entities that may interact with a binding domain include, for example, small molecules, macromolecules, oligopeptides, polypeptides, proteins, nucleic acids, aptamers, cofactors, substrates, inhibitors, agonists, and antagonists.

The term "equivalent amino acid residues" as used throughout the specification is to be understood to mean one or more residues that are in the same position in a polypeptide chain, and/or have the same or similar biophysical characteristics, and/or have the same or similar chemical characteristics. It will be understood that two amino acid residues may not be in the same absolute position of a protein sequence, yet still be equivalent. Brief Description of the Figures

Figure 1 shows the amino acid sequence of the S. aureus biotin protein ligase (SaBPL) utilised in the current studies. The amino acid sequence is designated SEQ ID NO.4.

Figure 2 shows a SaBPL-6xHis + Biotin crystal grown at 4⁰C for 5 days in reservoir conditions containing 12 % PEG 8K, 0.1M tris-HCL pH 8.0 (500 μl).

Figure 3 shows the atomic coordinate data for SaBPL Biotinyl-AMP crystal. In the table the second column denotes the atom number, the third column denotes the atom, the fourth the residue type, the fifth the chain identification (A, X or W), the sixth the residue number, the seventh, eighth and ninth columns are the X, Y and Z coordinates respectively of the atom in question, the tenth column the occupancy of the atom, the eleventh the temperature factor of the atom and the last column denotes the atom type.

Figure 4 shows a ribbon diagram of the dimer of SaBPL-6xHis in complex with the ligand biotinyl-5'-AMP.

Figure 5 shows a computer generated 3-dimensional structure of biotinol-5'-AMP docked into the active site of S. aureus biotin protein ligase (BPL). The adenosine (A) and biotin (B) binding pockets are shown. The pockets are rotated approximately 90° relative to each other. The biotinol-5'-AMP is shown as sticks, while the molecular surface and ribbon representation of the backbone of the BPL are also shown.

Figure 6 shows the stereo-chemical structure of 10-[(lS,3R,4S,5R,6R)-4,5-Dihydroxy- 6-methyl-3-((lS,3R,4S,5R,6R)-3,4,5-trihydroxy-6-methyl-tetrahydro-pyran-2-ylox)- tetrahydro-pyran-2-yloxy]-6-hydroxy- 1 -methyl-benzo [h] [ 1 Jbenzopyrano [5,4,3- cde][l]benzopyran-5,12-dione, identified by in silico drug screening.

Figure 7 shows a graph demonstrating that biotinol-5'-AMP is an inhibitor of S. aureus biotin protein ligase.

Figure 8 shows double reciprocal plots summarising the inhibitory mechanism of biotinol-5'-AMP on S. aureus biotin protein ligase (BPL). Plot A tracks initial BPL enzyme velocity against varying MgATP concentrations and different fixed concentrations of biotinol-5'-AMP. Plot B tracks initial BPL enzyme velocity against varying biotin concentrations and different fixed concentrations of biotinol-5'-AMP.

General Description of the Invention

The present invention relates to the crystal structure of Staphylococcus aureus biotin protein ligase complexed with biotinyl 5 '-adenylate, and methods for the identification and/or rational design of molecules (ligands) that are capable of interacting with a biotin protein ligase. These ligands are potential antagonists and agonists of biotin protein ligase enzymes generally, and in particular, potential antagonists of Staphylococcus aureus biotin protein ligase.

In one embodiment, the three-dimensional structure of the Staphylococcus aureus biotin protein ligase is useful for the screening and rational drug design of agents able to block the interaction(s) between Staphylococcus aureus biotin protein ligase and its natural ligands, such as biotin, ATP or its various natural protein substrates (or derivatives thereof).

Such agents may be useful for inhibiting the growth of bacteria, and thus are potential anti-bacterial agents.

In one embodiment, the agents may be useful for inhibiting bacteria of the genus Staphylococcus. Examples of bacteria in this genus include S. afermentans, S. aureus, S. auricularis, S. capitis, S. caprae, S. cohnii, S. epidermidis, S. felis, S. haemolyticus, S. hominis, S. intermedius, S. lugdunensis, S. pettenkoferi, S. saprophyticus, S. schleiferi, S. simulans, S. vitulus, S. warneri and S. xylosus.

In one specific embodiment, the agents may be useful for inhibiting Staphylococcus aureus.

In this regard, the present studies indicate that the active sites of biotin protein ligases from different species are significantly different, and as such antagonists identified or designed against Staphylococcus aureus biotin protein ligase are likely to show selectivity towards the target biotin protein ligase, and may show increased selectivity towards related biotin protein ligases, such as the biotin protein ligases from other bacteria.

Indeed, it is also anticipated that the methods of identifying or designing agents that bind to a biotin protein ligase using the structure of the Staphylococcus aureus biotin protein ligase will yield agents that are inhibitors of biotin protein ligase from Staphylococcus aureus, and possibly other pathogenic bacteria, but which do not substantially inhibit biotin protein ligases of other higher organisms, such as humans and animals, which is important in the generation of new antibiotics.

Thus, in one embodiment the present invention may be used to identify differential inhibitors, such as inhibitors that differentially inhibit a bacterial biotin protein ligase as compared to a human and/or animal biotin protein ligase.

Examples of pathogenic bacteria that may be inhibited by agents identified or designed using the structure of the Staphylococcus aureus biotin protein ligase include Acinetobacter calcoaceticus, Acinetobacter Iwqffϊ, Actinobacillus - all species, Actinomadura madurae, Actinomadura pelletieri, Actinomycetaceae - all members, Aeromonas hydrophila, Alcaligenes spp., Arachnia propionica, Arizona spp., Bacillus anthracis, Bacillus cereus, Bacteroides spp., Bartonella - all species, Bordetella - all species, Borrelia - all species, Brucella - all species, Campylobacter coli, Campylobacter fetus, Campylobacter jejuni, Cardiobacterium hominis, Chlamydia psittaci, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydia psittaci, Clostridium botulinum, Clostridium chauvoei, Clostridium difficile, Clostridium haemolyticum, Clostridium histolyticum, Clostridium novyi, Clostridium perfringens, Clostridium septicum, Clostridium sordellii, Clostridium tetani, Corynebacterium diphtheriae, Corynebacterium equi, Corynebacterium haemolyticum, Corynebacterium pseudotuberculosis, Corynebacterium pyogenes, Corynebacterium renale, Coxiella burnetii, Edwardsiella tarda, Eikenella corrodens, Enterobacter spp., Erysipelothrix rusiopathae (insidiosa), Escherichia coli (enterotoxigenic/invasive/haemorrhagic strains), Flavobacterium meningosepticum, Francisella (Pasteurella) tularensis Type A, Francisella tularensis Type B, Francisella novocida, Haemophilus influenzae , Haemophilus ducreyi, Klebsiella - all species and all serotypes, Helicobacter - all species, Legionella - all species, Leptospira interrogans - all serovars, Listeria - all species, Mimae polymorpha, Moraxella - all species, Morganella morganii, Mycobacterium bovis, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium marinum, Mycobacterium paratuberculosis, Mycobacterium africanum, Mycobacterium avium/intracellulare, Mycobacterium bovis, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium malmoense, Mycobacterium microtic, Mycobacterium scrofulaceum, Mycobacterium simiae, Mycobacterium szulga, Mycobacterium tuberculosis, Mycobacterium ulcerans, Mycobacterium xenopi, Mycoplasma - all species, Neisseria elongata, Neisseria gonorrhoeae, Neisseria meningitides, Nocardia spp., Pasteurella multocida, Pasteurella. spp., Peptostreptococcus spp., Plesiomonas shigelloides, Porphyromonas spp., Prevotella spp., Proteus - all species, Providencia spp., Pseudomonas aeruginosa, Pseudomonas (Burkholderia) mallei, Pseudomonas (Burkholderia) pseudomallei, Rickettsia - all species, Rhodococcus equi, Salmonella arizonae, Salmonella enteritidis, Salmonella typhimurium, Salmonella paratyphi, Salmonella typhi, Serpulina spp., Serratia liquefaciens, Serratia marcescens, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Shigella dysenteriae, Sphaerophorus necrophorus, Staphylococcus spp. including Staphyloccus aureus, Stenotrophomonas maltophilia, Streptobacillus moniliformis, Streptococcus spp., Treponema spp., Ureaplasma urealyticum, Vibrio spp., Yersinia (Pasteurella) pestis, Yersinia spp.

In one embodiment, the present invention provides a crystal of a Staphylococcus biotin protein ligase.

In one specific embodiment, the crystal is a crystal of a Staphylococcus aureus biotin protein ligase.

In this regard, the crystal produced in the current studies has a final R-factor and a FreeR- factor of 19.1% and 25.6%, respectively.

Generally, the generation of a protein crystal involves methods of expressing, purifying and crystallising the protein.

In the present studies, S. aureus biotin protein ligase was cloned using genomic PCR and methicillin-sensitive S. aureus. Specific oligonucleotide primers were designed using DNA sequence for the S. aureus genome (GenBank accession NC_002758). However, as a source of S. aureus biotin protein ligase, other strains of S. aureus may be used. Other strains of S. aureus include COL, MRSA252, MSSA476, MW2, Mu50, ATCC 700699, N315, NCTC 8325, Newman, USA300, JHl, JH9 and Mu3.

It will also be appreciated that a biotin protein ligase from another species (bacterial or otherwise) may be obtained and the nucleotide sequence altered by recombinant DNA technology to arrive at an amino acid sequence equivalent to that of a S. aureus biotin protein ligase.

For example, other Staphyloccus species may used. Examples of other Staphyloccus species include S. afermentans, S. auricularis, S. capitis, S. caprae, S. cohnii, S. epidermidis, S. felis, S. haemolyticus, S. hominis, S. intermedius, S. lugdunensis, S. pettenkoferi, S. saprophyticus, S. schleiferi, S. simulans, S. vitulus, S. warneri and S. xylosus.

