WO2009030211A2

WO2009030211A2 - Thermostable transglutaminases

Info

Publication number: WO2009030211A2
Application number: PCT/DE2008/001463
Authority: WO
Inventors: Markus Pietzsch; Thomas Hertel; Christian Marx
Original assignee: Martin-Luther-Universität Halle-Wittenberg
Priority date: 2007-09-07
Filing date: 2008-08-30
Publication date: 2009-03-12
Also published as: DE102007042727A1; DE112008003024A5; WO2009030211A3

Abstract

Transglutaminases are used for covalently cross-linking proteins, among other things. A previously known microbial transglutaminase which is produced from Streptomyces mobaraensis is not very stable at elevated temperatures. The transglutaminase in the form of Activa WM is primarily used in food technology. More temperature-resistant and more active transglutaminases are required for cross-linking reactions in applications outside the food sector. The aim of the invention is therefore to produce more thermostable transglutaminases. Said aim is achieved by means of modified transglutaminases which are produced with the help of random mutagenesis using error prone PCR and are more thermostable. The gene sequences of said transglutaminases have been analyzed and the corresponding modified amino acid sequence has been derived therefrom. The protein regions that are more temperature-resistant than the previously known enzyme have been identified with the help of said sequence data and the known crystal structures. The invention applies to food technology, the pharmaceutical and cosmetic field, and polymer synthesis.

Description

Thermostable transglutaminases

Transglutaminases (TG) are u. a. used for the covalent crosslinking of proteins. Known is a microbial transglutaminase (MTG) [Ando et al., 1990], which is produced with a wild-type microorganism (Streptomyces mobaraensis, former name: Streptoverticillium mobaraense) and is available under the trade name Activa WM. Attempts to produce the enzyme recombinantly and to achieve expression in soluble form in E. coli have failed so far. Insoluble inclusion bodies were always obtained. Genetic modifications of the enzyme were impossible for this reason.

However, an altered microbial transglutaminase is known, which is produced recombinantly in E. coli and expressed in soluble form [Marx et al., 2007]. This enzyme has a histidine tag in addition to the wild-type enzyme, which allows easy purification by affinity chromatography. The enzyme (FRAP-MTG-HiS ₆ ) was purified by affinity chromatography using the histidine tag and subsequently characterized (Table 1).

In the literature, different data regarding the stability of the MTG from Streptomyces are found at higher temperatures (Table 1). The strains used (Streptoverticillium S-8112 [Umezawa et al., 2002], or Streptoverticillium mobaraense WSH-Z2 [Lu et al., 2003]) are not available in strain collections.

For comparison with the new, recombinant enzyme (FRAP-MTG-HiS ₆ ), the commercially available enzyme preparation Activa WM was used (Table 1). The purified, recombinantly produced and sequence-modified enzyme (FRAP-MTG-HiS ₆ ) has a lower stability at higher temperatures than the commercial enzyme preparation Activa WM. However, according to the manufacturer, the latter contains 99% maltodextrin for stabilization. Removing the maltodextrin significantly reduces the stability (Table 1, column "MTG from Activa WM after purification"). When comparing the purified enzymes, the stability of the MTG from Activa WM and the enzyme (FRAP-MTG-HiS ₆ ) in the same frame.

Transglutaminase in the form of Activa WM is mainly used in food technology. For applications of the enzyme also outside of the food sector such as in the pharmaceutical and cosmetics sector as well as the polymer synthesis It would be beneficial to be able to carry out the crosslinking reactions at higher temperatures and thus produce more temperature-stable and more active transglutaminases.

Although various screening methods have been performed for different microorganisms with TG activity, in which a whole series of other sources of transglutaminases have been described (Kauppinen et al., 2002, Schaefer et al., 2001), no enzyme has been described that has the desired Kashiwagi et al., Kashiwagi et al., 2002a, describe a method for site-directed mutagenesis of MTGs based on crystal structure data [Kashiwagi et al., 2002b], however, this method was only used to determine the substrate specificity of the enzyme To do this, the extremely time-consuming process had to be used to initially produce the enzyme in insoluble form as inclusion bodies, and then to fold these into the active enzyme conformation.

