WO2009046118A1 - Locus de prédisposition au cancer situé sur le chromosome 6p22 et le chromosome 20 pour une utilisation dans des procédés diagnostiques et thérapeutiques - Google Patents

Locus de prédisposition au cancer situé sur le chromosome 6p22 et le chromosome 20 pour une utilisation dans des procédés diagnostiques et thérapeutiques Download PDF

Info

Publication number
WO2009046118A1
WO2009046118A1 PCT/US2008/078465 US2008078465W WO2009046118A1 WO 2009046118 A1 WO2009046118 A1 WO 2009046118A1 US 2008078465 W US2008078465 W US 2008078465W WO 2009046118 A1 WO2009046118 A1 WO 2009046118A1
Authority
WO
WIPO (PCT)
Prior art keywords
neuroblastoma
nucleic acid
single nucleotide
nucleotide polymorphism
chromosome
Prior art date
Application number
PCT/US2008/078465
Other languages
English (en)
Inventor
John M. Maris
Hakon Hakonarson
Original Assignee
The Children's Hospital Of Philadelphia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Children's Hospital Of Philadelphia filed Critical The Children's Hospital Of Philadelphia
Publication of WO2009046118A1 publication Critical patent/WO2009046118A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers

Definitions

  • This invention relates to the fields of oncology and genetic testing. More specifically, the invention provides compositions and methods for the diagnosis and treatment of cancer, including, without limitation, neuroblastoma.
  • somatically acquired events that correlate with tumor phenotype little is known about the genetic events that predispose to neuroblastoma tumorigenesis. We hypothesized that the majority of neuroblastomas arise from relatively common DNA variations that predispose to an increased risk for neuroblasts malignant transformation.
  • compositions and methods are provided for diagnosis and treatment of pediatric cancers, particularly neuroblastomas.
  • An exemplary method entails detecting the presence of a single nucleotide polymorphism on chromosome 6p22 or chromosome 20pl 1 in a target polynucleotide wherein if the single nucleotide polymorphism is present, the patient has an increased risk for developing neuroblastoma.
  • Exemplary single nucleotide polymorphisms associated with the development of cancer include, without limitation, a G at rs6939340, a C at rs4712653, an A at rs9295536, a C at rs3790171 or a G at rs7272481. Certain of the aforementioned polymorphisms are associated with the development of neuroblastomas which exhibit increased propensity for metastasis with MCYN oncogene amplification.
  • the methods of the invention can include alternative means for detecting the disclosed polymorphisms.
  • methods of detection can further comprises processes such as specific hybridization, measurement of allele size, restriction fragment length polymorphism analysis, allele-specific hybridization analysis, single base primer extension reaction, and sequencing of an amplified polynucleotide.
  • the polymorphism is on chromosome 6p22 and resides with in the FLJ22536 gene and/or the FLJ44180 gene. Alternatively, the polymorphism is present on chromosome 20 within the SLC24A3 gene.
  • nucleic acid molecules useful for amplifying the nucleic acids encoding the single nucleotide polymorphisms disclosed herein are provided. Also provided are solid supports comprising suitable nucleic acid targets to facilitate detection of such SNPS in patient samples. A suitable solid support for this process includes a microarray.
  • the invention also encompasses screening methods to identify agents which modulate the aberrant cellular proliferation and morphology observed in the SNP containing cancer cells described herein.
  • An exemplary method entails providing cells expressing an FLJ22536 gene or SLC24A3 gene containing the SNPs described herein (step a); providing cells which express these gene(s) which lack the cognate polymorphisms (step b); contacting each cell type with a test agent and analyzing whether said agent alters the proliferative rate or morphology of cells of step a) relative to those of step b), thereby identifying agents which modulate cell proliferation and morphology.
  • FIG. 1 Pairwise linkage disequilibrium diagram of the 6p22 locus and association results for regional SNPs.
  • a 290.98 Kb region from rs 12207699 to rs9393266 is shown, with pairwise LD calculated from the Stage 1 case and control data set combined (LD measured as D 1 as indicated by scale).
  • Individual SNP log transformed P- values are plotted in relation to the LD diagram.
  • the three SNPs showing a genome-wide significant association signal (red horizontal line) are annotated and map within a 94.2 Kb LD block, defined by SNPs rs 196051 and rs 10498705 (dashed vertical lines). These SNPs are also annotated to their relative physical map positions (NCBI Build 36), with predicted genes in the region shown (exons/transcribed sequences indicated by dashed vertical lines).
  • Neuroblastoma is a malignancy of the developing sympathetic nervous system that most commonly affects young children and is often lethal. The etiology of this embryonal cancer is not known. To address this issue, we performed a two-stage genome- wide association study. In Stage 1, we genotyped 1032 neuroblastoma patients and 2043 controls of European descent using the Illumina HumanHap550
  • a or “an” entity refers to one or more of that entity; for example, "a cDNA” refers to one or more cDNA or at least one cDNA.
  • a cDNA refers to one or more cDNA or at least one cDNA.
  • the terms “a” or “an,” “one or more” and “at least one” can be used interchangeably herein.
  • the terms “comprising,” “including,” and “having” can be used interchangeably.
  • a compound “selected from the group consisting of refers to one or more of the compounds in the list that follows, including mixtures (i.e. combinations) of two or more of the compounds.
  • an isolated, or biologically pure molecule is a compound that has been removed from its natural milieu.
