WO2009053091A2

WO2009053091A2 - Method and test kit for investigating biological processes at the interface between an implant and bone/soft tissues

Info

Publication number: WO2009053091A2
Application number: PCT/EP2008/009023
Authority: WO
Inventors: Felicia Suska; Peter Thomsen; M. M. Omar Omar; Christer Slotte; Ulf Nannmark; Jan Hall; Stina Wigren; Neven Zorics; Maria Lenneras
Original assignee: Nobel Biocare Services Ag
Priority date: 2007-10-24
Filing date: 2008-10-24
Publication date: 2009-04-30
Also published as: WO2009053091A3

Abstract

The invention relates to a method for investigating cellular and molecular processes at the interface between an implant and bone/soft tissues. A preferred embodiment comprises the steps of a) collecting crevicular fluid from sulcus around a tooth or an implant, b) extracting RNA from the fluid, c) means for generating cDNA using RNA as template and d) providing a gene expression analysis, preferably by means of qPCR technique. The invention also comprises a test kit for carrying out the method.

Description

Method and Test Kit for Investigating Biological Processes

Field of the Invention

The present invention relates to a method for investigating cellular and molecular processes in soft or bone tissue, specifically at the interface between an implant and surrounding bone/soft tissues. It also relates to a test kit for carrying out the method. The method is based on gene expression analysis, for instance analysis of mRNA levels of specifically selected genes using quantitative real time PCR (qPCR).

Background of the Invention

Various implant materials have been used in the field of dentistry and orthopedics for replacing missing teeth, joints and in bone fixation¹. The use of implants in dentistry involves the insertion of the implant, such as an implant screw, a so-called fixture, into a prepared hole in the tissue. Titanium with its unique osseointegrative characteristics has dominated the attention and became a material of interest in the field of biomaterial research. However, implantation of a titanium implant means that a foreign material is inserted into a wounded tissue².

The tissue reaction for such an inserted implant includes molecular and cellular responses, which eventually determine the fate of the healing process around the implant². It is well known that this outcome is dependent on many factors, including the degree of trauma, material factors and tissue factors. The mechanisms of early reaction and bone formation on the implant surfaces and factors influencing the maintenance of bone-implant contact are not fully understood³. There is a raised question about the molecular changes and cellular activities that occurs in response to the implant and to correlate that with the structural changes, which take place at the interface.

Studies on the early tissue response to different implant materials are difficult due to the inaccessibility of the interface zone and lack of sensitive techniques. The analysis of oral implants has therefore been dependent on clinical evaluation and radiological examination. Osseointegration has mainly been studied from histological and biomechanical aspects⁴"⁶.

In case of radiological examination, when x-rays are used for testing the condition of an implant, only significant bone resorption around the implant can be detected. Also, it is very difficult to monitor the progress of integration over time with x-rays, since it is difficult to reproduce the viewing and position and angle with sufficient accuracy. And, of course, the exposure of human beings for x-rays as such should be reduced to a minimum.

During recent years implant stability may be non-invasively evaluated using resonance frequency analysis. In US-PS 5,392,779 it is described a method and an apparatus for testing an implant attached to a bone of a human or animal subject which includes a member releasably attached to the implant. The member carries a transducer for exciting the member with a variable frequency AC signal, and a transducer for detecting a resonance frequency of the member. The detected resonance frequency is used to assess the degree of attachment of the implant to the bone.

Even if it is possible to carry out clinical measurements by means of such resonance frequency analysis it should be understood that such technique involves a specific apparatus for attachment to the implant, which might as such perturb the healing process of the implant.

However, few studies have examined the early cellular and biomolecular events involved in the bone healing and remodelling processes that take place around the implants at very early time points, even though that some reports have shown that tissue response to implant material start very early after insertion of the implant²"⁷'⁸.

It is well known in the art that bone cells may be divided into two broad classifications, depending on whether they make bone or resorb it - osteoblasts make bone, while osteoclasts resorb it. It would be of interest to study these two types of bone cells and biological factors involved during bone formation and in the following it is referred to some of the scientifical reports in the field.

Several biological factors are involved in early tissue reaction that occur during bone skeletal repair and the response to insertion of an implant. Tumor necrosis factor-alpha (TNF-α) and Interleukin-lbeta (IL-I β) are proinflammatory cytokines that have been reported to contribute to osteoclast growth and development . Moreover, some studies have shown that TNF-α directly enhances the differentiation of osteoclast progenitors into osteoclasts¹⁰'". These markers have been shown to increase at very early time points in soft tissue and exudates around materials with different chemical properties. An in vitro study has shown that IL-I β expression by macrophage adherent on a rough titanium surface was significantly higher than cells on a smooth surface at 24 and 48 h¹². Osteocalcin (OC) and Alkaline Phosphatase (ALP) are both considered as osteoblast markers. Osteocalcin is a major noncollagenous protein found in bone. It is secreted by osteoblasts and plays an important role in bone mineralization although the complete biological function of Osteocalcin is unknown. Osteocalcin was expressed at higher levels on rougher cp titanium surfaces¹³. ALP is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules. Several possible roles for ALP in bone formation have been proposed. It may increase local concentrations of inorganic phosphate, destroy local inhibitors of mineral crystal growth, transport phosphate, or act as a calcium-binding and is therefore considered as an early marker of bone formation¹⁴'¹⁵. ALP activity in osteogenic cells was significantly higher on titanium than on steel after 7 days¹⁶. The expression of Alkaline Phosphatase (ALP) was enhanced on large grit, acid etched commercially pure titanium (cpTi) (SLA) surfaces¹⁷.