The object of the invention was therefore to produce transglutaminases which have a higher thermal stability. The problem was solved by the use of random mutagenesis by means of error prone PCR to produce modified transglutaminases. These were identified in a screening for thermostability and the improved enzymes were subsequently characterized. The gene sequences of the transglutaminases, which had improved properties, were analyzed and the corresponding altered amino acid sequence derived. With the aid of this sequence information and the known crystal structures, it has been possible to identify those regions in the protein which have an increased temperature stability compared to the wild-type enzyme or the altered histidine-tagged enzyme (hot spots).

The invention will be further described by the following examples.

embodiments

Example 1: Cultivation of E. coli in microtiter plates (MTP) and expression of the pro- MTG-HiS ₆

Deepwell microtiter plates (MTP, No. 0030502.310, Eppendorf, Hamburg) were incubated with 500 μl LB Amp medium (10 g / L tryptone / peptone, 10 g / L NaCl, 5 g / L yeast extract, pH 7.5, 100 μg / mL ampicillin) per well. Each well was inoculated from the agar plate using a sterile toothpick with cells from a single E. coli culture (preparation of the agar plate, see Example 5C.) The MTPs were sealed with two sterile adhesive sheets, first with BreathSeal (# 676050, Greiner Biochem. One, Solingen), then additionally with gas permeable Adhesive Seal (No. AB-0718, Abgene Germany, Hamburg). The plates were incubated in a shaking incubator (Innova 4230, New Brunswick Scientific, Edison, USA) at 400 rpm, 37 ^° C. and 2.5 cm shaking radius for 16-18 hours.

Subsequently, in each case 20 .mu.l of the culture were transferred to a new MTP containing 480 .mu.l of LB Amp ONEx medium per well (LB Amp as described, additionally 0.05% glucose, 0.5% glycerol, 0.2% lactose, 25 mM KH ₂ PO ₄ , 25 mM Na ₂ HPO ₄ , 2 mM MgSO ₄ components of the ONEx medium according to [Studier, 2005]). This MTP was in a shaking incubator (Multitron, Infors HT, Bottmingen, Switzerland) at 300 rpm, 28 ⁰ C and 5 cm Schüttelradius incubated for 24 hours, then centrifuged at 4000 rpm for 20 minutes (centrifuge 5403, Eppendorf, Hamburg). The supernatant was discarded and the pellet stored at -80 ⁰ C until cell disruption.

Example 2 Cell Disruption and Activation of Pro-MTG-His ₆ by Dispase

For the cell disruption, 300 μl lysis buffer (50 mM Tris / HCl, 2 mM MgCl ₂ , pH 8.0, 1 mg / ml lysozyme (8259.2, Carl Roth GmbH & Co. KG) were added to the MTP with the frozen cell pellets (see Example 1) per well. Co. KG, Karlsruhe), 10 U / ml Benzonase (No. 1,01695,0001, Merck KGaA, Darmstadt)) and the pellet was resuspended by pipetting up and down with a multichannel pipette. The MTP was then incubated at 650 rpm and 37 ^° C. for 1 hour in a thermomixer (Eppendorf, Hamburg). Unexplained cells and cell debris were spun down at 400 rpm for 20 minutes and 180 μl of the supernatant were transferred to a new MTP (No. 267245, Nunc GmbH & Co. KG ₁ Wiesbaden). The activation of the pro-MTG-HIS ₆ was carried out by the addition of 20 ul dispase (1 U / mL final concentration, no. 354235, BD Biosciences, Heidelberg, Germany) per well, followed by incubation at 37 ⁰ C for 20 min in a thermomixer.

