WO2009025551A2

WO2009025551A2 - New molecular markers for detection of squamous cell carcinomas and adenocarcinomas and high-grade precursor lesions thereof

Info

Publication number: WO2009025551A2
Application number: PCT/NL2008/050556
Authority: WO
Inventors: Christophorus Joannes Lambertus Maria Meijer; Petrus Josephus Ferdinandus Snijders; Renske Daniëla Maria STEENBERGEN
Original assignee: Vereniging Voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek En Patiëntenzorg
Priority date: 2007-08-20
Filing date: 2008-08-20
Publication date: 2009-02-26
Also published as: EP2191017A2; CN101827948A; JP2010537191A; WO2009025551A3; AU2008289729A1; CA2697668A1

Abstract

The present invention provides for new markers for the detection of HPV-induced or lung squamous cell carcinoma and/or adenocarcinoma and high-grade precursor lesions thereof, comprising the genes of the present invention. Detection can take place by detection over expression or down regulation of said genes either by nucleic acid assay or by assays for the proteins produced by said genes.

Description

P80453PC00

Title: New molecular markers for detection of squamous cell carcinomas and adenocarcinomas and high-grade precursor lesions thereof

FIELD OF THE INVENTION

The invention is in the field of diagnostics, especially in the diagnostics of cancer, more specifically in the diagnostics of squamous cell carcinomas and adenocarcinomas and high-grade precursor lesions thereof.

BACKGROUND OF THE INVENTION

The development of squamous cell and adenocarcinomas is characterized by a sequence of premalignant lesions, which are graded as mild dysplasia, moderate dysplasia and severe dysplasia/carcinoma in situ. Squamous cell and adenocarcinomas can develop from the mucosal linings of several organs, such as the uterine cervix, vagina, anus, head and neck, and lung.

Over the past decade it has been well established that a subset of squamous cell carcinomas and even adenocarcinomas can be initiated by an infection with high-risk human papillomavirus (hrHPV). This causal relationship becomes evident from epidemiological and functional studies involving cervical cancer (zur Hausen, Nat Rev Cancer 2002; 2:342-350; Bosch et al., J Clin Pathol. 2002; 55: 244-265). HrHPV DNA has been detected in up to 99.7% of cervical squamous cell carcinomas (SCCs) (Walboomers et al., J. Pathol. 1999: 189: 12-19) and at least 94% of cervical adeno- and adenosquamous carcinomas (Zielinski et al., J Pathol 2003: 201: 535-543). Expression of the viral oncogenes E6 and E7, which disturb the p53 and Rb tumor suppressor pathways, respectively, has been shown to be essential for both the onset of oncogenesis and the maintenance of a malignant phenotype. However, consistent with a multistep process of carcinogenesis, additional alterations in the host cell genome are required for progression of an hr-HPV infected cell to an invasive carcinoma. In squamous cell carcinomas that are not associated with HPV these pathways are disturbed by other means, such as gene mutations and/or deletions, which have been recognized as early events in the pathogenesis of these tumors. As is the case for hrHPV-induced lesions additional alterations in the cellular genome are also required for progression of lesions with disturbed p53 and Rb pathways to premalignant lesions and carcinomas. These additive alterations may be equal in lesions caused by HPV and those that have the p53 and Rb pathways disturbed by other means, for example as a consequence of exposure to carcinogens in tobacco smoke. An example is inactivation of the tumour suppressor gene TSLCl/ CADMl, which plays a role in both a subset of hrHPV-induced cervical cancers (Steenbergen et al., J Natl Cancer Inst 2004: 96: 294-305) and lung cancers (Kuramochi et al., Nature Genetics 2001: 27: 427-430), the latter generally developing in an hrHPV independent manner. In line with multiple events underlying carcinogenesis is the observation that only a small proportion of patients harbouring epithelial cells with evidence of disturbed p53 and Rb pathways, including those infected with hrHPV, will develop premalignant lesions or cancer.

At present there is a lack of markers that with high specificity predict high-grade premalignant lesions and squamous cell carcinomas and adenocarcinomas amongst risk populations, such as women with cervical hrHPV infections. Such markers are of utmost importance for cost-effective early detection programmes. However, the heterogeneity of events that can drive malignant transformation of cells with disturbed p53 and Rb pathways indicates that a single marker lacks sufficient sensitivity for malignant disease. We therefore reasoned that a panel composed of several markers is necessary to cover all carcinomas and high-grade precursor stages thereof that may emerge from cells with disturbed p53 and/or Rb pathways. SUMMARY OF THE INVENTION

By using three datasets obtained by genomic and expression profiling of cervical squamous cell carcinomas, cervical adenocarcinomas and cell lineages of an in vitro model system of HPV-immortalized epithelial cells combined with innovative statistical methods the inventors now have discovered that overexpression and/or downregulation of a number of genes is highly correlated with human cervical squamous cell carcinomas and adenocarcinomas and high-grade precursor lesions thereof. As is shown in the examples, a marker panel of 3 of the genes was sufficient to detect all cervical squamous cell carcinomas and adenocarcinomas that have been analysed so far.