In this regard, methods for identifying biotin protein ligases are known in the art. For example, biotin protein ligases may be identified using the BLAST algorithm, which determines the extent of homology between two nucleotide sequences (blastn) or the extent of homology between two amino acid sequences (blastp). BLAST identifies local alignments between the sequences in the database and predicts the probability of the local alignment occurring by chance. The BLAST algorithm is as described in Altschul et al (199O) J MoI. Biol. 215:403-410.

It will also be appreciated that the S. aureus biotin protein ligase includes within its scope a variant or fragment of a S. aureus biotin protein ligase. For example, the biotin protein ligase may be based on a naturally occurring amino acid sequence and the DNA sequence altered by recombinant DNA technology to produce a variant amino acid sequence, for instance to improve properties such as the expression, stability, function, interaction with a ligand, or crystallization of the protein.

Possible variants include: (i) a variant that has one or more "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties to the replaced amino acid; and/or (ii) a variant that has one or more "non-conservative" changes; and/or (iii) a variant that has a deletion and/or insertion of one or more amino acids.

Conservative substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine, and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine. Under some circumstances, substitutions within the aliphatic group alanine, valine, leucine and isoleucine are also considered as conservative. Sometimes substitution of glycine for one of these can also be considered conservative. Other conservative interchanges include those within the aliphatic group aspartate and glutamate; within the amide group asparagine and glutamine; within the hydroxyl group serine and threonine; within the aromatic group phenylalanine, tyrosine and tryptophan; within the basic group lysine, arginine and histidine; and within the sulfur-containing group methionine and cysteine. Sometimes substitution within the group methionine and leucine can also be considered conservative. Substitutions as described above are contemplated within the scope of the present invention.

The S. aureus biotin protein ligase may be expressed and purified by a suitable method. Methods for expressing and purifying proteins are known in the art.

In the present studies, S. aureus biotin protein ligase was engineered with a hexahistidine sequence on the C-terminus of the protein in order to aid protein purification. Other protein tags which can aid protein purification and the associated methods of protein purification are known in the art and include, for example, maltose binding protein (MBP), glutathione-S-transferase (GST) and thioredoxin.

In one embodiment, the crystal of S. aureus biotin protein ligase is a co-crystal with another molecule. Examples of such molecules include natural ligands of biotin protein ligase, potential antagonists or agonists of a biotin protein ligase, and molecules identified by using the crystal structure of the biotin protein ligase. In one embodiment, the crystal may be a crystal of the biotin protein ligase with biotin or biotinyl 5'- adenylate. In one specific embodiment, the crystal of S. aureus biotin protein ligase is a co-crystal of the biotin protein ligase and biotinyl 5 '-adenylate.

In this regard, in the present studies biotin conjugation was performed by contacting 10 mM d-biotin in 50 mM Tris-HCl pH 7.5 with S. aureus BPL-H6. After concentration, the conjugate was contacted with 50 mM ATP to allow the formation of SaBPL- H₆biotinyl-5'AMP. Crystallisation of this form of the biotin protein ligase from S. aureus was then performed.

Co-crystals may be obtained, for example, by crystallizing the protein in the presence of a ligand or by soaking the ligand with the crystal.

In one embodiment, crystallisation of S. aureus biotin protein ligase, either conjugated to biotinyl 5 '-adenylate or unconjugated, is performed using the hanging drop method.

Other methods of crystallisation include batch, liquid, bridge, dialysis and vapour diffusion methods. Methods for growing crystals typically involve the addition of precipitants to the concentrated solution of the polypeptide, to a level where the precipitants are just below that necessary to precipitate the protein. Water is then removed by controlled evaporation to produce precipitating conditions. These conditions are maintained until crystal growth ceases.

In the present studies it has been determined that a precipitant solution including about 8% PEG may be used to effectively produce a crystal of biotin protein ligase.

Accordingly, the present invention also provides a method of producing a crystal of a biotin protein ligase, the method including the hanging drop diffusion technique using a precipitant solution including about 8% PEG.

In one embodiment, the biotin protein ligase is from a Staphyloccus species.

In one specific embodiment, the biotin protein ligase is from Staphyloccus aureus.

Accordingly, in another embodiment the present invention provides a method of producing a crystal of a Stαphyloccus aureus biotin protein ligase, the method including the hanging drop diffusion technique using a precipitant solution including about 8% PEG.

In the case of the hanging drop method, the method may be optimised by varying a number of conditions, including for example one or more of pH, buffer type, buffer concentration, salt type, polymer type, polymer concentration, other precipitating agents and the concentration of purified biotin protein ligase.

Conditions and buffers for the hanging drop method may also include one or more of the following:

• pH (for example pH 4-9);

• buffer type (for example phosphate, cacodylate, acetates, imidazole, Tris HCl, Tris base, sodium HEPES); • buffer concentration (for example 10-200 mM);

• salt type (for example calcium chloride, sodium citrate, magnesium chloride, ammonium acetate, ammonium sulphate, potassium phosphate, magnesium acetate, zinc acetate or calcium acetate);

• polymer type and concentration (for example polyethylene glycol (PEG) 1-50%, average molecular weight 100-10000);

• EDTA (for example 0-500 mM);

• other agents (for example salts: K, Na tartrate, (NH₄)₂SO₄, Na Acetate, Li₂SO₄, Na Formate, Na Citrate, Mg Formate, Na₂PO₄, K₂PO₄, (NH₄)PO₄; organics: 2- propanol; non-volatile: 2- methyl-2,4-pentanediol); and • concentration of biotin protein ligase (for example 1.0-100 mg/ml).

The present invention also provides a crystal or a co-crystal produced by the above method. For example, the method may be used to produce a crystal of a biotin protein ligase and a ligand, such as biotin or biotinyl 5 '-adenylate.

As described previously herein, it will also be appreciated that the present invention also provides a co-crystal of a biotin protein ligase and an agent or a ligand, the agent or ligand being identified or designed using the structure of the S. aureus biotin protein ligase.

As described previously herein, co-crystals may be generated by crystallising the conjugated protein. Alternatively, co-crystals may be obtained by soaking a crystal of biotin protein ligase in a mother liquor containing the ligand. Methods of soaking crystals to form co-crystals are known in the art. Typically, the crystal will be soaked for 6-18 hours in a mother liquor containing 2-5 mM of the ligand.

As described above, production of a crystal of biotin protein ligase allows the determination of the structure of the protein by X-ray crystallography. In the case of a co-crystal of a biotin protein ligase and a ligand, this allows the determination of the structure of the biotin protein ligase complexed with the ligand.

X-ray crystallography relies on the observation that as a parallel X-ray beam is passed through a molecule, the X-rays are scattered by electrons within the crystal. The scattering of X-rays in the context of the crystal give rise to diffraction. The pattern of diffraction is unique to the particular arrangement of atoms in the crystal. Typically X- rays are shone on the crystal while it rotates through up to 360 degrees, thus allowing a

"data set" to be collected. Diffraction data is recorded and the intensity and position of each diffraction spot is measured. The three dimensional structure of the molecule can then be determined from this data.

Crystallisation and X-ray crystallography can therefore provide a large amount of data about the protein including the unit cell dimensions, space group symmetry, spatial relationships represented by structural coordinates and atomic spatial relationship data.

The unit cell dimensions are characterised in three dimensions in units of Angstroms (one A = 10^"10 meters) and by angles at each vertices. The symmetry of the unit cell in the crystals is also characterised at this point. The symmetry of the unit cell in the crystal simplifies the complexity of the collected data by identifying repeating patterns.

A number of computer programs are known in the art to assist in the reconciliation of the coordinates to define the structure for use in identifying molecules that interact with biotin protein ligase and/or in rational drug design. In the present studies, coordinate data were processed using MOSFLM (Leslie, A.G.W. (1992) Joint CCP4 + ESF-EAMCB Newsletter on Protein Crystallography, No. 26.). The structure of SaBPL-H₆-Biotinyl-5"-AMP complex was solved by molecular replacement using PHASER as implemented in the CCP4 suite of programs and the Pyrococcus horikoshii OT3 (Ph) BPL-biotin structure (PDB entry IWPY) for catalytic and C-terminal phases and the E.coli (Ec) BPL-biotin structure (PDB entry IHXD) for the N-terminal. For molecular replacement, biotin and water groups were removed from the search model. Searches against PhBPL alone failed to produce a solution. EcBPL with the N-terminal 90 amino acids removed successfully determined the position and orientation of SaBPL. The model phases were improved using PIRATE followed by automatic model building with BUCCANEER (Cowtan, K. (2006) Acta Crystallogr. Section D 62(9): 1002- 11.). The structure was completed through rounds of Model building, COOT (Paul Emsley and Kevin Cowtan (2004) Acta Crystallographica Section D, 60:2126-2132) and refinement with REFMAC (Murshudov, G.N., et al. (1997) Acta Cryst. D53:240-255). 5% of the data were set aside prior to any refinement for cross validation. Biotinyl-5"-AMP was clearly visible in the active site.

In one embodiment, a co-crystal of the S. aureus biotin protein ligase and biotinyl 5'- adenylate has a space group symmetry P4₂.

In another embodiment, a co-crystal of the S. aureus biotin protein ligase and biotinyl 5 '-adenylate has a space group symmetry P2i.

In another embodiment, a co-crystal of the S. aureus biotin protein ligase and biotinyl 5'-adenylate has unit cell dimensions of 93.564 A±5%, 93.564 A±5%, 130.65 A±5%.

In another embodiment, a co-crystal of the S. aureus biotin protein ligase and biotinyl 5'-adenylate has unit cell dimensions of 93.564 A±O.2%, 93.564 A±O.2%, 130.65 A±O.2%.

In one embodiment, a co-crystal of the S. aureus biotin protein ligase and biotinyl 5'- adenylate has the space group symmetry P4₂2i2. In another embodiment, a co-crystal of the S. aureus biotin protein ligase and biotinyl 5 '-adenylate has the space group symmetry P2i2i2.

