WO2009046436A1 - Methods for inhibiting senescence of epithelial cells - Google Patents

Abstract

Methods of inhibiting senescence of a mammalian epithelial cell that has been exposed, or will be exposed, to damaging radiation, of minimizing or inhibiting aging of the skin of a mammal due to exposure of the skin to damaging radiation, and of preventing or reducing damage to the skin of a mammal due to exposure of the skin to damaging radiation are disclosed. The methods rely on introducing at least one inhibitor of mTOR (mammalian target of rapamycin) into the cell. Further a method of screening a candidate compound is disclosed based on determining whether the compound alters the senescence status of the cell in comparison with a second preparation of the cell not contacted with the candidate compound.

Description

METHODS FOR INHIBITING SENESCENCE OF EPITHELIAL

CELLS

Field of the Invention

The present invention relates to methods that are specifically effective in the inhibition of senescence in epithelial cells, such as those of skin or other epithelial surfaces. The methods contemplate use of inhibitors of mTOR. The methods are also effective in the treatment of cancer by inducing senescence of cancer cells.

Background of the Invention

Cellular senescence describes a terminal arrest of cell growth that is observed in response on the one hand to cell division (replicative senescence), and on the other hand to various insults including abnormally high activity of oncogenes and DNA damage.

The skin is composed of at least three layers named, in order from the exterior, the epidermis, the dermis and the hypodermis or subcutis. Cells found in the epidermis are Merkel cells, keratinocytes, as well as melanocytes and Langerhans cells. The main cell types of the hypodermis are fibroblasts, macrophages and adipocytes. Exposure of skin to sunlight can lead to photoaging resulting in premature aging of the skin, due primarily to UVA radiation, which is characterized by wrinkling, pigment changes of the skin, cracking and loss of elasticity among others. Cellular senescence is associated with some of this UV related skin damage. Moreover, cellular replication and normal exposure of cells to nutrients can induce cellular senescence. Similarly, exposure of skin and other epithelial cells to radiation, for example during radiotherapy treatments of cancer, can result in acute senescent side effects that might result in limiting the treatment.

Damage to the skin is an acute side effect of radiation therapy that leads to a complex pattern of direct tissue injury and inflammatory cell recruitment, involving damage to epidermal basal cells, endothelial cells and vascular components and a reduction in Langerhans cells. Typically the skin starts to become pink and sore several weeks into radiation treatment. The reaction may become more severe during the treatment and for up to about one week following the end of radiotherapy, and the skin may break down. Radiation-induced keratinocyte damage induces DNA injury repair via activation of the p53 pathway and a simultaneous release of inflammatory cytokines as a consequence of the generation of free radicals. The final consequences of the radiation effects are massive neutrophilic infiltration of the epidermis and profound apoptosis. With successive doses of radiation, the opportunity for tissue healing due to cellular repopulation is reduced, thereby compounding the insult. Chronic radiation-induced changes in the skin are characterized by the disappearance of follicular structures, an increase in collagen and damage to elastic fibers in the dermis, and a fragile epidermal covering.

Epithelial surfaces including skin, the oral cavity, pharyngeal and bowel mucosa, urothelium, etc. may also sustain damage from radiation therapy. The rates of onset of damage and recovery from it depend upon the turnover rate of epithelial cells. Similarly, the lining of the mouth, throat, esophagus, and bowel may be damaged by radiation. If the head and neck area is treated, temporary soreness and ulceration commonly occur in the mouth and throat. If severe, this can affect swallowing, and the patient may need painkillers and nutritional support. The esophagus can also become sore if it is treated directly, or if, as commonly occurs, it receives a dose of collateral radiation during treatment of lung cancer.

There are currently no standard treatments for radiation induced epithelial damage and is an object of the present invention to provide treatments to eliminate or alleviate this damage.

Cancer is a disease that still claims many lives despite many therapeutic advances, therefore new therapies and combination therapies are needed to treat cancer. Induction of early senescence with drugs that can target the senescence pathway in cancer in particular in cancer stem cells offers a new therapeutic intervention.

Summary of the invention

In one aspect the present disclosure provides a method of inhibiting senescence of a mammalian epithelial cell that has been exposed, or will be exposed, to damaging radiation. The method includes introducing at least one inhibitor of mTOR (mammalian target of rapamycin) into the cell. In various embodiments of this method the epithelial cell is a fibroblast, and in other embodiments the epithelial cell is a skin cell, such as a fibroblast of the hypodermal region or a keratinocyte. In a second aspect a method of minimizing or inhibiting aging of the skin of a mammal due to exposure of the skin to damaging radiation is disclosed. The method includes contacting the skin with a topical pharmaceutical composition that contains a therapeutically effective amount of at least one inhibitor of mTOR. In certain embodiments of this method the aging includes senescence of a keratinocyte or a fibroblast cell of the skin.

In yet an additional aspect a method of inhibiting or reducing damage to the skin of a mammal due to exposure of the skin to damaging radiation is disclosed. The method includes contacting the skin with a topical composition comprising a therapeutically effective amount of at least one inhibitor of mTOR and a pharmaceutically acceptable carrier. In various embodiments the damage includes accelerating senescence of a cell in the skin.

In significant embodiments of the various methods disclosed herein the mammal is a human. In further embodiments of the various methods disclosed herein the damaging radiation includes at least one of UV radiation, ionizing radiation, x-radiation, gamma- radiation, and radiation comprising a subatomic particle. In further embodiments of the various methods disclosed herein an inhibitor of mTOR is rapamycin, a biologically active derivative of rapamycin, a biologically active analog of rapamycin, temsirolimus, everolimus, ABT-578, or AP23573.

In an additional aspect a method of screening a candidate compound is disclosed. The screening method includes steps of a) providing an engineered cell lacking a functional Pten (phosphatase and tensin homolog) gene; b) contacting the cell with the candidate compound; and c) determining whether the compound alters the senescence status of the cell in comparison with a second preparation of the cell not contacted with the candidate compound.

In certain embodiments of the screening method the engineered cell includes a conditional knockout gene for Pten. In various other embodiments of this method the engineered cell is described as Pten^lx/lx. In yet further embodiments of this method the conditional knockout gene for Pten is activated by introducing a recombinase gene into the cell. In additional embodiments of the method an altered senescence status includes altered β-galactosidase activity in the cell when the candidate compound is present compared to absence of the candidate compound. In yet a further embodiment of the screening method an altered senescence status includes alteration of translational expression of p53 protein when the candidate compound is present compared to absence of the candidate compound.

In various embodiments compositions are used for providing skin cells with topical protection against damaging UV and ionizing radiation. Such compositions include an ingredient that is formulated into a topical skin care product for use either alone or in combination with conventional sunscreen components, for example.

In various embodiments of the methods provided herein a topical skin care product is employed that prevents or retards the adverse effects of damaging solar or ionizing radiation, and further to provide such a product that works at a cellular level to prevent or reduce cellular senescence, wherein the compounds are applied topically to the skin prior to, during, or shortly after exposure to the sun or radiotherapy at any other time.

The skin is also subject to senescence independently of abnormally high activity of oncogenes, cell division or radiation. Nutrient availability among other causes promote increases in mTOR activity inducing senescence. Disclosed here are topical compounds containing an inhibitor of mTOR activity, and a dermatologically acceptable carrier, wherein the compounds are applied topically to the skin and reduce skin senescence, delaying skin aging.

In a further aspect a therapeutic method directed toward the treatment of cancer is disclosed., wherein the method includes the induction of replication-independent senescence in cancer cells with functional p53 by inhibiting Pten, either alone or in combination with activation/stabilization of the protein p53. This senescence induction, achieved through activation of the mTOR protein that occurs when Pten is eliminated or inhibited, is useful in the treatment of cancer.

In an additional aspect a method for cancer therapy combining mTOR inhibition with p53 stabilizing drugs (such as mdm-2 inhibitors), in p53 positive cancer cells is disclosed. Given the fact that mTOR inhibitors have already been tested as anticancer treatments in cancer patients, this combined approach has the scope to minimize the negative effect of mTOR inhibition on p53.

In a further aspect a method is disclosed to choose between cancer therapies for a cancer patient including the determination of the Pten, mTOR and p53 status of a cancer in that patient.

In yet an additional aspect a method is disclosed to treat quiescent cancer cells (i.e. cancer stem cells) through super-activation of Akt and the potentiation of the p53 response on the basis that senescence can occur independently of proliferation and DNA replication, which is absent in quiescent cancer cells and in cancer stem cells.

In still a further aspect a method to determine a treatment course for a cancer patient is disclosed. This method includes determining the Pten and the p53 status, by means well known in the art, in a cancer biopsy of the cancer patient. If the test reveals heterozygous Pten levels in combination with intact p53 activity, the cancer patient can be advised to have therapy disclosed in the present invention directed toward inhibiting Pten, alone or in combination with therapy directed toward stabilizing or increasing levels of p53 (i.e. mdm-2 inhibitors). If the test reveals null Pten levels in combination with intact p53 activity, the cancer patient can be advised to have therapy disclosed in the present invention directed toward stabilizing or increasing levels of p53 (i.e. mdm-2 inhibitors).

Description of the Figures

Figure 1 Senescence driven by Pten loss occurs in the absence of cellular proliferation and DNA damage, a, Western blot analysis (upper left panel) of pten ^x MEFs after infection with adeno-GFP (Ad-GFP) or adeno-Cre (Ad-Cre) according to the experimental scheme shown in Fig. 5c. Lower left and centre panels: β-Galactosidase staining for senescence and its quantification. Scale bars, lOμm. Right panel: Growth curve oϊpten^h/lx

MEFs after infection with the indicated adenovirus. Error bars show S.D. b, Western blot analysis (upper left panel) oϊpten^lx/lx MEFs pretreated with aphidicolin and then infected as in (a). Lower left and centre panels: β-Galactosidase staining for senescence and its quantification. Right panel: Quantification of BrdU incorporation in pten^lxllx MEFs infected with control virus or Ad-Cre in the presence or absence of aphidicolin. Error bars show S.D. c, Immunofluorescence staining to detect SDF in cells undergoing PICS. Left panels: Representative images to detect phospho-ATM (pATM), phsopho-γ-H2AX (p- γ-H2AX) and phospho-p53(S15) (pp53^S15). Note that WT MEFs treated with doxorubicin were used as a positive control for pATM and p-p53(S15) while UV treated WT MEFs were used as a positive control for p-γ-H2AX. Right panels: quantification of immunofluorescence staining in Ad-Cre infected pten^lx/lx MEFs for times indicated. Error bars are S. D. d, Western analysis for DDR markers in UV treated primary WT MEFs, proliferating primary MEFs (vector) or MEFs undergoing PICS, e, Western analysis for p53-levels in primary pten ^x MEFs with acute loss of Pten (Ad-Cre infection) and knockdown of ATM (siRNA). f, TUNEL analysis in proliferating primary MEFs (vector) or MEFs undergoing PICS. Note that WT MEFs treated with doxorubicin were used as a positive control, g, Senescence associated β-Gal staining with p-γ-H2AX staining (upper left panel and right panel respectively) and quantification (lower left panel and right panel respectively) of prostates from 8-week old Pten^{pc~ '} mice. Graph inset shows p-γ-H2AX staining in a prostate from a 16-week old Pten^pc~'^~ mouse.