Example 3: Activity test on FRAP-MTG-HiS ₆ activity or its mutants in microtiter plate format

The test for MTG activity was carried out by hydroxamate [FoIk and CoIe, 1966] and was adapted to MTP format. To 50 μl of supernatant containing the respective activated enzyme (see Example 2 or Example 4C) was added 90 μl of hydroxamate test solution (Final concentrations: 0.2 M Tris, 100 mM hydroxylamine, 10 mM reduced glutathione, 30 mM Z-GIn-Gly, pH 6.0). After incubation at 37 ⁰ C for 10 minutes in a thermomixer the reaction was quenched with 160 μl_ reagent A (1 part by volume of 3 M HCl, 1 volume of 12% trichloroacetic acid, 1 part by volume of 5% FeCl ₃ ^* 6H ₂ O (in 0.1 M HCl)) stopped. 200 μl were transferred into a transparent MTP (No. 701304, Brand GmbH & Co. KG, Wertheim) and the extinction was measured at 525 nm in the microtiter plate reader (FluoStar, BMG Labtech GmbH, Offenburg).

Example 4: Preparation of FRAP-MTG-HiS ₆ and its mutants

A. Biomass Production for the Production of FRAP-MTG HiS ₆

E. coli BL21 (DE3) pDJ1-3 was cultured in the bioreactor. These were the

Autoinduction method described in the literature adapted to the 15 L scale [Marx et al., 2007]. 5 ml of a preculture I (LB Amp medium) were inoculated with a single colony E. coli BL21 (DE3) pDJ1-3. After 18 hours of growth at 37 ^° C. and 200 rpm, 100 ml of LB Amp medium were inoculated with 3 ml of preculture I and incubated for 7 hours at 37 ^° C. and 120 rpm (preculture II). 500 mL

Preculture IM (LB Amp medium) were inoculated with preculture II such that a start

OD ₆₀₀ of 0.02 resulted overnight at 37 ^° C. and 80 rpm up to an OD ₆₀₀ of

2.8 grown. 14.73 L of fermentation medium (see below) were mixed with 270 mL

Seed culture III inoculated. The bioreactor cultivation was carried out in a 20 L Biostat C at a temperature of 28 ⁰ C, a stirrer speed of 300 rpm and a gassing rate of 4.0 L / min.

During the fermentation, the pH was measured but not regulated. When

Antifoam was used silicone oil.

After 19 h, the cells were harvested by centrifugation (4 ⁰ C ₁ 6000 g, ZK 630,

Eppendorf, Hamburg).

The biomass was resuspended in 0.9% NaCl solution, recentrifuged and as

Plates with a thickness of approximately 0.5 cm stored at -80 ⁰ C.

From 15 L culture volume, 238 g of biomass were harvested.

fermentation medium

For the preparation of 15 L ONEx medium, 135 g tryptone (final concentration 9 g / L), 67.5 g yeast extract (4.5 g / L) and 135 g NaCl (9 g / L) were deionized in 13.5 L Dissolved water, transferred to a 20 L Biostat C-bioreactor (Braun Melsungen, Germany) and sterilized. The following solutions were sterilized separately and the bioreactor added: 7.5 g of glucose, 75 g of glycerol, 30 g of lactose in 300 ml of water, 51 g of KH ₂ PO ₄ , 53.25 g Na ₂ HPO ₄ in 750 ml water, 7.40 g MgSO ₄ 7 H ₂ O in 15 mL water, and 1, 5 g ampicillin in 30 mL water. Final concentrations were 0.5 g / L glucose, 5 g / L glycerol, 2 g / L lactose, 25 mM KH ₂ PO ₄ , 25 mM Na ₂ HPO ₄ , 2 mM MgSO ₄ , and 100 μg / mL ampicillin. The pH was adjusted to 7.5 with NaOH. Before inoculating, the volume was made up to 14.73 L with sterile water.

B. Biomass Production of FRAP-MTG-His ₆ Mutants:

5 ml LB _amp medium was inoculated with E. coli BL21 (DE3) with the plasmids containing mutant FRAP MTG gene sequences (performing random mutagenesis see example 5) and incubated at 37 ⁰ C and 200 rpm for about 6 hours incubated. With 3 ml of the preculture, in each case a 500 ml Erlenmeyer flask with baffles with 100 ml of autoinduction medium (see below) was inoculated and incubated for about 20 hours at 28 ^° C. and 120 rpm until the stationary growth phase had been reached.