Figure 3 shows the atomic coordinate data for SaBPL Biotinyl- AMP crystal.

Accordingly, in another embodiment there is provided a crystal of S. aureus biotin protein ligase, or a co-crystal of the S. aureus biotin protein ligase and biotinyl 5'- adenylate, which has atoms arranged in the spatial relationship represented by the structure coordinates listed in Figure 3.

In analysing the x-ray crystallographic data it will be appreciated that each of the amino acids contained within the structure is defined by a set of structure coordinates, as set forth in Figure 3. Slight variations in structure coordinates can be generated by mathematically manipulating the structure coordinates obtained. For example, the structure coordinates given in Figure 3 may be manipulated by crystallographic permutations of the structure coordinates, fractionalisation of the structure coordinates, integer additions or subtractions to sets of the structure coordinates, inversion of the structure coordinates or any combination of the above. Alternatively, modifications in the crystal structure due to mutations, additions, substitutions, and/or deletions of amino acids, or other changes in any of the components that make up the crystal, may also yield variations in structure coordinates. Such variations in the individual coordinates may have little effect on overall shape of the molecule. If such variations are within an acceptable standard error as compared to the original coordinates, the resulting three- dimensional shape is considered to be structurally equivalent.

There are a number of computational analytical techniques that can be used to determine whether a molecule or a part thereof is "structurally equivalent", defined in terms of its three-dimensional structure, to all or part of the S. aureus biotin protein ligase. These techniques may be carried out in current software applications, such as for example the Molecular Similarity application of QUANTA (Molecular Simulations Inc., San Diego, CA) version 4.1. Whilst each individual application that allows these calculations to be carried out works on slightly different principles, the end use output is typically very similar for each application. Such applications generally permit comparisons between different structures, different conformations of the same structure, and different parts of the same structure, and are typically divided into four steps: load the structures to be compared; define the atom equivalences in these structures; perform a fitting operation; and analysis of the results.

Generally, one structure is identified as the target (i.e. the fixed structure) and all remaining structures are working structures (i.e. moving structures). When a rigid fitting method is used, the working structure is translated and rotated to obtain an optimum fit with the target structure. The fitting operation generally uses a least squares fitting algorithm which computes the optimum translation and rotation to be applied to the moving structure, such that the root mean square difference of the fit over the specified pairs of equivalent atom is an absolute minimum.

Generally, any molecule, molecular complex or fragment thereof that has a root mean square deviation of conserved residue backbone atoms (eg N, Ca, C, O) of less than about 2.1 A, when superimposed on the relevant backbone atoms described by the reference structure coordinates listed in Figures 3, will be considered structurally equivalent to the reference molecule. In other words, the crystal structures of those portions of the two molecules are substantially identical, within acceptable error margins typically observed. In one embodiment, structurally equivalent molecules, molecular complexes or fragments thereof are those that are defined by the entire set of structure coordinates listed in Figure 3 with a root mean square deviation from the conserved backbone atoms of those amino acids of not more than 2.1 Angstrom. In one specific embodiment, the root mean square deviation is less than about 1.0 Angstrom.

In one embodiment, the crystals of S. aureus biotin protein ligase and/or S. aureus biotin protein ligase conjugated with a ligand or other molecule, are used to obtain atomic spatial relationship data.

In this regard, one of the primary outcomes for obtaining information provided by crystallising the biotin protein ligase and elucidating the structural relationship of the binding domain is that this information can be used in identification, for example computer-aided identification, of molecules capable of binding to the biotin protein ligase and/or in the rational design of drugs. Accordingly, the present invention also provides a method of identifying an agent which is capable of acting as a ligand of a biotin protein ligase, the method including identifying an agent that has a conformation and/or polarity such that it is capable of interacting with at least one relevant amino acid residue of a Staphylococcus aureus biotin protein ligase.

As described previously, X-ray structure coordinates obtained when a crystal structure is solved define a unique configuration of three-dimensional points that serve to identify positions of the atoms in the crystal relative to each other. The data obtained does not, however, define an absolute set of points in space.

As will be understood, a set of structure coordinates for any crystal structure defines a relative set of points that, in turn, define a configuration of atoms in three dimensions. The importance of crystal structure data is that it provides information as to the spatial relationship of the atoms in the crystal with respect to each other.

In addition, a scalable configuration of points can be defined by increasing or decreasing the distances between coordinates by a scalar factor while keeping the angles essentially the same. This scalable information may also be used for drug design applications.

In addition it should be noted that the crystal structure data obtained in Figure 3 includes data pertaining to all atoms in the crystal. When using this data in the identification of interacting molecules or in rational drug design, only a portion of the structural coordinates may be needed, as the salient information is that detailing the relative conformation of the atoms constituting the binding site and/or point of interaction of the two molecules in the complex as the case may be. Thus, the present invention includes utilising a portion of the data, and not the entire data set.

For example, by exploiting all or part of the data provided in Figure 3, it is possible to compile an abridged data set that when supplied to an appropriate computer program would provide all the information required to effectively model the binding domain. This would be sufficient to allow computer aided molecular interaction and drug design programs. In general, the data required relates to the binding domain identified by the crystal structure. Whilst the drug design/modelling would generally be carried out using all the crystal data pertaining to the binding domain, only a portion of the data may be required.

The present invention therefore includes within its scope data sets derived from the crystal structure data coordinates provided by the present invention or data sets defining the same relative spatial configuration of atoms as the structural coordinates of the crystal structure data provided by the present invention. As discussed above, it is envisaged that only a portion of the data set may be needed. The invention therefore includes data sets where only a portion of the data set of the present invention is utilised.

Accordingly, in one embodiment the crystal of S. aureus biotin protein ligase, and/or S. aureus biotin protein ligase conjugated with biotinyl-5'-AMP, are used to obtain atomic spatial relationship data for screening and/or designing a compound for binding to a biotin protein ligase.

In this regard, traditionally drug development and design has occurred by undertaking large screening programs, by the use of structure activity studies, or by serendipity.

More recently drug design has been carried out by using computer assisted models, referred to as in silico screening, which can model the desired interaction and leading to improved therapeutic compounds. Computer assisted analysis therefore provides the ability to screen, identify, select and/or design chemical entities capable of associating with a particular molecule of interest.

Therefore, in another embodiment the screening includes in silico screening of the ability of a compound to bind to a biotin protein ligase.

Detailed knowledge of the structural coordinates of a molecule permits the design and/or identification of molecules which are spatially adapted for possible interaction with a selected region of a target molecule, such as the binding site with a ligand. Accordingly computer aided modelling can be used to identify and/or design chemical entities, such as modulators, ligands, agonists and antagonists, that associate with one or more specific regions of a biotin protein ligase, such as the biotin binding domain.

In particular, once identified and screened for biological activity, inhibitors/antagonists may have utility to interfere with the activity of the molecule and as such are candidate molecules useful in inhibiting the growth of bacteria, and in particular S. aureus.

As described previously herein, in one embodiment the whole biotin protein ligase structure, or a part thereof, may be used to screen for compounds that associate with one or more biotin ligase binding domains.

In this regard, it will be appreciated that the present invention contemplates screening to any selected region of the biotin protein ligase of interest. In one embodiment, the region of interest is the biotin binding domain.

In this regard, the present invention also provides an isolated biotin binding domain of a Staphylococcus aureus biotin protein ligase.

In the current studies, amino acids Ser 92, Thr 93, GIn 115, Arg 119, Lys 186, Arg 121, Arg 124, and Asn 211 of Staphylococcus aureus biotin protein ligase have been determined as amino acids of particular relevance, as these residues interact with biotinyl-5"-AMP to form hydrogen bonds. Accordingly, one or more of each of these residues is a potentially suitable target for screening compounds to modulate the binding of biotin to biotin protein ligase.

In another embodiment, the isolated biotin binding domain of a Staphylococcus aureus biotin protein ligase includes at least one amino acid selected from the group consisting of Ser 92, Thr 93, GIn 115, Arg 119, Lys 186, Arg 121, Arg 124, and Asn 211.

In another embodiment, the amino acid residues in the binding domain are in the same relative spatial configuration as the corresponding amino acid residues in Figure 3.

In one embodiment, the isolated biotin binding domain is used for screening or designing a compound for binding to a biotin protein ligase. This may include non- silico and/or in silico screening of the ability of the compound to bind to a biotin protein ligase, or a variant or fragment thereof.

In terms of producing an isolated biotin binding domain, methods are known in the art for expressing and purifying polypeptides. For example, recombinant DNA technology may be used to produce a nucleic acid encoding a biotin binding domain. The isolated polypeptide may then be produced. Crystals of the biotin binding domain, with or without ligand, may then be produced.

In one embodiment, the isolated biotin binding domain of a Staphylococcus aureus biotin protein ligase includes amino residues 80-322, or a variant thereof. In one specific embodiment, the isolated binding domain consists of amino acids 80-322, or a variant thereof.

In one embodiment, the isolated biotin binding domain of a Staphylococcus aureus biotin protein ligase includes amino residues 64-322, or a variant thereof. In one specific embodiment, the isolated binding domain consists of amino acids 64-322, or a variant thereof.

In this regard, it has been determined in the present studies that Aspartate 64 has its side chain on the surface but can form a salt bridge or hydrogen bond to a cluster of charged and polar groups close to its acidic side chain, and Leucine 80 is positioned within its side chain held in a small hydrophobic pocket.

Selection of these amino acid residues omits the N-terminal domain of BPL from the structure. These residues have a clear domain boundary and the location of side chains is likely to produce a stable substructure, with maintained binding domain integrity.

The present invention also provides an isolated molecule or molecular complex with at least a portion of the structural coordinates in the same or a similar relative spatial configuration as at least a portion of the structural coordinates as set out in Figure 3.