Figure 2 mTOR-mediated p53 translation is essential for senescence upon Pten-loss. a, Western blot analysis (upper left panel) of pten^lx/lx MEFs after Rapamycin treatment and acute inactivation of Pten with Ad-Cre (Pte«^Δ/Δ) according to the experimental scheme shown in Fig. 5c. Lower left and right panels: β-Galactosidase staining for senescence and its quantification. Scale bars, lOμm. Error bars show S. D. b, Western analysis (lower left panel) in Ptew-deficient and Pten-mTOR compound mutant primary MEFs (through retroviral infection/selection). Upper left and right panels: β-Galactosidase staining for senescence and its quantification. Scale bars, lOμm. Error bars show S. D. c, Western blot analysis and quantification of MEFs treated as in (a) but including MG 132 addition at 60 hours after infection, d, Left panels: western analysis of Pten-pl^ ^" compound mutant MEFs (through retroviral infection/selection). Right panel shows quantification. Error bars show S.D. e, Left panels: MEFs as in (d) treated with Rapamycin or DMSO for 24 hours. Right panels show quantification. Error bars show S.D. f, Effect of Pten loss on p53 translation as measured by [S³⁵]-Methionine incorporation, g, Real time analysis of total p53 mRNA (upper panel) and p53 mRNA loaded on polysomes (lower panel) in Pten^A/A MEFs (Ad-Cre infected) compared to Pten^lx/lx MEFs (Ad-GFP infected) h, β-Galactosidase and immunohistochemical staining for p53 and phospho-S6 (pS6) in prostates from 8-week old Pten^pc~!~ mice that had been treated with DMSO or RADOO 1 as outlined in the timeline shown in the upper panel.

Figure 3 Ribosomal protein L26 mediates p53-induction downstream of mTOR. a, Effect of Rapamycin on L26 levels in cells undergoing PICS (acute loss of Pten with Ad- Cre). b, Western analysis of L26 levels in mTOR-deficient (left panels) and Pten-mTOR compound mutant primary MEFs (through retroviral infection/selection), c, Western analysis and quantification (left and right panels respectively) of p53-induction in Pten ^Δ primary MEFs (Ad-Cre infection) after knockdown of L26 via siRNA for times indicated. Error bar is S. D d, Senescence staining and quantification (right and centre panels respectively) of Pten^{+ '} primary MEF after knockdown of Pten and/or L26 via siRNA for times indicated. Right panels show western analysis from the same cells at 72 hours.

Figure 4 PICS can be driven by either activation of p53 or super-activation of PI3K pathway, a, β-Galactosidase staining for senescence (left panels) and their quantification (right panel) of Pten ^Δ MEFs treated with Rapamycin and/or Nutlin-3 during PICS (Ad-Cre mediated). Scale bar, lOμm. Error bars are S. D. b, β-Galactosidase staining for senescence (left panel) and their quantification (right panel) of Pten^+/~ (HET) cells treated with either 10% or 20% FCS. c, β-Galactosidase staining for senescence (upper left panel) and their quantification (right panel) for Pten^{+ '} (HET) cells treated with indicated concentrations of the Pten inhibitor VO-OHpic. Lower left panels show western analysis from the same cells. d, Summary of the molecular pathway and pharmacological manipulation of PI3K pathway for "pro-senescence" therapy for cancer and radiation damage .

Figure 5 Inactivation of Pten by Cre-mediated recombination or siRNA and experimental timeline, a, Efficiency of Adenovirus -Cre mediated recombination of the Pten^lx/lx allele as scored by PCR amplification. Note that while the Pten locus is quantitatively recombined, residual Pten protein may remain due to either mRNA or protein stability, b, Quantification of β-galactosidase staining for senescence in Pten^+/~ MEFs in response to treatment with siRNA against Pten for times indicated. The insert shows western analysis for Pten in the same cells at 48 hours, c, Experimental timeline of PICS induction through infection with Adenovirus-Cre (Ad-Cre) and its combination with additional drug treatments (in red). Asterisks denote analysis through either western blotting or β-galactosidase staining for senescence.

Figure 6 A classic DDR is not induced in response to acute loss of Pten a, Time-course of Pten down-regulation in PICS in response to Adenovirus-Cre (Ad-Cre) infection, b, Immunofluorescent analysis of DNA damage markers in cells undergoing PICS, c, Experimental timeline of PICS induction through Ad-Cre infection in combination with knock-down of ATM by siRNA. Asterisks denote analysis through either western blotting and β-galactosidase staining for senescence, d, Western analysis showing p53 levels in response to knock-down of ATM by siRNA at 24 hours (at the time of adenovirus infection) and 48 hours respectively according to the timeline in (c).

Figure 7 Molecular and genetic characterization of PICS, a, Quantification of β- galactosidase staining for senescence in MEFs undergoing PICS treated with Aphidicolin or Rapamycin according to the experimental timeline in Figure 5c. b, Trp53 transcript (left panel) and protein (right panels) levels in Pten^lx/lx MEFs infected with Ad-Cre (Pten^Nl^) as measured by real time PCR and western blotting. Error bars are S.D. c, Effect of Rapamycin on p53 and pl9^Ari levels, d, Effect of rapamycin and MG132 on protein levels of p53, pS6 and p21. e, Efficiency of mTOR recombination as assessed by western blotting (left panels and quantification) and PCR (inserted panels). Asterisk denotes a non-specific band., f, Western analysis of mTOR WT and mTOR ^Δ (through retroviral infection/selection) MEFs after Rapamycin and MG132 treatment for the indicated times.

Figure 8 Polysome profile analysis of primary MEFs in response to acute Pten loss.

Polysome profile of total RNA analyzed by sucrose gradient centrifugation from Pten^h/h MEFs infected with Adenovirus-Cre or Adenovirus-GFP control. Figure 9 mTOR is essential for a robust DNA-damage mediated p53 induction and senescence, a, Western analysis (left panel) and quantifications (right panels) of p53- response in primary WT MEFs after UV-irradiation and Rapamycin treatment, b, Quantification of β-Gal staining in WT MEFs after treatment with 60 J/m² UV and in the presence of Rapamycin. c, Western analysis and quantification (upper and lower panel respectively) of p53-response in primary human fibroblasts WI-38 treated as in (a), d, Western analysis and quantification (upper and lower panels respectively) of p53 -response after UV-irradiation and Rapamycin treatment in mTOR wt and mTOR-deficient primary MEFs. e, Effect of UV-irradiation on Trp53 transcription in mTOR-deficient MEFs as determined by real time PCR. f, γ-H2AX phosphorylation in UV-irradiated mTOR-deficient MEFs.

Figure 10 Senescence in normal cells treated with Rapamycin. WT MEFs were treated with either Rapamycin or control vehicle for 6h, 12h or 25h after 60 J/m² exposure to UV light. Senescence is measured as the percent of Annexin V-positive cells.

Figure 11 L26 is required for p53 induction in PICS, a, Experimental timeline of PICS induction through Adenovirus -Cre (Ad-Cre) infection oϊPten^lx/lx MEFs in combination with knock-down of L26 by siRNA. b, Western analysis of primary Pten^lx/lx MEFs treated as in (a). Note that two independent siRNA molecules against L26 (Nl and N4) were used so as to eliminate off-target effects, c, Western analysis from prostates of four independent 8- week old mice (2 wt and 2 Pte«^{pc" "}) showing an increase in L26 levels.

Figure 12 Modulation of PICS through different therapeutic approaches, a, Western analysis and quantification (upper and lower panel respectively) of pten^h/h MEFs undergoing PICS (Ad-Cre infected) treated with Rapamycin and/or Nutlin-3 according to the experimental scheme shown in Fig. 5c. Error bars are S. D. b, Growth curves of primary WT (upper panel) and p53-/- (lower panel) MEFs that have been treated with Rapamycin and/or Nutlin-3 as indicated, c, Growth curves of WT or Pten^{+ '} (HET) MEFs treated with 10% or 20% serum, d, Growth curve (left panel) and quantification of β-Galactosidase staining (right panel) of Pten^{+ '} MEFs treated with different concentrations of serum, e, β- Galactosidase staining (right panel) and quantification (left panel) oϊPten^hy/~ (Hypo/-) MEFs ttrreeaatteedd iinn tthhee p presence or absence of the Pten inhibitor VO-OHpic, as compared with Ptert ^' (HET) MEFs.

Figure 13 Reduction of senescence in normal cells treated with Rapamycin. WT MEFs were split every three days and treated with either Rapamycin or control vehicle up to five passages. Senescence was measured as a function of % of Beta-gal positive cells.

Figure 14 mTOR is essential for a robust DNA-damage mediated p53 induction senescence and apoptosis. A, Western analysis (left panel) and quantifications for p53 and p21 (right panels) in primary WT mouse embryonic fibroblasts (MEFs) treated with UV- irradiation (60 J/m²) in the presence or absence of Rapamycin (2OnM). B, Quantification of β-Galactosidase staining in WT MEFs after treatment with UV-irradiation with or without Rapamycin (2OnM) and analyzed at late time point (4 days after treatment). C, Percentage of apoptotic cells (Annexin V positive cells) in MEFs treated with UV in the presence or absence of 20 nM Rapamycin, analyzed at early time points (6,12,24h). Asterisk indicates statistically significance (<.006). D, Western analysis and quantification (upper and lower left panels respectively) of p53 induction in primary human fibroblasts (WI-38) treated as in (A). Right panel. Quantification of β-Galactosidase positive cells in WI-38 human fibroblasts after 4 days of UV-irradiation (60 J/m²) +/- Rapamycin (2OnM). E, Quantification of β-Gal staining in human dermal fibroblast after treatment with γ- irradiation (5Gy) +/- Rapamycin (2OnM) analyzed at late time point (4 days after irradiation). F, Percentage of apoptotic cells (Annexin V positive cells) in human dermal fibroblasts 24hs after treatment with γ-irradiation (5Gy) +/- Rapamycin (2OnM). G, Western analysis and quantification (upper and lower left panels respectively) of p53 induction after UV-irradiation and Rapamycin treatment in mTOR wt and mTOR-deficient primary MEFs. Upper right panel. Effect of UV-irradiation on Trp53 transcription in mTOR-deficient MEFs as determined by real time PCR. Lower right panel. γ-H2AX phosphorylation in UV- irradiated mTOR-deficient MEFs. H, Western analysis for p53 in primary WT MEFs treated with Cisplatin (CDDP) in the presence or absence of Rapamycin (2OnM). Note the left panel refers to an experiment where Rapamycin was added at the same moment of CDDP whereas the right panel to an experiment where Rapamycin was added 12h before the treatment with CDDP.

Detailed description of the invention

This disclosure describes a new cellular senescence pathway that can occur at extremely early time points in the life cycle of a cell without requiring a long-term hyper- proliferative phase or oncogene activity. Discovery of this cell pathway has allowed us to identify treatments that can either increase or decrease senescence, depending on the desired therapeutic or cosmetic outcomes.