  • isolated and “biologically pure” do not necessarily reflect the extent to which the compound has been purified.
  • An isolated compound of the present invention can be obtained from its natural source, can be produced using laboratory synthetic techniques or can be produced by any such chemical synthetic route.
  • Neuroblastoma-associated SNP or specific marker is a SNP or marker which is associated with an increased or decreased risk of developing neuroblastoma not found normal patients who do not have this disease.
  • markers may include but are not limited to nucleic acids, proteins encoded thereby, or other small molecules.
  • SNP single nucleotide polymorphism
  • genetic alteration refers to a change from the wild- type or reference sequence of one or more nucleic acid molecules. Genetic alterations include without limitation, base pair substitutions, additions and deletions of at least one nucleotide from a nucleic acid molecule of known sequence.
  • solid matrix refers to any format, such as beads, microparticles, a microarray, the surface of a microtitration well or a test tube, a dipstick or a filter.
  • the material of the matrix may be polystyrene, cellulose, latex, nitrocellulose, nylon, polyacrylamide, dextran or agarose.
  • the phrase "consisting essentially of when referring to a particular nucleotide or amino acid means a sequence having the properties of a given SEQ ID NO:. For example, when used in reference to an amino acid sequence, the phrase includes the sequence per se and molecular modifications that would not affect the functional and novel characteristics of the sequence.
  • Target nucleic acid refers to a previously defined region of a nucleic acid present in a complex nucleic acid mixture wherein the defined wild-type region contains at least one known nucleotide variation which may or may not be associated with neuroblastoma.
  • the nucleic acid molecule may be isolated from a natural source by cDNA cloning or subtractive hybridization or synthesized manually. The nucleic acid molecule may be synthesized manually by the triester synthetic method or by using an automated DNA synthesizer.
  • the term "isolated nucleic acid” is sometimes employed. This term, when applied to DNA, refers to a DNA molecule that is separated from sequences with which it is immediately contiguous (in the 5' and 3' directions) in the naturally occurring genome of the organism from which it was derived.
  • the "isolated nucleic acid” may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryote or eukaryote.
  • An "isolated nucleic acid molecule” may also comprise a cDNA molecule.
  • An isolated nucleic acid molecule inserted into a vector is also sometimes referred to herein as a recombinant nucleic acid molecule.
  • isolated nucleic acid primarily refers to an RNA molecule encoded by an isolated DNA molecule as defined above.
  • the term may refer to an RNA molecule that has been sufficiently separated from RNA molecules with which it would be associated in its natural state (i.e., in cells or tissues), such that it exists in a “substantially pure” form.
  • enriched in reference to nucleic acid it is meant that the specific DNA or RNA sequence constitutes a significantly higher fraction (2-5 fold) of the total DNA or RNA present in the cells or solution of interest than in normal cells or in the cells from which the sequence was taken.
  • nucleotide sequence be in purified form.
  • purified in reference to nucleic acid does not require absolute purity (such as a homogeneous preparation); instead, it represents an indication that the sequence is relatively purer than in the natural environment (compared to the natural level, this level should be at least 2-5 fold greater, e.g., in terms of mg/ml).
  • Individual clones isolated from a cDNA library may be purified to electrophoretic homogeneity.
  • the claimed DNA molecules obtained from these clones can be obtained directly from total DNA or from total RNA.
  • the cDNA clones are not naturally occurring, but rather are preferably obtained via manipulation of a partially purified naturally occurring substance (messenger RNA).
  • a cDNA library from mRNA involves the creation of a synthetic substance (cDNA) and pure individual cDNA clones can be isolated from the synthetic library by clonal selection of the cells carrying the cDNA library.
  • cDNA synthetic substance
  • the process which includes the construction of a cDN A library from mRNA and isolation of distinct cDNA clones yields an approximately 10 "6 -fold purification of the native message.
  • purification of at least one order of magnitude, preferably two or three orders, and more preferably four or five orders of magnitude is expressly contemplated.
  • substantially pure refers to a preparation comprising at least 50-60% by weight the compound of interest (e.g., nucleic acid, oligonucleotide, etc.). More preferably, the preparation comprises at least 75% by weight, and most preferably 90-99% by weight, the compound of interest. Purity is measured by methods appropriate for the compound of interest.
  • adenine is complementary to thymine as they can form two hydrogen bonds.
  • guanine and cytosine are complementary since they can form three hydrogen bonds.
  • a nucleic acid sequence contains the following sequence of bases, thymine, adenine, guanine and cytosine
  • a "complement" of this nucleic acid molecule would be a molecule containing adenine in the place of thymine, thymine in the place of adenine, cytosine in the place of guanine, and guanine in the place of cytosine.
  • the complement can contain a nucleic acid sequence that forms optimal interactions with the parent nucleic acid molecule, such a complement can bind with high affinity to its parent molecule.
  • the term “specifically hybridizing” refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed “substantially complementary”).
  • the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non- complementary sequence.