Accordingly, in another embodiment the present invention provides an isolated molecule or molecular complex wherein at least a portion of the structural coordinates of the molecule or molecular complex define the same relative spatial configuration as at least a portion of the structural coordinates of the Staphylococcus aureus biotin protein ligase as set out in Figure 3.

An isolated molecule or molecular complex includes any suitable molecule, variant or part thereof, a complex of two or more molecules, or a variant or part thereof.

In one embodiment, the molecule is a biotin protein ligase, or a variant or fragment thereof. The biotin protein ligase may or may not be complexed with another molecule.

In one embodiment, the molecule or molecule complex includes the biotin binding domain.

In one specific embodiment, the molecule or molecule complex consists of the biotin binding domain.

In another embodiment, the molecule or molecular complex has the capacity to bind biotin or biotinyl 5 '-adenylate.

In another embodiment, the molecular complex is a biotin protein ligase (or a variant or fragment thereof) associated with a ligand, such as biotin or biotinyl 5 '-adenylate, or a ligand identified or designed using the crystal structure of a biotin protein ligase.

In one embodiment, the isolated molecule or molecular complex includes at least one amino acid selected from the group consisting of Ser 92, Thr 93, GIn 115, Arg 119, Lys 186, Arg 121, Arg 124, and Asn 211.

In one embodiment, the isolated molecule or molecular complex includes a plurality of amino acid selected from the group consisting of Ser 92, Thr 93, GIn 115, Arg 119, Lys 186, Arg 121, Arg 124, and Asn 211. In one specific embodiment, the isolated molecule includes all these amino acids.

In one embodiment, the isolated molecule or molecular complex is used for producing a crystal or a co-crystal. In another embodiment, the isolated molecule or molecular complex is used for screening or designing a compound for binding to a biotin protein ligase, or a variant or part thereof.

In one embodiment, the screening includes in silico screening of the ability of the compound to bind to the molecule or molecular complex, and/or to bind to a biotin protein ligase, or a variant or part thereof.

As described previously herein, chemical entities that are identified or designed by computer methods to interact with the biotin binding domain of biotin protein ligase are potential biotin protein ligase antagonists or agonists, and are therefore potential drug candidates.

In one embodiment, potential agonists and antagonists binding to the biotin binding domain of biotin protein ligase may be identified and/or designed by consideration of the X-ray crystallography data described previously herein.

In one embodiment, such data is used in computational methods known in the art to determine which residues are on the surface of a molecule and therefore potentially able to interact with other molecules in solution. The structural coordinate data, stored for example in a machine-readable storage medium that is capable of displaying and/or using a three-dimensional representation of the structure in a liganded and unliganded state, can be used in drug discovery. The structure coordinates of the chemical entity are used to generate a three- dimensional representation that can be computationally fitted to the three-dimensional image of S. aureus biotin protein ligase. The data can be used by a number of well known programs to display the structure of the region of interest. There are a number of computer programs that can be used to do this, including BUSTER, RASMOL, COOT, ADT, CHAIN, CCP4, DIANA, FELIX, FRODO, HKL, HEAVY, MADIGRAS, MOSFILM, PHASES₅O, SHARP, SOLVE, XDS and XPLOR.

Methods to screen chemical entities or fragments for their ability to associate with a target site are known in the art. Selected fragments or chemical entitles may then be positioned in a variety of orientations, or docked, within that binding pocket as defined above. Docking may be accomplished using software such as Quanta and Sybyl, followed by energy minimization and molecular dynamics with standard molecular mechanics force fields, such as CHARM and AMBER.

Typically the docking procedure involves the following steps: (i) an affinity grid is calculated that maps onto the surface of the active site of the molecule. This grid is used to describe the binding energy of particular functional groups when they bind to the surface of the binding pocket; (ii) potential ligands with a large range of conformations are generated in silico; (iii) ligands are then screening against the affinity grids allowing for rotation about selected bonds and for the overall position on the affinity grid;

(iv) ligands with acceptable estimated binding energies are subjected to optimisation of both their geometry/conformation and their binding position/interaction energies.

Specialized computer programs that may also assist in the process of selecting fragments or chemical entities include GRID (Goodford, 1985), MCSS (Miranker et ah, 1991), AUTODOCK (Goodsell, 1990), and DOCK (Kuntz, 1982).

Once suitable chemical entities or fragments have been selected, they can also be assembled into a single compound or complex. Assembly may be preceded by visual inspection of the relationship of the fragments to each other on a three-dimensional image (displayed for example on a computer screen) in relation to the structure coordinates of the target compound or site. This may be followed by manual model building using software.

Programs that may be used to aid connecting individual chemical entities or fragments include CAVEAT (Bartlett, 1989), 3D Database systems such as MACCS-3D (MDL Information Systems, San Leandro, Calif), and HOOK (available from Molecular Simulations Burlington, Mass.).

In addition, identifying or designing a ligand for the target, target-binding compounds may also be designed as a whole or de novo. Methods include LUDI (Bohm, 1992), LEGEND (Nishibata, 1991), and Leap Frog (available from Tripos Associates, St. Louis. Mo.). Once a compound has been designed or selected by such methods, the efficiency with which that compound can bind to a target site may be assessed and optimised by further evaluation, typically being computational assisted evaluation. For example, an effective ligand will often demonstrate a relatively small difference in energy between its bound and free states, i.e. a small deformation energy of binding. Thus efficient ligands may be designed with a deformation energy of binding of not greater than, for example, about 10 kcal/mole, and generally not greater than 7 kcal/mole.

Molecules may also interact with the target in more than one conformation that is similar in overall binding energy. In those cases, the deformation energy of binding is generally taken to be the difference between the energy of the free entity and the average energy of the conformations observed when the inhibitor binds to the protein.

A chemical entity designed or selected as binding to a target may also be further optimised so that in its bound states it lacks repulsive electrostatic interaction with the target enzyme. Such non-complementary (e.g., electrostatic) interactions include repulsive charge-charge, dipole-dipole and charge-dipole interactions. Generally a suitable outcome is when the sum of all electrostatic interactions between the ligand and the target, when the ligand is bound to the target, makes a neutral or favourable contribution to the enthalpy of binding.

Specific computer software is available to evaluate compound deformation energy and electrostatic interaction. Examples of programs designed for such uses include Gaussian 92, revision C [M. J. Frisch, Gaussian, Inc., Pittsburgh, Pa.]; AMBER, version 4.0 [P. A. Kollman, University of California at San Francisco]; QUANTA/CHARMM [Molecular Simulations, Inc., Burlington, Mass.]; and Insight II/Discover (Biosysm Technologies Inc., San Diego, Calif.).

Once a molecule of interest has been optimally selected or designed, as described above, substitutions may then be made in some of its atoms or side groups in order to improve or modify its binding properties. Generally initial substitutions are chemically or physically conservative, i.e., the replacement group will have approximately the same size, shape, hydrophobicity and charge as the original group. Such substituted chemical compounds may then be analysed for efficiency of fit to the desired target site by the same methods described in detail, above.

Another approach is the computational screening of small molecule databases for chemical entities or compounds which can bind in whole, or in part, to a desired target. In this screening, the quality of fit of such entities to the binding site may be judged for example either by shape complementarity or by estimated interaction energy.

Such stereochemical complementarity is characteristic of a molecule which matches intra-site surface residues lining the binding regions identified herein. In this regard, the matching means that the identified portions interact with the surface residues, for example, via hydrogen bonding or by enthalpy/entropy-reducing van der Waals interactions which promote desolvation of the biologically active compound within the site, in such a way that retention of the biologically active compound within the groove is energetically favoured.

It will be appreciated that it is not necessary that the complementarity between potentially interacting molecules and a binding site extend over all residues lining the site in order to inhibit stabilise binding of the ligand. Accordingly, molecules which bind to some, but not all, of the residues lining the site are encompassed by the present invention.

In general, the design of a molecule possessing stereochemical complementarity can be accomplished by means of techniques which optimise, chemically and/or geometrically, the "fit" between a molecule and a target molecule. In a geometric approach, the number of internal degrees of freedom, and the corresponding local minima in the molecular conformation space, is reduced by considering only the geometric (hard-sphere) interactions of two rigid bodies, where one body (the active site) contains "pockets" or "grooves" which form binding sites for the second body (the complementing molecule, as ligand).

Another approach entails an assessment of the interaction of different chemical groups ("probes") with the active site at sample positions within and around the site, resulting in an array of energy values from which three- dimensional contour surfaces at selected energy levels can be generated. Molecules identified in this way can then be modified to satisfy criteria associated with chemical complementarity, such as hydrogen bonding, ionic interactions and van der Waals interactions.

The chemical-probe approach to ligand design is implemented in several commercial software packages, such as GRID (product of Molecular Discovery Ltd., West Way House, Elms Parade, Oxford 0X2 9LL, U. K.).

Pursuant to this approach, the chemical prerequisites for a site-complementing molecule may be identified at the outset, by probing the substrate/ligand binding site with different chemical probes, e. g., water, a methyl group, an amine nitrogen, a carboxyl oxygen, and a hydroxyl. Favoured sites for interaction between the active site and each probe are thus determined, and from the resulting three-dimensional pattern of such sites a putative complementary molecule can be generated.

Programs suitable for searching three-dimensional databases to identify molecules bearing a desired pharmacophore include MACCS-3D and ISIS/3D (Molecular Design Ltd., SanLeandro, CA), ChemDBS-3D (Chemical Design Ltd., Oxford, UK), and Sybyl/3DB Unity (Tripos Associates, St. Louis, MO).

Programs suitable for pharmacophore selection and design include: DISCO (Abbott Laboratories, Abbott Park, IL), Catalyst (Bio-CAD Corp., Mountain View, CA), andChemDBS-3D (Chemical Design Ltd., Oxford, U.K.).

Databases of chemical structures are available from a number of sources including Cambridge Crystallographic Data Centre (Cambridge, U.K.) and Chemical Abstracts Service (Columbus, OH).