Cathepsin K and Tartrate Resistent Acid Phosphatase (TRAP) are osteoclast markers. Cathepsin K's ability to catabolize elastin, collagen and gelatine allow it to break down bone and cartilage. Cathepsin K expression is stimulated by inflammatory cytokines that are released after tissue injury. Strong staining of osteoclasts and chondroclasts at the osteochondral junction has been observed with antibodies against Cathepsin K and MMP-9 particularly at day 9 of healing of mouse fracture callus demonstrating that Cathepsin K together with metalloproteinase are major players in the degradation and remodelling of the extracellular matrix during fracture healing¹⁸. In a pilot study the clinical parameters of peri- implantitis were associated with a higher amount of Cathepsin K and a higher volume were adsorbed to filter strips¹⁹. In bone, TRAP is found not only in osteoclasts but also in mononuclear cells presumed to represent osteoclast precursor cells²⁰. Therefore it is used as a histochemical and biochemical marker for osteoclasts and bone resorption²¹. Significant upregulation and temporal co-expression of mRNAs for three osteoclast enzymes, Cathepsin K, MMP-9 and TRAP were observed in the callus during the first and second weeks of healing of mouse bone fracture¹⁸.

A limitation involved in the type of studies referred to here, is the difficulty to obtain intact bone/implant interface samples, i.e. a major limitation for proper molecular studies at the bone-implant interface. Retrieval of osseointegrated implants by unscrewing at early time points and cutting out the surrounding bone using suitable sized trephines could offer proper way to study the early biomolecular gene expression using suitable biological technique which could be used clinically simply and effectively. Many techniques have then been used to analyze the molecular activities and genetic expression of biological molecules and markers in response to titanium implants, e.g. by using microplate reading technology (ELlSA Microplate Reader) or electrophoresis techniques. However, removal of an implant should not be an alternative in a non-invasive diagnostic procedure.

Summary of the Invention

Accordingly, embodiments of the present invention preferably seeks to mitigate, alleviate or eliminate one or more deficiencies, disadvantages or issues in the art, such as the above- identified, singly or in any combination by providing provide a non-invasive or minimal invasive, simple diagnostic procedure based on a highly sensitive technique which allows for very small sample sizes and is capable of investigating the conditions for tissue healing and integration of implants. This allows for a more early detection of healing complications after placement of an implant. It may also provide for new tools to monitor decisive interfacial processes which precede clinically manifested conditions (e.g. integration or failure of the implant) that would be helpful for further clinical decision-making and handling.

Some embodiments provide for a novel research tool for the study of bone anchored implants and/or implants in soft tissue and obtain molecular information from cells immediately adjacent to the implants. During a systematic approach to resolve these issues, biopsies and exudates and are valuable sources of material.

Specifically, a deepened understanding of the molecular and cellular responses at the interface zone between an already implanted material or in the tissue before a planned insertion of an implant is of importance.

According to a an aspect, a gene expression analysis is performed using for instance quantitative polymerase-chain-response (qPCR) for the evaluation of early gene expression response as well as cellular reactions close to the implant. Quantitative real time PCR represents a promising analytic technique to study different biological responses. As an example it is referred to WO 2006/094798 in which this technique is used for quantifying and evaluating the expression of at least two reporter genes, which for example can be used for assessing the state of differentiation of a cell population, such as e.g. a hBS cell population. However, this technique has not previously been used in relation to studies on the bone- implant interface.

The gene expression analysis can also be performed by means of the NASBA technique, which is a nucleic acid sequence based amplification method for sensitive detection of gene transcription.

According to an aspect a non-invasive diagnostic, monitoring method comprises the following steps:

a) collecting a sample, preferably a crevicular fluid from sulcus, of the implant and bone/soft tissue interface, b) extracting RNA from the sample, c) optionally generating cDNA using RNA as template, d) performing a gene expression analysis, e) analysing and performing quantification of biological markers in order to establish a biological marker panorama, and f) using the biological marker panorama for assessing the expected degree of regenerative capacity of said interface.

According to a specific embodiment of this method, the crevicular fluid is collected by means of absorbing devices, such as filter strips. The loaded filter strips are put into a preserving medium and the gene expression analysis is performed for specific markers and relative gene expression levels of these markers are calculated.

Embodiments of the invention can also be used as a minimal invasive diagnostic, monitoring method in which cellular and molecular processes in bone/soft tissues are investigated. Such a method then may comprise the following steps: a) collecting a sample from a biopsy or exudates from the tissue to be investigated in vitro, b) extracting RNA from the biopsy or exudates, c) optionally generating cDNA using RNA as template, and d) performing a gene expression analysis e) analysing and performing quantification of biological markers in order to establish a biological marker panorama, f) using the biological marker panorama for assessing the expected degree of regenerative capacity of an intended implantation site.

As an alternative, some embodiments of the invention can be used as a pre-clinical, research tool for the study of implant integration in soft tissue or bone tissue. Such a pre-clinical, screening method may include investigating a very early removal of an inserted implant together with implant surface associated cells. The method is customized for investigating cellular and molecular processes at the interface between an implant and bone/soft tissues. Typically, a smaller hole is made at a chosen location where a conventional implant is planned to be inserted. An implant of complementary shape and dimension is inserted in the pre made hole. The implant surface associated cells are then put into the same procedure as for said diagnostic, monitoring method. By this method the degree of osseointegration capacity can be assessed at a much earlier time point than previously, specifically 1-3 days after insertion of an implant. And it is only necessary to look at the cells on the implant surface. The hole for hosting the implant fixture is then made at the initially chosen location but with a larger width dimension. Such a method may comprise the following steps:

a) collecting a sample from a previously inserted implant unit, together with implant surface associated cells, b) extracting RNA from the implant surface associated cells, c) optionally generating cDNA using RNA as template, d) performing a gene expression analysis, e) analysing and performing quantification of biological markers in order to establish a biological marker panorama, and f) using the biological marker panorama for assessing the expected degree of regenerative capacity of said interface.