Radiation impinges naturally on the skin of a mammal during much or all of the time, under ambient conditions. Most of this radiation is innocuous, including visible light, infrared radiation, and microwave radiation, when these are at relatively low radiant intensities. Other forms of radiation are damaging to epithelial cells. Damage may include physical or chemical alteration of the DNA of the cell, as well as chemical transformation of proteins and low molecular weight metabolites of the cell.. Such damaging radiation includes, by way of nonlimiting example, UV radiation including UVA radiation and UVB radiation, γ-radiation, x-radiation and radiation by subatomic particles. Damage by UV radiation may arise upon exposure to sunlight, for example. In DNA UV damage includes formation of pyrimidine dimers. Damage by γ-radiation, x-radiation and radiation by subatomic particles may arise during therapeutic procedures used in treating pathologies such as various forms of cancer. γ-Radiation, x-radiation and radiation by subatomic particles induce damage primarily by inducing ionization of cellular components, which may lead to cleavage of chemical bonds of a molecule absorbing the radiation, or to further chemical reaction of the newly ionized molecule. When DNA absorbs ionizing radiation the DNA can undergo single-strand or double-strand breaks, or it can undergo chemical changes such as formation of pyrimidine dimers. Any of these deleterious effects are comprised in an understanding of injury caused by damaging radiation.

The Examples below describe in detail the identification and characterization of this new pathway. It involves, mainly, the proteins Pten, mTOR and p53. As diagrammed in Fig. 4d, Pten induces the synthesis of mTOR, which in turn has a positive effect on synthesis of p53. The latter step is mediated by ribosomal protein L26 (RpL26). The increased level of p53 promotes senescence and/or apoptosis of the cell (Senescence, shown in blue in Fig. 4d). The pathway can be modulated in two ways: first, by suppressing the function of mTOR, and second, by promoting the function of mTOR and inhibiting p53 activation. The cytoplasmic protein mTOR is usually present in cells at low, steady state levels. In the experiments reported here, in the first of these two modes mTOR is suppressed either by ablating Pten from the cell using an activatable conditional Pten knockout (indicated by the red cross-out over Pten in Fig. 4d) or by adding an inhibitor of mTOR protein such as rapamycin or a biologically functional analog or derivative thereof (Rapamycin shown in red in Fig. 4d); other means are also described in the Examples. Either of these approaches leads to suppressing the expression of p53 protein. This mode, consequently, diminishes the level of p53 in the cell, leading to suppression of senescence. Thus this mode is commended as a therapeutic intervention in cases such as radiation damage of a cell whose natural effect is enhanced senescence and apoptosis. That is, exposure of cells to UV light or other types of damaging radiation increases the activity of mTOR toward p53 in those cells. Such senescence contributes to skin aging or to epithelial linings in the body to become damaged. Inhibition of mTOR activity is a method to reduce senescence induced by UV light or other damaging radiation.

Furthermore even in the absence of radiation cells can senesce because of continuous cellular replications and the following accumulation of the p53. Both these two effects can be significantly delayed by the inhibition of mTOR. Therefore we disclose compounds useful in preventing ageing in normal condition and in retarding the aging effects of solar radiation on the skin.

Second, mTOR function may be promoted in the cell. As diagrammed in the schematic of Fig. 4d, this may be accomplished by treatment with a Pten inhibitor such as VO-OHpic, or by affording nutritive factors that promote mTOR expression (shown in blue in Fig. 4d). This leads to enhanced levels of p53 protein in the cell, promoting senescence. Alternatively, since mdm2 (hdm2 in human cells) inhibits expression of p53, the activity of mdm2 may be inhibited by adding a specific mdm2 inhibitor such as nutlin-3 (shown in blue in Fig. 4d). Thus administration of nutlin 3 also leads to enhanced p53 levels in the cell, promoting senescence. These activities promoting senescence are all shown in blue in Fig. 4d. Since treatment of a proliferative pathology such as cancer would benefit by promoting senescence of cancer cells, a therapeutic approach based on this second mode of modulating the pathway may be recommended in the treatment of various cancers.

There are many products in the market useful for protecting the skin of a mammal, such as a human, from solar radiation, like topical creams or lotions, containing a chemical or physical sunscreen mixed in a suitable carrier. Chemical or physical topical sunscreens provide a level of protection against UV induced skin damage. However this protection may not be complete so UV radiation can still potentially cause DNA damage to skin cells, thereby increasing senescence resulting in skin aging.

Moreover skin damage is a common side effect of radiotherapy for cancer in a mammal, such as a human, for example, that go from mild sunburn all the way to blisters. In an effort to manage this problem it might be decided to limit the radiation treatment which most likely affects the quality of the cancer cure. There are currently no standard treatments recommended for skin treatment during radiotherapy.

It has now been found, however, that topical skin care products can be rendered more effective in protecting a mammal, such as a human, against UV solar radiation or against other types of damaging radiation, especially UVB radiation and ionizing radiation, by adding mTOR inhibitors to the products. It has been found that in the absence of mTOR protein the cells are protected from UV of gamma radiation induced senescence; therefore these particular compounds can protect the skin from solar or gamma radiation at a cellular level.

A method is disclosed herein to decrease the UV light induced senescence of skin cells, wherein the method includes a step of contacting said cells with a therapeutically effective amount of an mTOR inhibitor or a composition that reduces levels of mTOR protein in the cells.

Further, a method is disclosed to decrease the radiation induced senescence of skin cells, the method including a step of contacting said cells with a therapeutically effective amount of an mTOR inhibitor or a substance able to reduce levels of mTOR protein.

Additionally a method is disclosed to decrease the radiation induced senescence of epithelial cells wherein the method includes a step of contacting said cells with a therapeutically effective amount of an mTOR inhibitor or a composition that reduces levels of mTOR protein.

Still further a medicament furnished as a liquid, gel, ointment or unguent and used for topical application is disclosed, wherein the medicament is useful to decrease senescence of skin cells. The medicament contains a therapeutically effective amount of an mTOR inhibitor together with a suitable cosmetic or pharmaceutical vehicle to produce a topically applied medicament. The medicament is applied to the skin of a mammal, such as a human.

Yet additionally a method is disclosed to decrease the senescence of normal epithelial cells, said method including a step of contacting said cells with a therapeutically effective amount of an mTOR inhibitor or a composition that reduces levels of mTOR protein. The cells may occur in a mammal, such as a human.

In yet another disclosure a method of treating a subject suffering from cancer is described wherein the method includes a step of administering to the subject a composition comprising a therapeutically effective amount of a Pten inhibitor. The subject may be a mammal, such as a human.

Still further a method is disclosed of treating a subject suffering from cancer, the method including a step of administering to the subject a composition containing a therapeutically effective amount of a Pten inhibitor and a composition including a therapeutically effective amount of a direct or indirect p53 activator or stabilizer. The subject may be a mammal, such as a human.

As used herein, the phrase "a therapeutically effective amount" and similar terms and phrases relate generally to an amount or concentration of an active agent, commonly incorporated into a pharmaceutical composition, that brings about a desired therapeutic result. In the case of inhibiting or minimizing injury from exposure to damaging radiation, a desired result includes inhibiting or minimizing cell senescence and/or apoptosis that damaging radiation induces. In the case of a cancer therapy, a desired result is promoting or enhancing cell senescence and/or apoptosis in cells of the target cancer.

A worker of skill in the field of this disclosure understands how to determine a therapeutically effective amount to be applied in the treatment of a pathology. Such understanding includes a wide familiarity with in vitro and preclinical in vivo studies carried out within the framework of the disclosure herein. The understanding further profits from broad familiarity with properties of various pharmaceutical preparations, and the ways in which they affect bioavailability of an active agent incorporated therein. The understanding further benefits from close monitoring of therapeutic effects obtained with a population of human subjects treated according to the instantly disclosed methods.

Broadly, a pharmaceutical composition containing an mTOR inhibitor or related active agent intended for topical application may contain the active agent in a range from about 1 μg/cm² of body surface or even less to about 1 mg/cm² or even more, or a range from about 5 μg/cm² of body surface to about 500 μg/cm², or a range from about 10 μg/cm² of body surface to about 200 μg/cm², or a range from about 50 μg/cm² of body surface to about 300 μg/cm², or a range from about 100 μg/cm² of body surface to about 200 μg/cm². A pharmaceutical composition containing an mTOR inhibitor or related active agent intended for systemic application may contain the active agent in a range from about 1 μg/kg of body weight or even less to about 100 mg/kg or even more, or a range from about 5 μg/ kg of body weight to about 50 mg/kg, or a range from about 10 μg/ kg of body weight to about 20 mg/cm , or a range from about 50 μg/ kg of body weight to about 10 mg/cm , or a range from about 200 μg/ kg of body weight to about 5 mg/cm².

The present disclosure describes a new cellular senescence process that occurs at extremely early time points without requiring a long-term hyper-proliferative phase or oncogene activity, i.e., that proceeds in the absence of significant cell proliferation. The pathway involved is summarized above in this disclosure, and set forth in detail in the Examples below. Characterization of this cell pathway has permitted the specification of various treatments that can either increase or decrease the rate or extent of cellular senescence, depending on the desired therapeutic or cosmetic outcomes. As summarized in Fig. 4d, this newly identified pathway involves, mainly, the proteins Pten, mTOR and p53.

In one aspect the present invention discloses the use of one or more mTOR inhibitors for the inhibition or treatment of skin aging or epithelial damage in a mammal, such as a human, brought about by exposure to UV light or other types of damaging radiation.

In another aspect the present invention discloses the use of one or more mTOR inhibitors for the inhibition or treatment of skin aging arising from causes other than by exposure to UV or damaging radiation, e.g. skin cell senescence brought on by means of inhibition of cellular replication and translational inhibition of p53 accumulation.

The cytoplasmic protein mTOR is usually present in cells at low, steady state levels. Exposure of cells to damaging radiation increases the presence of the mTOR protein in those cells, which we here have correlated with increased replication-independent senescence. Such senescence contributes to skin aging or other types of epithelial damage. Inhibition of mTOR protein is a method to reduce UV light or radiation induced skin senescence or epithelial senescence. Therefore we disclose the use of compounds effective in inhibiting or retarding the aging or damaging effects of radiation on the skin of a mammal, such as a human.

There are many consumer products that provide various degrees of protection from solar radiation. These products often come in the form of topical creams or lotions and contain a chemical or physical sunscreen active in combination with a cosmetically suitable carrier.

Chemical or physical topical sunscreens provide a level of protection against UV induced skin damage, but, this protection may not be complete so UV radiation present in impinging sunlight can potentially cause DNA damage to the skin cells, thereby increasing senescence resulting in skin aging.

As a consequence of the experimental results provided herein, however, the present disclosure demonstrates that topical skin care products can be rendered more effective in protecting against UV solar radiation, especially UVB radiation, by the addition of one or more mTOR inhibitors. It has been found that when mTOR protein activity is eliminated or greatly reduced, skin cells are protected from UV induced senescence, therefore these particular compounds can protect the skin of a mammal, such as a human, from solar radiation at a cellular level.