  • specific hybridization can refer to a sequence which hybridizes to any neuroblastoma specific marker gene or nucleic acid, but does not hybridize to other nucleotides.
  • polynucleotide which "specifically hybridizes" may hybridize only to a neurospecific specific marker, such a neuroblastoma-specific marker shown in the Tables contained herein. Appropriate conditions enabling specific hybridization of single stranded nucleic acid molecules of varying complementarity are well known in the art.
  • T m 81.5 0 C + 16.6Log [Na+] + 0.41(% G+C) - 0.63 (% formamide) - 600/#b ⁇ in duplex
  • the stringency of the hybridization and wash depend primarily on the salt concentration and temperature of the solutions. In general, to maximize the rate of annealing of the probe with its target, the hybridization is usually carried out at salt and temperature conditions that are 20-25 0 C below the calculated T m of the hybrid. Wash conditions should be as stringent as possible for the degree of identity of the probe for the target. In general, wash conditions are selected to be approximately 12- 20 0 C below the T m of the hybrid.
  • a moderate stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 ⁇ g/ml denatured salmon sperm DNA at 42°C, and washed in 2X SSC and 0.5% SDS at 55 0 C for 15 minutes.
  • a high stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 ⁇ g/ml denatured salmon sperm DNA at 42 0 C, and washed in IX SSC and 0.5% SDS at 65 0 C for 15 minutes.
  • a very high stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 ⁇ g/ml denatured salmon sperm DNA at 42°C, and washed in 0.1X SSC and 0.5% SDS at 65 0 C for 15 minutes.
  • oligonucleotide is defined as a nucleic acid molecule comprised of two or more ribo- or deoxyribonucleotides, preferably more than three. The exact size of the oligonucleotide will depend on various factors and on the particular application and use of the oligonucleotide. Oligonucleotides, which include probes and primers, can be any length from 3 nucleotides to the full length of the nucleic acid molecule, and explicitly include every possible number of contiguous nucleic acids from 3 through the full length of the polynucleotide. Preferably, oligonucleotides are at least about 10 nucleotides in length, more preferably at least 15 nucleotides in length, more preferably at least about 20 nucleotides in length.
  • probe refers to an oligonucleotide, polynucleotide or nucleic acid, either RNA or DNA, whether occurring naturally as in a purified restriction enzyme digest or produced synthetically, which is capable of annealing with or specifically hybridizing to a nucleic acid with sequences complementary to the probe.
  • a probe may be either single-stranded or double-stranded. The exact length of the probe will depend upon many factors, including temperature, source of probe and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide probe typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.
  • the probes herein are selected to be complementary to different strands of a particular target nucleic acid sequence. This means that the probes must be sufficiently complementary so as to be able to "specifically hybridize” or anneal with their respective target strands under a set of pre-determined conditions. Therefore, the probe sequence need not reflect the exact complementary sequence of the target. For example, a non-complementary nucleotide fragment may be attached to the 5' or 3' end of the probe, with the remainder of the probe sequence being complementary to the target strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the probe, provided that the probe sequence has sufficient complementarity with the sequence of the target nucleic acid to anneal therewith specifically.
  • primer refers to an oligonucleotide, either RNA or DNA, either single-stranded or double-stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically which, when placed in the proper environment, is able to functionally act as an initiator of template-dependent nucleic acid synthesis.
  • suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as a suitable temperature and pH
  • the primer may be extended at its 3' terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product.
  • the primer may vary in length depending on the particular conditions and requirement of the application.
  • the oligonucleotide primer is typically 15-25 or more nucleotides in length.
  • the primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, that is, to be able anneal with the desired template strand in a manner sufficient to provide the 3 1 hydroxyl moiety of the primer in appropriate juxtaposition for use in the initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represent an exact complement of the desired template.
  • a non-complementary nucleotide sequence may be attached to the 5' end of an otherwise complementary primer.
  • non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template-primer complex for the synthesis of the extension product.
  • PCR Polymerase chain reaction
  • vector relates to a single or double stranded circular nucleic acid molecule that can be infected, transfected or transformed into cells and replicate independently or within the host cell genome.
  • a circular double stranded nucleic acid molecule can be cut and thereby linearized upon treatment with restriction enzymes.
  • nucleotide sequences that are targeted by restriction enzymes are readily available to those skilled in the art, and include any replicon, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (either DNA or RNA) may be attached so as to bring about the replication of the attached sequence or element.
  • a nucleic acid molecule of the invention can be inserted into a vector by cutting the vector with restriction enzymes and ligating the two pieces together.
  • transformation refers to methods of inserting a nucleic acid and/or expression construct into a cell or host organism. These methods involve a variety of techniques, such as treating the cells with high concentrations of salt, an electric field, or detergent, to render the host cell outer membrane or wall permeable to nucleic acid molecules of interest, microinjection, PEG-fusion, and the like.