It should be understood, therefore, that embodiments of the invention includes different techniques for investigating bone/soft tissue-implant interfaces, diagnostic non-invasive methods as well as more invasive scientific, research methods. However, a common feature for the methods is the gene expression analysis, which is performed on the collected samples.

Some embodiments of the invention also comprise a specific test kit for using one or more of the methods. Such a test kit then comprises means for performing gene expression analysis, and optionally: a) means for collecting tissue sample cells, b) means for extracting RNA from samples, c) means for generating a cDNA using RNA as template, d) means for providing the samples to a gene expression analysis unit, and e) means for performing gene expression analysis.

For the diagnostic, non-invasive method said means for collecting tissue sample cells, for instance for collecting crevicular fluid from sulcus around a tooth or an implant, may comprise one or more absorbing filter strips.

Said regenerative capacity is used for determining the degree of loading or when loading can be applied to an implant in an environment represented by said regenerative capacity of bone or soft tissue. Also the type of implant and method of inserting and applying load to said implant can be adapted to the determined capacity of the implant interface, bone or soft tissue.

More specifically said regenerative capacity is used for determining the degree of loading or when loading can be applied to a dental implant in an environment represented by said regenerative capacity of bone or soft tissue. Preferably, the type of implant and method of inserting and applying load to said dental implant can be adapted to the determined capacity of the implant interface, bone or soft tissue.

In some embodiments of the invention, the means for providing the samples to the gene expression unit comprises a container with a preserving medium.

Further embodiments of the invention are defined in the dependent claims, wherein features for the various aspects of the invention are as for the first aspect mutatis mutandis.

It should be emphasized that the term "comprises/comprising" when used in this specification is taken to specify the presence of stated features, integers, steps or components but does not preclude the presence or addition of one or more other features, integers, steps, components or groups thereof.

Brief Description of the Drawings

In the following embodiments of the invention will be described more in detail by means of some examples and with reference to the accompanying drawings in which, Figure 1 is a schematic view of an implant inserted in a jaw-bone,

Figure 2 is a schematic view of the implant with an abutment,

Figure 3 is a schematic view of the implant abutment device with a temporary crown,

Figure 4 is a schematic view of an absorbent filter strip for collecting crevicular fluid,

Figure 5 is a schematic view illustrating the use of the filter strip for collecting crevicular fluid from the sides of the implant,

Figure 6 illustrates the situation after the collection of the fluid, when the temporary crown is recemented on the abutment,

Figure 7 illustrates the filter strip with components of the crevicular fluid including various cell types absorbed to the strip,

Figure 8 illustrates that the loaded strip is immediately put into a tube with a special preserving medium,

Figure 9 illustrates the case where the dental clinic is equipped with a qPCR unit for gene expression analysis,

Figure 10 illustrates the case where the tubes containing the strips are sent to a specialized center for gene expression analysis,

Figure 1 1 illustrates the step in which all the mRNA encoding for different kinds of biological markers is extracted from the strip,

Figure 12 illustrates the step in which mRNA is reverse transcribed to cDNA,

Figure 13 illustrates schematically the qPCR unit in which the qPCR analysis is performed and different biological markers are quantified, Figure 14 illustrates the case in which the biological markers indicate healthy condition so that early loading concept is confirmed and final restoration is made,

Figure 15 illustrates the case in which the markers have indicated unfavourable conditions like severe inflammation or bone resorption so that a conventional concept should be used allowing enough time for undisturbed osseointegration,

Figure 16 illustrates more in detail the workflow of extracting and converting RNA included in a test kit which can be used for the invention,

Figure 17 is a curve of threshold cycle versus concentration for calculating PCR efficiency,

Figure 18 is a table with data from a qPCR study of an implant screw which shows the ratio of marker copies expressed at two compared surfaces, normalized to 18S,

Figure 19 is a table with data from the same study for surrounding tissue, normalized to 18S,

Figure 20 is a table as in Figure 18, but not normalized, and

Figure 21 is a table as in Figure 19, but not normalized.

Deatailed Description of Embodiments

Specific embodiments of the invention now will be described with reference to the accompanying drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. The terminology used in the detailed description of the embodiments illustrated in the accompanying drawings is not intended to be limiting of the invention. In the drawings, like numbers refer to like elements.

Description of a first example of the invention. Figures 1 -15 illustrate the use of the invention to predict the early response to dental implants. It should be understood that this is just one example of the use, but as mentioned in the introductory part of this description early detection of healing complications after placement of a dental implant has been a pressing but elusive goal. This is especially true in connection with immediate or early loading concepts of a dental implant.

Referring now to Figure 1 it is illustrated an implanted dental implant screw, a so-called fixture 1 , in a section of human jaw bone 2. The implant screw 1 may be any one of a number of known types, made of a metal such as titanium, or from a ceramic material or any other appropriate material. It may for example be any of the types supplied by Nobel Biocare AB. After insertion of the implant there is a question for the dentist if he should proceed with an early loading concept or if the conventional concept should be used, allowing enough time for undisturbed healing and osseointegration. In this case it is supposed a preliminary decision to proceed with the early loading concept.