De novo design programs include Ludi (Biosym Technologies Inc., San Diego, CA), Sybyl (Tripos Associates) and Aladdin (Daylight Chemical Information Systems, Irvine, CA).

It will be appreciated that the identification or design of interacting molecules may be implemented in hardware or software, or a combination of both. Generally, the invention is implemented in computer programs executed on programmable computers each comprising a processor, a data storage system (including volatile and non-volatile memory and/or storage elements), at least one input device, and at least one output device.

Compounds identified or designed in silico may be synthesized by methods known in the art, or where available, may be purchased commercially.

As described previously herein, in the same manner that ligands may be soaked into the crystal, inhibitor soaks may be performed by soaking a crystal of biotin protein ligase in a mother liquor containing the inhibitor in order to generate inhibitor co-crystals. Methods of soaking crystals are known in the art. Typically, the crystal will be soaked for 6-18 hours in the mother liquor containing 2-5 mM of the inhibitor. Visual analysis (eg colour change) and X-ray crystallography may often be useful to confirm soaking and to define the interaction between the inhibitor and the biotin protein ligase. The same procedure may be utilized for ligands in general.

The present invention also contemplates the reiteration of this process, thereby allowing modifications to be made to the inhibitor based on the crystallographic data in order to improve the potency of the inhibitor. Similarly, a reiterative process may be used for other ligands.

It will appreciated that molecules identified by the methods of the present invention may be assessed for their ability to modulate biotin protein ligase activity by a number of in vitro assays, assays in a biological system, and in vivo assays. Assays for assessing biotin protein ligase activity are known in the art. Examples of such assays are as described in WO 2006/056007, the contents of which are herein incorporated by reference.

A typical in vitro assay for assessing biotin protein ligase activity will involve contacting biotin protein ligase with biotin, a nucleotide source and a substrate under appropriate conditions. Agents or compounds identified in silico may be added to the assay and the extent of substrate biotinylation in the presence or absence of the agent or compound determined.

In this regard, a substrate for assessing biotin protein ligase activity is a molecule that has the capacity to have a biotin group covalently attached to the molecule by the action of a biotin protein ligase. Examples of suitable substrates include the apo-biotin isoforms of biotin-containing proteins such as pyruvate carboxylase, acetyl CoA carboxylase, propionyl CoA carboxylase, B-methylcrotonyl CoA carboxylase, methylmalonyl-CoA carboxyltransferase, oxaloacetate decarboxylase, methylmalonyl- CoA decarboxylase, glutaconyl-CoA decarboxylase, urea carboxylase, geranoyl-CoA carboxylase and geranoyl-CoA transcarboxylase, or a functional variant of any of the aforementioned proteins; a polypeptide including the apo- biotin domain of any of the aforementioned protein substrates or variants of the proteins; proteins or polypeptides synthesised in vitro by chemical synthesis or in vitro translation that have the capacity to be biotinylated; or a small molecule that has the ability to have a free biotin group covalently attached to the molecule by a biotin protein ligase, such as hydroxylamine.

In one embodiment, the substrate is a polypeptide fragment containing the biotin domain of a biotin-containing protein or hydroxylamine. In one specific embodiment, the substrate is a polypeptide fragment containing the biotin domain of a biotin- containing protein.

Methods for identifying proteins encoding examples of the substrates hereinbefore described may be achieved by a suitable method. For example, pyruvate carboxylases may be identified using the BLAST algorithm, which determines the extent of homology between two nucleotide sequences (blastn) or the extent of homology between two amino acid sequences (blastp). BLAST identifies local alignments between the sequences in the database and predicts the probability of the local alignment occurring by chance. The BLAST algorithm is as described in Altschul et al., 1990, MoL Biol. 215:403-410.

In one embodiment, the substrate is a protein substrate derived from the same species or genus as that of the biotin protein ligase of interest. For example, when identifying inhibitors of S. aureus, the substrate may be a polypeptide from a S. aureaus biotin carboxylase, such as S. aureus pyruvate carboxylase. However, it will be appreciated that the substrate may also be derived from an unrelated species or genus as that of the biotin protein ligase of interest.

Identification of a test compound as an inhibitor of a biotin protein ligase may be made for example by a comparison of the extent of biotinylation of the substrate in the presence and absence of the test compound.

The present invention also contemplates the reiteration of the processes of non-silico and in silico screening, to arrive at antagonists of biotin protein ligase activity.

In another embodiment, the agent maybe tested for its ability to inhibit growth of a pathogen.

In a specific embodiment, the agent may be tested for its ability to inhibit growth of a bacterium.

In a further specific embodiment, the agent may be tested for its ability to inhibit growth of Staphylococcus spp., such as Staphyloccus aureus.

Methods for testing the ability of an agent to inhibit the growth of pathogens, including bacteria, are known in the art. Such methods include diffusion tests, disc diffusion tests, biofilm assays and serum killing tests. Suitable methods are as described in Denyer et ah, 1994, Hugo and Russell's Pharmaceutical Microbiology, Blackwell Science, USA, 7th Edition.

The present invention also contemplates the reiteration of the processes of in silico screening and screening for growth inhibitor agents, to arrive at effective anti- pathogenic agents, such as anti-bacterial agents.

The present invention also provides a computer-assisted method of identifying an agent capable of binding to a biotin protein ligase.

Accordingly, in another embodiment the present invention provides a computer-assisted method of identifying an agent capable of binding to a region of a biotin protein ligase, the method including: (a) supplying a computer modelling application with a set of structure coordinates of a molecule or molecular complex, at least a portion of the structural coordinates of the molecule or molecular complex being derived from, or defining the same relative spatial configuration as, at least a portion of the atomic coordinates of a Staphylococcus aureus biotin protein ligase as set out in Figure 3; (b) supplying the computer modelling application with a set of structure coordinates of an agent; and (c) determining whether the agent is expected to bind to the molecule or molecular complex, wherein binding to the molecule or molecular complex is indicative of binding to a region of a biotin protein ligase.

Computer-assisted methods are as previously described herein.

In one embodiment, the region of a biotin protein ligase includes a biotin binding domain. However, it will be appreciated that agents capable of binding to other suitable regions of a biotin protein ligase are also specifically contemplated.

In one embodiment, at least a portion of the structural coordinates of the molecule or molecular complex include one or more of amino acid residues Ser 92, Thr 93, GIn 115, Arg 119, Lys 186, Arg 121, Arg 124, and Asn 211, and in specific embodiments including a plurality of these amino acid residues or all of such amino acid residues.

In another embodiment, the structural coordinates of the molecule or molecular complex further include the structural coordinates of biotin or biotinyl 5 '-adenylate bound to the molecule or molecular complex.

In another embodiment, the structure coordinates of the agent are provided from a chemical library of compounds.

Methods for determining whether a compound binds or interacts with another molecule are known in the art, for example as described in "Protein-Ligand Interactions" (2003) Wiley- VCH Verlag GmbH & Co edited by H-J. Bohm et al.

In another embodiment, the method further includes using an in vitro and/or in vivo assay to determine whether the agent may bind to/interact with a region of the biotin protein ligase.

The present invention also provides an agent identified by the computer-assisted methods of the present invention. Such agents may be an antagonist or an agonist of a biotin protein ligase.

In one embodiment, the agent inhibits growth of a bacterium, such as Staphylococcus aureus. Examples of other bacteria are as previously described herein.

In another embodiment, the present invention provides a computer-assisted method for designing an agent capable of binding to a region of a biotin protein ligase, the method including: (a) supplying a computer modelling application with a set of structure coordinates of a molecule or molecular complex, at least a portion of the structural coordinates of the molecule or molecular complex being derived from, or defining the same relative spatial configuration as, at least a portion of the atomic, coordinates of a Staphylococcus aureus biotin protein ligase as set out in Figure 3; (b) supplying the computer modelling application with a set of structure coordinates for an agent; (c) evaluating the potential binding interactions between the agent and the molecule or molecular complex; (d) structurally modifying the agent to yield a set of structure coordinates for a modified agent; and (e) determining whether the modified agent is expected to bind to the molecule or molecular complex, wherein binding to the molecule or molecular complex is indicative of a potential ligand of a biotin protein ligase.

In one embodiment, steps (c) and (d) are repeated a plurality of times.

In another embodiment, the present invention provides a computer-assisted method of identifying an agent capable of binding to a region of a biotin protein ligase, the method including: (a) supplying a computer modelling application with a set of structure coordinates of a molecule or molecular complex, at least a portion of the structural coordinates of the molecule or molecular complex being derived from, or defining the same relative spatial configuration as, at least a portion of the atomic coordinates of a Staphylococcus aureus biotin protein ligase as set out in Figure 3; (b) constructing a negative image of the molecule or molecular complex; (c) supplying the computer modelling application with a set of structure coordinates of an agent; (d) determining the level of similarity of the agent with the negative image of the molecule or molecular complex; and (e) determining whether the agent is expected to bind to the molecule or molecular complex, wherein a high level of similarity of the agent with the negative image is indicative of binding to a region of a biotin protein ligase.

In another embodiment, the present invention provides a computer-assisted method for designing an agent capable of binding to a region of a biotin protein ligase, the method including: (a) supplying a computer modelling application with a set of structure coordinates of a molecule or molecular complex, at least a portion of the structural coordinates of the molecule or molecular complex being derived from, or defining the same relative spatial configuration as, at least a portion of the atomic, coordinates of a Staphylococcus aureus biotin protein ligase as set out in Figure 3; (b) constructing a negative image of the molecule or molecular complex; (c) supplying the computer modelling application with a set of structure coordinates for an agent; (d) structurally modifying the agent to yield a set of structural coordinates with high similarity to the negative image of the molecule or molecular complex; and (e) determining whether the agent is expected to bind to the molecule or molecular complex, wherein a high level of similarity of the agent with the negative image is indicative of binding to a region of a biotin protein ligase.