  • promoter element describes a nucleotide sequence that is incorporated into a vector that, once inside an appropriate cell, can facilitate transcription factor and/or polymerase binding and subsequent transcription of portions of the vector DNA into mRNA.
  • the promoter element of the present invention precedes the 5' end of the neuroblastoma specific marker nucleic acid molecule such that the latter is transcribed into mRNA. Host cell machinery then translates mRNA into a polypeptide.
  • nucleic acid vector can contain nucleic acid elements other than the promoter element and the neuroblastoma specific marker gene nucleic acid molecule. These other nucleic acid elements include, but are not limited to, origins of replication, ribosomal binding sites, nucleic acid sequences encoding drug resistance enzymes or amino acid metabolic enzymes, and nucleic acid sequences encoding secretion signals, localization signals, or signals useful for polypeptide purification.
  • a "replicon” is any genetic element, for example, a plasmid, cosmid, bacmid, plastid, phage or virus, that is capable of replication largely under its own control. A replicon may be either RNA or DNA and may be single or double stranded.
  • an "expression operon” refers to a nucleic acid segment that may possess transcriptional and translational control sequences, such as promoters, enhancers, translational start signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate the expression of a polypeptide coding sequence in a host cell or organism.
  • transcriptional and translational control sequences such as promoters, enhancers, translational start signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate the expression of a polypeptide coding sequence in a host cell or organism.
  • reporter As used herein, the terms “reporter,” “reporter system”, “reporter gene,” or “reporter gene product” shall mean an operative genetic system in which a nucleic acid comprises a gene that encodes a product that when expressed produces a reporter signal that is a readily measurable, e.g., by biological assay, immunoassay, radio immunoassay, or by colorimetric, fluorogenic, chemiluminescent or other methods.
  • the nucleic acid may be either RNA or DNA, linear or circular, single or double stranded, antisense or sense polarity, and is operatively linked to the necessary control elements for the expression of the reporter gene product.
  • the required control elements will vary according to the nature of the reporter system and whether the reporter gene is in the form of DNA or RNA, but may include, but not be limited to, such elements as promoters, enhancers, translational control sequences, poly A addition signals, transcriptional termination signals and the like.
  • the introduced nucleic acid may or may not be integrated (covalently linked) into nucleic acid of the recipient cell or organism.
  • the introduced nucleic acid may be maintained as an episomal element or independent replicon such as a plasmid.
  • the introduced nucleic acid may become integrated into the nucleic acid of the recipient cell or organism and be stably maintained in that cell or organism and further passed on or inherited to progeny cells or organisms of the recipient cell or organism.
  • the introduced nucleic acid may exist in the recipient cell or host organism only transiently.
  • selectable marker gene refers to a gene that when expressed confers a selectable phenotype, such as antibiotic resistance, on a transformed cell.
  • operably linked means that the regulatory sequences necessary for expression of the coding sequence are placed in the DNA molecule in the appropriate positions relative to the coding sequence so as to effect expression of the coding sequence. This same definition is sometimes applied to the arrangement of transcription units and other transcription control elements (e.g. enhancers) in an expression vector.
  • recombinant organism or “transgenic organism” refer to organisms which have a new combination of genes or nucleic acid molecules. A new combination of genes or nucleic acid molecules can be introduced into an organism using a wide array of nucleic acid manipulation techniques available to those skilled in the art.
  • organism relates to any living being comprised of a least one cell. An organism can be as simple as one eukaryotic cell or as complex as a mammal. Therefore, the phrase "a recombinant organism” encompasses a recombinant cell, as well as eukaryotic and prokaryotic organism.
  • isolated protein or “isolated and purified protein” is sometimes used herein. This term refers primarily to a protein produced by expression of an isolated nucleic acid molecule of the invention. Alternatively, this term may refer to a protein that has been sufficiently separated from other proteins with which it would naturally be associated, so as to exist in “substantially pure” form. "Isolated” is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification, addition of stabilizers, or compounding into, for example, immunogenic preparations or pharmaceutically acceptable preparations.
  • a “specific binding pair” comprises a specific binding member (sbm) and a binding partner (bp) which have a particular specificity for each other and which in normal conditions bind to each other in preference to other molecules.
  • specific binding pairs are antigens and antibodies, ligands and receptors and complementary nucleotide sequences. The skilled person is aware of many other examples. Further, the term “specific binding pair” is also applicable where either or both of the specific binding member and the binding partner comprise a part of a large molecule. In embodiments in which the specific binding pair comprises nucleic acid sequences, they will be of a length to hybridize to each other under conditions of the assay, preferably greater than 10 nucleotides long, more preferably greater than 15 or 20 nucleotides long.