Thus the invention comprises a method for the detection of a squamous cell carcinomas or adenocarcinoma or a high-grade precursor lesion thereof by assessing cells in a clinical sample for overexpression of one or more of the genes listed in Table 1 and/or for downregulation of one or more of the genes of Table 2. Preferably said method comprises the detection of a cervical carcinoma or a premalignant cervical lesion, more preferably wherein said squamous cell carcinoma or adenocarcinoma or high-grade precursor lesion thereof is a hrHPV-infected invasive cancer or high-grade precursor lesion thereof. In another embodiment the method comprises the detection of a lung squamous cell carcinoma or high-grade precursor lesion thereof.

The assessment of overexpression or downregulation is preferably performed by nucleic acid assays or by assessing the concentration of gene products, preferably by immunoassay. In another embodiment, the invention comprises one or more nucleic acid assays targeting at least 1 of the genes of Table 1 or 2, more preferably at least 2 of the genes, more preferably at least 3 of the genes, more preferably at least 4 of the genes, more preferably at least 5 of the genes, more preferably at least 6 of the genes, and most preferably at least 7 of the genes . Preferably said assay targets 3 to 6 of the genes listed in Table 1 and 2. It is also possible that a larger number of the genes of Table 1 or 2 are assessed in the assay of the invention. Further, the assay additionally targets control genes.

Also provided in the invention is a kit for the detection of squamous cell carcinoma or adenocarcinoma and high-grade precursor lesions thereof comprising means for taking a sample from a subject, optionally means for storage of said sample, and means for detection of overexpression or downregulation of one or more of the genes listed in Table 1 and 2.

In yet another embodiment the invention comprises a method for the treatment of squamous cell carcinoma or adenocarcinoma and high-grade precursor lesions thereof by antigen-specific immunotherapy based on polypeptide, peptide or gene sequences of genes listed in Table 1 serving as a tumor-associated antigen that is capable of being recognized by and/or inducing cytotoxic T lymphocytes (CTL). The (polypeptide sequence may also comprise an amino acid sequence in which one or several amino acids of the specific amino acid sequence are subjected to substitution, deletion, insertion or addition and further having immune induction activity is provided.

LEGENDS TO THE FIGURES

Figure 1. Real-time RT-PCR results. A. The expression of the ITGAV gene in samples taken from control patients (both normal ecto- and endocervix) and squamous cell carcinoma (SSC) and adenocarcinoma (AdCA) relative to cell line RNA used for standard curve by real-time RT-PCR. On Y-axis expression levels (21og) relative to the standard curve, based on tumor cell line RNA, are given B. Similar for SYCP2 C. Similar for DTX3L. Figure 2. Real time RT-PCR for AQP3 on A. HPV-immortalized cells and controls and B. normal cervical epithelium and cervical carcinomas

Figure 3. Fold changes (FC) compared to normal cervical epithelium as determined by microarray analysis are shown for the 7 genes identified by integration of microarray CGH and expression analysis.

Figure 4. Sequences of the genes of Table 1 and 2.

DETAILED DESCRIPTION OF THE INVENTION

The invention is based on an innovative approach in which three data sets obtained from a unique series of cervical tissue specimens and HPV- immortalized keratinocyte cell lines are combined. The first data set is based on mRNA expression profiling of cervical squamous cell carcinomas, cervical adenocarcinomas and normal epithelial controls and comprises genes, which are differentially expressed in cervical carcinomas compared with the normal controls. The second data set is based on integration of expression and genomic profiling, using comparative genomic hybridization arrays (CGH-arrays), of the same set of cervical squamous cell carcinomas and cervical adenocarcinomas as used for expression profiling (Wilting et al. J Pathol 2006: 209: 220-230). The third dataset is based on mRNA expression profiling of a well-defined in vitro model system of HPV- immortalized keratinocytes ( Steenbergen et al. J Natl Cancer Inst 2001: 93: 865-872). Since all cell lines within this model system have the same genetic and epigenetic background, differentially expressed genes identified within this model system represent marker genes, which are specifically associated with immortalization, a key feature of cancer cells, rather than being a result of differences in (epi)genetic background. Comparison of these data sets revealed that DNA copy number alterations do not necessarily reflect altered expression levels of genes located at the altered chromosomal regions. This indicates that expression markers cannot simply be deduced from DNA profiles alone. Vice versa, altered expression of genes at a given chromosomal region is not always reflected by DNA copy number alterations of that region. These findings stress the value of combining the various data sets for selection of the most comprehensive panel of candidate marker genes. By combining the three datasets 64 marker genes were identified, which are differentially expressed in subsets of cervical carcinomas and HPV- immortalized cells compared with normal epithelial cells. Of these, 30 genes, listed in Table 1, revealed over expression in cervical carcinomas/HPV- immortalized cells compared with normal epithelial controls. The other 34 genes, listed in Table 2, were found to be down regulated in cervical carcinomas/HPV-immortalized cells compared with normal epithelial controls.