Figure 2 illustrates the connection of an abutment 3 to the fixture 1. This connection is performed at the same visit as well as the design and cementation of a temporary crown 4 as illustrated in Figure 3. At the same time a new appointment is given to the patient after one week.

One week later the temporary crown 4 is removed by the dentist and he makes an investigation of the early bone-implant interface using the present invention, see Figures 4-5. According to the invention crevicular fluid is collected from the sulcus 5 on for instance four sides of the implant. The crevicular fluid is collected by means of a filter strip 6 having an absorbing portion 6a for inserting into the sulcus as illustrated in Figure 4. The use of different types of filter strips for collecting biological fluids are previously known and will not be described in any detail here. However, the filter strips in this case should be stiff enough and dimensioned to be put into the sulcus and they are preferably handled by means of a pair of tweezers (not shown here). For instance Periopaper Gingival Fluid Collection Strips from Proflow Inc., Amityville, N.Y., USA, can be used.

In Figure 6 it is illustrated that the temporary crown 4 is recemented to the abutment again after the fluid collection. Figure 7 illustrates that there are certain components of the crevicular fluid , including various cell types absorbed to the strip portion 6a. The loaded strip 6 is immediately put into a liquid tube 7 containing a preserving medium, such as a conservation buffer, e.g. RNALater (Ambion). The preserving liquid tube is then used as a tube for transportation of the loaded strip, either in-house if the dental clinic itself has the necessary gene expression analysis unit, or if they are sent to a special center for such analysis. These two alternatives are illustrated in Figures 9 and 10, respectively. If the dental clinic is equipped with a qPCR unit 8 then of course the further steps according to the invention can be carried out at the same place, see Figure 9. Otherwise the tubes 7 containing the strips are sent by regular mail or any other distribution channel to a specialized center having the necessary qPCR unit 8 for gene expression analysis.

Figure 1 1 illustrates the step in which all the mRNA encoding for different kinds of biological markers is extracted from the strip 6, and Figure 12 illustrates the step in which cDNA is generated using RNA as template. These steps will be described more in detail below in connection with Figure 16.

Figure 13 illustrates schematically the qPCR unit 8 in which the qPCR analysis is performed and different biological markers are quantified. Depending on the analysis data of these biological markers, compared for instance with other patient data, patient groups etc, and over time, the degree of regenerative capacity of the patient can be assessed by the dentist.

Figure 14 illustrates the case in which the biological markers have indicated healthy condition so that early loading concept is confirmed and final restoration can be made, and Figure 15 illustrates the case in which the markers have indicated unfavourable conditions like severe inflammation or bone resorption so that a conventional concept should be used allowing enough time for undisturbed osseointegration.

Figure 16 illustrates more in detail an example of the workflow of extracting and converting RNA. These parts can be included in a special test kit for sampling and carrying out the methods according to the invention, for instance collecting crevicular fluid from the sulcus of a tooth or an implant. Such a test kit may include a set of filter strips 6, transportation tubes 7 with preservation buffer, reagents for RNA extraction and reagents for cDNA synthesis and a Microtiter plate 9 as illustrated in Figure 16. According to embodiments of the invention, after sampling in patients the filtering strips were placed in RNALater (Ambion), which functions as a preserving buffer that "freezes" the gene expression profile of the cells attached to the strips. The buffer also provides the possibility of storing the sample at room temperature for a limited period of time, thereby simplifying transportation of the sample.

RNA from cells attached to the strips was then extracted and purified using a silica column based Qiagen RNeasy Micro Kit according to the manufacturer's instructions. Carrier RNA (Poly A RNA included in the kit) was used to minimize losses of RNA during extraction. RNA was deluted in 14 μl of RNase free water. This step is illustrated by "RNA extraction and purification" in the figure.

cDNA from the RNA template was generated using a reverse transcription kit "BioRad iScript cDNA synthesis kit" according to the manufacturer's instructions using 5 μl of the RNA. The kit uses a mixture of oligo dT priming and random hexameter priming ensuring high yields for a large range of different genes. This step is illustrated by "cDNA synthesis" in the figure.

The cDNA was diluted to 50 μl in UltraPure water (Invitrogen). Quantitative PCR assays for IL- l β, TNF-α, Osteocalcin, Alkaline Phosphatase, Cathepsin K, TRAP and 18S ribosomal

RNA were designed and validated according to a procedure described more in detail below.

BioRad SYBR Supermix and 3μl of cDNA template together with 0.4 μM of forward and reverse primer was then used in the quantitative PCR: Each cDNA sample was quantified in duplicate. The temperature protocol for each assay was: Enzyme activation 3 min at 98°C followed by 45 cycles of 20s at 98°C, 20s at 60⁰C and 20s at 72⁰C. Fluorescence detection was performed in the FAM/SYBR channel in the 72°C step. Experiments were performed on the Eppendorf Mastercycler S RealPlex. After amplification and dissociating/melting curve was generated to verify that specific products were generated. Data was analyzed using

Microsoft Excel and statistics software. Relative gene expression levels were calculated by normalizing gene expression of each gene using 18S ribosomal RNA and the ΔΔCt method using 90% efficiency for each assay. The design of primers play a vital role in performance of the subsequent real-time PCR assays when it comes to efficiency of amplification, sensitivity, linearity and specificity. In the following it will be described an example of assay design, optimization and validation.

Design of primers

The RNA or cDNA sequence of the desired gene was located in the Ensembl database and used for subsequent primer design. Primers were designed to yield short amplicons (preferably shorter than 200 bp) and to function well with SYBR Green 1 fluorescent dye for detection of the PCR products in real-time.