The cells were separated by centrifugation (20 min at 3000 g) and stored at -80 ⁰ C until further use.

The autoinducer medium was prepared as follows. To 93 ml LB medium, the following individually sterilized solutions were added: 200 μl ampicillin (50 mg / ml), 2 ml autoinduction solution 1 (final concentration 0.5 g / L glucose, 5 g / L glycerol, 2 g / L Lactose), 5 ml autoinduction solution 2 (final concentration 25 mM KH ₂ PO ₄ , 25 mM Na ₂ HPO ₄ ) and 100 μl autoinduction solution 3 (final concentration 2 mM MgSO ₄ ).

C. digestion, activation and purification

In each case 0.5 g of biochemical mass of E. coli BL21 (DE3) from the bioreactor culturing (see Example 4A) or of the individual mutants according to Example 4B were dissolved in 10 ml of buffer (50 mM Tris / HCl, pH 8.0, 2 mM MgCl ₂ , 1 mg / mL lysozyme, 10 U / mL benzonase) and then digested for 60 min at 37 ° C. After centrifugation for 20 min at 20,000 g to the supernatant 400 ul TAMEP were (protease from Streptomyces mobaraensis, own production analogously to [Zotzel et al., 2003]) is added and incubated for 60 min at 37 ⁰ C to the pro MTG-His ₆ to activate (activated raw extract).

After addition of 666 μl of 4.8 M NaCl and 400 μl of elution buffer (see below) to 10 ml of activated crude extract (final concentrations: 300 mM NaCl, 20 mM imidazole), 10 ml of it were added to a Streamline Chelating Sepharose FF at 0.5 ml / min 5x5 column (GE Healthcare, Freiburg), washed with binding buffer (50 mM Tris / HCl, 300 mM NaCl, 20 mM imidazole, pH 8) and washed with elution buffer (50 mM Tris / HCl, 300 mM NaCl, 500 mM imidazole pH 8) eluted. The 0.5 ml fractions with activity above 5 U / mL (hydroxamate test) were pooled.

The characterization of the purified enzymes was carried out as described in Example 7.

Example 5 Optimization of the Error-Prone PCR Conditions for Random Mutagenesis

A. Plasmid, plasmid isolation and sequencing

The starting plasmid used was the previously described plasmid pDJ1-3 [Marx et al., 2007]. The plasmid isolation was carried out according to the manufacturer's instructions by means of GeneJET Plasmid Miniprep Kit (No. K0503, Fermentas, St. Leon-Rot). The sequencing was carried out by the company MWG, Ebersberg.

B. Error-Prone PCR conditions

Mutagenesis of the FRAP-MTG gene was performed using GeneMorph II EZCIone Domain Mutagenesis Kit (Stratagene, Amsterdam, The Netherlands). 500 ng of target DNA (MTG gene in isolated pDJ1-3) were used for the error-prone PCR, the annealing temperature was 60 ⁰ C and there were 25 cycles performed (Whatman Biometra thermocycler, Göttingen, Germany). The primers used were at the beginning and at the end of the MTG gene without pro-sequence (forward primer: 5'-GACTCCGACGACAGGGTCACC-3 ', reverse primer: 5 ¹ -

GAGCGGCCAGCCCTGCTTTAC). Subsequently, the application was carried out on an agarose gel. The band corresponding to the amplified MTG gene was excised and purified by MinElute Gel Extraction Kit (Qiagen, Hilden). For the EZCIone reaction, 50 ng template plasmid pJ1-3 and 250 ng mutant MTG gene were used as megaprimer. The template plasmid was then digested with DpnI and the resulting plasmids with mutated MTG gene used in the transformation.

C. Transformation

Electrocompetent cells of E. coli BL21Gold (DE3) (Stratagene) were prepared as described [Marx et al., 2007].

1 μl of plasmid was transformed into 40 μl of competent cells. The transformation was repeated several times and the transformation mixture on a total of 30 agar plates with LB ampicillin medium plated. The plates were incubated at 37 ⁰ C and then stored at 4 ⁰ C. Approximately 30 plates each with about 200 clones were produced.