The genes listed in Table 1 and Table 2 and the gene products thereof provide a valuable source of molecular markers from which marker panels can be composed to diagnose carcinomas and their high-grade precursor lesions with invasive potential. Secondly, the (poly)peptide sequences of genes listed in Table 1 provide a valuable source of tumor-antigens for the treatment of carcinomas and their high-grade precursor lesion by immunotherapy.

"Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA) and, if applicable, subsequent translation into a protein.

The term "invasive cancer" refers to a carcinoma invading surrounding tissue.

The term "HPV-induced invasive cancer" refers to a carcinoma induced by high-risk HPV, which invades surrounding tissue. The term "invasive cervical cancer" refers to a cervical carcinoma invading surrounding tissue.

The term "invasive lung cancer" refers to a lung carcinoma invading surrounding tissue. The terms "high-grade premalignant lesion" and " high- grade precursor lesion" refer to a stage in the multistep cellular evolution to cancer with a strongly increased chance to progress to a carcinoma. With classical morphology the pathologist is unable to predict in the individual patient which premalignant lesion will progress or regress. The current patent application refers to a method, which can predict the progression to invasive cancer.

The term "invasive potential" refers to the potential to invade surrounding tissue and consequently to become malignant.

The term "high-grade premalignant cervical lesion" or "high-grade cervical precursor lesion" refers to a stage in the multistep cellular evolution to cervical cancer with a strongly increased chance to progress to a cervical carcinoma. With classical morphology the pathologist is unable to predict in the individual patient which cervical premalignant lesion will progress or regress.

The term "capable of specifically hybridizing to" refers to a nucleic acid sequence capable of specific base-pairing with a complementary nucleic acid sequence and binding thereto to form a nucleic acid duplex.

A "complement" or "complementary sequence" is a sequence of nucleotides which forms a hydrogen-bonded duplex with another sequence of nucleotides according to Watson-Crick base-paring rules. For example, the complementary base sequence for 5'-AAGGCT-3' is 3'-TTCCGA-5'.

The term "stringent hybridization conditions" refers to hybridization conditions that affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are empirically optimised to maximize specific binding and minimize non-specific binding of the primer or the probe to its target nucleic acid sequence. The terms as used include reference to conditions under which a probe or primer will hybridise to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background). Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridise specifically at higher temperatures. Generally, stringent conditions are selected to be about 5⁰C lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength and pH. The T_m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridises to a perfectly matched probe or primer. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes or primers (e.g. 10 to 50 nucleotides) and at least about 60⁰C for long probes or primers (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringent conditions or "conditions of reduced stringency" include hybridization with a buffer solution of 30% formamide, 1 M NaCl, 1% SDS at 37°C and a wash in 2x SSC at 40⁰C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in O.lx SSC at 60⁰C.

Hybridization procedures are well known in the art and are described in e.g. Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1994.

The term "oligonucleotide" refers to a short sequence of nucleotide monomers (usually 6 to 100 nucleotides) joined by phosphorous linkages (e.g., phosphodiester, alkyl and aryl-phosphate, phosphorothioate), or non- phosphorous linkages (e.g., peptide, sulfamate and others). An oligonucleotide may contain modified nucleotides having modified bases (e.g., 5-methyl cytosine) and modified sugar groups (e.g., 2'-O-methyl ribosyl, 2'-O- methoxyethyl ribosyl, 2'-fluoro ribosyl, 2'-amino ribosyl, and the like). Oligonucleotides may be naturally-occurring or synthetic molecules of double- and single-stranded DNA and double- and single-stranded RNA with circular, branched or linear shapes and optionally including domains capable of forming stable secondary structures (e.g., stem-and-loop and loop-stem-loop structures).

The term "primer" as used herein refers to an oligonucleotide which is capable of annealing to the amplification target allowing a DNA polymerase to attach thereby serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase, and at a suitable temperature and pH. The (amplification) primer is preferably single stranded for maximum efficiency in amplification. Preferably, the primer is an oligodeoxy ribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact lengths of the primers will depend on many factors, including temperature and source of primer. A "pair of bi-directional primers" as used herein refers to one forward and one reverse primer as commonly used in the art of DNA amplification such as in PCR amplification. The term "probe" refers to a single-stranded oligonucleotide sequence that will recognize and form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence analyte or its cDNA derivative. "Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA) and, if applicable, subsequent translation into a protein.