In this regard, the screening method of the present invention has been used to identify the compound 10-[(2R, 3S, 4R, 5R, 6S)-4,5-Dihydroxy-6-methyl-3-((2R, 3S, 4R, 5R, 6S)-3, 4, 5-trihydroxy-6-methyl-tetrahydro-pyran-2-yloxy)-tetrahydro-pyran-2-yloxy]- 6-hydroxy-l-methyl-benzo[h][l]benzopyrano[5,4,3-cde][l]benzopyran-5,12-dione, as a lead structure. The structure of this compound is as follows;

It will be appreciated that derivatives of the compound shown above that bind to a biotin protein ligase are also specifically contemplated within the scope of the present invention, including pharmaceutically acceptable derivatives, salts, esters and carboxylates thereof.

The present invention also provides a composition including the compound shown above and/or its derivatives, or a composition including any other compound or agent identified by the screening methods of the invention.

In one embodiment, the composition may be used as an anti-bacterial composition, and in particular, for the use against a Staphyloccus bacterium.

Thus in one embodiment the composition may be used to inhibit growth and/or survival of a pathogenic bacterium, such as S. aureus.

Examples of pathogenic bacteria are as previously described herein.

In one embodiment, a compound or agent identified by the screening methods of the invention, including the compound shown above and/or its derivatives, may be used to prevent and/or treat a bacterial infection in a subject.

Accordingly, in one embodiment the present invention provides a method for preventing and/or treating an infection by a bacterium of a subject, the method including administering to the subject an effective amount of a compound or agent identified by the screening methods of the invention, including the compound shown above and/or its derivatives.

Methods of preventing and/or treating bacterial infections are known in the art. The details of dosage, frequency of administration, and route of administration may be determined by a person skilled in the art.

In one embodiment, a composition for preventing and/or treating a bacterial infection is provided.

Accordingly, in another embodiment the present invention provides a composition for preventing and/or treating an infection of a subject by a bacterium, the composition including effective amount of a compound or agent identified by the screening methods of the invention, including the compound shown above and/or its derivatives.

The present invention also provides the use of a compound or agent identified by the screening methods of the invention, including the compound shown above and/or its derivatives, in the preparation of a medicament for preventing and/or treating an infection of a subject by a bacterium.

The preparation of pharmaceutical compositions is known in the art, for example Remington's Pharmaceutical Sciences, 18th ed., 1990, Mack Publishing Co., Easton, Pa. and U.S. Pharmacopeia: National Formulary, 1984, Mack Publishing Company, Easton, Pa.

Description of Specific Embodiments

Reference will now be made to experiments that embody the above general principles of the present invention. However, it is to be understood that the following description is not to limit the generality of the above description. Example 1

S. aureus BPL protein expression and purification

The amino acid sequence of the S. aureus BPL is shown in Figure 1 and has a Genbank accession number NP 371980 GI: 15924446. S. aureus BPL-HiS₆ was cloned into pET vector. The gene for S. aureus BPL was obtained by polymerase chain reaction on whole bacteria. PCR primers were designed using the genomic sequence deposited in Genbank (accession number NC 002758) from the genomic sequence of methicillin- resistant Staphylococcus aureus (Kuroda et al, 2001, Lancet 357(9264): 1225-1240). To facilitate subsequent cloning a Pcil restriction site was engineered into the 5' primer B 138/38 and BamHl and HindlW restriction sites were engineered into the 3' primer (B 139/40). The PCR was performed in IX Vent reaction buffer, 250 ng of each oligonucleotide, 0.4 mM dNTP mix containing equal concentrations of each dNTP, and 1 Unit of Vent DNA polymerase in a 50 μl reaction. A single colony of S. aureus was picked off a LB plate and included in the reaction mix. This sample was heated to 96°C for 5 min prior to PCR. The PCR conditions consisted of 35 cycles at 92°C for 30 seconds, 60⁰C for 30 seconds, 72°C for 5 minutes. PCR products were fractionated on a 1% agarose gel, excised and purified. The DNA fragment was employed as a template for further PCR with Dynazyme EXT DNA polymerase to linker single adenosine bases onto the 5' ends of the fragment. The amplified fragment was subsequently cloned into the pGEM-T easy vector (Pro mega) yielding pGEM(5^*. aureus BPL). DNA sequencing verified the clone was indeed the expected sequence.

To facilitate purification of S. aureus BPL by metal chelating chromatography, a hexahistidine sequence was engineered onto the C-terminus of the protein. This was performed using PCR with oligonucleotides B138/38 and B 140 and pGEM(5^*. aureus BPL) as a template. Reaction conditions employed were IX Dynazyme reaction buffer, 250 ng of each oligonucleotide, 0.4 mM dNTP mix containing equal concentrations of each dNTP, and 1 Unit of Dynazyme EXT DNA polymerase in a 50 μl reaction and PCR was performed as described above. The lkb fragment was fractionated on a 1% agarose gel, purified and ligated into pGEM-Teasy yielding pGEM (S. aureus BPL-H6). DNA sequencing verified the clone was indeed the expected sequence.

For over-expression of recombinant enzyme in E. coli, the coding sequence for S. aureus BPL-6xHis was introduced into pETlόb (Novogen). A 1 kb fragment was isolated from pGEM (S. aureus BPL-H6) with Pcϊl and HindlII endonuc lease restriction enzymes and ligated into Ncol and HindlII treated pETlόb. This yielded pET (S. aureus BPL-H6) that was transformed into the E. coli strain BL21(DE3) for expression.

Oligonucleotide Primers used were: (B138/38):

5 'AC ATGTCAAAAT AT AGTC AAGATGT ACTTCAATT ACTC-3 ' (SEQ ID NO.l)

(B 139/40):

5 'GGATCCAAGCTTAAAAATCTATATCTGCACTAATAAAACG-S ' (SEQ ID

NO.2) (B140/55):

5 'AAGCTTAATGATGATGATGATGATGACCAAAATCTATATCTGCACTAATT

AAACG-3' (SEQ ID NO.3)

[Initiation codon in bold, restriction endonuclease sites underlined]

E. coli BL21 (DE3) cells were transformed with the recombinant plasmid and grown at 310K in 2YT medium supplemented with 50 μg mL^"1 ampicillin for 3 hours. Cells were induced with 1 mM IPTG for 4 hours at 303K. The cells were harvested by centrifugation at 2968 RCF for 20 min at 277K, resuspended in 20 mM imidazole, 20 mM Tris-HCl, 0.5 M NaCl pH 7.9 and 1 mM PMSF (phenylmethanesulphonylfluoride) and disrupted by sonication and French press. Cellular debris was removed by centrifugation at 10,000 rpm for 20 minutes. The supernatant was filtered and applied to a Hi-trap column (Amersham Pharmacia Biotech) equilibrated with 20 mM imidazole, 20 mM Tris-HCl, 0.5 M NaCl pH 7.9. SaBPL-HiS₆ was eluted from the column with increasing amounts of imidazole and fractions containing protein, pooled and desalted through concentration and buffer exchange into SaBPL storage buffer (20 mM Tris pH 7.0, 0.5 mM EDTA, 5% Glycerol).

Cation exchange chromatography was used to purify SaBPL. Pooled protein from IMAC (Immobilized Metal Affinity Chromatography) was passed over a 15 ml S- Sepharose column equilibrated in 50 mM Na₂PO₄-NaHPO₄ pH 7.0, 5% glycerol, 1 mM EDTA and 1 mM DTT (buffer A). Any unbound protein was removed from the column by washing with Buffer A until UV trace returned to baseline. Bound protein was eluted using a gradient of 0 to 400 mM NaCl over 40 mins. To identify the fractions containing SaBPL protein, fractions were analysed by 12% SDS-PAGE and an in vitro activity assay on the apo-biotin domain of EcBCCP (as described in Chapman-Smith, 1999, J Biol. Chem. 274(3): 1449-1457). SaBPL was eluted in fractions when the salt concentration was around 200 mM. These fractions demonstrated BPL activity and the molecular mass (37891.3 Da) was comparable to the predicted molecular weight of SaBPL-6xHis (37893.4 Da), as determined by mass spectrometry.

Example 2

Crystallisation of BPL

Protein was stored in 50 mM Tris, pH 7.5, 0.5 mM EDTA pH 8.0 and 250 mM NaCl at minus 80⁰C prior to crystallization. Protein concentration was performed using a Vivaspin 10 kDa MW cut-off concentrator to concentrate the protein to 15 mg/ml. Three cycles of dilution with 5 ml of 20 mM tris-HCl pH 7.5 and subsequent concentration as described above were performed each time yielding a final protein concentration of 15 mg/ml. Following protein concentration, 100 μl was removed; being the apo enzyme (i.e. BPL with no ligand). Biotin complex formation was performed with the remaining protein by the addition of 3 ml 10 mM d-biotin in 50 mM Tris-HCl pH 7.5 and incubation on ice for 45 minutes. The protein was then concentrated to 15 mg/ml over 5 hours at 1,000 rpm, 4°C. After complex formation, 200 μl was removed and designated the SaBPL-6xHis + Biotin sample. A further 40 μl was removed and added to 10 μl 50 mM ATP to generate SaBPL-6xHisbiotinyl-5'-AMP.

The hanging drop vapour diffusion method was set up by adding l μl of reservoir solution to 1.1 μl of the protein solution on a coverslip. The coverslip was then inverted and sealed with grease over a 1 ml well containing 300 μl of the reservoir solution. Crystals could be observed after 1 day. Figure 2 shows a representative crystal grown. A crystal was selected from a tray stored at 4°C in a 500 μl reservoir, 1:1 μl protein (SaBPL-6xHis + Biotin) mix: reservoir (8 % PEG 8000 and 0.1 M tris-HCl pH 8.0). The crystal had dimensions of approximately 0.3 x 0.2 x 0.1 mm and was looped and streaked through cryo -protectant solutions. The cryo -protectant solutions were prepared with glycerol (100%) and reservoir solution at glycerol to reservoir ratios of 1:4, then 1:3, 1:2. The crystals were then flash frozen by placing in a nitrogen gas stream at 100 K. 131 images were collected on a Rigaku RUH2R X-ray source with a rotating copper anode equipped with Osmic confocal optics, an R-Axis IV detector, and an Oxford Cryosystems 700 Series cryostream.