  • Sample or “patient sample” or “biological sample” generally refers to a sample which may be tested for a particular molecule, preferably a neuroblastoma specific marker molecule, such as a marker shown in the tables provided below. Samples may include but are not limited to cells, body fluids, including blood, serum, plasma, urine, saliva, tears, pleural fluid and the like.
  • Neuroblastoma-related -SNP containing nucleic acids including but not limited to those listed in the Tables provided below may be used for a variety of purposes in accordance with the present inventioa Neuroblastoma-associated SNP containing DNA, RNA, or fragments thereof may be used as probes to detect the presence of and/or expression of neuroblastoma specific markers.
  • Methods in which neuroblastoma specific marker nucleic acids may be utilized as probes for such assays include, but are not limited to: (1) in situ hybridization; (2) Southern hybridization (3) northern hybridization; and (4) assorted amplification reactions such as polymerase chain reactions (PCR).
  • assays for detecting neuroblastoma-associated SNPs may be conducted on any type of biological sample, including but not limited to body fluids (including blood, urine, serum, gastric lavage), any type of cell (such as brain cells, white blood cells, mononuclear cells) or body tissue.
  • neuroblastoma-associated SNP containing nucleic acids, vectors expressing the same, neuroblastoma SNP containing marker proteins and anti-neuroblastoma specific marker antibodies of the invention can be used to detect neuroblastoma associated SNPs in body tissue, cells, or fluid, and alter neuroblastoma SNP containing marker protein expression for purposes of assessing the genetic and protein interactions involved in the development of neuroblastoma.
  • the neuroblastoma-associated SNP containing nucleic acid in the sample will initially be amplified, e.g. using PCR, to increase the amount of the templates as compared to other sequences present in the sample. This allows the target sequences to be detected with a high degree of sensitivity if they are present in the sample. This initial step may be avoided by using highly sensitive array techniques that are becoming increasingly important in the art. Alternatively, new detection technologies can overcome this limitation and enable analysis of small samples containing as little as l ⁇ g of total RNA.
  • RLS Resonance Light Scattering
  • PWG planar wave guide technology
  • kits which may contain a neuroblastoma-associated SNP specific marker polynucleotide or one or more such markers immobilized on a Gene Chip, an oligonucleotide, a polypeptide, a peptide, an antibody, a label, marker, or reporter, a pharmaceutically acceptable carrier, a physiologically acceptable carrier, instructions for use, a container, a vessel for administration, an assay substrate, or any combination thereof.
  • SNPs identified herein have been associated with the etiology of neuroblastoma, methods for identifying agents that modulate the activity of the genes and their encoded products containing such SNPS should result in the generation of efficacious therapeutic agents for the treatment of a variety of malignant diseases.
  • the predicted genes on chromosome 6, FLJ22536 and FLJ44180 contain regions which provide suitable targets for the rational design of therapeutic agents which modulate their activity. Small peptide molecules corresponding to these regions may be used to advantage in the design of therapeutic agents which effectively modulate the activity of the encoded proteins.
  • Other cancer associated single nucleotide polymorphisms have been identified on chromosome 20pl 1 and appear to be located entirely within the sodium and calcium transporter gene, SLC24A3.
  • LFJ22536 and FLJ44180 encoding nucleic acids based on conformation or key amino acid residues required for function.
  • a combinatorial chemistry approach will be used to identify molecules with greatest activity and then iterations of these molecules will be developed for further cycles of screening.
  • the polypeptides or fragments employed in drug screening assays may either be free in solution, affixed to a solid support or within a cell.
  • One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant polynucleotides expressing the polypeptide or fragment, preferably in competitive binding assays. Such cells, either in viable or fixed form, can be used for standard binding assays.
  • Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity for the encoded polypeptides and is described in detail in Geysen, PCT published application WO 84/03564, published on Sep. 13, 1984. Briefly stated, large numbers of different, small peptide test compounds, such as those described above, are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with the target polypeptide and washed. Bound polypeptide is then detected by methods well known in the art.
  • a further technique for drug screening involves the use of host eukaryotic cell lines or cells (such as described above) which have a nonfunctional or altered neuroblastoma associated gene. These host cell lines or cells are defective at the polypeptide level. The host cell lines or cells are grown in the presence of drug compound. The rate of cellular proliferation and transformation of the host cells is measured to determine if the compound is capable of regulating the proliferation and transformation of the defective cells.
  • Another approach entails the use of phage display libraries engineered to express fragment of the polypeptides encoded by FLJ22536 and FLJ44180 on the phage surface. Such libraries are then contacted with a combinatorial chemical library under conditions wherein binding affinity between the expressed peptide and the components of the chemical library may be detected.
  • US Patents 6,057,098 and 5,965,456 provide methods and apparatus for performing such assays.