Design was performed using the Primer3 web-based software (Krawetz S., Misener S. (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365-386). Design parameters were adjusted such that the formation of artefact products should be minimized and that the primers should be able to use an annealing temperature in the PCR at about 60⁰C. The predicted melting temperature (T₁₁₁) was controlled such that the two primers obtain a melting temperature T_m within 2-3°C.

The obtained primers were further evaluated for secondary structures and complementarities using Netprimer web-based primer evaluation tool. To ensure specificity, all primer sequences were searched in the NCBI sequence database using BLAST nucleotide search (Altschul, SF, W Gish, W Miller, EW Myers, and DJ Lipman. Basic local alignment search tool. J MoI Biol 215(3):403-10, 1990). When possible, primers were designed to span intron- exon boundaries to ensure that genomic DNA was not quantified.

To evaluate accessibility of the obtained primer sequences the resulting amplified sequence (amplicon) was analyzed using mFold secondary structure prediction tool (M. Zuker On Finding All Suboptimal Foldings of an RNA Molecule. Science 244, 48-52 (1989)) showing all probable secondary structures at certain conditions. The amplicon melting temperature was also analyzed using Oligonucleotide Properties Calculator, (Kibbe WA 'OligoCale: an online oligonucleotide properties calculator'. (2007) Nucleic Acids Res. 35 (webserver issue): May 25). As an example the resulting primers obtained for the IL-I β gene were as below (depicted 5 - 3^'):

Gene Forward primer Reverse primer Amplicon size IL-I β TGGCAATGAGGATGACTTGTT TGGTGGTCGGAGATTCGTAG 120

These primers were designed in two separate exons covering an intronic region of 547 base pairs.

Optimization and validation

Generation of standard

PCR was performed under standard conditions on available cDNA to generate PCR product. PCR product of 2 pooled reactions was purified using Qiagen Qiaquick PCR Purification Kit according to the manufacturer's instructions. Elution was performed in 30 μl of EB buffer. Determination of the DNA concentration in copies/μl of the obtained PCR product was performed on the NanoDrop ND- 1000 using absorbance at 260 nm. Using the amplicon size and the absorbance the concentration could be calculated.

Optimization

Using the purified PCR product of each PCR system, the PCR was optimized by varying the concentration of MgCl₂, deoxynucleotides and primers to obtain a good PCR efficiency and as little primer-dimers (artefact products) as possible. All PCR reactions were performed using SYBR Green I as a reporter dye to monitor amplification during the reaction. Threshold was set above the noise and in the exponential phase of the amplification PCR efficiency was determined by making a serial dilution of PCR product. The qPCR instrument software plots threshold cycle (the amplification round were the fluorescent signal crosses the threshold level) versus concentration and calculates the PCR efficiency, ideally 1 or 100%, see Figure 17.

Melt curve analysis (dissociation curve analysis) and gel electrophoresis on 2% agarose was performed to ensure that a single product of the desired size had been amplified.

As an example the conditions found to be suitable for the IL-I β gene were as follows: Reagent Concentration

Jump start Buffer xl O (Sigma) 1 x MgC12 (Sigma-Aldrich Co, St. Louis, MO, USA 3 mM dNTP mix (Sigma-Aldrich Co, St. Louis, MO, USA 0.3 mM

SYBR Green (Molecular Probes, Eugene OR, USA 0.4 x

Forward primer (MWG Biotech, Ebersberg, Germany) 0.4 μM

Reverse primer (MWG Biotech , Ebersberg, Germany) 0.4 μM Jump Start tag polymerase

(Sigma Aldrich Co, St. Louis, MO, USA) 0.04 U/μl cDNA template 2 μl

Final volume 20 μl

Alternatively, commercial pre-made mastermix could be used, such as:

Reagent Concentration

BioRad SYBR Supermix 1 x

Forward primer (MWG Biotech, Ebersberg, Germany) 0.4 μM Reverse primer (MWG Biotech, Ebersberg, Germany) 0.4 μM cDNA template 2 μl

Final volume 20 μl

In the following it is described a kinetic pilot study using the method for detection of possible healing complications after placement of dental implants. Specifically, this study proposes a non-invasive diagnostic research tool for the monitoring of healing-specific and peri-implant disease specific genes as a complement to clinical evaluations.

EXAMPLE

Material and Methods 12 partially edentulous patients participating in a prospective randomized controlled trial on immediate and delayed loading of dental implants were consecutively enrolled in this pilot study. Two days after one-stage implant placement, the test group of six patients received fixed implant supported bridges (immediate loading), while in the control group of six patients the implants were not loaded until three months after surgery (delayed loading). Crevicular fluid was collected using filter strips at two implants and one healthy tooth from each patient 2days, 2 weeks, 4 weeks and 12 weeks after surgery.