Data were processed using MOSFLM. The structure of SaBPL-6xHis-Biotinyl-5"-AMP complex was solved by molecular replacement using CCP4 suite of programs (COLLABORATIVE COMPUTATIONAL PROJECT, NUMBER 4. 1994. Acta Cryst. D50. 760-763) and the Pyrococcus horikoshii OT3 (Ph) BPL-biotin structure (PDB entry IWPY) for catalytic and C-terminal phases and the E.coli (Ec) BPL-biotin structure (PDB entry IHXD) for the N-terminal. For molecular replacement, biotin and water groups were removed from the search model. Searches against PhBPL alone failed to produce a solution. EcBPL with the N-terminal 90 amino acids removed successfully determined the position and orientation of SaBPL. The model phases were improved using PIRATE followed by automatic model building with BUCCANEER. The structure was completed through rounds of Model building, COOT and refinement with REFMAC. 5% of the data were set aside prior to any refinement for cross validation. Biotinyl-5"-AMP was clearly visible in the active site.

The structural coordinates obtained are presented in Figure 3.

Figure 4 shows a representation of the dimer of SaBPL-6xHis with ligand biotinyl-5"- AMP.

Example 3

Data and refinement statistics

Table 1

Wavelength (A) 1.542 Resolution range (A) 20-2.6 Total observations 351340 Unique reflections 18509 Completeness (%) 98.1 Waters 91 R-factor (%) 19.9 R-free (%) 25.7 r.m.s.d

Bond lengths (A) 0.0114 Bond angles (deg.) 1.658 Ramachandran plot Most favoured (%) 89 Additional allowed (% 10 Generously allowed ^r°- 0.7 Disallowed (%) 0.3 Unit cell parameters 93.564, 93.564, 130.65 (α=β-p90°) Space group P4₂2_!2

Table 2

Comparison of hydrogen bonds between SaBPL and biotinyl-5"-AMP to PhBPL and EcBPL SaBPL(A) EcBPL(A) PhBPL(A) biotinyl-5'-AMP

Ser92 O_γ(2.73) Ser89 O_γ(2.8) His46 N (2.99) O3B

Thr93 O_γ(3.25) Thr90O_γ(3.1) Thr22 O_γ(3.07) NlB

GIn 115 O_εi (2.75) GIn 42 O_εi (2.84)

Argll9O(2.87) Argll6O(2.7) His46 O (2.97) N2B

Lysl86N_ζ(3.12) LyslllN_ζ(2.7) 012

Argl21 N (2.56) Arg48N(3.22) Oil

Argl21 N (2.75) Argll8NHl (3.1) Arg48 N (2.93) O2P

Argl24NHl (2.85) Arg48NHl (3.49)

Argl24 NHl (3.08) Argil 8 NHl (2.7) Arg48 NHl (2.74) O1P

Argl21NHl (3.1)

Asn211 O_δi (2.81) Asn208 NH_δi (2.7) Nl

Asn208O_δi(3.1) Glu54 O (2.98) N6

Asnl31 O(3.06)

Table 3

Hydrogen bonding partners between the SaBPL-H6 dimer interface Dimer A Dist. (A) Dimer B

Lys98 Nζ 2.93 GLU 202 Oε2

Argl21 NHl 2.92 ASP 199 Oδ2

Serl50 Oγ 3.77 ASN 198 Oδl

Metl94N 2.75 ALA 196 O

Alal96 N 2.99 MET 194 O Asnl97 Nδ2 3.35 GLU 193 Oε2

Asnl98 Nδ2 3.83 ILE 316 O

Ser317 Oγ 3.29 ASP 199 Oδ2

Glu202 Oε2 2.93 LYS 98 Nζ

Aspl99 Oδ2 2.92 ARG 121 NHl

Asnl98 Oδl 3.77 SER 150 Oγ

Alal96 O 2.75 MET 194 N

Metl94 O 2.99 ALA 196 N

Glu93 Oε2 3.35 ASN 197 N52

Ile316 O 3.83 ASN 198 N52

Asp 199 Oδ2 3.29 SER 317 Oγ

Table 4

Salt bridges between the SaBPL-H₆ dimer interface

Dimer A Dist. (A) Dimer B

Lys98 Nζ 3.83 Glu202 Oεl

Lys98 Nζ 2.93 Glu202 Oε2

Argl21 NHl 3.24 Aspl99[ Oδl]

Argl21 NHl 2.92 Aspl99[ Oδ2]

Glu202 Oεl 3.83 Lys98 Nζ

Glu202 Oε2 2.93 Lys98 Nζ

Aspl99 Oδl 3.24 Argl21[ NHl]

Aspl99 Oδ2 2.92 Argl21[ NHl]

Example 4

In Silico Drug Screening

Two methods for in silico drug screening were used:

(i) The X-ray structures of BPL from Staphylococcus aureus determined above, in the absence and presence of biotin and biotinyl-5'-AMP, were used to identify potential inhibitory compounds using in silico technology. Missing amino acids and hydrogen atoms in the structure were modelled using the Biopolymer module of SYBYL (Tripos, Inc. SYBYL, St. Louis, MO 2004).

Those amino acid residues in contact with (Ser 92, Thr 93, GIn 115, Arg 119, Arg 121, Arg 124, Lys 186, Asn 211) or surrounding the biotinyl-5'-AMP were defined as the active site of SaBPL and a negative image constructed with ATPTS 2001 as described in Moreno and Leon, 2002, Proteins, 47:1-13.

The orientations of compounds present in the latest version of the ZINC (Irwin and Shoichet, 2005, J Chem. Inf. Model. 45(1): 177-82) were assessed on the surface and/or cavities of the Staphylococcus aureus BPL using various docking programs such as DOCK, Autodock (Morris, G. M., et Al, 1998, J Computational Chemistry, 19:1639- 1662), and GOLD (Ewing et al, 2001, J Comput. Aided MoI. Des. 15: 411-428).

Poses were scored using the rapid scoring functions found in Scorer vl .3 or the SYBYL CScore module (Tripos Associates Inc, St. Louis, MO) and ranked with a threshold of 10% in an in-house consensus scoring program (Branson, K. M., Smith, B. J. Unpublished) based on the CScore module of SYBYL (Tripos Associates Inc, St. Louis, MO). Compounds with a score of 4-6 and the top compounds based on the internal DOCK Energy Score were visually inspected and non-viable candidates were filtered out.

(ii) In another screening method, the crystal structures of BPL from S. aureus and E. coli have been used for in silico docking studies. This has been performed in the presence and absence of biotin. Both crystal structures were complete about the active site thus no modelling was utilized. All water molecules were deleted from the structure coordinates. The molecules were prepared for docking using the "Autodock Tool" suite of programs. Briefly, polar hydrogens, charge and solvation parameters were calculated and used in the docking experiments. The programs AUTOGRID4 and AUTODOCK4 calculated the BPL atomic affinity maps and the position, orientation and conformation of the ligands, respectively. Autodock 4 also allows for conformational changes in BPL during docking.

Two docking protocols were pursued: 1) fixed BPL sidechains, and, 2) all sidechains within 5 Angstroms of the biotinyl-5'-AMP moiety were allowed to be flexible. A range of compounds were screened against Staphylococcus aureus and Escherichia coli BPL including: the NCI Diversity set (1990 - diverse compounds), molecules selected from the ZINC database filtered to include: adenosine analogues, analogues of our compound 2, purine analogues less than 500 MW. These docking results were analysed in terms of the predicted binding energy and size of clusters of conformationally similar ligands. The docking results with the lowest energies were examined visually.

In one specific example, the following ligand docking procedure was employed. Briefly, the 3-dimensional coordinates of the holo-5^*. aureus biotin protein ligase (BPL) structure were used for docking using the FlexX2 module of SYBYL8.0. To prepare the docking site target the water and biotinyl-5 '-AMP were removed, hydrogen atoms added and charges calculated using the MMFF94 force field. Hydrogens were also added to biotinol-5 '-AMP, and charges calculated using the MMFF94 force field followed by 1000 step energy minimization. The coordinates were saved as a .mo 12 file. Using the dock ligands application within SYBYL8.0 and FlexX2, the top 30 docked structures based on consensus scoring (CScore) were reviewed for binding in the active site. Figure 5 shows two computer-generated views of biotinol-5'-AMP docked into the active site of S. aureus BPL.

Example 5

Lead compounds

Methods of in silico drug screening were performed as described in Example 4, with a number of potential compounds identified. One of the leads identified was 10-[(2R, 3S, 4R, 5R, 6S)-4,5-Dihydroxy-6-methyl-3-((2R, 3S, 4R, 5R, 6S)-3, 4, 5-trihydroxy-6- methyl-tetrahydro-pyran-2-yloxy)-tetrahydro-pyran-2-yloxy]-6-hydroxy-l-methyl- benzo[h][l]benzopyrano[5,4,3-cde][l]benzopyran-5,12-dione, the structure of which is as follows:

The stereochemical structure of this compound is shown in Figure 6.

This compound is a potential inhibitor of S. aureus biotin protein ligase. Methods for determining whether this compound has inhibitory activity are as described in WO 2006/056007.

Example 6

Biotinol-5 '-AMP is an inhibitor of S. aureus biotin protein ligase.