Example 6: Screening for improved transglutaminases

From the agar plates, individual cultures were picked by means of sterile toothpicks, thus inoculating medium in MTP and culturing was carried out as described in Example 1. Subsequently, the harvest, the cell disruption and the activation of the FRAP-MTG-HiS ₆ or their mutants as described in Example 2.

controls

In the last column of each MTP, the first four wells were inoculated with E. coli BL21 (DE3) pDJ1-3, the last four wells remained free as blank.

Screening for thermostable FRAP-MTG-HiS ₆

Screening for thermostable FRAP-MTG-HiS ₆ 50 L of the supernatant after activation at 55 ⁰ C for 30 min were preincubated in the water bath. Subsequently, the standard activity test was carried out as described in Example 3.

Result: Of about 5500 clones tested, 12 showed a higher stability, of which 10 had exactly one amino acid exchange. Of these 10 mutants, 7 mutants showed amino acid changes at different positions. Each mutant with increased stability had a double or a triple amino acid exchange.

Example 7: Detailed characterization of Activa WM, MTG from Activa WM, FRAP MTG-HiS ₆ and FRAP-MTG-HiS ₆ mutants

A. Determination of nucleic acid or amino acid substitutions

From the positive clones from the screening (see Example 6), the plasmids were isolated and the gene of FRAP-MTG-HiS ₆ amplified and sequenced (as in Example 5). Result: Mainly single nucleotide substitutions were found, which in some cases led to exchanges in the amino acids. The sequences found for the thermostable mutants are summarized in Tab.

B. Provision of Activa WM, MTG from Activa WM, FRAP-MTG-HiS ₆ and FRAP-MTG-His ₆ mutants

100 mg of Activa WM (Ajinomoto Europe Sales GmbH, Hamburg, Germany) were dissolved in 1 ml of 50 mM Tris / HCl, 300 mM NaCl, 20 mM Imidazole pH 8.0.

MTG from Activa WM was liberated from maltodextrin according to Example 9 and provided for the characterization experiments.

E. coli mutants of FRAP-MTG-HiS ₆ were cultured under the same conditions as the strain with the unmodified plasmid [Marx et al., 2007]. The respective Pro-MTG-HiS ₆ was activated by TAMEP and purified by affinity chromatography as described in Example 4.

The purified enzymes were pure by SDS-PAGE and used for characterization.

C. Characterization of Activa WM, MTG from Activa WM, FRAP-MTG-HiS ₆ and FRAP-MTG-His ₆ mutants with respect to thermostability.

The isolated enzymes (30 μl_ each) were PCR-vessel, and using a PCR thermal cycler (Whatman Biometra, Göttingen, Germany) pre-incubated at 60 ⁰ C for 10 min. Subsequently, the activity was determined using the MTP version of the standard test for FoIk and CoIe [FoIk and CoIe, 1966] (see Example 7E). The inactivation curves of Activa WM, MTG from Activa WM, FRAP-MTG-HiS ₆ and the selected mutants are shown in Figure 1. The results for all mutants are summarized in Tab. 6.

Result:

There were found thermostable variants, which significantly reduced the decrease of

Activity when incubated at 60 ⁰ C as the enzyme before the mutation (FRAP-MTG-HiS ₆ ) and also as the MTG isolated from commercial Activa WM. Obviously, the maltodextrin contained in the commercially available Activa WM preparation stabilizes the enzyme because the stability for this enzyme preparation is higher than for the purified, maltodextrin-free enzyme.

The incubation was present even after half the initial activity could be increased from 1.7 minutes at the FRAP-MTG-HiS ₆ to 4.6 minutes for the enzyme pCM203 (S2P) (ID SEQ N ⁰ 4.). The residual activity after 10 minutes incubation at 60 ⁰ C was significantly increased.