The strips were placed in a preservation buffer, in this case RNALater (Ambion). RNA from cells attached to the strips was extracted and purified using Qiagen RNeasy Micro Kit according to the manufacturer's instructions. Carrier RNA included in the kit was used to minimize losses of RNA during extraction. RNA was converted to cDNA using BioRadiScript cDNA synthesis kit according to the manufacturer's instructions using 5 μl of the RNA. The cDNA was diluted to 50 μl in UltraPure water (Invitrogen). Quantitative PCR assays for IL-I β, TNF-α, Osteocalcin, Alkaline Phosphatase, Cathepsin K, TRAP and 18S ribosomal RNA were designed and validated. Primers were designed using the Primer 3 website (Krawetz S., Misener S. (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Human press, Totowa, NJ, pp. 365-386). The PCR product was verified on a 1.5 % agarose gel and PCR efficiency was validated using dilution series. BioRad SYBR Supermix and 3 μl of cDNA template together with 0.4 μM of forward and reverse primer was used in the quantitative PCR: Each cDNA sample was quantified in duplicate. The temperature protocol for each assay was: Enzyme activation 3 min at 98°C followed by 45 cycles of 20s at 98°C, 20s at 60⁰C and 20s at 72°C. Fluorescence detection was performed in the FAM/SYBR channel in the 72°C step. Experiments were performed on the Eppendorf Mastercycler S RealPlex. After amplification and dissociating/melting curve was generated to verify that specific products were generated. Data was analyzed using Microsoft Excel and statistics software. Relative gene expression levels were calculated by normalizing gene expression of each gene using 18S ribosomal RNA and the ΔΔCt method (ref) using 90 % efficiency for each assay. Parallel to these analyses clinical parameters were assessed during the study period.

Results One implant was lost in each of the test and control groups. In the test group, three implants showed lowered stability after 2-4 weeks of loading. Therefore, these implants were relieved from occlusal load. After this intervention the implant stability improved which later allowed for full loading after 3-4 months. Regression analyses showed good correlation of healing parameters such as TGF-β, and Osteocalcin gene expression with implant stability as measured by the clinical Resonance Frequency Analysis technique. Bleeding in the peri- implant mucosa correlated well with increased gene expression of IL-I β as well as TNF-α. The gene expression analyses predicted the implant losses and also the decreased clinical stability of the ailing implants. Bone loss around these implants was predicted by increased gene expression of TRAP. In addition, low gene expression for IL-I β is expected to be strongly correlated to smokers or periodontal disease.

In the example the following gene types have been mentioned for the qPCR analysis: Osteocalcin, Alkaline Phosphatase, TRAP, Cathepsin K, IL-I β and TNF-α. It should be understood, however, that these are examples only, and genes can be chosen from one or more of the following groups: bone remodelling (osteoblast and osteoclast markers), inflammatory and cytokine markers, growth an differentiating markers, cell adhesion markers, transcription markers and microbial markers.

Specifically genes can be selected from the group of Osteocalcin, Alkaline Phosphatase, BSPs, Collagen type 1 , TRAP, Cathepsin K, RANKL, TNF-α, IL- l β, SDF-I , MCP-I, IL-10, BMPs, PDGF, VEGF, FGF, Vitronectin, Integrins and Focal Adhesion Kinase, Runx/Osterix, groEL, dnaK, htpG, sod A, PG 1431 and lux R family.

These markers could be grouped as follows:

Osteoblast markers

Osteocalcin, Alkaline Phosphatase, BSPs and Collagen type 1.

Osteoclast markers

TRAP, Cathepsin K and RANKL.

Inflammatory and cytokine markers (up and down regulatory) TNF-α, IL-I β, SDF-I , MCP-I and IL-10. Growth and differentiating markers BMPs, PDGF, VEGF and FGF.

Cell adhesion markers

Vitronectin, Integrins and Focal Adhesion Kinase.

Microbial markers

GroEL, dnaK, htpG, sodA, PG1431 and lux R family.

Description of a second example of the invention.

In the following other embodiments will be described more in detail. These embodiments provide for a novel scientifical research tool for the study of endosseous and other implants and obtain molecular information from cells immediately adjacent to the implants. During a systematic approach to resolve these issues, biopsies, exudates and morphological tissue sections are valuable sources of material. This method involves a very early removal of an inserted implant, in such a way that the implant surface associated cells are retained and then can be analyzed by means of the same procedure as in first embodiment. This method gives an instrument for assessing the degree of osseointegrating capacity for a specific type of implants, it can be used for evaluating different material types, different surgical procedures such as drilling, the influence of drugs, other biological molecules, irradiation and osteoporosis.

A feature of this method is the fact that only cells on the implant surface is analyzed and that this can be done already 1 -3 days after insertion. The inserted implant is rotated out so that the surface associated cells are preserved on the threaded portion of an implant screw.

Specifically, a deepened understanding of the molecular and cellular responses at the interface between the implanted material surface and the tissue is of vital importance, and this method gives an indication to a scientist - at a very early time point - whether a new implant or implant procedure should be successful or not. The purpose of the following study was to apply quantitave PCR (qPCR) in combination with SEM for the evaluation of early gene expression response as well as cellular reactions close to two different implant surfaces, namely TiUnite® (Nobel Biocare AB, Gόteborg) with its high osteoconductive properties and a machined surface used for the original Branemark implants. Three time points were selected (1 , 3 and 6 days).

EXAMPLE

Materials and methods

Implantation procedure

30 female Spraque-Dawley rats (200-250 g), fed on a standard pellet diet and water were used. The implantation procedure was done under Isoflurane anesthesia together with intramuscular analgesia (temgisic 0.03 mg/kg). After shaving and cleaning (5mg/ml chlorohexidine in 70% ethanol) incisions were made along the medical side of the legs, followed by skin and periosteum reflection with blunt instrument. Each tibia received one anodically oxidised titanium implant (TiUnite^®; Nobel Biocare AB, Goteborg) and one machined implant (2mmx2.3mm, Nobel Biocare AB, Goteborg). The locations of implants were decided using a predetermined schedule, ensuring a rotation of sites. The distance from the epiphysis to the centre of the implant sites was measured to make sure all implant was at the same location (proximal 5mm, distal 10 mm) every time. Drilling was done using low speed drill under NaCl 0.9% irrigation with bur 0 1.4 and 1.8 at the selected locations. The blood surrounding the implant came mainly from bone during the surgical procedure; however, some bleeding from the surrounding tissue was unavoidable. One leg was done at each time and sutured internally with vecryl and externally with Ethilon (5-0, Ethicons, Johnson & Johnson, Brussels, Belgium) sutures using single interrupted technique. Postoperatively, the animals were given temgesic 0.03 mg/kg body weight (Temgesic; Reckitt & Coleman, Hull, Great Britain) intramuscularly. The animals were allowed free postoperative movements with food and water ad libitum.