  • the goal of rational drug design is to produce structural analogs of biologically active polypeptides of interest or of small molecules with which they interact (e.g., agonists, antagonists, inhibitors) in order to fashion drugs which are, for example, more active or stable forms of the polypeptide, or which, e.g., enhance or interfere with the function of a polypeptide in vivo. See, e.g., Hodgson, (1991) Bio/Technology 9:19-21.
  • the three-dimensional structure of a protein of interest or, for example, of the protein-substrate complex is solved by x-ray crystallography, by nuclear magnetic resonance, by computer modeling or most typically, by a combination of approaches.
  • anti-idiotypic antibodies As a mirror image of a mirror image, the binding site of the anti-ids would be expected to be an analog of the original molecule.
  • the anti-id could then be used to identify and isolate peptides from banks of chemically or biologically produced banks of peptides. Selected peptides would then act as the pharmacore.
  • drugs which have, e.g., improved polypeptide activity or stability or which act as inhibitors, agonists, antagonists, etc. of polypeptide activity.
  • SNP containing nucleic acid sequences described herein sufficient amounts of the encoded polypeptide may be made available to perform such analytical studies as x-ray crystallography.
  • the knowledge of the protein sequence provided herein will guide those employing computer modeling techniques in place of, or in addition to x-ray crystallography.
  • compositions useful for treatment and diagnosis of neuroblastoma may comprise, in addition to one of the above substances, a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • a pharmaceutically acceptable excipient e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
  • administration is preferably in a "prophylactically effective amount” or a “therapeutically effective amount” (as the case may be, although prophylaxis may be considered therapy), this being sufficient to show benefit to the individual.
  • a region on chromosome 6, (6p22) has been identified that is associated with the development of the childhood cancer, neuroblastoma. Accordingly, this information can be utilized in a diagnostic test to determine the likelihood that a human subject will develop neuroblastoma. In addition, the identified region provides a new target for the development of therapeutic agents having efficacy against this deadly cancer. The following materials and methods are provided to facilitate the practice of the present invention.
  • Stage 1 genotyping cases were defined as a child diagnosed with neuroblastoma or ganglioneuroblastoma and registered through the Children's Oncology Group (COG) and recruited through a protocol allowing for banking of tumor and non-tumor tissues.
  • COG Children's Oncology Group
  • AU tumor samples from these patients were histopathologically confirmed as neuroblastoma or ganglioneuroblastoma by central histopathologic review, and the majority had full annotation with clinical co-variates).
  • Eligibility criterion for genome- wide genotyping was availability of 1.5 ⁇ g of high quality DNA from a tumor-free source such as peripheral blood or uninvolved (with tumor) bone marrow mononuclear cells.
  • neuroblastoma is demographically a disease of Caucasians 15 , we limited our initial scan to this racial cohort.
  • the median age of the neuroblastoma cohort at diagnosis and sample collection was 1.49 years.
  • Control subjects were recruited from the Philadelphia region through the Children's Hospital of Philadelphia (CHOP) Health Care Network, including four primary care clinics and several group practices and outpatient practices that included well child visits. Eligibility criteria for control subjects were: 1) self-reported as Caucasian; 2) availability of 1.5 ⁇ g of high quality DNA from peripheral blood mononuclear cells; and 3) no serious underlying medical disorder including cancer.
  • the median age of the control cohort at the time of sample collection was 10.0 years.
  • Control samples were from the 1958 birth Cohort Collection, an ongoing follow-up of all persons born in Great Britain during one week in 1958, including a recent biomedical assessment during 2002-2004 at which blood samples and informed consent were obtained for creation of a genetic resource (National Child Developmental Study at the world wide web at cls.ioe.ac.uk/Cohort/Ncds/mainncds.html). All cases and controls were from the UK and subjects known to be of non-UK ethnic groups were excluded.
  • the second replication cohort of unrelated individuals with neuroblastoma were recruited from Children's Cancer Group (CCG) study 3891 6 . There was no duplication of samples in this legacy cohort of US patients with the Stage 1 cohort accrued more recently from North America. Informed consent was obtained for all participants and the Children's Hospital of Los Angeles IRB, and the IRB's of the participating institutions, approved the collection of samples for research. Control DNA samples were collected from unrelated Caucasian individuals living in Los Angeles area during 2000-2001 from buccal swabs obtained for the creation of an anonymized genetic resource.
  • DNA samples were surveyed for quality both by optical density spectrophotometry and the pico-green assay. Samples judged to be of sufficient quality for genotyping were assayed on the Illumina InfiniumTM II HumanHap550 BeadChip technology 7 ' 8 (Illumina, San Diego), at the Center for Applied Genomics at the Children's Hospital of Philadelphia. We used750ng of germline genomic DNA to genotype each sample, according to the manufacturer's guidelines. On day one, genomic DNA was amplified 1000- 1500-fold; and on day two, the amplified DNA was fragmented to ⁇ 300-600bp, precipitated and resuspended followed by hybridization onto a BeadChip.