Determination of specific activity

The specific activity of the enzymes according to Example 7B was determined by the standard activity test according to FoIk and CoIe [FoIk and CoIe, 1966]). To 100 μl of supernatant containing the respective activated enzyme (see Example 4C) was added 700 μl of hydroxamate test solution (final concentrations: 0.2 M Tris, 100 mM hydroxylamine, 10 mM reduced glutathione, 30 mM Z-GIn-Gly , pH 6.0). After incubation at 37 ° C for 10 minutes in a thermomixer, reaction with 750 μL reagent A (1 volume of 3M HCl, 1 volume of 12% trichloroacetic acid, 1 volume of 5% FeCl ₃ · 6H ₂ O (in 0.1 M HCl)). The absorbance was measured after centrifugation at 525 nm.

The protein concentration of the purified enzyme fractions was determined by absorbance at 280 nm. The protein concentration was determined by measuring the UV absorption at 280 nm (ε ^1% _{280 nm} = (5500 * n _w + 1490 * n _γ + 125 ^* n _c ) / (MW ^* 10)) [Pace and Schmid, 1997] , Where n _w = number of tryptophan residues, n _γ = number of tyrosine residues and n _c = number of cysteine residues. The results for all enzymes are summarized in Tab. 6.

Result:

The specific activity of the parent enzyme (FRAP-MTG-HiS ₆ ) was as high at 23 U / mg protein as that of the MTG from Streptomyces mobaraensis (22.6 U / mg protein [Ando et al., 1989].) The commercial MTG preparation ( Activa WM), according to the manufacturer, has a specific activity of 80-140 U / g solids and contains 1% protein and 99% maltodextrin (corresponding to 8-14 U / mg protein) .The purified MTG from Activa WM had 7.6 U / mg a slightly higher specific activity than the commercial preparation. Some mutants have a decreased specific activity compared with the enzyme from Streptomyces mobaraensis (e.g., SEQ ID N ⁰ 3.:. (CM201 Y24N) with 18 U / mg) as a mutant surprisingly a significantly higher activity (SEQ ID N °. 4: pCM203 (S2P) at 46.1 U / mg).

Characterization of Activa WM, MTG from Activa WM, FRAP-MTG-HiS ₆ and FRAP-MTG-HiS ₆ mutants with respect to the temperature optimum.

Enzyme samples characterized according to Example 7D were diluted to approximately 5 U / mL. Subsequently, the activity was determined with the MTP version of the standard test for FoIk and CoIe [FoIk and CoIe, 1966] at different temperatures (10, 20, 30, 37, 40, 50, 60, 70 and 80 ^° C.). Each 140 μL of substrate solution was preconditioned for 2 minutes at the respective temperature using a PCR thermocycler (Whatman Biometra, Göttingen, Germany) before the reaction was started by addition of 10 μL of the enzyme solution 150 μL Reagent A (see Example 3) Fig. 2 shows the dependence of the activity on the reaction temperature for the Activa WM, the purified MTG from Activa WM, FRAP-MTG-HiS ₆ and for selected mutants for all enzymes are summarized in Table 6. The values for the specific activities at 37 ° C are in some cases higher than the comparable values measured according to Example 7D daily at the very small volumes used in the MTP test.

Result:

In thermostable mutants, a partially significantly increased activity is shown

Temperatures above 50 ° C compared to i. the parent enzyme (FRAP-MTG-HiS ₆ ), ii. the literature-described MTG from Streptomyces mobaraensis ([Ando et al., 1989] and Tab. 1) iii. the commercial enzyme preparation Activa WM and iv. against the purified form of MTG from Activa WM. Example 8: Identification of "not spots" in the three-dimensional structure of the FRAP-MTG-HiS ₆ for thermostability

The FRAP-MTG-His ₆ mutants were characterized according to Example 7. The results of the sequencing are summarized in Fig. 3. The amino acid changes found in thermostable mutants are highlighted. Surprisingly, it has been found that the mutations accumulate in certain areas of the primary structure. All mutations leading to improved properties lie in the left sidewall or at the bottom of the column, which according to Kashiwagi, 2002, forms the active center ("active site cleft" [Kashiwagi et al., 2002b] (see Fig. 4) ).