Retrieval procedure At each time point the animals were sacrificed under anesthesia. Because of the early retrieval time points, the implants were not yet strongly locked in bone, and could therefore be unscrewed with adherent biological material. Trephines with 2.3 mm internal diameters and slicing disc were used to retrieve bone surrounded the unscrewed implant. The unscrewed implants and the retrieved bone were immediately preserved in specific preserving solutions depending on the analysis they will undergo subsequently.

Quantitative PCR

Unscrewed implants and the corresponding surrounding bone from time points (1 , 3 and 6 days) were placed in a RNAlater^® preservation buffer solution and stored at -80⁰C until testing. For testing, total RNA from the screw and from the surrounding bone was extracted using RNeasy Microkit and Minikit (QIAGEN) respectively. Reverse transcription was performed using iScript First Strand synthesis kit (BioRad). The forward (FW) and reverse (RV) primers werte designed and optimized using software for Interleukin-1 beta (IL-I β), tumor necrosis factor-alpha (TNF-α), Osteocalcin (OC), Alkaline Phosphatase (ALP), tartrate resistant acid phosphatase (TRAP) and Cathepsin-K (CATK). The PCR mixture, containing cDNA template, the forward and reverse primers, and SYBR Green Mix, was amplified using Eppendorf PCR instrument. The PCR conditions were adjusted according to the protocol. Each sample was tested in duplicates, and the threshold cycle (Ct) values were averaged from each reaction. The quantification strategy were based on comparing two genes from two samples using the formula k*1.9^Λct. The gene expression levels were either normalized to 18S ribosomal sub unit indicating the expression level per cell or not normalized indicating the total content.

Scanning Electron Microscopy

Screws from each type at each time point were preserved in 2.5% gluteralhyde solution, and subsequently analyzed with SEM.

Immunohistochemistry Bone corresponding to the two different surfaces were dissected with slicing disc and preserved in 4% PF 0.1 & GA (EM avd immunofϊx). These bone samples were subsequently prepared for immunohistochemical analysis.

Statistics

Paired t-test has been used.

Results

Screws and surrounding tissues were analyzed individually. Table 1 in Figure 17 and Table 2 in Figure 18 show the ratio of marker copies expressed at the two compared surfaces (for both the screw and the surrounding tissue, respectively). Statistically significant differences were observed at the screw level and are indicated in a grey tone. More osteoblast and osteoclast markers were expressed at the TiUnite^® surface. On the other hand inflammatory markers were expressed at a higher level at the machined surface. There were also temporal changes in gene expression of cells at the same surface at the different time points. Kinetic changes in gene expression profile were observed already after 1 day, with different levels at the two surfaces. Different expression profile from the screw analysis compared to the tissue analysis. More statistically significant differences were found at the screw level.

The results demonstrate that the experimental model and qPCR provide interesting possibilities to analyze the mechanisms of osseointegration and it shows that the remodelling and in particular the molecular processes occur at implant surfaces in vivo already 3 days after implantation. It also shows that the early responses differ significantly with different surfaces with the kinetic changes in the gene expression explain the rapid tissue organization inside the threads of anodically oxidized implant screws.

The invention is not limited to the examples which have been described here, but can be varied within the scope of the following claims. Specifically it should be understood that the invention is not limited to the investigation of a bone-implant interface, it can be generally used as an instrument for assessing the capacity of bone or soft tissue not only in the field of implantology but also for orthodontics or the like. Furthermore it is not limited to the dental field, it can also be used in orthopedics, for bone fixation or similar applications. The present invention has been described above with reference to specific embodiments. However, other embodiments than the above described are equally possible within the scope of the invention. Different method steps than those described above, performing the method by hardware or software, may be provided within the scope of the invention. The different features and steps of he invention may be combined in other combinations than those described. The scope of the invention is only limited by the appended patent claims.