Polynucleotides are "heterologous" to one another if they do not naturally occur together in the same organism. A polynucleotide is heterologous to an organism if it does not naturally occur in its particular form and arrangement in that organism. Polynucleotides have "homologous" sequences if the sequence of nucleotides in the two sequences is the same when aligned for maximum correspondence as described herein. Sequence comparison between two or more polynucleotides is generally performed by comparing portions of the two sequences over a comparison window to identify and compare local regions of sequence similarity. The comparison window is generally from about 20 to 200 contiguous nucleotides. The "percentage of sequence homology" for polynucleotides, such as 50, 60, 70, 80, 90, 95, 98, 99 or 100 percent sequence homology may be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e. gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by: (a) determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions; (b) dividing the number of matched positions by the total number of positions in the window of comparison; and (c) multiplying the result by 100 to yield the percentage of sequence homology. Optimal alignment of sequences for comparison may be conducted by computerized implementations of known algorithms, or by inspection. Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST) (Altschul, S.F. et al. 1990. J. MoI. Biol. 215:403; Altschul, S.F. et al. 1997. Nucleic Acid Res. 25:3389-3402) and ClustalW programs both available on the internet. Other suitable programs include GAP, BESTFIT and FASTA in the Wisconsin Genetics Software Package (Genetics Computer Group (GCG), Madison, WI, USA).

As used herein, "substantially complementary" means that two nucleic acid sequences have at least about 65%, preferably about 70%, more preferably about 80%, even more preferably 90%, and most preferably about 98%, sequence complementarity to each other. This means that the primers and probes must exhibit sufficient complementarity to their template and target nucleic acid, respectively, to hybridise under stringent conditions. Therefore, the primer sequences as disclosed in this specification need not reflect the exact sequence of the binding region on the template and degenerate primers can be used. A substantially complementary primer sequence is one that has sufficient sequence complementarity to the amplification template to result in primer binding and second-strand synthesis.

The term "hybrid" refers to a double-stranded nucleic acid molecule, or duplex, formed by hydrogen bonding between complementary nucleotides. The terms "hybridise" or "anneal" refer to the process by which single strands of nucleic acid sequences form double -helical segments through hydrogen bonding between complementary nucleotides.

"Overexpression" or "upregulation" of a gene in a particular cell or sample means that more mENA is transcribed from the gene in a particular cell or sample than in control cells or samples. Alternatively, said increase in expression can be measured from the concentration of the gene product (protein) in a cell. The increase in expression should amount to at least 1.5 times the expression in controls, preferably at least 2 times, more preferably at least 3 times or more. This increase in expression can be measured against the expression of that gene in a control sample, or, within the same sample against the expression of a control gene.

"Underexpression" or "downregulation" of a gene in a particular cell or sample means that less mRNA is transcribed from the gene in a particular cell or sample than in control cells or samples. Alternatively, said decrease in expression can be measured from the concentration of the gene product (protein) in a cell. The decrease in expression should amount to at least 0.5 times the expression in controls, preferably at least 0.25 times, more preferably at least 0.1 times or less. This decrease in expression can be measured against the expression of that gene in a control sample, or, within the same sample against the expression of a control gene.

Table 1. Genes showing increased expression in squamous cell carcinomas and in vitro immortalized cells. The sequences of these genes are given in Fig. 4

Table 2. Genes showing decreased expression in squamous cell carcinomas and in vitro immortalized cells. The sequences of these genes are given in Fig. 4.

The expression of the genes of Table 1 and 2 may be detected by measuring gene transcripts. As such, the coding regions for the proteins in these genes provide marker sequences for detection of transcripts of the genes. In yet another alternative, the expression of the genes may be detected by measuring the proteins produced by the genes directly.

The cell component used for the assay can thus be nucleic acid, such as RNA, preferably mRNA, or protein. When a cell component is protein, the reagent is typically an antibody against the protein produced by the gene. When the component is nucleic acid, the reagent is typically a nucleic acid (DNA or RNA) probe or (PCR) primer. By using such probes or primers, gene expression products, such as mRNA may for example be detected.

The test cell component may be detected directly in situ or it may be isolated from other cell components by common methods known to those of skill in the art before contacting with the reagent (see for example, "Current Protocols in Molecular Biology", Ausubel et al. 1995. 4th edition, John Wiley and Sons; "A Laboratory Guide to RNA: Isolation, analysis, and synthesis", Krieg (ed.), 1996, Wiley-Liss; "Molecular Cloning: A laboratory manual", J. Sambrook, E.F. Fritsch. 1989. 3 VoIs, 2nd edition, Cold Spring Harbor Laboratory Press)

Detection methods include such analyses as Northern blot analysis, RNase protection, immunoassays, in situ hybridization, PCR (Mullis 1987, U.S. Pat. No. 4,683,195, 4,683,202, en 4,800,159), LCR (Barany 1991, Proc. Natl. Acad. Sci. USA 88:189-193; EP Application No., 320,308), 3SR (Guatelh et ah, 1990, Proc. Natl. Acad. Sci. USA 87:1874-1878), SDA (U.S. Pat. Nos. 5,270,184, en 5,455,166), TAS (Kwoh et al, Proc. Natl. Acad. Sci. USA 86:1173- 1177), Q-Beta Replicase (Lizardi et al, 1988, Bio/Technology 6:1197), Rolling Circle Amplication (RCA) or other methods for the amplification of cDNA/DNA. In an alternative method RNA may be detected by such methods as NASBA (L. Malek et al, 1994, Meth. Molec. Biol. 28, Ch. 36, Isaac PG, ed., Humana Press, Inc., Totowa, N.J.) or TMA. These include PCR analyses on microfluid array platforms, allowing simultaneous detection of multiple targets in one sample using limited amounts of input material. Nucleic acid probes, primers and antibodies can be detectably labeled, for instance, with a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelator, an enzyme or a biologically relevant binding structure such as biotin or digoxygenin. Those of ordinary skill in the art will know of other suitable labels for binding to the reagents or will be able to ascertain such, using routine experimentation.