Example 9: Isolation of MTG from Activa WM

To determine the stability of the MTG, which is only 1% in the commercial Activa WM -

Contained in the preparation, this enzyme had previously been excluded from the 99%

Maltodextrin be released.

To this end, 800 mg of Activa WM (Ajinomoto Europe Sales GmbH, Hamburg, Germany) were dissolved in 4 ml of chromatography buffer (50 mM Tris, 0.3 M NaCl, 20 mM imidazole, pH 8)

(Output solution Activa WM). 1 ml of this solution was commercialized

Gel Filtration Column (Superdex ™ 75 (1 cm diameter, 30 cm length), GE Healthcare,

Freiburg, Germany).

The depletion of maltodextrin by reaction with

Quantitatively monitored dinitrosalicylic acid reagent (DNS), with which the reducing sugars can be detected [Miller, 1959].

The elution chromatogram with the results of maltodextrin determination and volumetric activity for the MTG is shown in FIG.

The active fractions (0.5 mL each) in the range of the elution volume from 10.00 to 11.50 mL were pooled and used for the characterization according to Example 7.

Result:

By gel chromatography, the DNA-positive maltodextrin could be depleted by 95.8%.

The purified MTG from Activa WM was characterized like the other enzymes (see Example 7). Explanation of illustrations

Fig. 1: Thermal stability of Activa WM (contains 99% maltodextrin), purified MTG from Activa WM, purified FRAP-MTG-HiS ₆ and two selected (purified) FRAP-MTG-HiS ₆ mutants (pCM201 (SEQ ID N ° 3) pCM203 (SEQ. ID N ⁰ 4)). 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 min pre-incubation at 60 ⁰ C. Thereafter, standard activity test after FoIk and Coie [FoIk and Coie 1966].

Fig. 2: Specific activity at various temperatures of Activa WM, purified MTG from Activa WM, FRAP-MTG-His ₆ (SEQ ID N ^0. 2), the thermostable and active mutant pCM203 (SEQ ID N ⁰ 4.) And the thermostable mutant pCM224 (SEQ ID N ° 8). 2 min pre-incubation of the substrate solution at the respective temperature, then 10 min reaction time at 10, 20, 30, 37, 40, 50, 60, 70 and 80 ⁰ C. [FoIk and CoIe, 1966].

FIG. 3: Primary sequence of FRAP-MTG-HiS ₆ from Streptomyces mobaraensis. Marked are the altered amino acids found in thermostable mutants (highlighted in gray).

Fig. 4: Crystal structure of the FRAP-MTG from Streptomyces mobaraensis (pdb 1iu4) [Kashiwagi et al., 2002b]. Spacefill visualization highlights the altered amino acids found in thermostable mutants and the active site Cys64.

Fig. 5: Chromatogram of gel chromatography (Superdex 75) for the removal of maltodextrin from a solution of Activa WM. The conditions were described in Example 9. The standard activity test was carried out according to FoIk and CoIe [FoIk and CoIe, 1966], the concentration of maltodextrin was quantitatively determined by means of DNA reagent according to [Miller, 1959]. literature

Ando, H., Adachi, M., Umeda, K., Matsuura, A., Nonaka, M., Uchio, R., Tanaka, H. and

Motoki, M. (1989). "Purification and characteristics of a novel transglutaminase derived from microorganisms." Agήc. Biol. Chem., 53, 2613-17. Ando, H., Uchio, R., Matsuura, A., Umeda, K., Motoki, M., Nonaka, M., Okiyama, A. and

Tanaka, H. "Novel transglutaminase production for protein gelling

Compounds. "EP0379606 AMANO PHARMACEUTICAL CO LTD (JP), AJINOMOTO KK (JP),

JP. Foick, J.E. and CoIe, P.W. (1966). Transglutaminase: Biochemical Biophys Acta, 122, 244-64, Kashiwagi, T., Shimba, N., Ishikawa, K., Suzuki, E., Yokoyama , K. and Hirayama, K. (2002a)

"Method of modifying microbial transglutaminase substrate specificity by x-ray crystal structure-based designing and mutagenesis." WO 0214518 EP 1310560 (20020221),

Ajinomoto Co., Inc., PCT Int. Appl. Kashiwagi, T., Yokoyama, K., Ishikawa, K., Ono, K., Ejima, D., Matsui, H. and Suzuki, E.