The present disclosure further provides a product that protects a mammal, such as a human, against damaging radiation, especially various forms of ionizing radiation, specifically a product containing one or more mTOR inhibitors. It has been found that when mTOR protein activity is absent or greatly reduced, the cells are protected from radiation induced senescence, therefore these particular compounds can protect the skin or other epithelial surfaces from radiation, at a cellular level.

The present disclosure additionally provides new methods using compositions useful for providing skin and other epithelial surfaces with topical protection from radiation. The disclosure further for provides such compositions that are formulated into a topical product for use alone or in combination with conventional sunscreen active compounds or other ingredients. The present disclosure further describes use of a topical medicament that can inhibit or retard the adverse effects of solar radiation or other types of damaging radiation, wherein the medicament includes therapeutically active components that function at a cellular level to prevent or reduce cellular senescence, wherein the medicament is applied topically to the skin prior to, during, or shortly after exposure to the sun or at any other time, or prior to, or shortly after, exposure of the epithelial cell surface to damaging radiation, for example for the inhibition or treatment of epithelial damage due to radiation therapy.

The skin is also subject to senescence independently of abnormally high activity of oncogenes, cell division or UV radiation. Normal availability of nutrients from the circulation can promote increases in mTOR activity. Disclosed here are topical compounds containing one or more inhibitors of mTOR activity, and a dermatologically acceptable carrier, wherein the compounds are applied topically to the skin and reduce skin senescence, delaying skin aging.

Also disclosed is a topical cream useful for the treatment and prevention of senescence in skin or other epithelial cells. Any of the mTOR inhibitors described below can be used in the formulation of the topical medicament of the present invention.

Inhibitors of mTOR

mTOR inhibitors form a complex with FKBP and mTOR. Rapamycin, one of the best known of mTOR inhibitors, is a macrolide produced by Streptomyces hygroscopicus. Many mTOR inhibitors are known to one of skill in the art and include, by way of nonlimiting example, rapamycin (CAS number 53123-88-9) or an analog or derivative thereof, e.g., temsirolimus (CCI-779, Wyeth), everolimus (RADOOl, Novartis), ABT-578 (Abbott Labs) or AP23573 (ARIAD Pharmaceuticals, Inc.), which are being tested for treatment of cancer. In addition, rapamycin and derivatives are used as immunosuppressants in organ transplant recipients and are being used, evaluated or developed for use on stents as anti-restenotic agents following interventional cardiology. Any rapamycin analog or derivative contemplated in this disclosure has a biological activity comparable to that of the rapamycin parent. For example the derivative or analog forms a complex with FKBP and mTOR, and/or exerts downstream effects on protein expression and cell senescence in a manner equivalent to the effects exerted by rapamycin.

Many analogs and derivatives of rapamycin are known in the art. Examples include those compounds described in U.S. Pat. Nos. 7,160,867, 6,329,386; 6,200,985; 6,117,863; 6,015,815; 6,015,809; 6,004,973; 5,985,890; 5,955,457; 5,922,730; 5,912,253; 5,780,462; 5,665,772; 5,637,590; 5,567,709; 5,563,145; 5,559,122; 5,559,120; 5,559,119; 5,559,112; 5,550,133; 5,541,192; 5,541,191; 5,532,355; 5,530,121; 5,530,007; 5,525,610; 5,521,194; 5,519,031; 5,516,780; 5,508,399; 5,508,290; 5,508,286; 5,508,285; 5,504,291; 5,504,204; 5,491,231; 5,489,680; 5,489,595; 5,488,054; 5,486,524; 5,486,523; 5,486,522; 5,484,791; 5,484,790; 5,480,989; 5,480,988; 5,463,048; 5,446,048; 5,434,260; 5,411,967; 5,391,730; 5,389,639; 5,385,910; 5,385,909; 5,385,908; 5,378,836; 5,378,696; 5,373,014; 5,362,718; 5,358,944; 5,346,893; 5,344,833; 5,302,584; 5,262,424; 5,262,423; 5,260,300; 5,260,299; 5,233,036; 5,221,740; 5,221,670; 5,202,332; 5,194,447; 5,177,203; 5,169,851; 5,164,399; 5,162,333; 5,151,413; 5,138,051; 5,130,307; 5,120,842; 5,120,727; 5,120,726; 5,120,725; 5,118,678; 5,118,677; 5,100,883; 5,023,264; 5,023,263; and 5,023,262; all of which are incorporated herein by reference. mTOR inhibitors to be used topically together with a pharmaceutically acceptable carrier in the presently disclosed methods should be included in the final topical medicament at a concentration that is effective to inhibit mTOR activity in vivo. Such determination for any one of the mTOR inhibitors disclosed in the present invention is readily accomplished, for example by using commercially available assays such as the K- LISA™ mTOR Activity Kit (Calbiochem). Alternatively, mTOR inhibitors to be used topically together with a pharmaceutically acceptable carrier as disclosed herein should be included in the final topical medicament at a concentration that is sufficient to reduce senescence in epithelial cells, as determined using methods such as those presently disclosed or by using equivalent methods known to those of skill in the field of the present disclosure. Using any assay known to a worker of skill in the field of the present disclosure, an mTOR inhibitor useful in the presently disclosed methods reduces mTOR activity by at least 5%, or by at least 10%, or by at least 15%, or by at least 20%, or by at least 25%, or by at least 30%, or by at least 35%, or by at least 40%, or even by a higher percent, compared to the activity found in control experiments that include non treated cells.

Pharmaceutical formulations adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils.

Pharmaceutical formulations of adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. For example, the active ingredient may be delivered from the patch by iontophoresis as generally described in Pharmaceutical Research, 3(6), 318 (1986), incorporated herein by reference as related to such delivery systems.

For treatments of the skin or other epithelial surfaces, the formulations may be applied as a topical ointment or cream. When formulated in an ointment, the active ingredient may be employed with either a paraffϊnic or a water-miscible ointment base. Alternatively, the active ingredient may be formulated in a cream with an oil-in-water cream base or a water- in-oil base. Pharmaceutical formulations adapted for topical administration in the mouth include lozenges, pastilles, and mouthwashes.

When formulated in an ointment, the active ingredients may be employed with either a paraffϊnic or a water-miscible ointment base. Alternatively, the active ingredients may be formulated in a cream with an oil-in-water cream base.

If desired, the aqueous phase of the cream base may include, for example, at least 30% w/w of a polyhydric alcohol, i.e. an alcohol having two or more hydroxyl groups such as propylene glycol, butane 1,3-diol, mannitol, sorbitol, glycerol and polyethylene glycol (including PEG 400) and mixtures thereof. The topical formulations may desirably include a compound that enhances absorption or penetration of the active ingredient(s) through the skin or other affected areas. Examples of such dermal penetration enhancers include dimethyl sulphoxide and related analogs.

The oily phase of the emulsions of this invention may be constituted from known excipients in a known manner. While the phase may comprise merely an emulsifier (otherwise known as an emulgent), it desirably comprises a mixture of at least one emulsifier with a fat or an oil or with both a fat and an oil. A hydrophilic emulsifier may be included together with a lipophilic emulsifier, which acts as a stabilizer. Some embodiments include both an oil and a fat. Together, the emulsifier(s) with or without stabilizer(s) make up the so-called emulsifying wax, and the wax together with the oil and fat make up the so- called emulsifying ointment base which forms the oily dispersed phase of the cream formulations.

Emulgents and emulsion stabilizers suitable for use in the formulation of the invention include TweenόO™, Span80™, cetostearyl alcohol, benzyl alcohol, myristyl alcohol, glyceryl mono-stearate and sodium lauryl sulfate.

The choice of suitable oils or fats for the formulation is based on achieving the desired therapeutic or cosmetic properties. Creams are generally a non-greasy, non-staining and washable products with suitable consistency to avoid leakage from tubes or other containers. Straight or branched chain, mono- or dibasic alkyl esters such as di-isoadipate, isocetyl stearate, propylene glycol diester of coconut fatty acids, isopropyl myristate, decyl oleate, isopropyl palmitate, butyl stearate, 2-ethylhexyl palmitate or a blend of branched chain esters known as Crodamol CAP may be used. These may be used alone or in combination depending on the properties required. Alternatively, high melting point lipids such as white soft paraffin and/or liquid paraffin or other mineral oils are used.

Moreover, a therapeutic method is disclosed herein directed toward the treatment of cancer that includes a step of inducing replication-independent senescence in cancer cells with functional p53 by inhibiting Pten in the cancer cells, either alone or in combination with inducing the activation or stabilization of the protein p53 in the cancer cells. This senescence induction, achieved through activation of the mTOR protein that occurs in a cell when Pten is absent or inhibited in that cell, is useful in the treatment of cancer. By way of non limiting example, various Pten inhibitors and p53 activators or stabilizers that can be used in the presently disclosed methods are listed in the following sections, further below.

In a further aspect a method is disclosed to treat quiescent cancer cells (i.e. cancer stem cells) through super-activation of Akt (also known as protein kinase B) and the potentiation of the p53 response. This super-activation and potentiation is based on finding reported herein that senescence can occur independently of proliferation and DNA replication, which is absent in quiescent cancer cells. Akt is involved in cellular survival pathways, by inhibiting apoptotic processes. Since it can block apoptosis, and thereby promote cell survival, Akt has been implicated as a major factor in many types of cancer.

Still additionally a method of cancer therapy is disclosed, wherein the therapy combines mTOR inhibition with inhibitors of mdm-2 (a p53 inducer) or the human ortholog hdm-2 in p53 positive cancer cells.

Inhibitors of Pten

Pten, one of the most frequently mutated genes in human cancer, acts as a tumor suppressor by dephosphorylating the plasma membrane lipid second messenger phosphoinositide-3,4,5-trisphosphate (PIP3) generated by the action of PBKinases. Pten can be inhibited by several compounds known in the art, which, by way of a not exclusive example include: vanadyl complexed to hydroxypicolinic acid (VO-OHpic) compounds listed in patent application PCT7US2005/011626, and bisperoxovanadium (bpV) molecules: such as bpV(HOpic), dipotassium bisperoxo(5-hydroxypyridine-2-carboxyl)oxovanadate; bpV(bipy), potassium bisperoxo(bipyridine)oxovanadate; bpV(phen), potassium bisperoxo(l,10-phenanthroline)oxovanadate; bpV(pic), dipotassium bisperoxo(pyridine-2- carboxyl)oxovanadate

Activators of p53

In the methods disclosed herein various agents that stabilize or induce the activity of p53 may be used. Non limiting example of such compounds include PRIMA-I (p53 reactivation induction of massive apoptosis) and CP-31398 (Pfizer), which aim to reactivate mutant p53 proteins, possibly by helping them fold more normally. Others, such as nutlins, including nutlin-3 (CAS Number 548472-68-0), foster p53 activity by preventing its interaction with the natural inhibitor mdm2; Other agents are Leptomycin B and mitomycin C (MMC), actinomycin D (Act D) and etoposide.