Other methods for detection include such analyses as can be performed with nucleic acid arrays (See i.a. Chee et ah, 1996, Science 274(5287):610-614).. Such arrays comprise oligonucleotides with sequences capable of hybridizing under stringent conditions to the nucleic acid cell component of which the level is to be detected in a method of the present invention. The invention now provides a nucleic acid assay or immuno assay for the detection of squamous cell carcinomas and adenocarcinomas and targeting at least 1 of the genes of Table 1 or 2, more preferably 2 of the genes , more preferably 3 of the genes, more preferably 4 of the genes, more preferably 5 of the genes, more preferably 6 of the genes, and most preferably at least 7 of the genes.

Another embodiment of the invention is a method to predict the presence or risk of occurrence of squamous cell carcinoma and adenocarcinoma or the occurrence or risk of high-grade premalignant lesions comprising: a. taking a tissue sample, e.g. a cervical smear or lung specimen, from the patient; b. isolating the nucleic acid and/or protein from the sample; cl. analyse the gene expression profile of said nucleic acid by assaying it with a nucleic acid assay according to the invention; or c2. analyse gene expression of said protein lysate by assaying it with an immuno assay according to the invention; and d. identifying the expression of one or more of the genes listed in Table 1 and 2; and e. assessing the risk on basis of the expression found in step d.

Preferably, the samples in the above methods are fresh samples.

Gene expression analysis is preferably done using a nucleic acid assay or immuno assay. To investigate gene expression the assay should target polynucleotide molecules or proteins from a clinically relevant source, in this case e.g. a sample from a patient suspected of squamous cell or adenocarcinoma or high-grade precursor lesions thereof. Therefore, preferably a fresh (within 2 days from sampling) sample or a sample collected in preservation fluid that ensures preservation of RNA and/or protein needs to be available. Said target polynucleotide molecules should be expressed RNA or a nucleic acid derived therefrom (e.g., cDNA or amplified RNA derived from cDNA that incorporates an RNA polymerase promoter). If the target molecules consist of RNA, it may be total cellular RNA, poly(A)+ messenger RNA (mRNA) or fraction thereof, cytoplasmic mRNA, or RNA transcribed from cDNA (cRNA). Methods for preparing total and poly(A)+ messenger RNA are well known in the art, and are described e.g. in Sambrook et al., (1989) Molecular Cloning- A Laboratory Manual (2nd Ed.) VoIs. 1-3, Cold Spring Harbor, New York. In one embodiment, RNA is extracted from cells using guanidinium thiocyanate lysis followed by CsCl centrifugation (Chrigwin et al., (1979) Biochem. 18:5294-5299). In another embodiment, total RNA is extracted using a silica-gel based column, commercially available examples of which include RNeasy (Qiagen, Valencia, CA, USA) and StrataPrep (Stratagene, La Jolla, CA, USA). In another embodiment, total RNA is extracted using commercially available RNA isolation reagents examples of which include

Trizol (Life Technologies, Breda, The Netherlands) and RNAbee (Tel-Test Inc., Friendswood, Texas, USA). In another embodiment, total RNA is extracted using automated nucleic acid extraction platforms an example of which is the Nuclisens EasyMAG (BioMerieux, Durham, NC, USA). PoIy(A)+ messenger RNA can be selected, e.g. by selection with oligo-dT cellulose or, alternatively, by oligo-dT or hexamer primed reverse transcription of total cellular RNA. In another embodiment, the polynucleotide molecules analyzed by the invention comprise cDNA, or PCR products of amplified RNA or cDNA.

When desiring to predict or determine the presence of squamous cell carcinoma or adenocarcinoma in a subject, the practitioner should take a sample from that subject, and after isolation of the RNA the expression of at least 1, but preferably 3 to 6 of the genes of Table 1 or 2 should be determined. To normalize these expression data it is possible to correct the data for variations with the help of expression data of a control gene or element which is not affected by the tumour state (such as a housekeeping gene), which is present in the nucleic acid assay that has been used to determine the expression profile of the subject to be assessed. Instead of one control gene, also the mean value of a pool of control genes can be taken. This correction can, for instance, be done by dividing the expression level of each of the tested genes by the expression level of the control gene(s)/element(s).

For purposes of the invention, an antibody specific for a gene product from Table 1 or 2 may be used to detect and quantify the presenceof the polypeptide produced by the gene in biological fluids or tissue samples.

For purposes of the invention, probes specific for polynucleotides of genes from Table 1 or 2 may be used to detect and quantify the polynucleotide of the gene in biological fluids or tissue samples.