  • Single base extension utilized a single probe sequence ⁇ 50bp long designed to hybridize immediately adjacent to the SNP query site. Following targeted hybridization to the bead array, the arrayed SNP locus-specific primers (attached to beads) were extended with a single hapten-labeled dideoxynucleotide in the SBE reaction. The haptens were subsequently detected by a multi-layer immunohistochemical sandwich assay.
  • the Illumina BeadArray Reader scanned each BeadChip at two wavelengths and created an image file. As BeadChip images were collected, intensity values were determined for all instances of each bead type, and data files were created that summarized intensity values for each bead type.
  • Stage 2 genotyping All Stage 2 cases and controls from the UK were genotyped at rs6939340 and rs9295536, while the CCG/Los Angeles cases and controls were genotyped at rs6939340 and rs412673, by real-time quantitative PCR (Taqman; Applied Biosystems). Assays were performed according to the manufacturers instructions using a ABI PRISM 7900HT system. Primes were supplied by Biomers.net and probes by Applied Biosystems and were designed using Primer Express software (Applied Biosystems; sequences available upon request). Assays were performed in 384-well format and each plate contained negative control wells. Data analysis was performed using Sequence Detection System software version 2.1 software (Applied Biosystems) and by visual inspection.
  • GWA genome-wide association
  • DNA samples from 2,236 disease-free Caucasian subjects recruited within the Children's Hospital of Philadelphia (CHOP) Health Care Network were used as controls. All samples were genotyped using the Illumina HumanHap550 BeadChip 6 ' 7 , and data were subsequently filtered based on pre-specified quality control measures where individual SNPs were excluded from further analysis if they showed: 1) deviation from Hardy Weinberg equilibrium with PO.0001; 2) individual SNP genotype yield ⁇ 98%; or 3) minor allele frequency (MAF) ⁇ 5%. This resulted in 464,934 SNPs being utilized in the subsequent analyses. In addition, 33 samples had genotype yields ⁇ 90% and were removed (23 cases and 10 controls).
  • the chromosome 6 risk alleles discovered in Stage 1 were also significantly over-represented in both sets of neuroblastoma cases compared to their controls, showing a combined OR for rs6939340 of 1.42 (95% CI 1.29-1.56).
  • the chromosome 6 signal falls within a 94.2 Kb LD block containing the predicted genes FLJ22536 and FLJ44180 ( Figure 2, Table 5).
  • FLJ22536 has multiple predicted isoforms, and is also predicted to contain an epidermal growth factor-like domain.
  • the FLJ44180 gene is apparently novel as there are no sequence similarities in human or mouse nucleic acids and protein databases.
  • RNA small non-coding RNA
  • the piRNAs are a recently discovered class of germline-specific small RNAs that likely interact directly with Argonaute proteins to maintain transposon silencing 10"12 .
  • the chromosome 20 signal is located entirely within the sodium and calcium transporter gene SLC24A3 (Table 6).
  • Neuroblastoma is a disease of diverse clinical presentations, disease course and patient outcomes. Neuroblastoma shows the highest proportion of cases that will spontaneously regress compared to other human malignancies 13 ' 14 , but the majority of patients have a relentless malignant disease that is difficult to cure even with intensive chemoradiotherapy.
  • risk alleles at the chromosome 6p22 locus were differentially associated with patient subsets and outcome, we analyzed the associated SNPs genotype distribution with respect to prognostically relevant clinical and biological covariates present at diagnosis, and survival rates. For all three SNPs, there was a significantly different allele frequency distribution indicating that the risk alleles were much more likely to be present in patients with a more clinically aggressive disease (Table 7).
  • Chr chromosome. Genome position from NCBI build 36. OR, odds ratio for allelic test, as well as for heterozygosity [AB-AA] and homozygosity [BB-AA] for the B risk allele.
  • Table 3 Neuroblastoma GWAS Stage 1 results showing genotype frequencies. Data provided to com lement allelic fre uenc data rovided in Table 1A. SNPs sorted b unad usted P-value.
  • Chr chromosome. Genome position from NCBI build 36. OR, odds ratio for allelic test, as well as for heterozygosity [AB-AA] and homozygosity [BB-AA] for the B risk allele.
  • Results are shown for the United Kingdom (UK) cohort and the Children's Cancer Group (CCG) cohort.
  • the final column shows the odds ratio and 95% confidence interval for all Stage 1 and 2 results combined.
  • I-S9460708 1 0785 1053 CTGCAACTGTAGAGGTTCTGGATGAA[CZG]CCTTTTCCTCCTTTCTCTTGCTCTA rs6934891 0918 0779 1951 ACTATTAGMTGCGGTACAGCGCAGG[AZG]TGTGTATTGAGATTCTCACTTTACA rs9356805 1 0776 1738 cttttttcaacctcagctgggaacac[A/G]tatgtcaggtactaacattttcatg rs196050 1 0774 1904 cttgatctgggtaatatatgtaaaaa[CZG]tgtatagactttatgtgaaaattca rs1047953 1 0773 1708 ctgTGCTMCAGCAGAAMGTTTCCA[AZG]TTGATTTAAAATCMGTGATTTGCA rs9358492 1 0773 1573 CAMCACTGAGAATGAACA
  • Embryonal cancers are postulated to arise from partially committed primordial cells during fetal or early childhood development.
  • This GWA study shows that the likelihood for malignant transformation of developing neuroblasts is influenced by common variation in the human genome at 6p22 and on chromosome 20, and that the ultimate neuroblastoma phenotype is in part determined by germline variation at these genetic loci.
  • Purcell, S. et al. PLESfK a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 81, 559-75 (2007).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des compositions et des procédés de détection et de traitement du cancer.
PCT/US2008/078465 2007-10-01 2008-10-01 Locus de prédisposition au cancer situé sur le chromosome 6p22 et le chromosome 20 pour une utilisation dans des procédés diagnostiques et thérapeutiques WO2009046118A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US97672307P 2007-10-01 2007-10-01
US60/976,723 2007-10-01