S. aureus BPL activity was quantitated using an in vitro biotinylation assay, as described in Chapman-Smith et al, 1999, J Biol. Chem. 274(3): 1449-1457. Here the 87 amino acid biotin domain (BCCP-87) of the biotin carboxyl carrier protein from E. coli acetyl coA carboxylase was employed as the biotin accepting substrate in the BPL reaction. A reaction mix containing 50 mM Tris pH 8.0, 200 mM KCl, 5.5 mM MgCl₂, 3 mM ATP, 4.75 μM biotin, 0.25 μM ³H-biotin, 0.1 mg/ml BSA and 10 μM BCCP-87 was prepared and pre-equilibrated at 37⁰C for 5 minutes. The reaction was initiated by the addition of purified S. aureus BPL to a final concentration of 3 nM. After 20 minutes the reaction was terminated by withdrawing 4 μl of sample and spotting onto Whatmann paper pre-treated with 4.1 mM biotin and 10% TCA. The filters were then washed two-times with cold 10% TCA and once with cold ethanol to precipitate protein and remove radio label not incorporated into BCCP-87. After drying the amount of 3H- biotin incorporated into protein was quantitated by scintillation counting, facilitating calculation of BPL activity (pmol of ho Io BCCP-87 formed per minute). To determine the inhibitory concentration (IC₅₀) of biotinol-5'-AMP, the BPL reaction was performed by measuring the enzyme's velocity in the presence of varying concentrations of inhibitor. Inhibition curves were plotted using GraphPad Prism software.

A seen in Figure 7 the activity of S. aureus BPL is inhibited by increasing concentrations of biotinol-5'-AMP. The biotinol-5'-AMP was determined to have an IC₅₀ of 203 ± 33 nM and K₁ of 37 nM.

Example 7

Mechanism of inhibition by biotinol-5 '-AMP

To determine the mechanism of inhibition of S. aureus BPL by biotinol-5'-AMP, Lineweaver-Burk analysis was performed [Cleland (1970) The Enzymes 2, 1-65]. The S. aureus BPL reaction was performed with varying concentrations of inhibitor, as well as the ligands biotin (Figure 8A) or MgATP (Figure 8B). Enzyme activity was measured, as described in Example 6.

Figure 8 A is double reciprocal plots of initial velocity of the BPL enzyme with varying concentrations of MgATP and different fixed concentrations of biotinol-5'-AMP. Concentrations of biotinol-5'-AMP were 0 (■), 50 nM (A) and 200 nM (#).

Figure 8B is double reciprocal plots of initial velocity of the BPL enzyme with varying biotin concentrations and different fixed concentrations of inhibitor, as shown on the graph. Concentrations of biotinol-5'-AMP were 0 (■), 20 nM (A), 100 nM (#) and 200 nM (Φ).

The series of intersecting lines obtained from the double reciprocal plots[Cleland (1970) The Enzymes 2, 1-65] revealled that biotinol-5'-AMP is a competitive inhibitor of biotin, whereas MgATP is uncompetitive.

Finally, it will be appreciated that various modifications and variations of the described methods and compositions of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are apparent to those skilled in the art or related fields are intended to be within the scope of the present invention.

Future patent applications may be filed in Australia or overseas on the basis of or claiming priority from the present application. It is to be understood that the following provisional claims are provided by way of example only, and are not intended to limit the scope of what may be claimed in any such future application. Features may be added to or omitted from the provisional claims at a later date so as to further define or redefine the invention or inventions.

Claims

Claims:

I . A crystal of Staphylococcus aureus biotin protein ligase.

2. A crystal according to claim 1, wherein the crystal is a co-crystal of the biotin protein ligase and biotinyl 5 '-adenylate.

3. A crystal according to claim 2, wherein the crystal has space group symmetry P4₂

4. A crystal according to claims 2 or 3, wherein the crystal has unit cell dimensions of 93.564 A±5%, 93.564 A±5%, 130.65 A±5%.

5. A crystal according to any one of claims 2 to 4, wherein the crystal has the space group symmetry P4₂2₁2.

6. A crystal according to any one of claims 1 to 5, wherein the crystal has atoms arranged in the spatial relationship represented by the structure coordinates listed in Figure 3.

7. Use of a crystal according to any one of claims 1 to 6 to obtain atomic spatial relationship data.

8. A use according to claim 7, wherein the crystal is used to obtain atomic spatial relationship data for screening a compound for binding to a biotin protein ligase.

9. A use according to claim 8, wherein the screening includes in silico screening of the ability of the compound to bind to the biotin protein ligase.

10. A use according to claims 8 or 9, wherein the compound is an antagonist of biotin protein ligase.

I I. A method of producing a crystal of a Staphylococcus aureus biotin protein ligase, the method including the hanging drop diffusion technique using a precipitant solution including about 8% PEG.

12. A method according to claim 11, wherein the crystal is a co-crystal of the biotin protein ligase and a ligand.

13. A method according to claim 12, wherein the ligand is biotin or biotinyl 5'- adenylate.

14. A crystal produced according to the method of any one of claims 11 to 13.

15. An isolated biotin binding domain of a Staphylococcus aureus biotin protein ligase.

16. An isolated binding domain according to claim 15, wherein the binding domain includes at least one amino acid selected from the group consisting of Ser 92,

Thr 93, GIn 115, Arg 119, Lys 186, Arg 121, Arg 124, and Asn 211.

17. An isolated binding domain according to claims 15 or 16, wherein the amino acid residues in the binding domains are in the same relative spatial configuration as the corresponding amino acid residues in Figure 3.

18. Use of an isolated biotin binding domain according to any one of claims 15 to 17, wherein the binding domain is used for screening a compound for binding to a biotin protein ligase.

19. A use according to claim 18, wherein the screening includes in silico screening of the ability of the compound to bind to the binding domain and/or a biotin protein ligase, or a variant thereof.

20. A use according to claims 18 or 19, wherein the compound is an antagonist of biotin protein ligase.

21. An isolated molecule or molecular complex wherein at least a portion of the structural coordinates of the molecule or molecular complex define the same relative spatial configuration as at least a portion of the structural coordinates of the Staphylococcus aureus biotin protein ligase as set out in Figure 3.

22. An isolated molecule or molecular complex according to claim 21, wherein the molecule or molecular complex includes at least one amino acid selected from the group consisting of Ser 92, Thr 93, GIn 115, Arg 119, Lys 186, Arg 121, Arg 124, and Asn 211.

23. An isolated molecule or molecular complex according to claims 21 or 22, wherein the molecule or molecular complex includes the biotin binding domain.

24. An isolated molecule or molecular complex according to any one of claims 21 to 23, wherein the molecule or molecular complex has the capacity to bind biotin or biotinyl 5 '-adenylate.

25. Use of an isolated molecule or molecular complex according to any one of claims 21 to 24, for screening a compound for binding to a biotin protein ligase.

26. A use according to claim 25, wherein the screening includes in silico screening of the ability of the compound to bind to the molecule or molecular complex, and/or to bind to a biotin protein ligase, or a variant thereof.

27. A use according to claims 25 or 26, wherein the compound is an antagonist of biotin protein ligase.

28. A data set defining a scalable three-dimensional configuration of points at least a portion of the data set being derived from, or defining the same relative spatial configuration as, at least a portion of the structure coordinates of a Staphylococcus aureus biotin protein ligase.

29. A data set according to claim 28, wherein at least a portion of the data is derived from or defines the same relative spatial configuration as at least a portion of the structure coordinates of a crystalline Staphylococcus aureus biotin protein ligase as set out in Figure 3.

30. A data set according to claim 29, wherein at least a portion of the data in the data set is derived from or defines the same relative spatial configuration as at least a portion of the structural coordinates for amino acid residues Ser 92, Thr 93, GIn 115, Arg l l9, Lys l86, Arg l21, Arg l24, and Asn 211.

31. A data set according to claim 30, wherein the data set includes data derived from or defining the same relative spatial configuration as the coordinates of a plurality of the said amino acid residues, including all of said amino acid residues.

32. A scalable three dimensional configuration of points, at least a portion of the points being derived from, or defining the same relative spatial configuration as, at least a portion of the structure coordinates of a Staphylococcus aureus biotin protein ligase.

33. A scalable three dimensional configuration of points according to claim 32, wherein at least a portion of the points is derived from, or defines the same relative spatial configuration as at least a portion of the structure coordinates of a crystalline Staphylococcus aureus biotin protein ligase as set out in Figure 3.

34. A scalable three dimensional configuration of points according to claim 33, wherein at least a portion of the points is derived from, or defines the same relative spatial configuration as at least a portion of the structural coordinates for amino acid residues Ser 92, Thr 93, GIn 115, Arg 119, Lys 186, Arg 121, Arg

124, and Asn 211.

35. A scalable three dimensional configuration of points according to claim 34, wherein at least a portion of the points is derived from, or defines the same relative spatial configuration as the coordinates of a plurality of the said amino acid residues, including all of said amino acid residues.

36. A method of identifying an agent which is capable of acting as a ligand of a biotin protein ligase, the method including identifying an agent that has a conformation and/or polarity such that it is capable of interacting with at least one relevant amino acid residue of a Staphylococcus aureus biotin protein ligase.

37. A method according to claim 36, wherein the at least one relevant amino acid residue is in the same relative spatial configuration as the corresponding amino acid residues as the structure coordinates of a crystalline Staphylococcus aureus biotin protein ligase as set out in Figure 3.

38. A method according to claims 36 or 37, wherein the method includes identifying an agent that has a conformation and/or polarity such that it is capable of interacting with one or more amino acid residues selected from the group consisting of Ser 92, Thr 93, GIn 115, Arg 119, Lys 186, Arg 121, Arg 124, and Asn 211.

39. A method according to claim 38, wherein the agent interacts with a plurality of said amino acid residues, including all said amino acid residues.

40. A method according to any one of claims 36 to 39, wherein the method involves computer assisted modelling.

41. A method according to any one of claims 36 to 40, wherein the agent is an antagonist of a biotin protein ligase.

42. An agent identified by the method according to any one of claims 36 to 41.

43. An agent according to claim 42, wherein the agent is an antagonist of a biotin protein ligase.

44. An agent according to claims 42 or 43, wherein the agent inhibits growth of a bacterium.

45. An agent according to any one of claims 42 to 44, wherein the bacterium is Staphylococcus aureus.