Any specimen containing a detectable amount of polynucleotide or encoded polypeptide of the genes of Tables 1 and 2 can be used. Nucleic acid can also be analyzed by RNA in situ methods that are known to those of skill in the art such as by in situ hybridization. Preferred samples for testing according to methods of the invention include such specimens as (cervical) smears and/or (cervical) biopsies and the like. Preferably, cytological (cervical) scrapes, self sampled cervico/vaginal specimens, sputa and/or cervical biopsies are used as samples for testing. Although the subject can be any mammal, preferably the subject is human.

The invention methods can utilize antibodies immunore active with polypeptide encoded by the genes listed in Tables 1 and 2, the predicted amino acid sequences of which are available from the GenBank Accession Nos. listed in said Tables, or immunore active fragments thereof. An antibody preparation that consists essentially of pooled monoclonal antibodies with different epitopic specificities, as well as distinct monoclonal antibody preparations can be used. Monoclonal antibodies are made against antigen containing fragments of the protein by methods well known to those skilled in the art (Kohler, et al., Nature, 256: 495,1975).

The term antibody as used in this invention is meant to include intact molecules as well as fragments thereof, such as Fab and F(ab')2, which are capable of binding an epitopic determinant on genes listed in Tables 1 (and 2). Antibody as used herein shall also refer to other protein or non-protein molecules with antigen binding specificity such as miniantibodies, peptidomimetics, anticalins etc.

Monoclonal antibodies can be used in the diagnostic methods of the invention, for example, in immunoassays in which they can be utilized in liquid phase or bound to a solid phase carrier. In addition, the monoclonal antibodies in these immunoassays can be detectably labelled in various ways. Examples of types of immunoassays that can utilize monoclonal antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format. Examples of such immunoassays are the radioimmunoassay (RIA) and the sandwich (immunometric) assay. Detection of the antigens using the monoclonal antibodies of the invention can be done utilizing immunoassays that are run in either the forward, reverse, or simultaneous modes, including immunohistochemical or immunocytochemical assays on physiological samples. Those of skill in the art will know, or can readily discern, other immunoassay formats without undue experimentation. Monoclonal antibodies can be bound to many different carriers to be used to detect the presence of the gene products of the genes of Table 1 and 2. Examples of well-known carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses and magnetite. The nature of the carrier can be either soluble or insoluble for purposes of the invention. Those skilled in the art will know of other suitable carriers for binding monoclonal antibodies, or will be able to ascertain such using routine experimentation. In performing the assays it may be desirable to include certain "blockers" in the incubation medium (usually added with the labeled soluble antibody). The "blockers" are added to assure that non-specific proteins, proteases, or antiheterophilic immunoglobulins to the immunoglobulins present in the experimental sample do not cross-link or destroy the antibodies on the solid phase support, or the radiolabeled indicator antibody, to yield false positive or false negative results. The selection of "blockers" therefore may add substantially to the specificity of the assays described in the present invention. A number of nonrelevant (i. e., nonspecific) antibodies of the same class or subclass (isotype) as those used in the assays (e. g., IgGl, IgG2a, IgM, etc.) can be used as "blockers". The concentration of the "blockers" (normally 1- 100 μg/μL) may be important, in order to maintain the proper sensitivity yet to inhibit any unwanted interference by mutually occurring cross-reactive proteins in the specimen. Other diagnostic methods for the detection of production of gene products or gene expression of the genes listed in Tables 1 and 2, include methods wherein a sample for testing is provided, which sample comprises a cell preparation from cervical or other tissue. Preferably such samples are provided as (cervical) scrapes, self sampled cervico/vaginal specimens, or sputa. In order to provide for efficient testing schemes, hrHPV positive specimens are used as cervical samples for testing.

A cell or tissue sample obtained from a human, is suitably pretreated to allow contact between a target cellular component of a test cell comprised in said sample with a reagent that detects the gene product of one or more of the genes listed in Tables 1 and 2 and detecting an increase or a reduction therein as compared to that of a comparable normal cell. Samples may be mounted on a suitable support to allow observation of individual cells. Examples of well-known support materials include glass, polystyrene, polypropylene, polyethylene, polycarbonate, polyurethane, optionally provided with layers to improve cell adhesion and immobilization of the sample, such as layers of poly-L-lysine or silane. Cervical smears or biopsies may for instance be prepared as for the Papanicolaou (Pap) test or any suitable modification thereof as known by the skilled person, and may be fixed by procedures that allow proper access of the reagent to the target component. In certain embodiments of the invention the cytological specimens are provided as conventional smear samples, thin layer preparations of cervical cells, self- sampled cervico/vaginal specimens or any other kind of preparation known to those of skill in the art. If storage is required, routine procedures use buffered formalin for fixation followed by paraffin embedding, which provides for a well- preserved tissue infrastructure. In order to allow for immunohistochemical or immunofLuorescent staining, the antigenicity of the sample material must be retrieved or unmasked. One method of retrieving the antigenicity of formaldehyde cross-linked proteins involves the treatment of the sample with proteolytic enzymes. This method results in a (partial) digest of the material and mere fragments of the original proteins can be accessed by antibodies.