(2002b). "Crystal Structure of Microbial Transglutaminase from Streptoverticillium mobaraense." J. Biol. Chem., 277, 44252-60. Kauppinen, M.S., Sandal, T., Bech, L, Halkier, T., Andersen, L.N., Rasmussen, G. and

Okada, M. "Transglutaminase from oomycetes." EP0871712; US6428993; , DK. Lu, S., Zhou, N., Tian, Y., Li, H. and Chen, J. (2003). "Purification and properties of transglutaminase from Streptoverticillium mobaraense." Journal of Food

Biochemistry, 27, 109-125. Marx, C, Hertel, T. and Pietzsch, M. (2007). "Soluble expression of a pro-transglutaminase from Streptomyces mobaraensis in Escherichia coli." Em. Microb. Technoi, 40, 1543

- 1550. Miller, G. (1959). "Use of dinitrosalicylic acid reagent for determination of reducing sugars."

Anal. Chem., 31, 426-428. Pace, C.N. and Schmid, F.X. (1997). "How to determine the molar absorption coefficient of a protein." (Creighton, T.E., ed.), IRL Press, Oxford, 253-259. Schaefer, T., Bech, L., Halkier, T., Andersen, J.T., Noerrevang, I.A. and Rasmussen, G.

"Microbial transglutaminases, their production, gene cloning and sequence and use for protein crosslinking." 6,190,879 B1 (02/20/01), Novo Nordisk A / S, DK. Studier, F.W. (2005). "Protein production by auto-induction in high density shaking cultures."

Protein. Expr. Purif., 41, 207-34. Umezawa, Y., Ohtsuka, T., Yokoyama, K. and Nio, N. (2002). "Comparison of enzymatic properties of microbial transglutaminase from Streptomyces sp." Food Science and

Technology Research, 8, 113-118. Zotzel, J., Keller, P. and Fuchsbauer, HL (2003). "Transglutaminase from Streptomyces mobaraensis is activated by an endogenous metalloprotease." Eur. J. Biochem., 270, 3214-22.

Claims

claims

1. Thermostable Traπsglutaminasen characterized in that in the amino acid sequence of the pro-transglutaminase from Streptomyces mobaraensis (SEQ ID N '1) single or multiple mutations in the form of amino acid substitutions are generated.

2. thermostable transglutaminases according to claim 1, characterized in that the mutants may have a change of the N- and / or the C-terminus.

3. Thermostable transglutaminases according to claim 1, characterized in that the exchange of amino acids takes place against any of the proteinogenic amino acids in the respective sequence region mentioned or against a codon at the gene level which codes for any amino acid.

4. Thermostable transglutaminases according to claim 1 to 3, characterized in that the mutation in the N-terminal region (position -4 to 30) or in the C-terminal region (position 251 to 297).

5. thermostable transglutaminases according to claim 1 to 4, characterized in that the mutation is preferably in the range -3 to 24 or 254 to 294.

6. thermostable transglutaminases according to claim 1 to 5, characterized in that the mutation is particularly preferably at the positions -3; 2, 23, 24, 257, 269, 289 and 294.

7. Thermostable transglutaminases according to claim 1 to 6, characterized in that the double mutation is in the range 184 to 294.

8. thermostable transglutaminases according to claim 1 to 7, characterized in that three mutations on the one hand in the N-terminal region (position -4 to 30) and at the same time in the C-terminal region (position 221 to 297).

9. Thermostable transglutaminases according to claim 1 to 8, characterized in that the exchange of amino acids includes the combination of the exchanges and their cumulation.

10. Thermostable transglutaminases according to claim 1 to 9, characterized in that a higher specific activity of the enzyme is achieved by the mutation.