Specification of literature referred to in the description

1. Takeshita F. et al. J Biomed Mater Res, 34, 1 , 1997

2. L. Sennerby, P. Thomsen, L. E. Ericson, Journal of Materials Science: Materials in Medicine 4, 494, 1993

3. Larsson S. et al. Clin. Orhop. Relat. Res. 240, 2001

4. Wennerberg A. et al. J CHn Periodontal, 30, 88, 2003

5. Lumbikanonda N., Sammons R. Int. J Oral Maxillofac Implants, 16, 627, 2001

6. Li D et al. J Biomed Mater Res, 60, 325, 2002 7. Eriksson C. et al. J Biomed Mater Res A, 66, 662, 2003

8. Suska F. et al. Biomaterials, 24, 461, 2003

9. Roodman G. D. Endocr Rev, 17, 308, 1996

10. Azuma Y. et al. J Biol Chem, 275, 4858, 2000

11. Kobayashi K. et al. J Exp Med, 191, 275, 2000 12. Tan K. S. et al. Biomaterials, 27, 5170, 2006

13. Davies J. E. Int J Prosthodont, 11, 391 , 1998

14. Calvo M.S., Eyre D.R., Gundberg CM. Endocr Rev, 17, 333, 1996

15. Weiss M. J. et al. J Biol Chem, 263, 12002, 1988

16. Kudelska-Mazur D. et al. Cell Tissue Bank, 6, 55, 2005 17. Boyan B.D. et al. J Biomed Mater Res, 55, 350, 2001

18. Uusitalo H. et al. Calcif Tissue Int, 67, 382, 2000

19. Strbac G. D. et al. J Clin Periodontal, 33, 302, 2006

20. Andersson G N. et al. J Histochem Cytochem, 34, 293, 1986

21. Ek-Rylander B. et al. J Biol Chem, 266, 24684, 1991

Claims

1 A method for investigating cellular and molecular processes at the interface between an implant and bone/soft tissues, comprising a) collecting a sample, preferably a crevicular fluid from sulcus, of the implant and bone/soft tissue interface , b) extracting RNA from the sample, c) optionally generating cDNA using RNA as template, d) performing a gene expression analysis, e) analysing and performing quantification of biological markers in order to establish a biological marker panorama, and f) using the biological marker panorama for assessing the expected degree of regenerative capacity of said interface

2 A method for investigating cellular and molecular processes in bone/soft tissues, comprising a) collecting a sample from a biopsy or exudates from the tissue to be investigated m vitro, b) extracting RNA from the biopsy or exudates, c) optionally generating cDNA using RNA as template, and d) performing a gene expression analysis e) analysing and performing quantification of biological markers in order to establish a biological marker panorama, f) using the biological marker panorama for assessing the expected degree of regenerative capacity of said implantation site

3 A method for investigating cellular and molecular processes at the interface between an implant and bone/soft tissues, comprising a) collecting a sample from a previously insertedimplant unit, together with implant surface associated cells, b) extracting RNA from the implant surface associated cells, c) optionally generating cDNA using RNA as template, d) performing a gene expression analysis, e) analysing and performing quantification of biological markers in order to establish a biological markei panorama, and f) using the biological marker panorama for assessing the expected degree of regenerative capacity of said interface

4 A method according to claim 1 , in which method the crevicular fluid is collected by means of absorbing devices, such as filter stπps

5 A method according to any one of claims 1 -4, in which method sample cells or the loaded absorbing devices are provided into a container with a preserving medium

6 A method according to any one of claims 1 -5, in which method the gene expression analysis is performed in-house, at the site of a dental clinic or the like

7 A method according to any one of claims 1-5, in which method the gene expression analysis is performed at a specialized center

8 A method according to claim 7, in which method the container is sent by regular mail or any other distribution channel from the site of sampling to the specialized center for gene expression analysis

9 A method according to any one of claims 1-8, in which method reverse transcπption is used for generating cDNA using RNA as template

10 A method according to any one of claims 1-9, in which the gene expression analysis is performed by means of qPCR

1 1 A method according to claim 10, in which method the qPCR analysis is performed for specific markers and relative gene expression levels of these markers are calculated

12 A method according to any one of claims 1-11, in which method the gene expression analysis is performed by means of NASBA amplification technique

13 A method according to any one of claims 1 -12, m which method assays for gene expression analysis are designed and validated for genes chosen from one or more of the following groups bone remodelling (osteoblast and osteoclast markers), inflammatory and cytokine markers, growth and differentiating markers, cell adhesion markers, tianscπption markers and microbial markers

14 A method according to claim 13, in which the genes are selected from the group of

Osteocalcin, Alkaline Phosphatase. BSPs, Collagen type 1 , TRAP, Cathepsin K, RANKL, TNF-α, IL- l β, SDF-I , MCP-I, IL-IO, BMPs, PDGF, VEGF, FGF, Vitronectin, Integrins and Focal Adhesion Kinase, Runx/Osterix, groEL, dnaK, htpG, sodA, PG 1431 and lux R family.

15. A method according to claim 14, in which method qPCR analysis is designed and validated for genes selected from the group of Osteocalcin, Alkaline Phosphatase, TRAP, Cathepsin

K, IL-I β and TNF-α.

16. A method according to claim 3, in which method the removal of an inserted implant together with implant surface associated cells is performed by unscrewing the implant, preferably an implant of mini-type.

17. A method according to any one of claims 1-16, in which method said regenerative capacity is used for determining the degree of loading or when loading can be applied to an implant in an environment represented by said regenerative capacity of bone or soft tissue.

18. A method according to any one of claims 1 -17, in which method said regenerative capacity is used for determining the degree of loading or when loading can be applied to a dental implant in an environment represented by said regenerative capacity of bone or soft tissue.

19. A test kit for investigating cellular and molecular processes in soft or bone tissue according to a method in any one of claims 1-18 comprising: a) optionally a means for collecting tissue sample cells, b) optionally a means for extracting RNA from samples, c) optionally a means for generating a cDNA using RNA as template, d) optionally a means for providing the samples to a gene expression analysis unit, and e) a means for performing gene expression analysis.

20. A test kit according to claim 19, wherein said means for collecting tissue sample cells, for instance for collecting crevicular fluid from sulcus around a tooth or an implant, comprises one or more absorbing filter strips

21. A test kit according to claim 19, wherein said means for collecting tissue sample cells comprises one or more implants.

22. A test kit according to claim 19, wherein said means for collecting tissue sample cells comprises a biopsy collecting device.

23. A test kit according to any one of claims 19-22, wherein said means for providing the samples to the gene expression unit comprises a container with a preserving medium.

24. A test kit according to any one of claims 19-23, wherein said means for perfoπning gene expression analysis comprises primers and optionally reagents and/or consumables for qPCR, NASBA or the like.