Another method for retrieving the immunore activity of formaldehyde cross-linked antigens involves the thermal processing using heat or high energy treatment of the samples. Such a method is described in e.g. U.S. Pat. No. 5,244,787. Yet another method for retrieving antigens from formaldehyde-fixed tissues is the use of a pressure cooker (e.g. 2100-Retriever), either in combination with a microwave or in the form of an autoclave, such as described in e.g. Norton, 1994. J. Pathol. 173(4):371-9 and Taylor et al. 1996. Biotech Histochem 71(5):263-70.

Several alternatives to formaldehyde may be used, such as ethanol, methanol, methacarn or glyoxal, citrated acetone, or fixatives may be used in combination. Alternatively, the sample may be air-dried before further processing.

In order to allow for a detection with nucleic acid probes, the sample material must be retrieved or unmasked in case of formalin fixed and paraffin embedded material. One method involves the treatment with proteolytic enzymes and a postfixation with paraformaldehyde. Proteolytic digestion may be preceded by a denaturation step in HCl. This method results in a (partial) digest of the material allowing the entry of probes to the target. No specific unmasking procedures are required in case of non-formalin fixed material, e.g. frozen material. Prior to hybridisation samples can be acetylated by treatment with triethanolamine buffer.

The present invention also provides a kit of parts for use in a method of detecting squamous cell carcinomas and adenocarcinomas and their high-grade precursor lesions in test cells of a subject. Such a kit may suitably comprise means for taking and storing a sample, such as a brush or spatula to take a scrape of the suspected mucosal tissue, e.g. a cervical scrape or lung brush together with a container filled with collection medium to collect test cells. Alternatively, a sampling device consisting of an irrigation syringe, a disposable female urine catheter and a container with irrigation fluid will be included to collect cervical cells by cervico-vaginal lavage.

A kit according to the present invention may comprise primers and probes for the detection of mRNA expression of the genes listed in Table 1 and 2. In another embodiment, a kit according to the invention may comprise antibodies and reagents for the detection of protein expression of proteins expressed by the genes of Table 1 and 2 in cervical scrapes or other tissue specimens.

The present invention will now be illustrated by way of the following, non limiting examples.

EXAMPLES

1. Differentially expressed genes in tissues and cell lines To confirm differential expression of genes listed in Tables 1 and 2 we measured mRNA expression of the following genes: ITGAV, SYCP2, DTX3L, SEMPl, DEK, ATP2C1, SLC25A36 and PIK3R4 by real time RT-PCR analysis. For this purpose RNA was extracted from 22 cervical squamous cell carcinomas, 8 cervical adenocarcinomas, 15 high-grade cervical intraepithelial neoplasia (CIN) lesions and 24 normal epithelial controls (normal ectocervix n=13 and normal endocervix n=ll). ITGAV, SYCP2, DTX3L SEMPl, DEK, ATP2C1, PIK3R4 and SLC25A36 showed significant overexpression in squamous cell carcinomas compared with normal ectocervix (see examples Figure 1). DTX3L in addition showed significant overexpression in adenocarcinomas compared with normal endocervix (Figure 1). Analysis of RNA isolated from 15 high-grade CIN lesions, enriched for dysplastic cells by laser capture microdissection, demonstrated increased expression of ITGAV in 60% (9/15) of cases, ATP2C1 in 40% (6/15) of cases,

DEK in 80% (12/15) of cases, SLC25A36 in 73% (11/15) of cases and PIK3R4 in 67% (7/15) of cases.

For another gene, AQP3 reduced expression in both HPV- immortalized cells (n=8) compared with control cells (n=4) and cervical carcinomas (n=8) compared with normal cervical epithelium (n=l) was confirmed by real-time RT-PCR (Figure 2)

Based on a more than 2-fold overexpression as detected by micro array analysis a marker panel of 3 of the genes (i.e. a combination of DTX3L and FLJ21291 and CCDC14 or ITGAV) enabled the detection of 100% of cervical squamous cell carcinomas and 100% of cervical adenocarcinomas (Figure 3).

In addition, real time RT-PCR analysis for ITGAV, DTX3L, DEK, ATP2C1, SLC25A36 and PIK3R4 mRNA expression was performed on 20 lung squamous cell carcinomas and 20 normal lung samples (adjacent to carcinomas). ITGAV, DTX3L, ATP2C1, SLC25A36 and PIK3R4 mRNA expression was significantly increased in carcinomas compared with normal control samples.

The primers used for RT-PCR are summarized in Table 3.

Table 3. Real-time RT-PCR primer sequences.