Moreover, we disclose a method to choose among various cancer therapies for a cancer patient that includes a step of determining the Pten, mTOR and p53 status of a cancer in a cancer biopsy of the cancer patient by means well known to workers of skill in the field of this disclosure. If the test reveals heterozygous Pten levels in combination with intact p53 activity, the cancer patient can be advised to have therapy disclosed herein directed toward inhibiting Pten, alone or in combination with therapy directed toward stabilizing or increasing levels of p53. If the test reveals null Pten levels in combination with intact p53 activity, the cancer patient can be advised to undergo therapy such as disclosed herein directed toward stabilizing or increasing levels of p53.

Examples

Experimental Procedures

Mouse crosses and MEF production

Conditional knockout mice are crossed to allow a gene to be inactivated in a tissue- or temporal-specific fashion. mTOR conditional knockout mice (mT0R^XxlXx, see²⁵) and pl9^Arϊ heterozygous mice²⁶ were crossed with Pten conditional knockout mice (Pten^lxΛx, see¹⁶) to produce mTOR ^{x X}-Pten ^x and pi 9 -Pten ^{x x} compound mutants (see respective references for genotyping). Mouse Embryonic Fibroblasts (MEFs) from these crosses were harvested by standard procedures and recombination achieved as indicated below. Cell culture, treatments, and infection

Primary MEF cells were transiently infected with Adenovirus type 5-Cre (Microbix Biosystems Inc., Toronto, Canada) or with Ad5-GFP (a kind gift of Dr. U. Greber and Dr. S. Hemmi, University of Zurich) for 48 hrs at a Multiplicity of Infection of 50 as previously described². Cells were pretreated with Aphidicolin (Sigma-Aldrich, St. Louis, MO) used at 2 μg/ml and Rapamycin (Cell Signalling Technology) at 20 nM, 12 hours prior to infection (see also experimental scheme in Fig. 5c). Aphidicolin is a tetracyclic diterpene antibiotic that is a reversible inhibitor of eukaryotic nuclear DNA replication. It blocks the cell cycle at early S-phase. Nutlin-3 (Cayman Chemical, Ann Arbor, MI, #10004372) was added at 10 μM and the proteasome inhibitor MG 132 (Calbiochem, La Jolla, CA) was used at 10 μM after 48 hours of infection for 12 hours (see also experimental scheme in Fig. 5c) while the Pten inhibitor, VO-OHpic, was used at concentrations up to 500 nM . For metabolic labeling, MEFs undergoing PICS were pre -incubated in DMEM without methionine and cysteine with 5% dialyzed FCS for 1 hr. After starvation cells were labeled with 100 μCi/ml of [³⁵S] -labeled methionine (Amersham) for 30 min. Cells were subsequently lysed and immunoprecipitations for p53 carried out as detailed below.

For stable transfections, primary MEFs (Pten^lx/hi, mT0R^lx//lx and combinations including/) 19^Arf null MEFs) were infected with retroviruses expressing Cre-PURO-IRES- GFP, or control virus and selected in 3 μg/ml puromycin (Sigma) for 2 days as described² and used for analyses. Senescence staining was done using the Senescence Detection Kit (Calbiochem, #JA7633), based on X-gal detection of beta-galactosidase, as described² and quantifications were done on 4 images (roughly 500 cells) per experiment by determining the ratio of perinuclear-blue positive to -negative cells. TdT-mediated dUTP Nick-End Labeling (TUNEL) assays were performed with in situ Cell Death Detection (Roche) kit, in accordance with the manufacturers' instructions; 50-100 cells were screened in each sample.

Western blotting, immunoprecipitation and immunochemistry

MEF lysates were prepared with RIPA buffer (1 PBS, 1% Nonidet P40, 0.5% sodium deoxycholate, 0.1% SDS and protease inhibitor cocktail (Roche)). The following antibodies were used for western blotting: mouse monoclonal anti-Pten (Cascade BioScience, clone 6H2.1, #ABM-2052), rabbit monoclonal anti-Pten (Cell signalling, clone 138G6, #9559), rabbit polyclonal anti-pl9^Arf (Neomarkers, Ab-I, #RB-1714-PO), rabbit polyclonal anti-p53 (Novocastra, CM5, #NCL-p53-CM5p), rabbit polyclonal anti-Akt (Cell Signalling, #9272) and anti-phospho-serine 473 of Akt (Cell Signalling, #9271), rabbit polyclonal anti- phospho-serine 240/244 of S6 (Cell Signalling, #2217), rabbit polyclonal anti-p21 (Santa Cruz, C-19, #sc-397), rabbit polyclonal anti-RPL26¹⁹, rabbit anti-RPL26 (Bethyl Lab. Inc., BL3208, #A300-685A), mouse monoclonal anti-actin (Sigma, #AC-74), Anti-Phospo- Histone γ-H2AX(Serl39) (Upstate , #05-636) rabbit polyclonal anti-mTOR (Upstate- Millipore, mTAbl, #07-231). Mouse monoclonal antibody to ATM (Novus Biologicals, NB 100-220). Mouse monoclonal Chkl (Cell signaling, #2360), rabbit polyclonal Phospho- Chkl (ser 317) (Cell Signaling, #2344), rabbit polyclonal Chk2 (Cell Signaling, # 2662), Rabbit Anti-Chk2, phospho (Thr68) Polyclonal Antibody, (Abeam, ab38461), Phospho- (Ser/Thr) ATM/ATR Substrate Antibody (Cell Signaling, #2851). After standard SDS- PAGE and western blotting techniques, proteins were visualized using the ECL system (Amersham Biosciences) and quantified using the ImageJ software (http://rsb.info.nih.gov/ij/) from NIH on Macintosh computers.

Immunoprecipitation was carried out as previously described²⁷. Briefly, cells were scraped off a 10 cm dish with lysis buffer and incubated for 30 min at 4 deg on a rocking platform. The 30 min (13 krpm) supernatants were pre -cleared with Protein-G Sepharose beads (Amersham) for 1 hr and mouse anti-p53 (1 : 1000, Santa Cruz sc-100) was added to equal protein amounts of cleared supernatants for overnight incubation at 4°C followed by Protein-G Sepharose co-precipitation (1 hour) and 3 consecutive washes (5 min each) at 4°C with lysis buffer. For immunohistochemistry tissues were fixed in 10% formalin and embedded in paraffin blocks according to the standard procedures. The antibodies used to stain the sections for anti-Phospho-Histone (Serl39) γ-H2AX, anti-p53 and anti-phospho- serine 240/244 of S6 were the same used for Western blot analysis. Immunofluorescence microscopy.

Cells were fixed as previously described²⁷. Cover slips were mounted in Anti-Fade (IMP) and sealed with clear nail polish. Confocal sections were obtained with a Leica DMRXA2 microscope (HCX PL APO 63x water objective, 1.2 nominal aperture) using Leica Confocal Software v. 2.61. Comparative immunofluorescence analyses were performed in parallel with identical acquisition parameter; 100-300 cells were screened for each antigen. All data analysis was done on Apple Macintosh Computers. The following antibodies were used for immunofluorescence: rabbit anti-Phospho-Histone (Serl39) γ- H2AX (Cell signaling, #2577), Phospho-p53 (Serl5) Antibody (Cell Signaling, #9284), mouse Anti-ATM-Protein Kinase pS1981 (Rockland, # 200-301-400).

Real time and conventional PCR

Total RNA was extracted from the various MEFs after indicated treatments using the Trizol method (Invitrogen) and quantitative real-time PCR performed as described27. Briefly, cDNA was produced from 2μg of RNA using the Superscript III system (Invitrogen) using oligo dT primers as suggested by the manufacturer. Quantitative real-time PCR was performed on a Roche LightCycler using the Quantitect SYBR Green PCR kit (Qiagen) and the following amplification protocol: 15 min at 95 deg, 40 cycles (15 sec at 94 deg - 20 sec at 57 deg - 20 sec at 72 deg) followed by determination/confirmation of amplicon melting temperature. Reactions were performed in triplicates, primer pairs were confirmed to yield a single amplicon band by 3% agarose gel electrophoresis and absence of amplification from non reverse-transcribed RNA was confirmed to exclude genomic DNA amplification. The primer sequences were obtained from PrimerBank (http://pga.mgh.harvard.edu/ primerbank/index.html) and have been described28.

Sequences used were: p53 pair 1 (PrimerBank ID: 675588IaI), Fwdl (5'-GCGTAAACGCTTCGAGATGTT-S '; SEQ ID NO: 1), Revl (5'- TTTTTATGGCGGGAAGTAGACTG -3'; SEQ ID NO: 2), pair 2 (ID: 6755881a2) Fwd2 (5'- GATGCCCATGCTACAGAGGAG-3'; SEQ ID NO:3), Rev2 (5 'TTTTTATGGCGGGAAGTAGACTG -3'; SEQ ID NO:4), pair 3 (ID: 675588 Ia3) Fwd3 (5'- CTCTCCCCCGCAAAAGAAAAA -3'; SEQ ID NO:5), Rev3 (5'- CGGAACATCTCGAAGCGTTTA -3'; SEQ ID NO: 6).

The following primers for Hprtl and β-actin cDNA were used as reference standards: Hprtl [Fwd (5'-CACAGGACTAGAACACCTGC-S ' ; SEQ ID NO:7), Rev (5'- GCTGGTGAAAAGGACCTCT-3'; SEQ ID NO:8)]; β-actin [Fwd (5'-GGCCAACCGTGAAAAGATGA-S ' ; SEQ ID NO: 9), Rev (5'- TGGATGGCTACGTACATGGCT -3'; SEQ ID NO: 10)]. Polysome fractionation

Polysome profiles were generated as previously described²⁹. Briefly, cytoplasmic cell extracts were sedimented on 10-50% linear sucrose gradients by centrifugation at 36,000 rpm for 3h. Twelve fractions were collected from the gradients and monitored with an ISCO UA-6 detector. RNA was extracted from each fraction using the RNeasy kit (Qiagen) and quantitative real-time PCR performed as described above. RNA-interference assays

MEFs were plated into 6-well dishes and transfected with anti-RPL26 (Dharmacon, SMARTpool), anti-Pten (Dharmacon, SMARTpool), anti-ATM (Dharmacon, SMARTpool) siRNAs and control siRNA (si-Luc, Dharmacon) according to the manufacturer's instructions. See Fig.όc for siATM experimental timeline and Fig. 11a, for si-RPL26). Two independent si-RNAs for mouse RPL-26,

Nl (AAGUAUAACGUUCGGUCUAUU; SEQ ID NO:11) and

N4 (UCGAACGAGUCCAGCGAGAUU; SEQ ID NO:12), were also used.

Statistical analysis

Statistical evaluations were carried out using SigmaStat 2.03 (SPSS, San Rafael, California) For all tests the level of statistical significance was set at p < 0.05. Cell culture, treatments and growth curve analysis

For irradiation, cells were UV-treated at 60 J/m² using the UV Stratalinker 2400 (Stratagene) in the absence of media and re-incubated in their respective media for a further 6, 12 hours in the presence or absence of Rapamycin (20 nM). WI-38 human fibroblasts were obtained from the American Type Culture Collection and maintained as recommended. For growth curve analysis, cells were plated at 2.5 x 10⁴ per well in 12-wells dishes in triplicate and spectroscopic measurement of crystal violet uptake was done at the indicated time points. Experimental results

Example 1. Conditional Knockout of Pten.