Publications (1)

Publication Number Publication Date
WO2009046118A1 true WO2009046118A1 (fr) 2009-04-09

Family

ID=40526650

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/078465 WO2009046118A1 (fr) 2007-10-01 2008-10-01 Locus de prédisposition au cancer situé sur le chromosome 6p22 et le chromosome 20 pour une utilisation dans des procédés diagnostiques et thérapeutiques

Country Status (1)

Country Link
WO (1) WO2009046118A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9410206B2 (en) 2011-11-30 2016-08-09 John Wayne Cancer Institute Long noncoding RNA (lncRNA) as a biomarker and therapeutic marker in cancer

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050123963A1 (en) * 2003-10-29 2005-06-09 The Regents Of The University Of Colorado Methods of identifying and using chemotherapeutic agents
US20060257895A1 (en) * 1992-03-04 2006-11-16 The Regents Of The University Of California Detection of chromosomal abnormalities associated with breast cancer
US20070105133A1 (en) * 2005-06-13 2007-05-10 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060257895A1 (en) * 1992-03-04 2006-11-16 The Regents Of The University Of California Detection of chromosomal abnormalities associated with breast cancer
US20050123963A1 (en) * 2003-10-29 2005-06-09 The Regents Of The University Of Colorado Methods of identifying and using chemotherapeutic agents
US20070105133A1 (en) * 2005-06-13 2007-05-10 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
"(BRODEUR) NEUROBLASTOMA: BIOLOGICAL INSIGHTS INTO A CLINICAL ENIGMA.", NATURE REVIEWS CANCER, vol. 3, March 2003 (2003-03-01), pages 203 - 216 *
HU ET AL.: "Genome-wide loss of heterozygosity and copy number alteration in esophageal squamous cell carcinoma using the Affymetrix GeneChip Mapping 10 K array.", BMC GENOMICS, vol. 7, 29 November 2006 (2006-11-29), pages 1 - 16 *
KUSHNER ET AL.: "Neuroblastoma: Linking a Common Allele to a Rare Disease.", N ENGL J MED, vol. 358, no. 24, 12 June 2008 (2008-06-12), pages 2635 - 2637 *
MARIS ET AL.: "Chromosome 6p22 Locus Associated with Clinically Aggressive Neuroblastoma.", N ENGL J MED, vol. 358, no. 24, 12 June 2008 (2008-06-12), pages 2585 - 2593 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9410206B2 (en) 2011-11-30 2016-08-09 John Wayne Cancer Institute Long noncoding RNA (lncRNA) as a biomarker and therapeutic marker in cancer

Similar Documents

Publication Publication Date Title
US20220056529A1 (en) Identification of pediatric onset inflammatory bowel disease loci and methods for use thereof for the diagnosis and treatment of the same
EP2257644B1 (fr) Modifications génétiques associées à l'autisme et au phénotype autistique et procédés d'utilisation de celles-ci pour le diagnostic de l'autisme
US20150051114A1 (en) Genetic variants underlying human cognition and methods of use thereof as diagnostic and therapeutic targets
US20140303243A1 (en) Genetic Alterations Associated with Autism and the Autistic Phenotype and Methods of Use Thereof for the Diagnosis and Treatment of Autism
AU2017318669B2 (en) Methods and composition for the prediction of the activity of enzastaurin
EP1828410A2 (fr) Polymorphisme a simple nucleotide (snp) associes au diabete sucre de type 2
US10519501B2 (en) Common and rare genetic variations associated with common variable immunodeficiency (CVID) and methods of use thereof for the treatment and diagnosis of the same
US20230304094A1 (en) Genomic alterations associated with schizophrenia and methods of use thereof for the diagnosis and treatment of the same
AU2013301607B2 (en) Prognosis biomarkers in cartilage disorders
WO2014011398A1 (fr) Biomarqueurs associés à des inhibiteurs de cdk
KR20110106244A (ko) 간세포암종의 예후 진단용 단일 염기 다형성
EP3233115B1 (fr) Procédés et compositions relatifs à la microangiopathie thrombotique associée à un transplant
Manderson et al. Molecular genetic analysis of a cell adhesion molecule with homology to L1CAM, contactin 6, and contactin 4 candidate chromosome 3p26pter tumor suppressor genes in ovarian cancer
WO2009046118A1 (fr) Locus de prédisposition au cancer situé sur le chromosome 6p22 et le chromosome 20 pour une utilisation dans des procédés diagnostiques et thérapeutiques
US20230313304A1 (en) Association of genetic variations to diagnose and treat attention-deficit hyperactivity disorder (adhd)
WO2023097197A2 (fr) Compositions et méthodes pour évaluer l'efficacité d'une administration de polynucléotides et d'une thérapie anticancéreuse
KR101255565B1 (ko) 관상동맥질환에 관련된 단일염기다형성 및 그의 용도
EP2251438A1 (fr) Marqueurs génétiques associés au cancer pancréatique sporadique
JP2011239697A (ja) パーキンソン病発症リスクマーカー

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08835690

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08835690

Country of ref document: EP

Kind code of ref document: A1