Gene Primers

DEK F: : AGAGAGGTTGACAATGCAAGTCT

R: TCTGCCCCTTTCCTTGTG

SEMPl F: GATGAGGATGGCTGTCATTG

R: : TACCATGCTGTGGCAACTAAA

ITGAV F: TTGTTGCTACTGGCTGTTTTG

R: : TCCCTTTCTTGTTCTTCTTGAG

SYCP2 F: : ACAGAAAACTGAAGACTACCTTTGTTA

R: : TCATCAGCTCCATTCAAATTAAA

ATP2C1 F: GGATGTTCAGCAGCTTTCACAA

R: : TCTGTAGCGACTTAATAATTTTCATCTTG

SLC25A36 F: CCAGTGTCAACCGAGTAGTGTCT

R: : AGGAACGAGGCCCTTCTTTT

PIK3R4 F: : GACTGCTACAAAAACCCCATGTT

R: CGGCACCATAACGTATCCATAA

DTX3L F: CAGTGAAAGGGCAGCTAAGG

R: GCACAGGTTTTTCGTCAACA

AQP3 F: CCCATCGTGTCCCCACTC

R : GCCGATCATCAGCTGGTACA

F: Forward primer; R: Reverse primer; ITGAV primer sequences were retrieved from Rogojina et al (Rogojina et al., 2003)

Immunohistochemical analysis of PIK3R4 and DTX3L on 25 high-grade CIN lesions and 8 cervical squamous cell carcinomas confirmed increased expression of both proteins. 100% (PIK3R4) and 85% (DTX3L) of cervical squamous cell carcinomas and 65% (PIK3R4) and 41% (DTX3L) of high-grade

CIN lesions revealed protein over expression.

A pilot experiment on 2 lung squamous cell carcinomas also revealed increased PIK3R4 protein expression in these tumours. 2. Marker gene analysis of cervical scrapes

Using a nested case-control design of women participating in the POBASCAM trial we studied cervical scrapes of 50 hrHPV positive case women in which ≥CIN 2 (including 1 carcinoma) was diagnosed within 18 months of follow-up versus 100 hrHPV positive control women with CIN 1 or better within an 18 months follow-up period. Baseline cervical scrapes of these women were collected in universal collection medium and subjected to DTX3L, and PIK3R4 mRNA expression analysis by real time PCR. For the latter, a pool of cervical scrapes of hrHPV negative women with no signs of disease during 5 years of follow-up served as normal reference. Samples were scored positive for differential expression in case the mean ratio [DTX3L or PIK3R4 gene mRNA copies : housekeeping gene mRNA copies case sample]/ [DTX3L or PIK3R4 gene mRNA copies : housekeeping gene mRNA copies normal reference sample]of duplicate experiments was >1.5. Increased expression ratios of DTX3L and PIK3R4 relative to a housekeeping gene were found in 21 and 28, respectively, of cases versus none of the controls. A total of 36 cases revealed increased ratios for one or more of these genes.

Claims

1. A method for the detection of a squamous cell carcinoma or adenocarcinoma or a high-grade precursor lesion thereof by assessing cells in a tissue sample for overexpression of one or more of the genes listed in Table 1 and/or for downregulation of one or more of the genes of Table 2.

2. Method according to claim 1, wherein said squamous cell carcinoma or adenocarcinoma or high-grade precursor lesion thereof is cervical carcinoma or a premalignant cervical lesion.

3. Method according to claim 1 or 2, wherein said squamous cell carcinoma or adenocarcinoma or high-grade precursor lesion thereof is a hrHPV- infected invasive cancer of non-cervical origin or high-grade precursor lesion thereof.

4. Method according to claim 1 or 2, wherein said squamous cell carcinoma or adenocarcinoma or high-grade precursor lesion thereof is a lung cancer or high-grade precursor lesion thereof.

5. Method according to any of claims 1-4, wherein the assessment of overexpression and/or downregulation is performed by nucleic acid assay

6. Method according to any of claims 1-4, wherein the assessment of overexpression and/or downregulation is performed by assessing the concentration of gene products, preferably by immunoassay.

7. Method according to any of claims 1-6, wherein said overexpression and/or said downregulation is assayed for at least two of the genes listed in Table 1 or Table 2, preferably at least 3 of the genes, more preferably at least 4 of the genes, more preferably at least five of the genes, more preferably at least 6 of the genes, and most preferably at least 7 of the genes.

8. Method according to any of claims 1-7, wherein said tissue sample is a cervical smear, a cervical (or lung) brush, a self sampled cervico/vaginal specimen, sputum, lavage and/or a cervical biopsy.

9. A kit for the detection of squamous cell carcinoma or adenocarcinoma or high-grade precursor lesions thereof comprising means for taking a sample from a subject, optionally means for storage of said sample, and means for detection of overexpression or downregulation of one or more of the genes listed in Table 1 and 2.

10. A method for the (immunotherapeutic) treatment of a squamous cell carcinoma or adenocarcinoma or a high-grade precursor lesion thereof using a peptide or polypeptide of a (modified/codon optimized) amino acid sequence selected from genes listed in Table 1, wherein the peptide is recognized by a cytotoxic T lymphocyte and/or induces a cytotoxic T lymphocyte.