As intended, Ad-Cre infection of primary Pten^lx/lx MEFs efficiently reduced Pten protein as determined by Western blotting, compared to infection by control Ad-GFP (see upper insert in Fig. Ia) and reduced gene levels as detected by PCR (Fig. 5 a). The Western blot also shows (Fig. Ia) that Ad-Cre infection resulted in activation of p53 synthesis, consistent with previous findings². Similarly, the hallmark feature of senescent cells, β- galactosidase (β-Gal) activity, revealed a rapid senescence response (Fig. Ia, center panels for slide fields, and left panel for quantitation of the fields), as well as a dramatic impairment in cell growth (Fig. Ia, right panel).

Example 2. RNA Interference of Pten.

Similar to the results in Example 1, acute inactivation of Pten by means of RNA interference (RNAi) in Pten heterozygous (Pten^+/~) MEFs resulted in loss of expression of Pten protein after 48 hours (Fig. 5b, right panel), and induction of cellular senescence at early time points between 48 and 96 hours, as detected by β-galactosidase activity (Fig. 5b, left panel).

Example 3. Pten Inactivation Produces Senescence in the Absence of Cellular Proliferation In Vitro.

Since Ptew-loss induced cellular senescence (PICS) occurs acutely and in the absence of a long-term hyper-proliferative phase, the inventors formed the hypothesis that in vitro, PICS could occur in the complete absence of DNA replication and cellular proliferation, characteristics of both replicative senescence and oncogene-induced senescence (OIS)^6"9. To validate this hypothesis Pten in MEFs was acutely inactivated when they were pretreated with Aphidicolin, a reversible inhibitor of the eukaryotic DNA polymerase that specifically blocks the cell cycle at early S-phase by inhibiting DNA replication⁷, 12 hr prior to infection with Ad-Cre (see experimental timeline outlined in Fig. 5c).

Pre-treatment ofPten^lx/lx MEFs with Aphidicolin followed by acute inactivation of Pten resulted in β-galactosidase-detected senescence after 24 hours (Fig. Ib, left and center panels). It is to be noted that unexpectedly this occurred in the absence of cellular proliferation as visualized by the lack of BrdU incorporation into newly synthesized DNA (Fig. Ib, right panel). This finding suggests that DNA replication and cellular proliferation are not required for PICS progression.

Example 4. Absence of Requirement for DNA Damage Repair.

Since DNA hyper-replication drives senescence through the progressive accumulation of a DNA-damage response (DDR) in OIS^7"9, the inventors also looked for evidence of a DDR in MEFs that were progressively undergoing PICS (Fig. 6a). Control cells and cells undergoing PICS were followed for 72 hours. Senescence-associated DNA-damage Foci (SDF) are characterized by immuno fluorescent detection of the activated form of the ataxia telangiectasia protein (ATM pS1981) and activated DDR mediators such as phosphorylated histone H2AX (γ-H2AX) and phosphorylation of p53 on Serl5. It was found that no apparent increase in SDF was observed (Fig. Ic and Fig. 6b). Furthermore, western analysis did not show any increase in CHKl (checkpoint kinase 1) phosphorylation on Ser345, CHK2 (checkpoint kinase 2) phosphorylation on Thr68, and phosphorylation of γ- H2AX, markers already shown to correlate with the DDR required for OIS (Fig. Id, left panel; see frames labeled pCHKl and pCHK2). Furthermore, a general increase in phosphorylation of ATM/ ATR substrates (detected using anti-phospho-ST/Q) was not associated with PICS (Fig. Id, right panel).

Finally, to test whether DDR activation has the potential to drive p53 up-regulation in PICS we used an RNAi approach to knockdown ATM in Pten^h/lx MEFs infected with Ad- Cre (Fig. Ie, and the experimental time-line in Fig. 6c). Western analysis showed that at the time of infection with Ad-Cre ATM levels were already undetectable (Fig. 6d, 24hrs). Notably, acute inactivation ofPten in MEFs unable to sense DNA damage still resulted in the up-regulation of p53 at early time points (Fig. Ie, lane 3, and Fig. 6d, 48hrs, lane 2). This allowed us to uncouple p53 induction from DDR activation and demonstrates that the establishment of DDR is not required for PICS. Furthermore, we did not observe the presence of DNA breaks in cells undergoing PICS as detected by TdT-mediated dUTP Nick-End Labeling (TUNEL) (Fig. If), which is supported by our previous data in PterP^{c~ '} mice in vivo .

Finally, samples from prostate conditional Pten null mice (PterP^{c~ "}) were analyzed for evidence of DDR activation to corroborate the observations reported above in vivo. As previously reported, Ptetf^{c~ '} mice at the age of 8-11 weeks develop prostate tumours that contain a significant amount of β-Gal positive senescent cells (at least 20 fold increase of the β-Gal staining compared with wild type (WT) prostates)². Mice sacrificed at 8 weeks were stained for both β-Gal and phospho-γ-H2AX. While we observed a strong senescent phenotype in the prostates of the PterP^{c~ '} mice, no significant difference in phospho-γ- H2AX was observed (Fig. Ig). Interestingly, late stage Pterf^0'1' tumours (16 weeks) that have overcome senescence and show features of higher invasiveness associated with increasing genomic instability were found to have increased phosphorylation of γ-H2AX (Fig. Ig, graph inset). Overall, our data support the hypothesis that in PICS the DDR is not engaged, at least at an early stage of disease, and is independent of a DDR activation in vivo.

Example 5. Requirement for mTOR in PICS. Based on the results in Examples 3 and 4, the inventors hypothesized that a downstream oncogenic component of the Ptew-pathway, when maximally activated, has the subversive ability to slow growth by inducing a p53-response independent of DDR activation. Indeed, overexpression of active myristoylated Akt/PKB (myr-Akt), a major kinase activated upon Ptew-loss, has been reported to initiate PICS to some degree² consistent with the general concept of oncogene-induced senescence¹⁰.

To test this hypothesis, and to dissect which of the numerous Akt-targets could be relevant, we tested the effect of Rapamycin on PICS. Rapamycin, an anti-fungal macrolide with well-known immune-suppressive properties, inhibits the mTOR kinase Complex 1 (mTORCl)¹¹. It is currently being tested for anti-tumoral activity in clinical trials¹² after several pre -clinical cancer model systems showed a response, especially under conditions of activated Akt/PKB signalling^13"15. mTOR is a key mediator of translation downstream of Akt through its ability to activate both initiation factor eIF4e as well as the ribosomal protein S6 (RpLS6)ⁿ.

To test if PICS and p53 induction downstream of Akt activation depends on mTORCl we treated primary Pten ^{x x} MEFs with Rapamycin prior to Ptew-ablation via infection with Ad-Cre (see Fig. 5c for a time line of the experiment). It is seen that activation of the conditional Pten knockout by Ad-Cre resulted in efficient Pten-loss (Fig. 2a, upper left panel, lane 3). Additionally, it was surprisingly found that in the Ad-Cre sample p53- induction, while present in the control, was largely abolished by Rapamycin. Similarly, β- galactosidase activity, which is induced by Ptew-loss (Fig. 2a, lower left and both right panels), was reduced to background levels after rapamycin treatment, demonstrating that Rapamycin abrogates the PICS response. Furthermore, the effect of Rapamycin is independent of its effect on proliferation since another anti-proliferative drug such as Aphidicolin does not prevent PICS (Fig. Ib and Fig. 7a, showing high β-galactosidase activity). In corroboration, no change was found in 7Vp53-transcription as determined by real time PCR when Ptew-deficient MEFs were treated with Rapamycin (Fig. 7b, left panel), suggesting that transcription of p53 is not affected by rapamycin. It is also seen, nevertheless, that the level of p53 protein determined by Western blotting is strongly diminished (Fig. 7b, right panel). In further corroboration of the role of mTOR, we tested genetically if mTOR is also essential for p53-induction in PICS. It was found that both p53-induction (Western blots) and senescence (β-galactosidase activity) are entirely mTOR-dependent as shown in Pten^1'; mTOR^ double null MEFs (Fig. 2b).

This Example shows that in activated conditional Pten knockout mice, interference with the normal function of mTOR, whether by treatment with an mTOR inhibitor or by genetic knockout, results in inhibition of cell senescence.

Example 6. Inhibition of Proteasomal Degradation of p53.

Since protection from degradation is a well-defined means of regulating p53-levels the inventors next tested whether Rapamycin would also exert an effect when p53- degradation is blocked. The proteasomal inhibitor MG 132 was added to experimental cultures at 60 hrs after treatment with rapamycin (see timeline in Fig. Sc). As shown in Fig. 2c, MG132-mediated disruption of proteasomal p53-degradation resulted in a 6-fold p53- increase, determined by Western blotting, compared to Pten-loss alone (see Table 1). Rapamycin was still able to reduce p53 protein levels in this setting (Fig. 2c), consistent with the effect of rapamycin in Example 5.

Example 7. Induction of pl^ in Pten loss and Effect on p53.

As the inventors have previously shown², p53-induction in PICS is accompanied by induction of pi ^, which contributes to p53 stabilization. This is confirmed in Fig. 2d using Western blotting, which shows that Pten-loss resulted in pl9^Arf protein induction, p53 stabilization and p21 upregulation (see Table 2). Importantly however, even upon complete knockout of pi 9*^, p53 was still strongly induced (Fig. 2d). Most notably, we found that the induction of p53 in these cells was strongly suppressed by Rapamycin and hence was translation-dependent (Fig. 2e, see especially the third bar in the right panel; refer to Table 3). Note that Rapamycin did not decrease pi 9

^ levels in cells (Fig. 7c, lane 3). In sum, these data strongly suggest that upon Pten loss the translational control of p53 is dominant over Arf-mediated pS3-stabilization.

Example 8. Effect of Inactivation of mTOR on p53 Levels To address the role of p53 -translation in absence of oncogenic stimuli we measured steady state p53-levels under pharmacological and genetic inactivation of mTOR alone. As shown by the Western blots in Fig. 7d, Rapamycin efficiently reduced p53 steady-state levels and activity even after p53 -protection with MG132. Furthermore, genetic ablation of mTOR (see Fig. 7e for demonstration of mTOR genetic ablation at both the transcript and protein levels) demonstrated that in absence of oncogenic stress mTOR activity is essential for p53 -translation as its loss is dominant over the p53-induction observed by proteasomal inhibition (Fig. If). The activated conditional knockout of mTOR leads to sharply decreased expression of p53 protein whether proteasomes are functional or inhibited by MG132.

Further, we confirmed this translational contribution to the increase in p53 level by pulsing cells undergoing PICS with [S³⁵] -labelled methionine. Immunoprecipitation of p53 identified a significant proportion of newly synthesized p53 protein in PICS (Fig. 2f) when compared with the WT control. Furthermore, the amount of p53 mRNA loaded on the polysome, as analyzed by sucrose gradient, was higher in PICS (Fig. 2g, lower panel), while the amount of total p53 mRNA remains unaffected (Fig. 2g, upper panel; see Fig. 8 for the polysome sucrose gradient profiles).

Taken together, these results demonstrate that mTOR-mediated p53 translation is a major regulator of its induction in PICS. The results presented in Examples 6-8 demonstrate that inactivation of mTOR, whether genetically by knockout, or functionally by means of a specific inhibitor, reduces the cellular level of p53, a major mediator of cell longevity and senescence.

Example 9. In vivo Inhibition of mTOR.

Importantly, we also confirmed the relevance of our observations in vivo. To study the effect of pharmacological inhibition of mTOR in this setting, we used RADOOl, a well- known analogue of Rapamycin that has been previously tested in several pre-clinical mouse models for prostate cancer^13"15. In these animals administration of the drug was initiated when the Pterf^0''^' mice were 4 weeks old, prior to tumour onset (for experimental scheme see Fig. 2h, top panel). Surprisingly, when we scored for the presence of β-Gal positive cells in Pterf^0'1' prostates of mice treated with RADOOl we observed a marked decrease in the total number of β-Gal positive cells in almost all glands of animals treated with RADOOl as compared with control (Fig. 2h bottom, upper frames). Similarly, p53 levels were significantly diminished by RAIDOOl treatment, as determined by immunofluorescence (Fig.2h bottom, middle panels).

Thus, to summarize the results in Examples 6-9, die results demonstrate that mTOR is essential for p53-induction and senescence in PICS, for steady-state translation of p53 and that mTORCl inhibitors including Rapamycin and analogs thereof effectively blunt these two functions both in vitro and in vivo.

Example 10. mTOR Effects under Conditions of DNA Damage and Repair.

We also sought to test if this novel role of mTOR can be observed with other stress signals. DNA-damage represents a well-defined stimulus that leads to p53-induction, which in contrast to oncogenic stress or PICS does not induce pl9^Λrf (see reference¹⁷), yet is thought to involve stabilization of p53 through its phosphorylation on serine IS (see¹⁸).

DNA damage was induced in primary wild type MEFs by irradiation with UV light as described in the Experimental Procedures. Rapamycin strongly reduced p53-levels as judged by western blotting (Fig.9a) and senescence as assessed by β galactosidase activity (Fig. 9b) after UV-irradiation, leading also to reduction of p21 (Fig. 9a). To test this effect in a primary human fibroblast cell line we subjected WI-38 cells to the same procedure. It was found that UV irradiation sharply enhanced p53 expression, and that this UV-mediated induction was strongly inhibited by Rapamycin (Fig.9c). To confirm the mTOR- dependence of this response genetically we irradiated mTOR^"'^' MEFs and tested them for p53-induction. While WT MEFs showed a robust and Rapamycin-sensitive p53-activation after UV treatment p53-induction in the mTOR null MEFs was low (similar to that of Rapamycin-treated WT MEFs) and only weakly Rapamycin-sensitive (Fig. 9d; see Table 4), perhaps suggesting the presence of vestigial mTOR in the null MEFs. Notably, p53 transcription was affected neither by UV treatment nor mTOR-status (Fig. 9e) and mTOR- deficient cells were still responding normally to the DNA-damage insult as measured by γ- H2AX phosphorylation (Fig. 9f) indicating that mTOR is essential for eliciting a strong senescence response not only in PICS but also upon DNA-damage. The results in this Example clearly demonstrate that cellular damage induced by UV irradiation produces strong induction of p53 protein in both murine and human fibroblast cells, and that this induction of p53 is highly sensitive to an inhibitor of mTOR function. UV irradiation of MEFs in which mTOR is knocked out corroborate this finding.

Example 11. Role of RpL26 in mTOR-Mediated Expression of p53.

Translation of p53 has recently been shown to involve binding of the ribosomal protein L26 (RpL26, L26) to the 5'-UTR of p53, thereby regulating p53 translation¹⁹. In addition, previous work has shown that ribosomal proteins are under the translational and transcriptional control of mTOR (reviewed in²⁰). We therefore hypothesized that L26 could be a key component downstream of mTOR for mediating p53 -activation, especially in PICS.

To test this model, we first analyzed L26 levels before and after acute induction of PICS. As shown in Fig. 3a, when compared with control, in Ad-Cre infected MEFs L26 levels were sharply increased upon acute Pten-loss at 48 hours post Ad-Cre infection. Importantly, Rapamycin treatment prevented not only p53 -activation but also inhibited L26 induction, consistent with the notion that its increase is under the control of mTOR. To test the role of mTOR in L26 induction we assessed the level of L26 in WT and mTOR-null cells by Western blotting and found that the ribosomal protein was virtually absent from the latter (Fig. 3b, left panels). According to our hypothesis, this mTOR-dependence of L26- induction should be downstream of Pten-loss and hence not overruled in this setting. To test this genetically, we analyzed Pten-mTOR double-null MEFs for their L26 levels and found that mTOR-deficiency not only reversed the L26-induction seen upon Ptew-loss, but kept L26 undetectable in double-null cells (Fig. 3b, right panels). Thus, L26 levels closely correlate with p53 -induction under conditions that both trigger and abolish PICS. In addition, the mTOR inhibitor rapamycin suppresses expression of RpL26, in an apparent downstream effect of the inhibition of mTOR activity.

Example 12. Role of RpL26 in p53 Induction.

To determine if, and to what extent, p53-induction would actually depend on L26 the protein was knocked down using a siRNA approach (see Fig. 11a for experimental scheme). We found that upon acute Ptew-loss, p53-induction was reversed by down-regulation of L26, in a L26 time-dependent manner, demonstrating that L26 is indeed a key positive regulator of PICS downstream of mTOR (Fig. 3c). To eliminate the possibility of off-target effects we further confirmed the functional relevance of L26 in PICS using an irrelevant siRNA molecule (Fig. 1 Ib). We also confirmed the ability of L26 to mediate mTOR signaling in PICS by testing whether L26 could block the senescence induced by Pten-loss. As siRNA was seen to efficiently knock-down Pten and L26, we used a combination of siRNAs directed against both mRNAs in Pten heterozygous MEFs (Fig. 3d). This had the effect to completely blunt the senescence induced by Pten loss, in stark contrast with the levels of senescence induced by the Pten siRNA alone as detected by β-galactosidase activity (Fig. 3d, left panel and center panel for quantification). Importantly, mTOR activity was not compromised by the knock-down of L26 since the phosphorylation of two major mTOR downstream targets, S6 and 4EBP 1 remain unaffected (Fig. 3d, right panel, see frames for pS6 and p4EBPl). Finally, we examined in vivo whether L26 was up regulated at the protein level in PterP^{c~ '} in vivo. As shown in Fig. 1 Ic, we detected a 2-fold increase in the level of L26 in the prostates oiPten^{pc ~/~} mice. This increase was associated with a strong upregulation of p53 as detected by immunohistochemistry and strong staining by β-Gal, one of the main markers of senescence also in vivo (see Fig. 2h).

The demonstration that p53 induction in PICS has a clear dependence on mTOR function has strong clinical implications for the targeting of mTOR and the use of Rapamycin in cancer therapy. Although Rapamycin does elicit a growth inhibitory response in several settings, its ability to blunt senescence and p53 -induction in PICS could limit its application for cancer therapy and prevention.

Example 13. Role of mdm2.

We also reasoned that mdm2 activity in PICS is only partially inhibited by the induction of pl9^Arf, as p53 levels are not dramatically reduced upon genetic loss of pl9^Arf (Fig.2d, Fig.2e and Fig. 7c). This is also supported by the fact that treatment with MG132 results in a substantial increase of p53 levels in PICS (Fig. 2c compare lane 2 with lane 3).

Thus, we hypothesized that these undesired negative effects of Rapamycin could be overcome through simultaneous use of a p53 -stabilizing drug, such as Nutlin-3. Nutlins are small molecule antagonists of mdm2, able to enhance p53 stability and function²¹. As shown in Fig. 4a, the strong PICS response was restored when cells pre-treated with Rapamycin were subsequently treated with Nutlin-3 (Fig. 4a, senescence staining, compare "Rapamycin" with "Rapa. + Nutlin") demonstrating that recovery of the senescence response is possible even after it has been blunted by mTOR inhibition (Fig. 4a, right panel for quantification; see Fig. 5c for experimental scheme). This recovery of the PICS response was also accompanied by a strong p53 -induction as determined by Western blotting (Fig. 12a). Interestingly, WT MEFs treated simultaneously with Nutlin-3 and Rapamycin were maximally growth-inhibited when compared to the single administration of either drugs (Fig. 12b, upper panel). It is worth noting that the combination of the two drugs had no synergistic effect in p53^7~ MEFs (Fig. 12b, lower panel).

Example 14. Modulation of the PI3K Pathway.

However, while this may be a relevant mechanism for the treatment of cancer in the case of complete Pten loss, cancer patients rarely present with tumours that are null for Pten. Indeed, most patients present with tumours that show mono-allelic loss of Pten¹⁶. Given this fact, we thought to impose a super-activation of the PI3K pathway in Pten^+I~ MEFs. Pten^{+ '} MEFs treated with 20% fetal calf serum (FCS) showed a 2-fold increase in senescence staining when compared with WT (Fig. 4b, HET). These MEFs were also found to undergo a strong growth arrest in culture (Fig. 12c), while wild type control MEFs remained unaffected by the enhanced growth factor stimulation. Thus, super-activation of the PI3K pathway through increased growth factor stimulation was able to mimic the complete loss of Pten in Pten heterozygous MEFs, and drive senescence in vitro. On the contrary, serum starvation ofPten^+l~ MEFs reduced the number of senescent cells to a level that was lower than background (see Fig. 12d for growth curve and quantification of senescence).

Example 15. Pharmacological Inhibition of Pten.

While enhanced stimulation of signaling pathways is one way to mediate increased Akt stimulation and subsequent mTOR super-activation, we also considered that pharmacological inactivation of Pten itself may phenocopy the senescence response observed with acute genetic inactivation of Pten. For this purpose, we took advantage of the recently characterized Pten inhibitor VO-OHpic²². VO-OHpic is a vanadyl complex of hydroxypicolinic acid which was recently found to be a highly potent and specific inhibitor of Pten, increasing cellular PtdIns(3,4,5)P3 levels, phosphorylation of Akt, and glucose uptake in adipocytes²².

Treatment of both wild type and Pten ^+/~ MEFs with either 25OnM or 50OnM VO- OHpic showed a clear, dose-dependent induction of senescence compared to a vehicle control in Pten^{+ '} cells, while there was no induction of senescence in the WT control MEFs (Fig. 4c). Pten inhibition was confirmed by western analysis showing that both phospho-Akt and phospho-S6 levels were increased in the Pten " ^' treated cells (Fig. 4c, right panel). Pten hypomorpic MEFs (Pten^hy/~) were also treated with VO-OHpic. While these Pten ^y'^~ had a higher background level of senescence, VO-OHpic induced a significant increase in the senescence of these cells (Fig. 12e).

Interestingly, both in the case of growth factor stimulation and Pten inhibitor administration, the proliferation of the wild-type cells was not altered.

To summarize the results broadly presented in the above Examples, we have shown how a linear pathway leads from mTOR activation to senescence induction and how two anti-pro liferative therapeutic approaches, Rapamycin and Nutlin-3, affect this pathway both alone and in combination (see the schematic diagram in Fig. 4d). Furthermore, we have demonstrated how, in the condition of Pten heterozygosity, either a super-activation of the PI3K pathway or a further inhibition of the tumour suppressor Pten can drive senescence. Our cell based system for PICS induction thus affords us a formidable assay to test efficiencies and negative effects of these and similar drugs, especially when comparing their application with the genetic ablation of their respective targets (e.g. mTOR- or pl9 -loss).

Example 16. Role of mTOR in modulating p53 Expression and Senescence in Irradiated Cells.

The experiments shown in Figure 14 demonstrate that mTOR inhibition leads to a profound down-regulation of the tumor suppressor p53 and to the attenuation of apoptosis and senescence in irradiated primary mouse and human dermal fibroblasts (Fig. 14A-E). mTOR is a well known master regulator of protein translation and its activity increases after irradiation. As a consequence the effect of mTOR inhibition in opposing p53 up-regulation and apoptosis depends on the inhibition of the translational control of p53 and its direct downstream target p21 (as discussed also previously). Notably these experiments were conducted using different type of irradiation (UV (Fig. 14A-D and G) and gamma- irradiation (Fig. 14 E-F)). In all cases mTOR inhibition resulted in a profound attenuation of apoptosis and senescence. mTOR inhibitors, such as rapamycin or its analogues (everolimus, tacrolimus, etc) and derivatives thereof are thus useful in prophylactic and therapeutic applications to minimize skin injury by damaging radiation. In addition, Rapamycin is a well-known immunosuppressant agent whose property can be used to prevent the accumulation of inflammatory cells in the epidermis reducing the amount of inflammatory cytokines and free radical.

Exploitation of the cellular senescence response, "pro-senescence therapy for cancer", represents a powerful means for therapeutic intervention or chemoprevention. Moreover, direct genetic assessment of cancer progression in the presence (Pte«^Δ/Δ) or absence (Pten^AIA, Trp53^^A) of PICS reveals a striking delay of prostate cancer (CaP) onset in its absence (note that p53-deficient mice retain normal prostates throughout their lives²), and demonstrates the preventive potential of the senescence response in vivo.

We have here characterized PICS as a new mechanism of cellular senescence. Firstly, we have shown that PICS occurs at extremely early time points after Pten inactivation, without requiring hyper-proliferation, and in the absence of a classic DDR. Secondly, we have shown that mTOR, a key mediator of cellular growth, paradoxically, is an essential component of PICS through its ability to control p53 translation. Finally, our findings in vitro and in vivo call for a careful design of studies involving mTOR inhibitors by taking into account the p53 status, as p53-activity forms an essential part of the aspired therapeutic response.

Furthermore, as mammalian cells are subject to many transient fluctuations in Akt activity in response to a variety of physiological stimuli, we propose that a transient and acute activation of the PI3K signalling pathway, through either pharmacological inactivation of Pten, or growth factor and nutrient stimulation, would drive senescence in a context of Pten heterozygosity, while avoiding negative effects of prolonged Akt activation in wild type cells. As well as its importance for cancer therapy, these findings are relevant for understanding the mechanisms underlying organism aging, as they demonstrate for the first time in mammalian cells that cellular senescence caused by increased nutrient uptake is mediated by super-activation of the AKT-mTOR signalling pathway.

Some diabetes drugs aim at enhancing AKT-mTOR signalling for glucose utilization and uptake. Such anti-diabetic drugs represent a class of molecules for 'pro-senescence' therapy in Pten heterozygous tumors and cells, which is relevant since Pten heterozygosity is commonly observed in human cancers.

Table 1. Relative Protein Level

Table 2. Relative p53 Protein Level

Table 3. Relative p53 Protein Level

Table 4. Relative p53 levels (in %)

38A Docket No.402-05-PCT References

1. Braig, M. et al. Oncogene -induced senescence as an initial barrier in lymphoma development. Nature 436, 660-5 (2005).

2. Chen, Z. et al. Crucial role of p53 -dependent cellular senescence in suppression of Pten-deficient tumorigenesis. Nature 436, 725-30 (2005).

3. Collado, M. et al. Tumor biology: senescence in premalignant tumors. Nature 436, 642 (2005).

4. Michaloglou, C. et al. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 436, 720-4 (2005).

5. Kim, J. S., Lee, C, Bonifant, C. L., Ressom, H. & Waldman, T. Activation of p53- dependent growth suppression in human cells by mutations in PTEN or PIK3CA. MoI Cell Biol 27, 662-77 (2007).

6. d'Adda di Fagagna, F. et al. A DNA damage checkpoint response in telomere- initiated senescence. Nature 426, 194-8 (2003).

7. Di Micco, R. et al. Oncogene-induced senescence is a DNA damage response triggered by DNA hyper-replication. Nature 444, 638-42 (2006).

8. Bartkova, J. et al. Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature 444, 633-7 (2006).

9. Mallette, F. A., Gaumont-Leclerc, M. F. & Ferbeyre, G. The DNA damage signaling pathway is a critical mediator of oncogene-induced senescence. Genes Dev 21, 43-8 (2007).

10. Mooi, W. J. & Peeper, D. S. Oncogene-induced cell senescence-halting on the road to cancer. N Engl J Med 355, 1037-46 (2006).

11. Sabatini, D. M. mTOR and cancer: insights into a complex relationship. Nat Rev Cancer 6, 729-34 (2006).

12. Thomas, G. V. mTOR and cancer: reason for dancing at the crossroads? Curr Opin Genet Dev 16, 78-84 (2006).

13. Majumder, P. K. et al. mTOR inhibition reverses Akt-dependent prostate intraepithelial neoplasia through regulation of apoptotic and HIF-I -dependent pathways. Nat Med 10, 594-601 (2004).

14. Neshat, M. S. et al. Enhanced sensitivity of PTEN-deficient tumours to inhibition of FRAP/mTOR. Proc Natl Acad Sci U S A 98, 10314-9 (2001).

15. Podsypanina, K. et al. An inhibitor of mTOR reduces neoplasia and normalizes p70/S6 kinase activity in Pten+/- mice. Proc Natl Acad Sci U S A 98, 10320-5 (2001).

16. Trotman, L. C. et al. Pten dose dictates cancer progression in the prostate. PLoS Biol 1, E59 (2003).

17. Sherr, C. J. Divorcing ARF and p53: an unsettled case. Nat Rev Cancer 6, 663-73 (2006).

18. Bode, A. M. & Dong, Z. Post-translational modification of p53 in tumorigenesis. Nat Rev Cancer 4, 793-805 (2004).

19. Takagi, M., Absalon, M. J., McLure, K. G. & Kastan, M. B. Regulation of p53 translation and induction after DNA damage by ribosomal protein L26 and nucleolin. Cell 123, 49-63 (2005).

20. Wullschleger, S., Loewith, R. & Hall, M. N. TOR signaling in growth and metabolism. Cell 124, 471-84 (2006). 21. Vassilev, L. T. et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 303, 844-8 (2004).

22. Rosivatz, E. et al. A small molecule inhibitor for phosphatase and tensin homologue deleted on chromosome 10 (PTEN). ACS Chem Biol 1, 780-90 (2006).

23. Campisi, J. Senescent cells, tumour suppression, and organismal aging: good citizens, bad neighbors. Cell 120, 513-22 (2005).

24. Campisi, J. Suppressing cancer: the importance of being senescent. Science 309, 886-7 (2005).

25. Gangloff, Y. G. et al. Disruption of the mouse mTOR gene leads to early postimplantation lethality and prohibits embryonic stem cell development. MoI Cell Biol 24, 9508-16 (2004).

26. Kamijo, T., Bodner, S., van de Kamp, E., Randle, D. H. & Sherr, C. J. Tumor spectrum in ARF-deficient mice. Cancer Res 59, 2217-22 (1999).

27. Trotman, L. C. et al. Identification of a tumour suppressor network opposing nuclear Akt function. Nature 441, 523-7 (2006).

28. Wang, X. & Seed, B. A PCR primer bank for quantitative gene expression analysis. Nucleic Acids Res 31, el54 (2003).

29. Arava, Y. Isolation of polysomal RNA for microarray analysis. Methods MoI Biol 224, 79-87 (2003).

Claims

We claim:

1. A method of minimizing or inhibiting senescence of a mammalian epithelial cell due to exposure to damaging radiation, the method comprising introducing at least one inhibitor of mTOR into the cell.

2. The method described in claim 1 wherein the epithelial cell is a fibroblast.

3. The method described in claim 1 wherein the epithelial cell is a skin cell.

4. The method described in claim 3 wherein the skin cell is a fibroblast of the hypodermal region

5. The method described in claim 3 wherein the skin cell is a keratinocyte.

6. A method of minimizing or inhibiting aging of the skin of a mammal due to exposure of the skin to damaging radiation, the method comprising contacting the skin with a topical pharmaceutical composition comprising a therapeutically effective amount of at least one inhibitor of mTOR.

7. The method described in claim 6 wherein aging comprises senescence of a keratinocyte or a fibroblast cell of the skin.

8. A method of preventing or reducing damage to the skin of a mammal due to exposure of the skin to damaging radiation, the method comprising contacting the skin with a topical composition comprising a therapeutically effective amount of at least one inhibitor of mTOR and a pharmaceutically acceptable carrier.

9. The method described in claim 8 wherein damage comprises accelerating senescence of a cell in the skin.

10. The method described in any one of claims 1-9 wherein the radiation comprises at least one of UV radiation, ionizing radiation, x-radiation, gamma-radiation, and radiation comprising a subatomic particle.

11. The method described in any one of claims 1-9 wherein the mammal is a human.

12. The method described in any one of claims 1-9 wherein an inhibitor of mTOR is rapamycin, a biologically active derivative of rapamycin, a biologically active analog of rapamycin, temsirolimus, everolimus, ABT-578, or AP23573.

13. A method of screening a candidate compound, comprising a) providing an engineered cell lacking a functional Pten gene; b) contacting the cell with the candidate compound; and c) determining whether the compound alters the senescence status of the cell in comparison with a second preparation of the cell not contacted with the candidate compound.

14. The method described in claim 13 wherein the engineered cell comprises a conditional knockout gene for Pten.

15. The method described in claim 14 wherein the engineered cell is described as Pten^lx/lx.

16. The method described in claim 15 wherein the conditional knockout gene for Pten is activated by introducing a recombinase gene into the cell.

17. The method described in claim 13 wherein an altered senescence status comprises altered β-galactosidase activity in the cell when the candidate compound is present compared to absence of the candidate compound.

18. The method described in claim 13 wherein an altered senescence status comprises alteration of translational expression of p53 protein when the candidate compound is present compared to absence of the candidate compound.